Secretory protein or membrane protein

[0001] This application is a continuation of application Ser. No. 09/611,523, filed Jul. 7, 2000 now abandoned.

[0002] The present invention relates to a polynucleotide encoding a novel protein, a protein encoded by the polynucleotide, and novel usages of these.

[0003] Currently, sequencing projects, the determination and analysis of the genomic DNA of various living organisms are in progress all over the world. The whole genomic sequences of more than 10 species of prokaryotes, a lower eukaryote, yeast, and a multicellular eukaryote, C. elegans have been already determined. As to the human genome, which is supposed to be composed of three thousand million base pairs, world wide cooperative projects are under way to analyze it, and the whole structure is predicted to be determined by the years 2002-2003. The aim of the determination of genomic sequence is to reveal the functions of all genes and their regulation and to understand living organisms as a network of interactions between genes, proteins, cells or individuals through deducing the information in a genome, which is viewed as a blueprint of the highly complicated living organisms. To understand living organisms by utilizing the genomic information from various species is not only important as an academic subject, but also socially significant from the viewpoint of industrial application.

[0004] However, determination of genomic sequences itself cannot identify the functions of all genes. For example, for yeast, the function of only approximately half of the 6000 genes, which is predicted based on the genomic sequence, has been deduced. As for humans, the number of genes is predicted to be approximately one hundred thousand. Therefore, it is desirable to establish “a high throughput analysis system of gene functions” which allows us to identify rapidly and efficiently the functions of vast amounts of the genes obtained by the genomic sequencing.

[0005] Many genes in the eukaryotic genome are split by introns into multiple exons. Thus, it is difficult to predict correctly the structure of encoded proteins solely based on genomic information. In contrast, cDNA, which is produced from mRNA that lacks introns, encodes a protein as a single continuous amino acid sequence and allows us to identify the primary structure of the protein easily. In human cDNA research, to date, more than one million ESTs (Expression Sequence Tags) are available from public domains (public databases), and the ESTs presumably cover not less than 80% of all human genes.

[0006] The information of ESTs is utilized for analyzing the structure of human genome, or for predicting the exon-regions of genomic sequences or their expression profile. However, many human ESTs have been derived from proximal regions to the 3′-end of cDNA, and information around the 5′-end of mRNA is extremely little. Among these human cDNAs, the number of the corresponding mRNAs whose encoding protein sequences are deduced is approximately 7000, and further, the number of full-length clones is only 5500. Thus, even including cDNA registered as EST, the percentage of human cDNA obtained so far is estimated to be 10–15% of all the genes.

[0007] It is possible to identify the transcription start site of mRNA on the genomic sequence based on the 5′-end sequence of a full-length cDNA, and to analyze factors involved in the stability of mRNA that is contained in the cDNA, or in its regulation of expression at the translation stage. Also, since a full-length cDNA contains ATG, the translation start site, in the 5′-region, it can be translated into a protein in a correct frame. Therefore, it is possible to produce a large amount of the protein encoded by the cDNA or to analyze biological activity of the expressed protein by utilizing an appropriate expression system. Thus, analysis of a full-length cDNA provides valuable information that complements the information from genome sequencing. Also, full-length cDNA clones that can be expressed are extremely valuable in empirical analysis of gene function and in industrial application.

[0008] In particular, human secretory proteins or membrane proteins would be useful by itself as a medicine like tissue plasminogen activator (TPA), or as a target of medicines like membrane receptors.

[0009] Therefore, it has great significance to isolate novel full-length cDNA clones of humans, of which only a few have been isolated. Especially, isolation of a novel cDNA clone encoding a secretory protein or membrane protein is desired since the protein itself, or a molecule that interacts with the membrane protein would be useful as a medicine, and also the clones potentially include a gene associated with diseases. Thus, identification of the full-length cDNA clones encoding those proteins has great significance.

[0010] An objective of the present invention is to provide a polynucleotide encoding a novel protein, a protein encoded by said polynucleotide, and novel usages of these.

[0011] The inventors have developed a method for efficiently cloning a human full-length cDNA that is predicted by the ATGpr etc. to be a full-length cDNA clone, from a full-length-enriched cDNA library that is synthesized by the oligo-capping method [K. Maruyama and S. Sugano, Gene, 138: 171–174 (1994); Y. Suzuki et al., Gene, 200: 149–156 (1997)]. Then, the inventors determined the nucleotide sequence of the obtained cDNA clones from both 5′- and 3′-ends. By utilizing the sequences, the inventors selected clones that were expected to contain a signal by the PSORT (Nakai K. and Kanehisa M. (1992) Genomics 14: 897–911), and obtained clones that contain a cDNA encoding a secretory protein or membrane protein. The inventors found that it is possible to synthesize a novel full-length cDNA by using the combination of a primer that is designed based on the nucleotide sequence of the 5′-ends of the selected full-length cDNA clones and any of an oligo-dT primer or a 3′-primer that is designed based on the nucleotide sequence of the 3′-ends of the selected clones.

[0012] The full-length cDNA clones of the present invention have high fullness ratio since these were obtained by the combination of (1) construction of a full-length-enriched cDNA library that is synthesized by the oligo-capping method, and (2) a system in which fullness ratio is evaluated from the nucleotide sequence of the 5′-end.

[0013] Furthermore, the inventors have analyzed the nucleotide sequence of the full-length cDNA clones obtained by the method, and deduced the amino acid sequence encoded by the nucleotide sequence. Then, the inventors have performed the BLAST search (Altschul S. F. Gish W., Miller W., Myers E. W., and Lipman D. J. (1990) J. Mol. Biol. 215: 403–410; Gish W., and Stares D. J. (1993) Nature Genet. 3: 266–272; of the GenBank and SwissProt using the deduced amino acid sequence to accomplish the present invention.

[0014] Homology analysis in which the analysis is carried out against a non-full-length cDNA fragment to postulate the function of a protein encoded by said fragment, is being commonly performed. However, since such analysis is