Probe set, probe carrier, and method for determining and identifying fungus

[0001] 1. Field of the Invention

[0002] The present invention relates to a method for examining a gene which is useful for the detection and identification of a causative fungus of disease attributed to infection and to a kit for gene examination.

[0003] 2. Description of the Related Art

[0004] Examples of infection caused by fungi include skin disease and deep-seated mycosis.

[0005] Meanwhile, some skin diseases cause itching and smallpox in the skin. The causes of these diseases are impossible to visually identify. In general, these skin diseases may be caused by Trichophyton (athlete's foot) or may be caused by yeast-like fungi such as Candida. These skin diseases are infections caused by fungi. Alternatively, skin disease may be caused not by such fungi but by herpes viruses or may be atopic dermatitis. A drug to be administered totally differs depending on such a different cause of skin disease. Under these circumstances, the development of a method has been demanded by which the cause of skin disease is rapidly diagnosed by determining whether the skin disease is attributed to fungi, bacteria or viruses or attributed to, among the fungi, filamentous fungi or yeast-like fungi.

[0006] In general, a specimen collected from an affected area is treated with a potassium hydroxide solution and observed under a microscope. If a hypha can be confirmed in this observation, a fungus is determined as the cause of the disease. In addition, a species of the fungus is usually identified by culture.

[0007] On the other hand, a method for identifying an organism species performed by the determination of a nucleic acid sequence is known. Japanese Patent Publication No. H08-024600 discloses a method for detecting a fungus in a specimen, including amplifying ribosomal RNA universally held by pathogenic fungi. Alternatively, Japanese Patent No. 3167154 discloses a method for detecting Candida albicans among pathogenic fungi, including amplifying the mitochondrial DNA of this fungus. Likewise, U.S. Pat. No. 5,426,027 discloses primers that can be used in a method including: isolating Candida albicans in blood; amplifying a nucleic acid thereof; and detecting this fungus.

[0008] Alternatively, Japanese Patent Application Laid-Open No. 2004-258024 discloses a method for identifying a dermatophyte, including performing antigen-antibody reaction with the surface of an isolated fungus using magnetic beads.

[0009] On the other hand, Yasuzawa et al. have reported that a nucleic acid is directly amplified by PCR without isolating a fungus from a nail, and a fungal species thereof is identified from the length or number of fragments of the amplification product treated with a restriction enzyme (Yasuzawa et al., (2005), Japanese Journal of Medical Mycology, Vol. 46, No. 1 (Suppl.), p. 89).

[0010] Furthermore, the conventional method for identifying an organism species by the determination of a nucleic acid sequence generally involves separating a fungus with specific antibody-immobilized particles and then detecting a gene, as described in detail in, for example, Japanese Patent Application Laid-Open No. H11-142409. Alternatively, Japanese Patent Application Laid-Open No. 2004-313181 discloses a method capable of collectively detecting plural candidates of causative microorganism species by one experiment using a DNA chip.

[0011] Thus, a causative fungal species of skin disease can be identified by such conventional techniques.

[0012] However, in the visual identification using a microscope, fungal cells are generally difficult to find in the microscope field of view. It may also be difficult to determine whether a filamentous object that has been found is a hypha of a filamentous fungus, a pseudohypha of a yeast-like fungus or dust. Even if the fungus of interest is confirmed to be a yeast-like fungus or filamentous fungus, a fungal species thereof is often impossible to visually identify.

[0013] Moreover, the fungal species identification by culture, which is currently performed as a standard method, usually requires a period as very long as approximately 4 weeks. It is not easy to reliably culture a sample collected from a patient. Therefore, such unsuccessful culture highly probably derives a wrong result (false negative) indicating the absence of a fungus in the sample.

[0014] In the skin, microorganisms called indigenous microorganisms are also usually present which do not always cause disease. Only these indigenous microorganisms may be grown selectively. In such a case, a causative fungus of disease cannot correctly be identified.

[0015] Furthermore, the conventional method for identifying an organism species by the determination of a nucleic acid sequence generally involves separating a fungus with specific antibody-immobilized particles and then detecting a gene, as described in detail in, for example, Japanese Patent Application Laid-Open No. H11-142409. Specifically, after the isolation operation of a fungus, a nucleic acid is further extracted, and the extracted nucleic acid is further sequenced. Thus, this method requires very complicated operation.

[0016] Furthermore, the conventional method for identifying an organism species by the determination of a nucleic acid sequence requires designing a primer set for each fungal species to be identified and then performing an amplification experiment by PCR for each possible fungal species. Therefore, the experiment must be performed plural times corresponding to the number of the possible fungal species. Alternatively, a method for multiplexing PCR using plural primer sets by one experiment has been devised and practiced generally as multiplex PCR. In this multiplex PCR method, the experiment is inevitably complicated. This method also requires, for example, respectively introducing different labels for primers or conducting thermal analysis after PCR and as a result, can simultaneously detect only the limited number of fungal species. Both of such an experiment performed plural times or multiplexing by one experiment may be performed. However, in either case, amplification using primers designed for each candidate fungal species is performed for all the candidates. Therefore, the problem is that the amount of a sample collected must be increased according to the number of candidate fungal species.

[0017] Japanese Patent Application Laid-Open No. 2004-313181 discloses a method for solving such problems associated with the determination of a nucleic acid sequence. The document discloses a method capable of collectively detecting plural candidates of causative microorganism species by one experiment using a DNA chip. The method disclosed in Japanese Patent Application Laid-Open No. 2004-313181 is directed to a 16S rRNA region of the causative bacterium. However, fungi do not contain such 16S rRNA. Therefore, this method cannot be used for fungi.

[0018] The detection method using antigen-antibody reaction, as described in Japanese Patent Application Laid-Open No. 2004-258024, requires isolating fungal cells from a fungus-containing analyte for removing inhibitors of antigen-antibody reaction. Moreover, this antigen-antibody reaction utilizes an antigen on the surface of the fungus. Thus, it is not easy to prepare an antibody capable of sufficiently distinguishing among, for example, closely related fungi, which have similar surface structures.

[0019] The method for identifying a fungal species by PCR-RFLP disclosed in Yasuzawa et al., (2005), Japanese Journal of Medical Mycology, Vol. 46, No. 1 (Suppl.), p. 89 indicates the restriction enzyme treatment of PCR amplification products, by which a cleavage site differing among fungal species is expected. In this method, a fungal species is identified from characteristics such as the number or length of fragments produced depending on a fungal species after restriction enzyme treatment. Plural fungal species to be detected may be present. In such a case, according to this method, restriction enzymes must be selected such that the number and length of fragments produced by restriction enzyme treatment differ among these fungal species. Therefore, the selection of appropriate restriction enzymes is more complicated with increases in the number of fungal species to be detected. In the skin, microorganisms called indigenous microorganisms are also present, as already known, which are not always pathogens of infection. The direct extraction of a nucleic acid without isolating a fungus, as described in the document, highly probably causes the coexistence of the nucleic acid of a pathogen of infection with the nucleic acids of such indigenous microorganisms. In this case, the nucleic acid of interest may be contaminated with the nucleic acids derived from unexpected indigenous microorganisms. Therefore, characteristics such as the number or length of fragments obtained by restriction enzyme treatment lead to unexpected complicated combination. Thus, a fungal species is difficult to identify.

[0020] The present invention relates to a method for identifying a fungal species, comprising: extracting a nucleic acid from an affected tissue; amplifying the extracted nucleic acid using a primer set capable of amplifying at least a portion of a nucleic acid sequence region held in common by fungi; and obtaining information about a partial sequence of the amplified nucleic acid which permits fungal species identification and determining and identifying the fungal species of the amplified nucleic acid.

[0021] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the amplification reaction using the primer set is PCR.

[0022] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the region held in common by fungi is selected from the group consisting of an 18S ribosomal RNA sequence, an ITS region and a 23S ribosomal RNA sequence.

[0023] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the determining and identifying the fungal species of the amplified nucleic acid comprises performing hybridization reaction with a nucleic acid probe designed from a partial sequence specific to a fungal species and determining and identifying the fungal species from the obtained hybridization signal intensity.

[0024] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the determining and identifying the fungal species of the amplified nucleic acid comprises constituting a probe set from nucleic acid probes designed from partial sequences respectively specific to plural fungal species and using a carrier in which the constituted probe set is immobilized.

[0025] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the plural probes constituting the probe set are arranged at a distance from each other on the carrier and used as a probe carrier.

[0026] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the nucleic acid probes constituting the probe set have uniform properties such that hybridization conditions can be unified.

[0027] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the nucleic acid probes constituting the probe set are designed to have a uniform melting temperature falling within a predetermined range.

[0028] Furthermore, the present invention relates to the method for identifying a fungal species, wherein the determining and identifying the fungal species of the amplified nucleic acid comprises using the fact that probes respectively designed for fungal species produce hybridization signal intensities different from each other.

[0029] Furthermore, the present invention relates to the method for identifying a fungal species, wherein a probe set is used, the probe set comprising, as the nucleic acid probe, (1) a first probe belonging to any group selected from the following groups 1 to 29 and a second probe belonging to any group selected from the following groups 1 to 29 and not belonging to the group to which the first probe belongs, or (2) a third probe having a nucleotide sequence complementary to the first probe and a fourth probe having a nucleotide sequence complementary to the second probe:

[0030] group 1: (1) a probe having a nucleotide sequence tctttgaaacaaacttgctttggcgg (SEQ ID NO: 1), (2) a probe having a nucleotide sequence ccgccagaggtctaaacttacaacc (SEQ ID NO: 2), (3) a probe having a nucleotide sequence gacggtagtggtaaggcgggat (SEQ ID NO: 3), (4) a probe having a nucleotide sequence ggcggtaacgtccaccacgtat (SEQ ID NO: 4), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 1 to 4 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 2: (1) a probe having a nucleotide sequence tgtgttttgttctggacaaacttgctttg (SEQ ID NO: 5), (2) a probe having a nucleotide sequence ctgccgccagaggacataaacttac (SEQ ID NO: 6), (3) a probe having a nucleotide sequence tagtggtataaggcggagatgcttga (SEQ ID NO: 7), (4) a probe having a nucleotide sequence tctggcgtcgcccattttattcttc (SEQ ID NO: 8), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 5 to 8 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 3: (1) a probe having a nucleotide sequence ggtgttttatcacacgactcgacact (SEQ ID NO: 9), (2) a probe having a nucleotide sequence ggagttctcccagtggatgcaaac (SEQ ID NO: 10), (3) a probe having a nucleotide sequence ggccatatcagtatgtgggacacg (SEQ ID NO: 11), (4) a probe having a nucleotide sequence aggttttaccaactcggtgttgatctag (SEQ ID NO: 12), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 9 to 12 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 4: (1) a probe having a nucleotide sequence gcttaactgcgcggcgaaaaac (SEQ ID NO: 13), (2) a probe having a nucleotide sequence agataggttgggccagaggtttaaca (SEQ ID NO: 14), (3) a probe having a nucleotide sequence tcttagtcggactaggcgtttgctt (SEQ ID NO: 15), (4) a probe having a nucleotide sequence tcgttgaatggtgtggcgggat (SEQ ID NO: 16), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 13 to 16 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 5: (1) a probe having a nucleotide sequence gtgttgccttccgaaatatcacagttg (SEQ ID NO: 17), (2) a probe having a nucleotide sequence cagttgtcgcaatacgttacttcaacttt (SEQ ID NO: 18), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 17 to 18 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 6: (1) a probe having a nucleotide sequence gcggccagttcttgattctctgc (SEQ ID NO: 19), (2) a probe having a nucleotide sequence agctcgtctctccagtggacataaac (SEQ ID NO: 20), (3) a probe having a nucleotide sequence ttgaaagtggctagccgttgcc (SEQ ID NO: 21), (4) a probe having a nucleotide sequence tcgtggtaagcttgggtcatagagac (SEQ ID NO: 22), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 19 to 22 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 7: (1) a probe having a nucleotide sequence agcggaacgaaaacaacaacacct (SEQ ID NO: 23), (2) a probe having a nucleotide sequence acctagtgtgaattgcagccatcg (SEQ ID NO: 24), (3) a probe having a nucleotide sequence gacgtgtaaagagcgtcggagc (SEQ ID NO: 25), (4) a probe having a nucleotide sequence gcgagtgttgcgagacaacaaaaag (SEQ ID NO: 26), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 23 to 26 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 8: (1) a probe having a nucleotide sequence ctcgaggcattcctcgaggcat (SEQ ID NO: 27), (2) a probe having a nucleotide sequence aggcgttgctccgaaatatcaacc (SEQ ID NO: 28), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 27 to 28 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 9: (1) a probe having a nucleotide sequence tggggcctgccagagattaaact (SEQ ID NO: 29), (2) a probe having a nucleotide sequence gtgttgagcgatacgctgggttt (SEQ ID NO: 30), (3) a probe having a nucleotide sequence gttttttccactcattggtacaaactcca (SEQ ID NO: 31), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 29 to 31 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 10: (1) a probe having a nucleotide sequence accgccagaggttataactaaaccaaa (SEQ ID NO: 32), (2) a probe having a nucleotide sequence gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO: 33), (3) a probe having a nucleotide sequence acgcttattttgctagtggccacc (SEQ ID NO: 34), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 32 to 34 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 11: (1) a probe having a nucleotide sequence tgaactgttgattgacttcggtcaattga (SEQ ID NO: 35), (2) a probe having a nucleotide sequence gcgtgtttaacttgtcttatctggcg (SEQ ID NO: 36), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 35 to 36 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 12: (1) a probe having a nucleotide sequence gttctactacttgacgcaagtcgagt (SEQ ID NO: 37), (2) a probe having a nucleotide sequence ttgggcgtctgcgatttctgatc (SEQ ID NO: 38), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 37 to 38 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 13: (1) a probe having a nucleotide sequence caacggatctcttggcttccaca (SEQ ID NO: 39), (2) a probe having a nucleotide sequence ttgagagtcatgaaaatctcaatccctcg (SEQ ID NO: 40), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 39 to 40 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 14: (1) a probe having a nucleotide sequence cccgtgtctatcgtaccttgttgc (SEQ ID NO: 41), (2) a probe having a nucleotide sequence tgaacgctgttctgaaagtatgcagt (SEQ ID NO: 42), (3) a probe having a nucleotide sequence gccagccgacacccaactttatt (SEQ ID NO: 43), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 41 to 43 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 15: (1) a probe having a nucleotide sequence cccatccgtgtctattgtaccctgt (SEQ ID NO: 44), (2) a probe having a nucleotide sequence acacgaacactgtctgaaagcgtg (SEQ ID NO: 45), (3) a probe having a nucleotide sequence cctgccgacgttttccaaccat (SEQ ID NO: 46), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 44 to 46 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 16: (1) a probe having a nucleotide sequence tctctctgaatgctggacggtgtc (SEQ ID NO: 47), (2) a probe having a nucleotide sequence ctcgccgaaggagtgattctcaga (SEQ ID NO: 48), (3) a probe having a nucleotide sequence ttccaccgggagaggagaaagg (SEQ ID NO: 49), (4) a probe having a nucleotide sequence acaaaaccagcgccttcaggac (SEQ ID NO: 50), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 47 to 50 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 17: (1) a probe having a nucleotide sequence cctgagggggactcttgtttcct (SEQ ID NO: 51), (2) a probe having a nucleotide sequence cgccggaggattactctggaaaac (SEQ ID NO: 52), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 51 and 52 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 18: (1) a probe having a nucleotide sequence gtccggggacaatcaactccct (SEQ ID NO: 53), (2) a probe having a nucleotide sequence aatccatgaatactgttccgtctgagc (SEQ ID NO: 54), (3) a probe having a nucleotide sequence ggccggttttctggcctagtttt (SEQ ID NO: 55), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 53 to 55 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe,
group 19: (1) a probe having a nucleotide sequence agcctctttgggggctttagct (SEQ ID NO: 56), (2) a probe having a nucleotide sequence acagacatcaaaaaatcttggaaagctgt (SEQ ID NO: 57), (3) a probe having a nucleotide sequence ctgggcgaatgggcagtcaaac (SEQ ID NO: 58), (4) a probe having a nucleotide sequence ctctggccttcccccaaatctc (SEQ ID NO: 59), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 56 to 59 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 20: (1) a probe having a nucleotide sequence agacaccaagaaaaaattctctgaagagc (SEQ ID NO: 60), (2) a probe having a nucleotide sequence gaatgggcagccaattcagcgc (SEQ ID NO: 61), (3) a probe having a nucleotide sequence cttctgggagcctcgagccg (SEQ ID NO: 62), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 60 to 62 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 21: (1) a probe having a nucleotide sequence cggcgagcctctctttatagcg (SEQ ID NO: 63), (2) a probe having a nucleotide sequence cctctctttatagcggctcaacgc (SEQ ID NO: 64), (3) a probe having a nucleotide sequence ggctttctaggcgaatgggcaa (SEQ ID NO: 65), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 63 to 65 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 22: (1) a probe having a nucleotide sequence aggacagacatcaaaaaatcttgaagagc (SEQ ID NO: 66), (2) a probe having a nucleotide sequence aagctcggcttgtgtgatggac (SEQ ID NO: 67), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 66 and 67 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 23: (1) a probe having a nucleotide sequence acaccaaggaaaattctctgaagggc (SEQ ID NO: 68), (2) a probe having a nucleotide sequence ccaaggaaaattctctgaagggctgt (SEQ ID NO: 69), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 68 and 69 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 24: (1) a probe having a nucleotide sequence tctctttagtggctcaacgctgga (SEQ ID NO: 70), (2) a probe having a nucleotide sequence ggacagacgcaaaaaaattctttcagaag (SEQ ID NO: 71), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 70 and 71 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 25: (1) a probe having a nucleotide sequence tgggcaataaccagcgcctcta (SEQ ID NO: 72), (2) a probe having a nucleotide sequence tcagggatgcatttctctgcgaatc (SEQ ID NO: 73), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 72 and 73 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 26: (1) a probe having a nucleotide sequence cctctctttagtggctaaacgctgg (SEQ ID NO: 74), (2) a probe having a nucleotide sequence cgccctggcctcaaaatctgtt (SEQ ID NO: 75), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 74 and 75 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 27: (1) a probe having a nucleotide sequence ttcgagcgtcatttcaacccctc (SEQ ID NO: 76), and (2) a probe having a variant sequence of the sequence of SEQ ID NO: 76 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 28: (1) a probe having a nucleotide sequence gttgacctcggatcaggtagggat (SEQ ID NO: 77), and (2) a probe having a variant sequence of the sequence of SEQ ID NO: 77 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe; and
group 29: (1) a probe having a nucleotide sequence aactttcaacaacggatctcttggttct (SEQ ID NO: 78), (2) a probe having a nucleotide sequence gcatcgatgaagaacgcagcga (SEQ ID NO: 79), (3) a probe having a nucleotide sequence gtgaatcatcgaatctttgaacgcaca (SEQ ID NO: 80), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 78 to 80 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe.

[0031] Furthermore, the present invention relates to a kit for fungal species identification comprising: the probe carrier; and a reagent for detecting the reaction between the probe and a target nucleic acid.

[0032] According to the present invention, the identification of the presence or absence of a causative fungus of disease, or a fungal species thereof can be performed more reliably and rapidly than a conventional method by microscopic examination or culture. Furthermore, the present invention enables more convenient identification of a fungal species than a conventional method including designing primers for each possible fungus and identifying a fungal species from the amplification products. The present invention also enables more convenient identification of a fungal species than a conventional method including isolating a fungus from an affected area and then performing gene examination and antibody examination. The present invention can also be applied to nucleic acids extracted from plural fungal species. In such a case, the hybridization signals of probes respectively designed for fungi can be analyzed independently. Therefore, the present invention enables reliable identification of a fungal species.

[0033] Further features of the present invention will become apparent from the following description of exemplary embodiments with reference to the attached drawings.

[0040] Preferred embodiments of the present invention will now be described in detail in accordance with the accompanying drawings.

[0041] An embodiment of the present invention will be described with reference to FIG. 1. FIG. 1 is a flow chart illustrating the outline of a method for identifying a fungal species according to the present invention. An affected area infected with a fungus is collected (101). The affected area together with the fungus is then dissolved or disrupted to extract a nucleic acid (102). The extracted nucleic acid is amplified (103) using primers having a nucleic acid sequence capable of amplifying a region which is possessed commonly by fungi but of which sequence is not common in these 26 fungal species. Then, analysis is conducted (104) for obtaining information about a partial sequence of the amplified nucleic acid (amplification product) which permits fungal species identification. This analysis result is analyzed (105), and a fungal species is identified (106).

[0042] In the nucleic acid amplification, primers capable of collectively amplifying the genomic sequences of fungi to be detected, irrespective of fungal species, may be used alone or as a primer set including plural combined primers.

[0043] In the nucleic acid amplification, a label may be introduced.

[0044] The analysis for obtaining information about a partial sequence of the amplified nucleic acid which permits fungal species identification includes various methods such as hybridization using a probe, the sequencing of a fungal species-specific partial sequence, and mass spectrometry.

[0045] To use the approach of hybridization using a probe, probes designed from partial sequences respectively specific to plural possible fungal species can be used simultaneously. This is because a highly possible fungus and a low possible fungus can be determined clearly by comprehensive determination after the determination of the hybridization intensity of each probe. This is also because plural fungal species, if simultaneously causing infections, can be identified individually from the hybridization intensity of each probe. Furthermore, this is because increases in the number of probes simultaneously used can impart redundancy to information obtained from hybridization results. Furthermore, this is because the hybridization results serve as listing data indicating results of simultaneously detecting plural fungi.

[0046] The method of the present invention may be directed to skin disease as fungal infection. In such a case, both of a causative fungus of skin disease and indigenous microorganisms usually present even in normal individuals may be present in a skin disease-affected area. A causative fungus of disease is usually present in larger amounts in an affected area than that of indigenous microorganisms. Therefore, a quantitative ratio of extractable nucleic acids differs between the causative fungus and the indigenous microorganism. In this context, according to the method of the present invention, amplification treatment is performed using nucleic acid primers capable of amplifying both of the indigenous microorganism and the causative fungus of disease. Difference in the amount of nucleic acids after amplification is larger than that in the amount of nucleic acids after extraction. As a result, in the detection of hybridization signal intensity, an intensity ratio thereof is increased. The indigenous microorganisms and the causative fungus can be discriminated from the signal intensity ratio.

[0047] Staphylococci, which are observed as indigenous microorganisms, have a ribosomal RNA region sequence different from fungi. Therefore, amplification using a ribosomal RNA region specific to fungi can eliminate staphylococcus-derived nucleic acids from the nucleic acid amplification products. Thus, the indigenous microorganisms and the causative fungus can be discriminated.

[0048] A nucleic acid extracted from a skin disease-affected tissue slice contains skin-derived human genomes. For the amplification using nucleic acid primers, the design and use of primers are important which do not permit the amplification of these human genomes. Examples of the nucleic acid sequence region held in common by fungi include 18S ribosomal RNA, an ITS region and 26S ribosomal RNA. The design of primers or a primer set is important which are capable of collectively amplifying at least a portion of these regions in fungi, independently of fungal species. These primers or primer set are designed based on the premise that the primers or primer set do not permit the amplification of human genomes.

[0049] On the other hand, cells such as hair free of a root, keratinized skin and nails are enucleated. Therefore, nucleic acids extracted from these specimens do not contain human genomes. Accordingly, if nucleic acids can be extracted from specimens and amplified using the primer set capable of amplifying at least a portion of a nucleic acid sequence region held in common by fungi, the specimens are shown to contain some fungus.

[0050] The method of the present invention may also be directed to blood disease as fungal infection. In such a case, an extracted nucleic acid contains leukocyte-derived human genomes. In this case as well, primers must be designed for use which are capable of selectively amplifying only fungal genomes without amplifying the human genomes.

[0051] According to the method of the present invention, nucleic acid amplification may not be observed using the primer set capable of amplifying at least a portion of a nucleic acid sequence region held in common by fungi. In such a case, it can be determined that skin disease is not caused by fungi. In this case, other causes such as bacteria, viruses, atopy, autoimmune disease and drug eruption are expected. Therefore, drug candidates used for treatment can be narrowed down rapidly.

[0052] In the analysis for obtaining information about a partial sequence of the amplified nucleic acid which permits fungal species identification, the approach of hybridization using a nucleic acid probe may be used. In such a case, a fungal species can be identified by analyzing hybridization signals. To identify a fungal species by analyzing hybridization signals, determination software may be used in which fungal species determination logic is incorporated. FIG. 5 is a block diagram illustrating an information processing apparatus in which determination software according to the present embodiment is operated. The determination software is installed in an apparatus which includes a central processing unit (CPU) 501, a memory 502, RAM 503 and an input-output unit 504 connected via a bus 505. Specifically, this software can be installed in a general personal computer, a workstation, or the like. In FIG. 5, the central processing unit (CPU) 501 temporarily stores, on the RAM 503, the program of the present embodiment stored in the memory 502 or data necessary for executing the program of the present embodiment and executes the program of the present embodiment. The input-output unit 504 includes a display, a keyboard, a pointing device, a printing apparatus, a network interface, and so on, and performs user interaction to execute the program of the present embodiment. In many cases, a user executes the program of the present embodiment via this input-output unit 504. A user also reads execution results or controls parameters during program execution via this input-output unit 504. The determination software receives data on hybridization results by input and normalizes the input data, if necessary, for data analysis. As a result, the software outputs the presence or absence of a fungus in the hybridized sample, existing probability of a fungus, or the name of a fungus that is present.

[0053] The present invention further provides a probe set including two or more combined probes for fungal species identification. The use of this probe set permits the detection of any one of 26 fungi below or the simultaneous detection of plural species thereof.

1) Candida albicans

2) Candida dubliniensis

3) Candida glabrata

4) Candida guilliermondii

5) Candida intermedia

6) Candida kefyr

7) Candida krusei

8) Candida lusitaniae

9) Candida parapsilosis

10) Candida tropicalis

11) Trichosporon cutaneum

12) Trichosporon asahii

13) Cryptococcus neoformans

14) Aspergillus fumigatus

15) Aspergillus niger

16) Epidermophyton floccosum

17) Arthroderma otae

18) Arthroderma gypseum

19) Arthroderma benhamiae

20) Trichophyton rubrum

21) Trichophyton tonsurans

22) Trichophyton verrucosum

23) Trichophyton violaceum

24) Arthroderma vanbreuseghemii

25) Arthroderma incurvatum

26) Trichophyton interdigitale

[0054] Specifically, the present invention provides a probe set for sufficiently detecting an ITS region which is possessed commonly by fungi but of which sequence is not common in these 26 fungal species. Probes constituting the probe set according to the present invention are reacted with a sample containing a nucleic acid having the DNA sequence itself of a fungal ITS region or a nucleotide sequence specific to the ITS region. The probes constituting the probe set used in fungal species identification according to the present invention are selected as the following combination (1) or (2): (1) a first probe belonging to any group selected from the following groups 1 to 29 and a second probe belonging to any group selected from the following groups 1 to 29 and not belonging to the group to which the first probe belongs, or (2) a third probe having a nucleotide sequence complementary to the first probe and a fourth probe having a nucleotide sequence complementary to the second probe:

[0055] group 1: (1) a probe having a nucleotide sequence tctttgaaacaaacttgctttggcgg (SEQ ID NO: 1), (2) a probe having a nucleotide sequence ccgccagaggtctaaacttacaacc (SEQ ID NO: 2), (3) a probe having a nucleotide sequence gacggtagtggtaaggcgggat (SEQ ID NO: 3), (4) a probe having a nucleotide sequence ggcggtaacgtccaccacgtat (SEQ ID NO: 4), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 1 to 4 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 2: (1) a probe having a nucleotide sequence tgtgttttgttctggacaaacttgctttg (SEQ ID NO: 5), (2) a probe having a nucleotide sequence ctgccgccagaggacataaacttac (SEQ ID NO: 6), (3) a probe having a nucleotide sequence tagtggtataaggcggagatgcttga (SEQ ID NO: 7), (4) a probe having a nucleotide sequence tctggcgtcgcccattttattcttc (SEQ ID NO: 8), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 5 to 8 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 3: (1) a probe having a nucleotide sequence ggtgttttatcacacgactcgacact (SEQ ID NO: 9), (2) a probe having a nucleotide sequence ggagttctcccagtggatgcaaac (SEQ ID NO: 10), (3) a probe having a nucleotide sequence ggccatatcagtatgtgggacacg (SEQ ID NO: 11), (4) a probe having a nucleotide sequence aggttttaccaactcggtgttgatctag (SEQ ID NO: 12), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 9 to 12 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 4: (1) a probe having a nucleotide sequence gcttaactgcgcggcgaaaaac (SEQ ID NO: 13), (2) a probe having a nucleotide sequence agataggttgggccagaggtttaaca (SEQ ID NO: 14), (3) a probe having a nucleotide sequence tcttagtcggactaggcgtttgctt (SEQ ID NO: 15), (4) a probe having a nucleotide sequence tcgttgaatggtgtggcgggat (SEQ ID NO: 16), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 13 to 16 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 5: (1) a probe having a nucleotide sequence gtgttgccttccgaaatatcacagttg (SEQ ID NO: 17), (2) a probe having a nucleotide sequence cagttgtcgcaatacgttacttcaacttt (SEQ ID NO: 18), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 17 to 18 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 6: (1) a probe having a nucleotide sequence gcggccagttcttgattctctgc (SEQ ID NO: 19), (2) a probe having a nucleotide sequence agctcgtctctccagtggacataaac (SEQ ID NO: 20), (3) a probe having a nucleotide sequence ttgaaagtggctagccgttgcc (SEQ ID NO: 21), (4) a probe having a nucleotide sequence tcgtggtaagcttgggtcatagagac (SEQ ID NO: 22), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 19 to 22 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 7: (1) a probe having a nucleotide sequence agcggaacgaaaacaacaacacct (SEQ ID NO: 23), (2) a probe having a nucleotide sequence acctagtgtgaattgcagccatcg (SEQ ID NO: 24), (3) a probe having a nucleotide sequence gacgtgtaaagagcgtcggagc (SEQ ID NO: 25), (4) a probe having a nucleotide sequence gcgagtgttgcgagacaacaaaaag (SEQ ID NO: 26), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 23 to 26 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 8: (1) a probe having a nucleotide sequence ctcgaggcattcctcgaggcat (SEQ ID NO: 27), (2) a probe having a nucleotide sequence aggcgttgctccgaaatatcaacc (SEQ ID NO: 28), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 27 to 28 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 9: (1) a probe having a nucleotide sequence tggggcctgccagagattaaact (SEQ ID NO: 29), (2) a probe having a nucleotide sequence gtgttgagcgatacgctgggttt (SEQ ID NO: 30), (3) a probe having a nucleotide sequence gttttttccactcattggtacaaactcca (SEQ ID NO: 31), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 29 to 31 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 10: (1) a probe having a nucleotide sequence accgccagaggttataactaaaccaaa (SEQ ID NO: 32), (2) a probe having a nucleotide sequence gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO: 33), (3) a probe having a nucleotide sequence acgcttattttgctagtggccacc (SEQ ID NO: 34), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 32 to 34 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 11: (1) a probe having a nucleotide sequence tgaactgttgattgacttcggtcaattga (SEQ ID NO: 35), (2) a probe having a nucleotide sequence gcgtgtttaacttgtcttatctggcg (SEQ ID NO: 36), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 35 to 36 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 12: (1) a probe having a nucleotide sequence gttctactacttgacgcaagtcgagt (SEQ ID NO: 37), (2) a probe having a nucleotide sequence ttgggcgtctgcgatttctgatc (SEQ ID NO: 38), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 37 to 38 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 13: (1) a probe having a nucleotide sequence caacggatctcttggcttccaca (SEQ ID NO: 39), (2) a probe having a nucleotide sequence ttgagagtcatgaaaatctcaatccctcg (SEQ ID NO: 40), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 39 to 40 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 14: (1) a probe having a nucleotide sequence cccgtgtctatcgtaccttgttgc (SEQ ID NO: 41), (2) a probe having a nucleotide sequence tgaacgctgttctgaaagtatgcagt (SEQ ID NO: 42), (3) a probe having a nucleotide sequence gccagccgacacccaactttatt (SEQ ID NO: 43), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 41 to 43 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 15: (1) a probe having a nucleotide sequence cccatccgtgtctattgtaccctgt (SEQ ID NO: 44), (2) a probe having a nucleotide sequence acacgaacactgtctgaaagcgtg (SEQ ID NO: 45), (3) a probe having a nucleotide sequence cctgccgacgttttccaaccat (SEQ ID NO: 46), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 44 to 46 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 16: (1) a probe having a nucleotide sequence tctctctgaatgctggacggtgtc (SEQ ID NO: 47), (2) a probe having a nucleotide sequence ctcgccgaaggagtgattctcaga (SEQ ID NO: 48), (3) a probe having a nucleotide sequence ttccaccgggagaggagaaagg (SEQ ID NO: 49), (4) a probe having a nucleotide sequence acaaaaccagcgccttcaggac (SEQ ID NO: 50), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 47 to 50 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 17: (1) a probe having a nucleotide sequence cctgagggggactcttgtttcct (SEQ ID NO: 51), (2) a probe having a nucleotide sequence cgccggaggattactctggaaaac (SEQ ID NO: 52), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 51 and 52 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 18: (1) a probe having a nucleotide sequence gtccggggacaatcaactccct (SEQ ID NO: 53), (2) a probe having a nucleotide sequence aatccatgaatactgttccgtctgagc (SEQ ID NO: 54), (3) a probe having a nucleotide sequence ggccggttttctggcctagtttt (SEQ ID NO: 55), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 53 to 55 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 19: (1) a probe having a nucleotide sequence agcctctttgggggctttagct (SEQ ID NO: 56), (2) a probe having a nucleotide sequence acagacatcaaaaaatcttggaaagctgt (SEQ ID NO: 57), (3) a probe having a nucleotide sequence ctgggcgaatgggcagtcaaac (SEQ ID NO: 58), (4) a probe having a nucleotide sequence ctctggccttcccccaaatctc (SEQ ID NO: 59), and (5) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 56 to 59 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 20: (1) a probe having a nucleotide sequence agacaccaagaaaaaattctctgaagagc (SEQ ID NO: 60), (2) a probe having a nucleotide sequence gaatgggcagccaattcagcgc (SEQ ID NO: 61), (3) a probe having a nucleotide sequence cttctgggagcctcgagccg (SEQ ID NO: 62), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 60 to 62 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 21: (1) a probe having a nucleotide sequence cggcgagcctctctttatagcg (SEQ ID NO: 63), (2) a probe having a nucleotide sequence cctctctttatagcggctcaacgc (SEQ ID NO: 64), (3) a probe having a nucleotide sequence ggctttctaggcgaatgggcaa (SEQ ID NO: 65), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 63 to 65 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 22: (1) a probe having a nucleotide sequence aggacagacatcaaaaaatcttgaagagc (SEQ ID NO: 66), (2) a probe having a nucleotide sequence aagctcggcttgtgtgatggac (SEQ ID NO: 67), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 66 and 67 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 23: (1) a probe having a nucleotide sequence acaccaaggaaaattctctgaagggc (SEQ ID NO: 68), (2) a probe having a nucleotide sequence ccaaggaaaattctctgaagggctgt (SEQ ID NO: 69), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 68 and 69 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 24: (1) a probe having a nucleotide sequence tctctttagtggctcaacgctgga (SEQ ID NO: 70), (2) a probe having a nucleotide sequence ggacagacgcaaaaaaattctttcagaag (SEQ ID NO: 71), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 70 and 71 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 25: (1) a probe having a nucleotide sequence tgggcaataaccagcgcctcta (SEQ ID NO: 72), (2) a probe having a nucleotide sequence tcagggatgcatttctctgcgaatc (SEQ ID NO: 73), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 72 and 73 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 26: (1) a probe having a nucleotide sequence cctctctttagtggctaaacgctgg (SEQ ID NO: 74), (2) a probe having a nucleotide sequence cgccctggcctcaaaatctgtt (SEQ ID NO: 75), and (3) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 74 and 75 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 27: (1) a probe having a nucleotide sequence ttcgagcgtcatttcaacccctc (SEQ ID NO: 76), and (2) a probe having a variant sequence of the sequence of SEQ ID NO: 76 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe;
group 28: (1) a probe having a nucleotide sequence gttgacctcggatcaggtagggat (SEQ ID NO: 77), and (2) a probe having a variant sequence of the sequence of SEQ ID NO: 77 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe; and
group 29: (1) a probe having a nucleotide sequence aactttcaacaacggatctcttggttct (SEQ ID NO: 78), (2) a probe having a nucleotide sequence gcatcgatgaagaacgcagcga (SEQ ID NO: 79), (3) a probe having a nucleotide sequence gtgaatcatcgaatctttgaacgcaca (SEQ ID NO: 80), and (4) a probe having a variant sequence of any one of the sequences of SEQ ID NOs: 78 to 80 which has deletion, substitution or addition of a base within a range which can maintain functions as the probe.

[0056] One to four probes belong to each of the groups. The probe set includes at least two probes and at most 80 probes.

[0057] The variant sequence has a variation within a range which does not impair functions as the probe, that is, within a range which can detect a target nucleic acid sequence to be detected by hybridization. Particularly, the variant sequence can have a variation within a range which permits hybridization with a target nucleic acid sequence to be detected under stringent conditions. Examples of suitable hybridization conditions that specify the range of the variation can include conditions described in Examples below. In this context, the target to be detected is contained in an analyte for hybridization and may be the nucleotide sequence itself specific to a pathogen of infection or a complementary sequence of this specific nucleotide sequence. Examples of the variation can include the deletion, substitution or addition of one or several bases, which is performed within a range which can maintain functions as the probe.

[0058] These probe functions largely depend on the specificity of the probe sequence to a target nucleic acid sequence to be examined. The specificity of the probe sequence can be evaluated from base match to the target nucleic acid sequence and melting temperatures between the target nucleic acid sequence and the probe sequence. The performance of a probe constituting the probe set also depends on variations from the melting temperatures of other probe sequences.

[0059] To design these probe sequences, a universal region among fungal species is selected such that the selected region does not vary even among different strains of the same species. Moreover, a specific region is selected which has base mismatch of three or more bases from the sequence of a fungal species other than the fungal species of interest. The probe sequences are designed such that melting temperatures between the probe sequence and the sequence of the fungal species of interest differ by 10° C. or more from melting temperatures between the probe sequence and the sequence of a fungal species other than the fungal species of interest. Furthermore, the probes immobilized on one carrier are designed to have their respective melting temperatures falling within a predetermined range. The melting temperatures are controlled by deleting or adding a base in or to the highly specific region.

[0060] To design these probe sequences, low homology to the sequence of Malassezia known as an indigenous fungus in the skin is taken into consideration. Thus, a pathogenic fungus to be detected by the probe set of the present invention and Malassezia as an indigenous fungus can be discriminated. Specifically, the probe of the present invention is capable of identifying the fungal species to be detected in the presence of Malassezia.

[0061] Experiments of the present inventors have demonstrated that a probe sequence in which 80% or more of its consecutive sequence is conserved gives little attenuation of hybridization intensity. This means that a variant sequence in which 80% or more of consecutive nucleotide sequence in the probe sequence disclosed by the present application is conserved does not impair probe functions.

[0062] In this context, the detection functions of each of the groups are shown below.

group 1: Candida albicans

group 2: Candida dubliniensis

group 3: Candida glabrata

group 4: Candida guilliermondii

group 5: Candida intermedia

group 6: Candida kefyr

group 7: Candida krusei

group 8: Candida lusitaniae

group 9: Candida parapsilosis

group 10: Candida tropicalis

group 11: Trichosporon cutaneum

group 12: Trichosporon asahii

group 13: Cryptococcus neoformans

group 14: Aspergillus fumigatus

group 15: Aspergillus niger

group 16: Epidermophyton floccosum

group 17: Arthroderma otae

group 18: Arthroderma gypseum

group 19: Arthroderma benhamiae

group 20: Trichophyton rubrum

group 21: Trichophyton tonsurans

group 22: Trichophyton verrucosum

group 23: Trichophyton violaceum

group 24: Arthroderma vanbreuseghemii

group 25: Arthroderma incurvatum

group 26: Trichophyton interdigitale

group 27: For detection of Trichophyton (fungi in groups 16 to 26 and their closely related fungi)

group 28: For detection of filamentous fungi (fungi in groups 14 to 26 and their closely related fungi)

group 29: For detection of fungi (fungi in groups 1 to 26 and their closely related fungi)

[0063] Sequences complementary to these probe sequences have the same functions and are also effective as probe sequences. Two or more probes having these complementary sequences can be used to constitute a probe set.

[0064] The probes were respectively designed for fungi from the ITS region portion in the DNA sequence such that very high specificity to the fungi, no variations among the probe nucleotide sequences, and sufficient hybridization sensitivity can be expected.

[0065] The nucleotide sequences of these probes are designed to have a melting temperature falling within a predetermined range such that the probes form stable hybrids with analytes in the hybridization reaction between one or more of the probes bound with and immobilized on a carrier and the analytes and produce favorable results. The melting temperature is controlled by adjusting the length of the nucleotide sequences and a constituent ratio of bases.

[0066] These probe sequences are also designed to permit fungal species determination by combining plural characteristic portions without determining the whole sequence of the ITS region.

[0067] Accordingly, the information about a partial sequence of the amplified nucleic acid which permits fungal species identification can be obtained using these probe sequences.

[0068] Moreover, the combined use of the probes specific to fungal species and the probes specific to fungal groups can more increase distinct sites in portions characteristics of the fungi and enables more precise determination of a fungal species.

[0069] Specifically, determination using only one probe of the present invention enables acquisition of sequence information based on only the number of bases in the nucleotide sequence of each probe, that is, detection of the presence or absence of a complementary sequence.

[0070] Such determination is performed by increasing the number of probes for different sequence regions to 2, 3, etc. and is achieved based on the total number of bases of the sequences. Specifically, increases in the number of probes more improve the precision of determination of the presence or absence of the fungal sequence.

[0071] Such probes for determination may be selected as probes that are not limited to specific sequences held by particular fungal species. These probes are group probes. Therefore, the use of both of the group and species probes further improves determination precision.

[0072] Furthermore, a probe carrier (e.g., a DNA chip) in which the probes for fungal species identification according to the present invention are immobilized can be obtained by supplying the probes to predetermined positions in a carrier and immobilizing the probes thereon. The supply of the probes to a carrier can be performed using various methods. For example, a method that can be used is capable of immobilizing probes onto a carrier through a chemical bond (e.g., a covalent bond) and includes adding solutions containing these probes to predetermined positions in the carrier by an inkjet printing method. As a result, the probes are hardly dissociated from the carrier, and the effect of improving sensitivity is also additionally produced. Specifically, a DNA chip prepared by a conventional stamping method called the Stanford method generally used has the disadvantage that DNA applied to a carrier is easily dissociated therefrom. An alternative method for preparing a DNA chip includes arranging probes by DNA synthesis on carrier surface (e.g., Affymetrix oligonucleotide array). For this method including synthesizing probes on a carrier, the probes are difficult to synthesize in uniform amounts. Therefore, the amount of the probe immobilized tends to considerably differ among probe-immobilized regions (spots). Due to such variations in the amount of the probe immobilized, precise evaluation may not be made on detection results obtained using such a probe carrier. From these viewpoints, the probe carrier according to the present invention can be prepared using the inkjet printing method. The inkjet printer method has the advantage that: probes are stably immobilized on a carrier and hardly dissociated therefrom; and a probe carrier capable of achieving highly sensitive and highly precise detection can be provided efficiently.

[0073] To immobilize plural probes on a carrier for use, the probes can be designed to have a predetermined melting temperature such that a hybridization protocol can be simplified and unified.

[0074] Hereinafter, an exemplary embodiment of the present invention will be described in more detail.

[0075] Terms used herein will be described below.

[0076] A “specimen” refers to an object obtained for examination. An “analyte” refers to such a specimen adjusted to contain DNA or nucleic acid fragments. A “sample” refers to an object to be reacted with probes. The specimen may be reacted directly with probes. In such a case, the “sample” encompasses the specimen. Alternatively, the analyte adjusted from the specimen may be reacted with probes. In such a case, the “sample” encompasses the analyte.

[0077] The sample to be examined using the probe carrier (e.g., a DNA chip) used in the method for identifying a fungal species according to the present invention includes those derived from animals such as humans and livestock. For example, any of body fluids (e.g., blood, spinal fluid, sputum, stomach fluid, vaginal secretions and oral mucus), tissue slices (e.g., nails, skin and hair), and excretions (urine and feces) probably having bacteria can be used as a sample to be examined. Alternative examples of the sample to be examined include all media probably contaminated with bacteria, such as: food and water in the environment (e.g., drink water and hot spring water) which cause food poisoning or are contaminated; and filters for air cleaners. Furthermore, animals and plants to be quarantined during import and export are used as samples to be examined.

[0078] Such a specimen may be used directly in reaction with the DNA chip. In such a case, the specimen is reacted as a sample with the DNA chip, and the obtained results are analyzed. Alternatively, such a specimen may not directly be reacted with the DNA chip. In such a case, the specimen is subjected to necessary treatment such as the extraction and purification of a target substance to obtain an analyte. Then, this analyte is reacted as a sample with the DNA chip. For example, an extract probably containing a target nucleic acid is prepared from an analyte derived from a specimen containing the target nucleic acid and further subjected to necessary treatment such as washing or dilution to prepare a specimen solution. Then, this specimen solution may be reacted with the DNA chip. A specimen containing a target nucleic acid is subjected to various amplification treatments such as PCR amplification to amplify this target nucleic acid. Then, the resulting specimen may be reacted with the DNA chip. Such a nucleic acid analyte for amplification includes the following:

(a) an analyte prepared using PCR reaction primers designed for detecting an ITS region,

(b) an analyte prepared by further subjecting the PCR amplification product to PCR reaction,

(c) an analyte prepared by an amplification method other than PCR, and

(d) an analyte labeled by various labeling methods for visualization.

[0079] Any carrier that can satisfy characteristics which permit solid phase-liquid phase reaction of interest may be used in the preparation of the probe-immobilized carrier such as a DNA chip. For example, flat substrates (e.g., glass substrates, plastic substrates and silicon wafers), three-dimensional structures having asperities, spherical (e.g., beads), rod-shaped, cord-shaped, and thread-shaped carriers can be used. Furthermore, the carrier may be surface-treated such that probes can be immobilized thereon. Particularly, a carrier having functional groups for chemical reaction introduced to its surface is stably bound with probes in the process of hybridization reaction and is suitable in terms of reproducibility.

[0080] The immobilization of probes can be performed using various methods. One example thereof can include a method using the combination of maleimide and thiol (—SH) groups. This method includes binding thiol (—SH) groups to the ends of probes and treating carrier (solid phase) surface to have maleimide groups. As a result, the thiol groups of the probes supplied to the carrier surface are reacted with the maleimide groups on the carrier surface to immobilize the probes via the covalent bonds formed therebetween.

[0081] The introduction of maleimide groups can be performed using a method including first reacting an aminosilane coupling agent with a glass substrate and next introducing maleimide groups through the reaction between the amino groups thereof and an EMCS reagent (N-(6-Maleimidocaproyloxy)succinimide, manufactured by DOJINDO LABORATORIES). The introduction of thiol groups to DNA can be performed using 5′-Thiol-Modifier C6 (manufactured by Glen Research) in an automatic DNA synthesizer. Examples of the combination of functional groups used in the immobilization include, in addition to the combination of the thiol and maleimide groups, the combination of epoxy (on a solid phase) and amino (at the ends of nucleic acid probes) groups. Surface treatment using various silane coupling agents is also effective. In this case, probes are used in which functional groups capable of reacting with functional groups introduced using the silane coupling agent are introduced. A method including coating a carrier with a resin having functional groups is also available.

[0082] The detection of the DNA of a pathogen of infection using the probe carrier according to the present invention can be performed by a DNA detection method including at least:

(i) preparing a sample from a nucleic acid extracted from an affected area;

(ii) reacting the sample with the probe carrier in which the probes according to the present invention are immobilized; and

(iii) detecting the intensity of the reaction between the probe on the probe carrier and the nucleic acid in the sample.

[0083] Alternatively, the detection method can include at least:

(A) preparing a sample from a nucleic acid extracted from an affected area;

(B) reacting the sample with the probe carrier in which the probes according to the present invention are immobilized;

(C) detecting the presence or absence of the reaction between the probe on the probe carrier and the nucleic acid in the sample; and

[0084] (D) when the reaction between the probe and the nucleic acid in the sample is detected, identifying the probe reacted with the nucleic acid in the sample and identifying the DNA of a pathogen of infection contained in the sample, based on the nucleotide sequence of the identified probe.

[0085] As described above, an ITS region may be targeted as a region which is possessed commonly by fungi but of which sequence is not common in these 26 fungal species. The nucleotide sequence of the ITS region may be amplified by PCR to prepare a sample for reaction with the probe carrier. In such a case, a primer set for detection of a pathogen of infection can be used. Primers suitable for this primer set are oligonucleotides having the following generally known nucleotide sequences:

(1) 5′ tccgtaggtgaacctgcgg 3′ (ITS1; SEQ ID NO: 81), and

(2) 5′ tcctccgcttattgatatgc 3′ (ITS4; SEQ ID NO: 82).

Accordingly, the method for identifying a fungal species according to the present invention may further include PCR-amplifying a target nucleic acid in the specimen using the primer set having the nucleotide sequences of ITS1 and ITS4.

[0086] At least the probe set described above and a reagent for detecting the reaction between a nucleic acid in a sample and each probe can be used to constitute a kit for fungal species identification. The probe set in this kit may be provided, as described above, as a probe set immobilized on a carrier. Alternatively, the reagent for detection may contain a label for reaction detection and primers for amplification as pretreatment. The reagent for detection containing primers can include primers for amplifying the DNA of a fungal ITS region.

[0087] Hereinafter, the present invention will be described in more detail.

[0088] A DNA chip is prepared which is capable of identifying a fungal species by hybridization with nucleic acids amplified from the common regions of fungal species to be detected.

[0089] 1. Selection of Fungi to be Detected

[0090] One embodiment of a method for identifying a fungal species described in the present invention was directed to fungi shown in Table 1 below as fungi to be detected.

[0091]

TABLE 1
Possible fungal species
No.	Fungal Name
1	Candida albicans
2	Candida dubliniensis
3	Candida glabrata
4	Candida guilliermondii
5	Candida intermedia
6	Candida kefyr
7	Candida krusei
8	Candida lusitaniae
9	Candida parapsilosis
10	Candida tropicalis
11	Trichosporon cutaneum
12	Trichosporon asahii
13	Cryptococcus neoformans
14	Aspergillus fumigatus
15	Aspergillus niger
16	Epidermophyton floccosum
17	Arthroderma otae
18	Arthroderma gypseum
19	Arthroderma benhamiae
20	Trichophyton rubrum
21	Trichophyton tonsurans
22	Trichophyton verrucosum
23	Trichophyton violaceum
24	Arthroderma vanbreuseghemii
25	Arthroderma incurvatum
26	Trichophyton interdigitale

[0092] The fungal species shown in Table 1 are listed for describing one embodiment of the present invention. It is obvious that the same identification method as in the present invention can also be applied to embodiments including fungi to be detected other than those described above.

[0093] 2. Selection of Region to be Amplified

[0094] One embodiment of the method for identifying a fungal species described in the present invention was directed to an ITS region as a region which is possessed commonly by fungi but of which sequence is not common in these 26 fungal specie. In addition, generally known primers shown in Table 2 below were used as primers capable of amplifying in common the ITS regions of the fungal species shown in Table 1.

[0095]

TABLE 2
Primer capable of amplification
irrespective of fungal species
			SEQ
	Primer		ID
Primer Type	Name	Primer Sequence	No:
Forward Primer	ITS1	5′ tccgtaggtgaacctgcgg 3′	81
Reverse Primer	ITS4	5′ tcctccgcttattgatatgc 3′	82

[0096] The primers shown in Table 2 amplify the ITS region selected as a region to be amplified. It is obvious that if another gene region is used, primers capable of amplifying in common the gene region irrespective of fungal species may be used according to the nucleic acid sequence thereof.

[0097] 3. Design of Fungus-Specific Probe

[0098] For the regions amplified with the primers shown in Table 2, probes shown in Tables 3 to 5 below were designed from regions respectively specific to the fungi shown in Table 1.

[0099]

TABLE 3
				SEQ
		Probe		ID
Group	Fungal Name	Name	Nucleotide Sequence	No:
1	Candida albicans	P0101	5′ tctttgaaacaaacttgctttggcgg 3′	1
		P0102	5′ ccgccagaggtctaaacttacaacc 3′	2
		P0103	5′ gacggtagtggtaaggcgggat 3′	3
		P0104	5′ ggcggtaacgtccaccacgtat 3′	4
2	Candida	P0201	5′ tgtgttttgttctggacaaacttgctttg 3′	5
	dubliniensis	P0202	5′ ctgccgccagaggacataaacttac 3′	6
		P0204	5′ tagtggtataaggcggagatgcttga 3′	7
		P0205	5′ tctggcgtcgcccattttattcttc 3′	8
3	Candida glabrata	P0302	5′ ggtgttttatcacacgactcgacact 3′	9
		P0303	5′ ggagttctcccagtggatgcaaac 3′	10
		P0304	5′ ggccatatcagtatgtgggacacg 3′	11
		P0305	5′ aggttttaccaactcggtgttgatctag 3′	12
4	Candida	P0401	5′ gcttaactgcgcggcgaaaaac 3′	13
	guilliermondii	P0402	5′ agataggttgggccagaggtttaaca 3′	14
		P0403	5′ tcttagtcggactaggcgtttgctt 3′	15
		P0404	5′ tcgttgaatggtgtggcgggat 3′	16
5	Candida	P0503	5′ gtgttgccttccgaaatatcacagttg 3′	17
	intermedia	P0502	5′ cagttgtcgcaatacgttacttcaacttt 3′	18
6	Candida kefyr	P0601	5′ gcggccagttcttgattctctgc 3′	19
		P0602	5′ agctcgtctctccagtggacataaac 3′	20
		P0603	5′ ttgaaagtggctagccgttgcc 3′	21
		P0604	5′ tcgtggtaagcttgggtcatagagac 3′	22
7	Candida krusei	P0701	5′ agcggaacgaaaacaacaacacct 3′	23
		P0702	5′ acctagtgtgaattgcagccatcg 3′	24
		P0703	5′ gacgtgtaaagagcgtcggagc 3′	25
		P0704	5′ gcgagtgttgcgagacaacaaaaag 3′	26
8	Candida	P0801	5′ ctcgaggcattcctcgaggcat 3′	27
	lusitaniae	P0803	5′ aggcgttgctccgaaatatcaacc 3′	28

[0100]

TABLE 4
				SEQ
		Probe		ID
Group	Fungal Name	Name	Nucleotide Sequence	No:
9	Candida	P0901	5′ tggggcctgccagagattaaact 3′	29
	parapsilosis	P0902	5′ gtgttgagcgatacgctgggttt 3′	30
		P0903	5′ gttttttccactcattggtacaaactcca 3′	31
10	Candida	P1102	5′ accgccagaggttataactaaaccaaa 3′	32
	tropicalis	P1103	5′ gagcaatacgctaggtttgtttgaaagaa 3′	33
		P1104	5′ acgcttattttgctagtggccacc 3′	34
11	Trichosporon	P2701	5′ tgaactgttgattgacttcggtcaattga 3′	35
	cutaneum	P2702	5′ gcgtgtttaacttgtcttatctggcg 3′	36
12	Trichosporon	P2801	5′ gttctactacttgacgcaagtcgagt 3′	37
	asahii	P2802	5′ ttgggcgtctgcgatttctgatc 3′	38
13	Cryptococcus	P3301	5′ caacggatctcttggcttccaca 3′	39
	neoformans	P3302	5′ ttgagagtcatgaaaatctcaatccctcg 3′	40
14	Aspergillus	P2901	5′ cccgtgtctatcgtaccttgttgc 3′	41
	fumigatus	P2902	5′ tgaacgctgttctgaaagtatgcagt 3′	42
		P2903	5′ gccagccgacacccaactttatt 3′	43
15	Aspergillus	P3001	5′ cccatccgtgtctattgtaccctgt 3′	44
	niger	P3002	5′ acacgaacactgtctgaaagcgtg 3′	45
		P3003	5′ cctgccgacgttttccaaccat 3′	46
16	Epidermophyton	P1901	5′ tctctctgaatgctggacggtgtc 3′	47
	flocoosum	P1902	5′ ctcgccgaaggagtgattctcaga 3′	48
		P1903	5′ ttccaccgggagaggagaaagg 3′	49
		P1904	5′ acaaaaccagcgccttcaggac 3′	50
17	Arthroderma	P2001	5′ cctgagggggactcttgtttcct 3′	51
	otae	P2002	5′ cgccggaggattactctggaaaac 3′	52
18	Arthroderma	P2105	5′ gtccggggacaatcaactccct 3′	53
	gypseum	P2102	5′ aatccatgaatactgttccgtctgagc 3′	54
		P2103	5′ ggccggttttctggcctagtttt 3′	55

[0101]

TABLE 5
				SEQ
		Probe		ID
Group	Fungal Name	Name	Nucleotide Sequence	No:
19	Arthroderma	P2205	5′ agcctctttgggggctttagct 3′	56
	benhamiae	P2202	5′ acagacatcaaaaaatcttggaaagctgt 3′	57
		P2203	5′ ctgggcgaatgggcagtcaaac 3′	53
		P2204	5′ ctctggccttcccccaaatctc 3′	59
20	Trichophyton	P2302	5′ agacaccaagaaaaaattctctgaagagc 3′	60
	rubrum	P2306	5′ gaatgggcagccaattcagcgc 3′	61
		P2305	5′ cttctgggagcctogagccg 3′	62
21	Trichophyron	P2405	5′ cggcgagcctctctttatagcg 3′	63
	tonsurans	P2402	5′ cctctctttatagcggctcaacgc 3′	64
		P2403	5′ ggctttctaggcgaatgggcaa 3′	65
22	Trichophyton	P2501	5′ aggacagacatcaaaaaatcttgaagagc 3′	66
	verrucosum	P2502	5′ aagctcggcttgtgtgatggac 3′	67
23	Trichophyton	P2604	5′ acaccaaggaaaattctctgaagggc 3′	68
	violaceum	P2601	5′ ccaaggaaaattctctgaagggctgt 3′	69
24	Arthroderma	P3101	5′ tctctttagtggctcaacgctgga 3′	70
	vanbreuseghemii	P3102	5′ ggacagacgcaaaaaaattctttcagaag 3′	71
25	Arthroderma	P3201	5′ tgggcaataaccagcgcctcta 3′	72
	incurvatum	P3202	5′ tcagggatgcatttctctgcgaatc 3′	73
26	Trichophyton	P3401	5′ cctctctttagtggctaaacgctgg 3′	74
	interdigitale	P3402	5′ cgccctggcctcaaaatctgtt 3′	75
27	Common to	Ptricho1	5′ ttcgagcgtcatttcaacccctc 3′	76
	Trichophyton
28	Common to	Pfila1	5′ gttgacctcggatcaggtagggat 3′	77
	Filamentous
	Fungi
29	Common to	Pfungi1	5′ aactttcaacaacggatctcttggttct 3′	78
	Fungi	Pfungi2	5′ gcatcgatgaagaacgcagcga 3′	79
		Pfungi3	5′ gtgaatcatcgaatctttgaacgcaca 3′	80

[0102] The designed probes were not only probes respectively specific to fungal species but also probes respectively specific to groups of fungi (Groups 27, 28 and 29).

[0103] The probe common to Trichophyton of the group 27 is designed from a sequence common to the fungi in the groups 16 to 26. The probe common to filamentous fungi of the group 28 is designed from a sequence common to the fungi in the groups 14 to 26. The probe common to fungi of the group 29 is designed from a sequence common to the fungi in the groups 1 to 26.

[0104] 4. Preparation of DNA Chip

[0105] To achieve collective detection using the probes shown in Tables 3 to 5, a DNA chip was prepared in which these probes were immobilized on a glass substrate.

[0106] 4-1. Washing of Glass Substrate

[0107] A synthetic quartz glass substrate (size: 25 mm×75 mm×1 mm; manufactured by IIYAMA PRECISION GLASS CO., LTD.) was placed in a rack resistant to heat and alkali and dipped in a washing solution for ultrasonic washing prepared to a predetermined concentration. After overnight dipping in the washing solution, the substrate was ultrasonically washed for 20 minutes. Subsequently, the substrate was taken out of the solution and lightly rinsed with pure water. The substrate was then ultrasonically washed in ultrapure water for 20 minutes. Next, the substrate was dipped for 10 minutes in a 1 N aqueous sodium hydroxide solution heated to 80° C. The substrate was washed again with pure water and then with ultrapure water to prepare a quartz glass substrate for a DNA chip.

[0108] 4-2. Surface Treatment

[0109] A silane coupling agent KBM-603 (manufactured by Shin-Etsu Chemical Co., Ltd.) was dissolved at a concentration of 1% by weight (wt %) in pure water and stirred at room temperature for 2 hours. Subsequently, the previously washed glass substrate was dipped in the aqueous solution of the silane coupling agent and left at room temperature for 20 minutes. The glass substrate was pulled out of the solution. The surface of the substrate was lightly washed with pure water. Nitrogen gas was then sprayed on both surfaces of the substrate to dry the substrate. Next, the dried substrate was baked for 1 hour in an oven heated to 120° C. to complete the coupling agent treatment such that amino groups were introduced in the substrate surface. Subsequently, N-maleimidocaproyloxysuccinimide (hereinafter, abbreviated to EMCS) was dissolved at a final concentration of 0.3 mg/ml in a 1:1 (by volume) mixed solvent of dimethyl sulfoxide and ethanol to prepare an EMCS solution. The EMCS used is (N-(6-Maleimidocaproyloxy)succinimide) manufactured by DOJINDO LABORATORIES.

[0110] The completely baked glass substrate was allowed to cool and dipped in the prepared EMCS solution at room temperature for 2 hours. This treatment caused the reaction between the amino groups introduced in the surface by the silane coupling agent and the succinimide groups of EMCS such that the maleimide groups were introduced in the glass substrate surface. The glass substrate pulled out of the EMCS solution was washed with the mixed solvent containing the EMCS dissolved therein and further with ethanol and then dried in a nitrogen gas atmosphere.

[0111] 4-3. Probe DNA

[0112] The probes in the probe set for fungus detection prepared in the paragraph ‘3. Design of fungus-specific probe’ were separately dissolved in pure water and dispensed at a final concentration of 10 μM (in terms of a concentration after dissolution in ink). The solutions were freeze-dried to remove water.

[0113] 4-4. Discharge of DNA Using Inkjet Printer and Binding Thereof to Substrate

[0114] An aqueous solution was prepared which contained 7.5 wt % glycerin, 7.5 wt % thiodiglycol, 7.5 wt % urea and 1.0 wt % Acetylenol EH (manufactured by Kawaken Fine Chemicals Co., Ltd.). Subsequently, the previously prepared 80 probes (Tables 3 to 5) were separately dissolved at the specified concentration in the mixed solvent. The obtained DNA solutions were charged into an ink tank for an inkjet printer (trade name: BJF-850 manufactured by Canon Inc.), which was mounted on a print head.

[0115] The inkjet printer used here was modified to permit flat plate printing. This inkjet printer is capable of inputting a print pattern according to a predetermined file creation method such that approximately 5 picoliters of a DNA solution are spotted with a pitch of approximately 120 μm.

[0116] Subsequently, print operation using this modified inkjet printer was conducted on one glass substrate to prepare an array. After confirmation that printing was performed with reliability, the substrate was left standing in a humidifying chamber for 30 minutes to cause the reaction between the maleimide groups in the glass substrate surface and the thiol groups at the ends of the nucleic acid probes.

[0117] 4-5. Washing

[0118] After 30-minute reaction, the DNA solution remaining on the substrate surface was washed away with a 10 mM phosphate buffer solution (pH 7.0) containing 100 mM NaCl to obtain a DNA chip in which single-stranded DNAs were immobilized on the glass substrate surface.

[0119] 5. DNA Collection from Fungi

[0120] To confirm the performance of the prepared DNA chip, DNA was extracted from fungal strains shown below.

[0121] 5-1. Microorganism Culture and DNA Extraction

[0122] Fungal strains shown in Table 6 below were cultured according to a standard method. DNA extraction and purification were performed from this microorganism culture solution using a nucleic acid purification kit (FastPrep FP100A and FastDNA Kit; manufactured by Funakoshi Co., Ltd.).

[0123]

TABLE 6
Fungal species and strain name
No.	Fungal Name	Strain Name
1	Candida albicans	JCM 1542
2	Candida dubliniensis	ATCC MYA-646
3	Candida glabrata	JCM 3761
4	Candida guilliermondii	ATCC 6260
5	Candida intermedia	ATCC 14439
6	Candida kefyr	ATCC 42265
7	Candida krusei	JCM 1609
8	Candida lusitaniae	ATCC 34449
9	Candida parapsilosis	JCM 1618
10	Candida tropicalis	JCM 1541
11	Trichosporon cutaneum	JCM 1462
12	Trichosporon asahii	JCM 1809
13	Cryptococcus neoformans	ATCC 32045
14	Aspergillus fumigatus	JCM 10253
15	Aspergillus niger	JCM 10254
16	Epidermophyton floccosum	ATCC 52063
17	Arthroderma otae	ATCC 28327
18	Arthroderma gypseum	ATCC 24163
19	Arthroderma benhamiae	ATCC 16781
20	Trichophyton rubrum	ATCC 10218
21	Trichophyton tonsurans	ATCC 10217
22	Trichophyton verrucosum	ATCC 28203
23	Trichophyton violaceum	ATCC 28944
24	Arthroderma vanbreuseghemii	ATCC 28145
25	Arthroderma incurvatum	ATCC 24005
26	Trichophyton interdigitale	IFM 55365

[0124] 5-2. Examination of Collected DNA

[0125] The collected DNA of each fungal strain was subjected to agarose electrophoresis and absorbance measurement at 260/280 nm according to a standard method to assay the quality thereof (the amount of low-molecular-weight nucleic acids contaminating and the degree of degradation) and the amount of DNA collected. In the present Example, approximately 10 μg of DNA was collected, and DNA degradation or ribosomal RNA contamination were not observed. The collected DNA was dissolved at a final concentration of 50 ng/μl in a TE buffer solution, and this solution was used in Examples below.

[0126] 6. Amplification and Labeling

[0127] 6-1. Nucleic Acid Amplification: 1st PCR

[0128] The extracted nucleic acids were amplified. Specifically, PCR was performed according to solution composition shown in Table 7 using the primers shown in Table 2.

[0129]

TABLE 7
1st PCR solution composition
	TaKaRa ExTaq	25.0	μL
	Primer mix	2.0	μL
	Forward Primer	1.0	μL
	Reverse Primer	1.0	μL
	Template	1.0	μL
	Water	up to 50	μL
	Total	50	μL

[0130] The reaction solution having the composition shown in Table 7 was subjected to amplification reaction according to a protocol shown in FIG. 2 using a commercially available thermal cycler.

[0131] After the completion of reaction, the amplification products were purified using a purification column (QIAGEN QIAquick PCR Purification Kit) and then quantified.

[0132] In this context, obvious nucleic acid amplification was observed, demonstrating the presence of some fungus in the specimens.

[0133] 6-2. Nucleic Acid Amplification/Labeling: 2nd PCR

[0134] 2nd PCR was performed using a primer for labeling shown in Table 8.

[0135]

TABLE 8
Primer for labeling
			SEQ
Primer			ID
Type	Primer Name	Primer Sequence	No:
Primer	Cy3-labeled-	5′ tcctccgcttattgatatgc 3′	83
for	ITS4
Labeling

[0136] Specifically, Cy3 was introduced to the 5′ end of the ITS4 primer shown in Table 2, and the resulting primer was used as a primer for labeling.

[0137] A reaction solution having composition shown in Table 9 below was subjected to amplification reaction according to a protocol shown in FIG. 3 using a commercially available thermal cycler.

[0138]

TABLE 9
2nd PCR solution composition
	TaKaRa ExTaq	25.0	μL
	Primer or Labeling	5.0	μL
	Template DNA (1st PCR Product)	variable
		(30 ng/tube)
	Water	up to 50	μL
	Total	50	μL

[0139] After the completion of reaction, the amplification products were purified using a purification column (QIAGEN QIAquick PCR Purification Kit) and used as labeled samples.

[0140] 7. Hybridization

[0141] 7-1. Hybridization Reaction

[0142] Hybridization reaction was performed using the amplified/labeled, specimen-derived nucleic acids obtained by the treatment described in the paragraph ‘6-2. 2nd PCR’ and the DNA chip prepared by the method described in the paragraph ‘4. Preparation of DNA chip’.

[0143] Specifically, hybridization reaction was performed according to a protocol shown in FIG. 4 using a hybridization solution shown in Table 10.

[0144]

	TABLE 10
	20 × SSPE	39.0	μL
	Formamide	13.0	μL
	25 nM Positive Control	1.3	μL
	Water	13.7	μL
	Template DNA (2nd PCR Product)	50	μL
	0.5% SDS	13.0	μL
	total	130	μL

[0145] 7-2. Fluorescence Measurement

[0146] After the completion of the hybridization reaction, fluorescence measurement was performed using a fluorescence detection apparatus (manufactured by Axon, GenePix 4000B).

[0147] 8. Analysis of Results

[0148] Fluorescence intensities obtained by the fluorescence measurement are shown in Tables 11 to 88 below.

[0149]

TABLE 11
Candida albicans
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	16696.4	194.2	13186.9	269.0
	P0102	2	25680.8	298.6	16178.1	330.1
	P0103	3	25387.4	295.2	18482.3	377.1
	P0104	4	31495.4	366.3	24985.8	509.7
2	P0201	5	92.7	1.1	52.1	1.1
	P0202	6	953.1	11.1	196.5	4.0
	P0204	7	651.6	7.6	166.2	3.4
	P0205	8	77.9	0.9	46.0	0.9
3	P0302	9	75.2	0.9	44.1	0.9
	P0303	10	79.1	0.9	43.7	0.9
	P0304	11	78.6	0.9	43.3	0.9
	P0305	12	76.9	0.9	45.3	0.9
4	P0401	13	83.1	1.0	44.4	0.9
	P0402	14	81.2	0.9	45.7	0.9
	P0403	15	87.2	1.0	43.8	0.9
	P0404	16	436.8	5.1	97.5	2.0
5	P0503	17	78.1	0.9	43.8	0.9
	P0502	18	80.9	0.9	43.2	0.9
6	P0601	19	80.8	0.9	44.0	0.9
	P0602	20	73.7	0.9	43.2	0.9
	P0603	21	76.5	0.9	44.4	0.9
	P0604	22	79.8	0.9	46.0	0.9
7	P0701	23	82.7	1.0	44.7	0.9
	P0702	24	114.9	1.3	47.7	1.0
	P0703	25	80.2	0.9	45.3	0.9
	P0704	26	84.2	1.0	44.2	0.9
8	P0801	27	105.1	1.2	50.5	1.0
	P0803	28	74.2	0.9	47.5	1.0

[0150]

TABLE 12
Candida albicans
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	97.2	1.1	52.0	1.1
	P0902	30	439.1	5.1	163.9	3.3
	P0903	31	81.0	0.9	47.2	1.0
10	P1102	32	114.3	1.3	49.8	1.0
	P1103	33	403.5	4.7	55.3	1.1
	P1104	34	78.9	0.9	151.3	3.1
11	P2701	35	79.4	0.9	46.1	0.9
	P2702	36	78.8	0.9	46.7	1.0
12	P2801	37	81.8	1.0	45.9	0.9
	P2802	38	79.1	0.9	46.8	1.0
13	P3301	39	111.1	1.3	53.8	1.1
	P3302	40	83.9	1.0	45.2	0.9
14	P2901	41	84.2	1.0	45.9	0.9
	P2902	42	75.4	0.9	46.6	1.0
	P2903	43	76.9	0.9	45.1	0.9
15	P3001	44	78.2	0.9	45.2	0.9
	P3002	45	77.4	0.9	44.8	0.9
	P3003	46	80.3	0.9	46.4	0.9
16	P1901	47	76.8	0.9	44.4	0.9
	P1902	48	81.5	0.9	43.6	0.9
	P1903	49	83.2	1.0	44.4	0.9
	P1904	50	81.6	0.9	45.1	0.9
17	P2001	51	82.0	1.0	48.9	1.0
	P2002	52	83.4	1.0	42.7	0.9
18	P2105	53	73.8	0.9	43.4	0.9
	P2102	54	74.4	0.9	43.8	0.9
	P2103	55	75.4	0.9	44.4	0.9

[0151]

TABLE 13
Candida albicans
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	80.4	0.9	56.0	1.1
	P2202	57	75.9	0.9	43.5	0.9
	P2203	58	81.3	0.9	45.5	0.9
	P2204	59	74.7	0.9	46.9	1.0
20	P2302	60	80.9	0.9	44.6	0.9
	P2306	61	82.9	1.0	43.9	0.9
	P2305	62	79.9	0.9	44.8	0.9
21	P2405	63	77.3	0.9	44.7	0.9
	P2402	64	81.8	1.0	44.5	0.9
	P2403	65	75.3	0.9	44.2	0.9
22	P2501	66	77.4	0.9	45.2	0.9
	P2502	67	73.6	0.9	45.7	0.9
23	P2604	68	80.9	0.9	44.4	0.9
	P2601	69	83.0	1.0	46.1	0.9
24	P3101	70	79.2	0.9	46.2	0.9
	P3102	71	79.2	0.9	44.0	0.9
25	P3201	72	75.6	0.9	45.0	0.9
	P3202	73	78.5	0.9	43.4	0.9
26	P3401	74	78.7	0.9	47.3	1.0
	P3402	75	79.1	0.9	47.6	1.0
27	Ptricho1	76	78.0	0.9	44.9	0.9
28	Pfila1	77	293.4	3.4	68.3	1.4
29	Pfungi1	78	24243.6	281.9	23631.5	482.1
	Pfungi2	79	15604.1	181.5	14957.7	305.2
	Pfungi3	80	24244.6	281.9	24264.3	495.0

[0152]

TABLE 14
Candida dubliniensis
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	7289.3	66.3	1477.8	31.7
	P0102	2	2548.6	23.2	1046.0	22.4
	P0103	3	301.3	2.7	93.9	2.0
	P0104	4	105.0	1.0	44.8	1.0
2	P0201	5	26899.4	244.8	14128.7	302.7
	P0202	6	20909.2	190.3	10805.3	231.5
	P0204	7	36715.8	334.2	19906.9	426.6
	P0205	8	42855.0	390.0	15913.4	341.0
3	P0302	9	96.9	0.9	43.1	0.9
	P0303	10	81.8	0.7	43.3	0.9
	P0304	11	86.0	0.8	43.2	0.9
	P0305	12	75.5	0.7	42.6	0.9
4	P0401	13	92.1	0.8	44.7	1.0
	P0402	14	73.3	0.7	46.1	1.0
	P0403	15	81.8	0.7	47.1	1.0
	P0404	16	74.3	0.7	47.4	1.0
5	P0503	17	73.3	0.7	45.3	0.9
	P0502	18	70.5	0.6	43.6	1.0
6	P0601	19	74.8	0.7	44.3	0.9
	P0602	20	75.3	0.7	43.6	0.9
	P0603	21	69.2	0.6	42.7	0.9
	P0604	22	68.8	0.6	44.3	0.9
7	P0701	23	72.2	0.7	42.6	0.9
	P0702	24	113.5	1.0	47.2	1.0
	P0703	25	81.6	0.7	44.5	1.0
	P0704	26	73.8	0.7	44.0	0.9
8	P0801	27	98.9	0.9	51.7	1.1
	P0803	28	72.1	0.7	44.8	1.0

[0153]

TABLE 15
Candida dubliniensis
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	77.7	0.7	48.2	1.0
	P0902	30	133.8	1.2	54.3	1.2
	P0903	31	68.7	0.6	45.1	1.0
10	P1102	32	81.5	0.7	49.5	1.1
	P1103	33	309.7	2.8	46.7	1.0
	P1104	34	70.2	0.6	79.1	1.7
11	P2701	35	79.0	0.7	44.1	0.9
	P2702	36	70.8	0.6	43.8	0.9
12	P2801	37	73.2	0.7	43.5	0.9
	P2802	38	69.9	0.6	46.6	1.0
13	P3301	39	136.2	1.2	50.5	1.1
	P3302	40	66.7	0.6	43.3	0.9
14	P2901	41	77.3	0.7	44.0	0.9
	P2902	42	72.7	0.7	43.4	0.9
	P2903	43	71.2	0.6	42.3	0.9
15	P3001	44	72.1	0.7	43.7	0.9
	P3002	45	75.6	0.7	44.4	1.0
	P3003	46	73.3	0.7	42.9	0.9
16	P1901	47	73.9	0.7	44.1	0.9
	P1902	48	79.5	0.7	42.3	0.9
	P1903	49	71.0	0.6	42.8	0.9
	P1904	50	74.2	0.7	44.0	0.9
17	P2001	51	77.2	0.7	46.5	1.0
	P2002	52	78.3	0.7	43.7	0.9
18	P2105	53	73.4	0.7	44.3	0.9
	P2102	54	72.4	0.7	43.6	0.9
	P2103	55	74.6	0.7	43.7	0.9

[0154]

TABLE 16
Candida dubliniensis
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	84.2	0.8	54.9	1.2
	P2202	57	78.0	0.7	43.5	0.9
	P2203	58	74.1	0.7	44.9	1.0
	P2204	59	66.2	0.6	44.3	0.9
20	P2302	60	77.0	0.7	42.5	0.9
	P2306	61	68.7	0.6	44.8	1.0
	P2305	62	73.8	0.7	43.9	0.9
21	P2405	63	73.9	0.7	43.7	0.9
	P2402	64	75.7	0.7	43.2	0.9
	P2403	65	69.9	0.6	43.5	0.9
22	P2501	66	76.4	0.7	44.5	1.0
	P2502	67	71.5	0.7	45.2	1.0
23	P2604	68	75.6	0.7	43.2	0.9
	P2601	69	79.3	0.7	44.8	1.0
24	P3101	70	73.8	0.7	43.7	0.9
	P3102	71	72.8	0.7	43.7	0.9
25	P3201	72	71.7	0.7	43.3	0.9
	P3202	73	76.3	0.7	43.6	0.9
26	P3401	74	75.6	0.7	46.1	1.0
	P3402	75	76.4	0.7	46.5	1.0
27	Ptricho1	76	81.2	0.7	42.4	0.9
28	Pfila1	77	521.6	4.7	82.7	1.8
29	Pfungi1	78	27915.0	254.1	13552.2	290.4
	Pfungi2	79	17538.3	159.6	8943.8	191.6
	Pfungi3	80	29656.3	269.9	14534.7	311.4

[0155]

TABLE 17
Candida glabrata
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	82.9	0.8	43.2	1.0
	P0102	2	102.2	1.0	41.4	1.0
	P0103	3	111.7	1.1	42.7	1.0
	P0104	4	92.1	0.9	43.4	1.0
2	P0201	5	82.9	0.8	43.2	1.0
	P0202	6	102.2	1.0	41.4	1.0
	P0204	7	111.7	1.1	42.7	1.0
	P0205	8	92.1	0.9	43.4	1.0
3	P0302	9	15833.9	154.1	5529.2	127.3
	P0303	10	14015.9	136.4	4610.8	106.2
	P0304	11	10759.6	104.7	4087.5	94.1
	P0305	12	25439.3	247.5	8721.3	200.8
4	P0401	13	97.8	1.0	43.3	1.0
	P0402	14	82.5	0.8	41.9	1.0
	P0403	15	93.9	0.9	44.6	1.0
	P0404	16	111.5	1.1	44.7	1.0
5	P0503	17	89.0	0.9	41.6	1.0
	P0502	18	85.3	0.8	41.6	1.0
6	P0601	19	88.6	0.9	42.6	1.0
	P0602	20	94.0	0.9	42.6	1.0
	P0603	21	86.8	0.8	41.3	1.0
	P0604	22	88.8	0.9	42.7	1.0
7	P0701	23	89.7	0.9	43.1	1.0
	P0702	24	204.2	2.0	44.3	1.0
	P0703	25	82.5	0.8	41.8	1.0
	P0704	26	89.0	0.9	42.4	1.0
8	P0801	27	80.4	0.8	43.8	1.0
	P0803	28	93.8	0.9	42.7	1.0

[0156]

TABLE 18
Candida glabrata
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	86.3	0.8	42.2	1.0
	P0902	30	91.4	0.9	41.8	1.0
	P0903	31	100.7	1.0	42.0	1.0
10	P1102	32	92.3	0.9	45.3	1.0
	P1103	33	89.9	0.9	41.8	1.0
	P1104	34	78.3	0.8	41.9	1.0
11	P2701	35	85.0	0.8	43.8	1.0
	P2702	36	83.8	0.8	42.7	1.0
12	P2801	37	91.2	0.9	41.9	1.0
	P2802	38	87.3	0.8	41.7	1.0
13	P3301	39	97.6	0.9	42.0	1.0
	P3302	40	84.4	0.8	43.6	1.0
14	P2901	41	94.7	0.9	41.0	0.9
	P2902	42	88.3	0.9	41.0	0.9
	P2903	43	84.7	0.8	41.0	0.9
15	P3001	44	89.7	0.9	41.8	1.0
	P3002	45	83.9	0.8	40.5	0.9
	P3003	46	85.3	0.8	42.3	1.0
16	P1901	47	83.4	0.8	41.5	1.0
	P1902	48	84.9	0.8	42.1	1.0
	P1903	49	88.5	0.9	42.4	1.0
	P1904	50	87.8	0.9	44.8	1.0
17	P2001	51	94.4	0.9	44.9	1.0
	P2002	52	82.9	0.8	41.6	1.0
18	P2105	53	84.3	0.8	42.1	1.0
	P2102	54	84.7	0.8	41.8	1.0
	P2103	55	93.7	0.9	41.4	1.0
19	P2205	56	91.7	0.9	55.2	1.3
	P2202	57	77.9	0.8	42.1	1.0
	P2203	58	99.4	1.0	43.0	1.0
	P2204	59	85.3	0.8	41.6	1.0

[0157]

TABLE 19
Candida glabrata
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
20	P2302	60	85.7	0.8	41.4	1.0
	P2306	61	89.0	0.9	41.9	1.0
	P2305	62	80.9	0.8	41.8	1.0
21	P2405	63	79.7	0.8	42.4	1.0
	P2402	64	100.4	1.0	42.4	1.0
	P2403	65	87.0	0.8	42.1	1.0
22	P2501	66	85.9	0.8	42.3	1.0
	P2502	67	78.1	0.8	42.1	1.0
23	P2604	68	90.7	0.9	41.1	0.9
	P2601	69	88.3	0.9	41.7	1.0
24	P3101	70	80.9	0.8	42.4	1.0
	P3102	71	91.3	0.9	41.0	0.9
25	P3201	72	93.1	0.9	41.4	1.0
	P3202	73	96.4	0.9	42.8	1.0
26	P3401	74	89.0	0.9	44.6	1.0
	P3402	75	88.5	0.9	44.7	1.0
27	Ptricho1	76	99.5	1.0	42.1	1.0
28	Pfila1	77	952.4	9.3	107.6	2.5
29	Pfungi1	78	3649.8	35.5	1439.2	33.1
	Pfungi2	79	8597.1	83.6	3522.0	81.1
	Pfungi3	80	15934.8	155.0	5841.6	134.5

[0158]

TABLE 20
Candida guilliermondii
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	73.1	0.8	48.8	1.0
	P0102	2	71.9	0.8	46.9	1.0
	P0103	3	167.2	1.8	71.5	1.5
	P0104	4	75.6	0.8	47.4	1.0
2	P0201	5	73.1	0.8	48.8	1.0
	P0202	6	71.9	0.8	46.9	1.0
	P0204	7	167.2	1.8	71.5	1.5
	P0205	8	75.6	0.8	47.4	1.0
3	P0302	9	64.1	0.7	44.4	0.9
	P0303	10	81.6	0.9	45.1	0.9
	P0304	11	79.0	0.9	46.5	1.0
	P0305	12	95.2	1.0	52.7	1.1
4	P0401	13	13730.3	148.0	6877.6	142.0
	P0402	14	30043.5	323.8	18892.8	390.1
	P0403	15	41016.3	442.1	24412.7	504.1
	P0404	16	28662.9	308.9	26971.4	557.0
5	P0503	17	60.5	0.7	45.3	1.0
	P0502	18	76.3	0.8	46.4	0.9
6	P0601	19	65.2	0.7	47.2	1.0
	P0602	20	65.6	0.7	45.1	0.9
	P0603	21	63.3	0.7	45.5	0.9
	P0604	22	63.5	0.7	48.7	1.0
7	P0701	23	66.7	0.7	44.9	0.9
	P0702	24	84.6	0.9	49.8	1.0
	P0703	25	67.3	0.7	44.7	0.9
	P0704	26	63.9	0.7	44.9	0.9
8	P0801	27	75.8	0.8	47.1	1.0
	P0803	28	66.7	0.7	45.9	0.9

[0159]

TABLE 21
Candida guilliermondii
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	70.5	0.8	49.1	1.0
	P0902	30	60.3	0.6	45.0	0.9
	P0903	31	57.6	0.6	44.7	0.9
10	P1102	32	105.8	1.1	51.5	1.1
	P1103	33	72.6	0.8	55.5	1.1
	P1104	34	50.1	0.6	45.8	0.9
11	P2701	35	67.7	0.7	46.2	1.0
	P2702	36	60.4	0.7	45.2	0.9
12	P2801	37	66.1	0.7	47.4	1.0
	P2802	38	62.4	0.7	46.4	1.0
13	P3301	39	93.0	1.0	52.2	1.1
	P3302	40	59.8	0.6	46.7	1.0
14	P2901	41	79.3	0.9	44.8	0.9
	P2902	42	68.3	0.7	46.1	1.0
	P2903	43	67.1	0.7	45.3	0.9
15	P3001	44	65.8	0.7	45.7	0.9
	P3002	45	67.6	0.7	43.7	0.9
	P3003	46	62.7	0.7	44.3	0.9
16	P1901	47	69.9	0.8	45.2	0.9
	P1902	48	73.2	0.8	44.8	0.9
	P1903	49	71.2	0.8	45.7	0.9
	P1904	50	68.2	0.7	46.7	1.0
17	P2001	51	70.5	0.8	49.9	1.0
	P2002	52	69.4	0.7	46.8	1.0
18	P2105	53	69.8	0.8	45.9	0.9
	P2102	54	64.2	0.7	45.3	0.9
	P2103	55	66.7	0.7	43.9	0.9

[0160]

TABLE 22
Candida guilliermondii
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	68.2	0.7	59.5	1.2
	P2202	57	64.0	0.7	45.5	0.9
	P2203	58	67.2	0.7	46.3	1.0
	P2204	59	66.2	0.7	45.4	0.9
20	P2302	60	62.4	0.7	43.9	0.9
	P2306	61	67.0	0.7	46.0	0.9
	P2305	62	63.6	0.7	45.4	0.9
21	P2405	63	64.4	0.7	45.0	0.9
	P2402	64	65.6	0.7	44.6	0.9
	P2403	65	66.2	0.7	45.5	0.9
22	P2501	66	64.0	0.7	45.5	0.9
	P2502	67	70.8	0.8	45.1	0.9
23	P2604	68	68.9	0.7	42.7	0.9
	P2601	69	59.8	0.6	45.1	0.9
24	P3101	70	62.5	0.7	44.8	0.9
	P3102	71	62.9	0.7	45.6	0.9
25	P3201	72	77.7	0.8	45.5	0.9
	P3202	73	67.6	0.7	45.4	0.9
26	P3401	74	66.9	0.7	47.9	1.0
	P3402	75	65.1	0.7	48.4	1.0
27	Ptricho1	76	77.3	0.8	47.3	1.0
28	Pfila1	77	435.5	4.7	100.4	2.1
29	Pfungi1	78	32700.0	352.4	19752.5	407.9
	Pfungi2	79	19694.3	212.3	13434.9	277.4
	Pfungi3	80	31534.1	339.9	20458.9	422.5

[0161]

TABLE 23
Candida intermedia
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	68.9	0.8	46.6	1.0
	P0102	2	62.7	0.8	44.0	0.9
	P0103	3	68.5	0.8	46.0	1.0
	P0104	4	62.5	0.8	45.2	0.9
2	P0201	5	68.9	0.8	46.6	1.0
	P0202	6	62.7	0.8	44.0	0.9
	P0204	7	68.5	0.8	46.0	1.0
	P0205	8	62.5	0.8	45.2	0.9
3	P0302	9	61.0	0.7	44.3	0.9
	P0303	10	60.9	0.7	44.7	0.9
	P0304	11	64.8	0.8	45.1	0.9
	P0305	12	61.6	0.8	44.7	0.9
4	P0401	13	67.0	0.8	46.5	1.0
	P0402	14	60.5	0.7	45.2	0.9
	P0403	15	60.6	0.7	45.9	1.0
	P0404	16	62.8	0.8	48.9	1.0
5	P0503	17	51448.9	632.4	33343.8	595.8
	P0502	18	50283.5	618.0	28719.5	0.9
6	P0601	19	65.6	0.8	47.5	1.0
	P0602	20	58.4	0.7	44.3	0.9
	P0603	21	60.3	0.7	44.8	0.9
	P0604	22	57.4	0.7	44.9	0.9
7	P0701	23	67.5	0.8	45.7	0.9
	P0702	24	68.8	0.8	45.4	0.9
	P0703	25	59.6	0.7	45.1	0.9
	P0704	26	65.7	0.8	44.8	0.9
8	P0801	27	15715.7	193.2	9173.3	190.3
	P0803	28	79.7	1.0	49.6	1.0

[0162]

TABLE 24
Candida intermedia
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	63.6	20.8	46.7	1.0
	P0902	30	56.0	0.7	45.7	0.9
	P0903	31	57.5	0.7	46.3	1.0
10	P1102	32	60.4	0.7	51.3	1.1
	P1103	33	61.7	0.8	45.2	0.9
	P1104	34	55.7	0.7	45.6	0.9
11	P2701	35	61.1	0.8	44.3	0.9
	P2702	36	59.6	0.7	44.5	0.9
12	P2801	37	58.7	0.7	45.3	0.9
	P2802	38	61.5	0.8	45.8	0.9
13	P3301	39	174.3	2.1	68.6	1.4
	P3302	40	60.1	0.7	45.5	0.9
14	P2901	41	67.8	0.8	46.6	1.0
	P2902	42	60.1	0.7	43.9	0.9
	P2903	43	58.5	0.7	44.9	0.9
15	P3001	44	61.0	0.7	44.6	0.9
	P3002	45	62.5	0.8	45.1	0.9
	P3003	46	58.6	0.7	45.9	1.0
16	P1901	47	67.1	0.8	59.6	1.2
	P1902	48	59.4	0.7	44.7	0.9
	P1903	49	56.4	0.7	46.0	1.0
	P1904	50	60.2	0.7	47.4	1.0
17	P2001	51	62.1	0.8	50.3	1.0
	P2002	52	56.6	0.7	44.5	0.9
18	P2105	53	62.1	0.8	44.1	0.9
	P2102	54	61.4	0.8	44.7	0.9
	P2103	55	59.7	0.7	44.9	0.9

[0163]

TABLE 25
Candida intermedia
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
	P2103	55	59.7	0.7	44.9	0.9
19	P2205	56	67.1	0.8	59.6	1.2
	P2202	57	59.4	0.7	44.7	0.9
	P2203	58	56.4	0.7	46.0	1.0
	P2204	59	60.2	0.7	47.4	1.0
20	P2302	60	55.5	0.7	45.7	0.9
	P2306	61	60.8	0.7	44.3	0.9
	P2305	62	60.4	0.7	45.1	0.9
21	P2405	63	60.1	0.7	44.0	0.9
	P2402	64	60.7	0.7	43.6	0.9
	P2403	65	57.5	0.7	44.0	0.9
22	P2501	66	58.7	0.7	45.1	0.9
	P2502	67	57.7	0.7	45.1	0.9
23	P2604	68	62.0	0.8	43.5	0.9
	P2601	69	62.4	0.8	44.6	0.9
24	P3101	70	62.8	0.8	44.5	0.9
	P3102	71	61.3	0.8	44.8	0.9
25	P3201	72	61.4	0.8	43.6	0.9
	P3202	73	62.6	0.8	44.5	0.9
26	P3401	74	61.0	0.7	48.2	1.0
	P3402	75	61.1	0.8	48.5	1.0
27	Ptricho1	76	67.5	0.8	44.8	0.9
28	Pfila1	77	145.7	1.8	51.5	1.1
29	Pfungi1	78	42950.4	527.9	32385.8	671.8
	Pfungi2	79	37967.1	466.7	22023.4	456.9
	Pfungi3	80	26347.8	323.8	15280.4	317.0

[0164]

TABLE 26
Candida kefyr
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	66.0	0.8	42.7	0.9
	P0102	2	61.1	0.8	41.8	0.9
	P0103	3	65.5	0.8	44.0	1.0
	P0104	4	62.8	0.8	42.2	0.9
2	P0201	5	66.0	0.8	42.7	0.9
	P0202	6	61.1	0.8	41.8	0.9
	P0204	7	65.5	0.8	44.0	1.0
	P0205	8	62.8	0.8	42.2	0.9
3	P0302	9	61.3	0.8	43.0	0.9
	P0303	10	59.4	0.7	42.9	0.9
	P0304	11	59.5	0.7	43.2	0.9
	P0305	12	64.5	0.8	41.1	0.9
4	P0401	13	67.2	0.8	42.3	0.9
	P0402	14	60.8	0.8	43.2	0.9
	P0403	15	60.6	0.7	42.6	0.9
	P0404	16	62.6	0.8	45.2	1.0
5	P0503	17	56.6	0.7	40.7	0.9
	P0502	18	58.2	0.7	43.0	0.9
6	P0601	19	7074.0	87.3	2535.2	55.8
	P0602	20	12223.7	150.9	4219.5	92.9
	P0603	21	9000.8	111.1	2951.8	65.0
	P0604	22	31074.6	383.7	14120.9	310.8
7	P0701	23	61.1	0.8	45.8	1.0
	P0702	24	100.8	1.2	50.8	1.1
	P0703	25	60.0	0.7	41.7	0.9
	P0704	26	61.6	0.8	41.8	0.9
8	P0801	27	67.6	0.8	44.8	1.0
	P0803	28	59.0	0.7	43.5	1.0

[0165]

TABLE 27
Candida kefyr
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	62.7	0.8	44.6	1.0
	P0902	30	59.6	0.7	43.2	1.0
	P0903	31	61.9	0.8	42.8	0.9
10	P1102	32	60.3	0.7	45.9	1.0
	P1103	33	64.6	0.8	42.0	0.9
	P1104	34	58.0	0.7	41.5	0.9
11	P2701	35	63.3	0.8	41.1	0.9
	P2702	36	60.3	0.7	42.5	0.9
12	P2801	37	62.0	0.8	41.7	0.9
	P2802	38	58.4	0.7	42.1	0.9
13	P3301	39	85.3	1.1	47.6	1.0
	P3302	40	56.3	0.7	42.5	0.9
14	P2901	41	69.1	0.9	42.8	0.9
	P2902	42	58.9	0.7	41.9	0.9
	P2903	43	61.2	0.8	41.8	0.9
15	P3001	44	61.3	0.8	42.0	0.9
	P3002	45	61.5	0.8	43.1	0.9
	P3003	46	58.6	0.7	42.6	0.9
16	P1901	47	67.9	0.8	42.2	0.9
	P1902	48	58.9	0.7	42.8	0.9
	P1903	49	60.1	0.7	43.5	1.0
	P1904	50	59.0	0.7	43.6	1.0
17	P2001	51	61.0	0.8	44.0	1.0
	P2002	52	63.1	0.8	43.1	0.9
18	P2105	53	60.2	0.7	43.7	1.0
	P2102	54	61.9	0.8	42.4	0.9
	P2103	55	61.2	0.8	41.3	0.9

[0166]

TABLE 28
Candida kefyr
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	66.7	0.8	50.8	1.1
	P2202	57	60.8	0.8	41.7	0.9
	P2203	58	60.3	0.7	42.2	0.9
	P2204	59	60.6	0.7	42.7	0.9
20	P2302	60	59.3	0.7	40.4	0.9
	P2306	61	59.3	0.7	40.3	0.9
	P2305	62	63.0	0.8	42.6	0.9
21	P2405	63	59.3	0.7	42.3	0.9
	P2402	64	58.8	0.7	42.1	0.9
	P2403	65	59.5	0.7	42.7	0.9
22	P2501	66	63.4	0.8	41.7	0.9
	P2502	67	62.4	0.8	42.3	0.9
23	P2604	68	63.0	0.8	42.8	0.9
	P2601	69	64.3	0.8	41.0	0.9
24	P3101	70	62.3	0.8	44.2	1.0
	P3102	71	60.5	0.7	41.7	0.9
25	P3201	72	58.3	0.7	42.7	0.9
	P3202	73	58.8	0.7	42.2	0.9
26	P3401	74	62.3	0.8	44.0	1.0
	P3402	75	62.5	0.8	43.7	1.0
27	Ptricho1	76	62.6	0.8	42.8	0.9
28	Pfila1	77	213.8	2.6	62.7	1.4
29	Pfungi1	78	23970.6	296.0	10604.0	233.4
	Pfungi2	79	13462.3	166.2	6275.1	138.1
	Pfungi3	80	12130.3	149.8	6773.7	149.1

[0167]

TABLE 29
Candida krusei
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	133.4	0.8	44.4	0.9
	P0102	2	122.7	0.7	45.6	0.9
	P0103	3	103.2	0.6	47.6	1.0
	P0104	4	102.8	0.6	45.6	0.9
2	P0201	5	133.4	0.8	44.4	0.9
	P0202	6	122.7	0.7	45.6	0.9
	P0204	7	103.2	0.6	47.6	1.0
	P0205	8	102.8	0.6	45.6	0.9
3	P0302	9	104.5	0.6	43.8	0.9
	P0303	10	102.4	0.6	44.1	0.9
	P0304	11	107.3	0.6	44.2	0.9
	P0305	12	96.4	0.6	49.6	1.0
4	P0401	13	135.0	0.8	60.9	1.2
	P0402	14	97.4	0.6	44.3	0.9
	P0403	15	110.4	0.7	43.4	0.9
	P0404	16	102.8	0.6	49.6	1.0
5	P0503	17	110.8	0.7	44.8	0.9
	P0502	18	94.4	0.6	45.2	0.9
6	P0601	19	109.1	0.6	44.7	0.9
	P0602	20	102.9	0.6	44.3	0.9
	P0603	21	113.3	0.7	45.9	0.9
	P0604	22	108.8	0.6	51.0	1.0
7	P0701	23	16550.6	98.1	23242.4	55.8
	P0702	24	14238.0	84.4	15461.0	92.9
	P0703	25	14560.7	86.3	10592.3	65.0
	P0704	26	16313.7	96.7	9740.5	310.8
8	P0801	27	151.2	0.9	52.7	1.1
	P0803	28	123.3	0.7	46.2	0.9

[0168]

TABLE 30
Candida krusei
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	117.1	0.7	46.9	0.9
	P0902	30	110.1	0.7	45.9	0.9
	P0903	31	113.7	0.7	44.1	0.9
10	P1102	32	115.0	0.7	51.8	1.0
	P1103	33	114.2	0.7	42.6	0.9
	P1104	34	99.4	0.6	44.6	0.9
11	P2701	35	108.0	0.6	45.1	0.9
	P2702	36	106.7	0.6	44.7	0.9
12	P2801	37	98.5	0.6	44.3	0.9
	P2802	38	104.1	0.6	46.2	0.9
13	P3301	39	143.9	0.9	50.6	1.0
	P3302	40	91.4	0.5	46.0	0.9
14	P2901	41	139.8	0.8	44.2	0.9
	P2902	42	91.9	0.5	44.9	0.9
	P2903	43	92.5	0.5	45.1	0.9
15	P3001	44	85.5	0.5	45.2	0.9
	P3002	45	98.6	0.6	43.1	0.9
	P3003	46	101.6	0.6	46.4	0.9
16	P1901	47	119.2	0.7	45.7	0.9
	P1902	48	116.3	0.7	45.4	0.9
	P1903	49	104.6	0.6	45.5	0.9
	P1904	50	97.7	0.6	46.7	0.9
17	P2001	51	115.3	0.7	47.5	1.0
	P2002	52	122.8	0.7	45.2	0.9
18	P2105	53	116.8	0.7	45.9	0.9
	P2102	54	107.5	0.6	44.8	0.9
	P2103	55	104.8	0.6	44.6	0.9

[0169]

TABLE 31
Candida krusei
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	129.4	0.8	62.2	1.3
	P2202	57	116.6	0.7	44.0	0.9
	P2203	58	111.1	0.7	46.9	0.9
	P2204	59	98.8	0.6	43.6	0.9
20	P2302	60	115.1	0.7	42.6	0.9
	P2306	61	98.4	0.6	44.5	0.9
	P2305	62	91.8	0.5	43.9	0.9
21	P2405	63	110.9	0.7	45.1	0.9
	P2402	64	110.5	0.7	44.7	0.9
	P2403	65	94.2	0.6	45.4	0.9
22	P2501	66	134.3	0.8	43.4	0.9
	P2502	67	112.3	0.7	45.5	0.9
23	P2604	68	160.2	0.9	43.4	0.9
	P2601	69	117.2	0.7	44.3	0.9
24	P3101	70	96.1	0.6	43.7	0.9
	P3102	71	100.4	0.6	43.9	0.9
25	P3201	72	120.9	0.7	44.5	0.9
	P3202	73	104.7	0.6	45.3	0.9
26	P3401	74	123.2	0.7	48.0	1.0
	P3402	75	114.6	0.7	48.2	1.0
27	Ptricho1	76	119.0	0.7	43.5	0.9
28	Pfila1	77	217.5	1.3	96.3	1.9
29	Pfungi1	78	11741.5	69.6	16636.0	334.4
	Pfungi2	79	1007.7	6.0	1226.3	24.6
	Pfungi3	80	282.5	1.7	273.2	5.5

[0170]

TABLE 32
Candida lusitaniae
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
1	P0101	1	87.2	0.9	53.7	1.0
	P0102	2	86.6	0.9	49.3	0.9
	P0103	3	80.7	0.9	50.7	1.0
	P0104	4	86.6	0.9	50.3	1.0
2	P0201	5	87.2	0.9	53.7	1.0
	P0202	6	86.6	0.9	49.3	0.9
	P0204	7	80.7	0.9	50.7	1.0
	P0205	8	86.6	0.9	50.3	1.0
3	P0302	9	85.0	0.9	48.9	0.9
	P0303	10	80.0	0.9	50.0	1.0
	P0304	11	81.9	0.9	47.0	0.9
	P0305	12	74.1	0.8	48.0	0.9
4	P0401	13	81.9	0.9	47.2	0.9
	P0402	14	84.0	0.9	48.1	0.9
	P0403	15	80.1	0.9	49.7	1.0
	P0404	16	82.5	0.9	51.5	1.0
5	P0503	17	86.6	0.9	47.5	0.9
	P0502	18	84.2	0.9	48.6	3.3
6	P0601	19	76.3	0.8	47.9	0.9
	P0602	20	83.5	0.9	46.3	0.9
	P0603	21	78.9	0.9	46.7	0.9
	P0604	22	86.3	0.9	47.5	0.9
7	P0701	23	82.0	0.9	47.2	0.9
	P0702	24	105.6	1.1	49.7	1.0
	P0703	25	80.4	0.9	48.3	0.9
	P0704	26	77.6	0.8	51.3	1.0
8	P0801	27	44085.0	477.4	31133.3	598.1
	P0803	28	20873.6	226.1	4959.9	95.3

[0171]

TABLE 33
Candida lusitaniae
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
9	P0901	29	87.5	0.9	50.8	1.0
	P0902	30	86.5	0.9	47.4	0.9
	P0903	31	80.1	0.9	49.0	0.9
10	P1102	32	84.5	0.9	53.7	1.0
	P1103	33	89.0	1.0	45.5	0.9
	P1104	34	79.0	0.9	46.7	0.9
11	P2701	35	75.9	0.8	48.2	0.9
	P2702	36	74.7	0.8	48.4	0.9
12	P2801	37	81.2	0.9	49.1	0.9
	P2802	38	79.1	0.9	47.9	0.9
13	P3301	39	188.2	2.0	65.5	1.3
	P3302	40	78.3	0.8	47.7	0.9
14	P2901	41	80.7	0.9	48.2	0.9
	P2902	42	75.5	0.8	48.6	0.9
	P2903	43	78.8	0.9	48.3	0.9
15	P3001	44	84.4	0.9	48.7	0.9
	P3002	45	82.8	0.9	46.3	0.9
	P3003	46	75.6	0.8	48.9	0.9
16	P1901	47	77.6	0.8	47.3	0.9
	P1902	48	81.9	0.9	47.5	0.9
	P1903	49	78.9	0.9	47.8	0.9
	P1904	50	78.9	0.9	50.1	1.0
17	P2001	51	88.7	1.0	51.7	1.0
	P2002	52	85.1	0.9	48.0	0.9
18	P2105	53	82.4	0.9	47.4	0.9
	P2102	54	77.7	0.8	48.9	0.9
	P2103	55	85.1	0.9	47.6	0.9

[0172]

TABLE 34
Candida lusitaniae
	Probe	SEQ ID	1st	2nd
Group	Name	No:	Intensity	S/N	Intensity	S/N
19	P2205	56	79.9	0.9	62.7	1.2
	P2202	57	86.4	0.9	47.4	0.9
	P2203	58	74.8	0.8	51.2	1.0
	P2204	59	81.8	0.9	50.1	1.0
20	P2302	60	74.8	0.8	45.8	0.9
	P2306	61	75.9	0.8	48.0	0.9
	P2305	62	73.4	0.8	48.4	0.9
21	P2405	63	81.4	0.9	47.7	0.9
	P2402	64	75.8	0.8	47.7	0.9
	P2403	65	76.4	0.8	46.9	0.9
22	P2501	66	79.3	0.9	45.9	0.9
	P2502	67	76.6	0.8	48.3	0.9
23	P2604	68	85.3	0.9	47.1	0.9
	P2601	69	78.7	0.9	45.7	0.9
24	P3101	70	78.0	0.8	47.8	0.9
	P3102	71	75.4	0.8	52.2	1.0
25	P3201	72	81.2	0.9	46.4	0.9
	P3202	73	75.7	0.8	45.0	0.9
26	P3401	74	81.6	0.9	51.7	1.0
	P3402	75	80.3	0.9	51.4	1.0
27	Ptricho1	76	85.2	0.9	48.2	0.9
28	Pfila1	77	153.9	1.7	54.5	1.0
29	Pfungi1	78	45903.5	497.1	34330.3	659.6
	Pfungi2	79	31139.0	337.2	22431.9	431.0
	Pfungi3	80	39709.1	430.0	33279.2	639.4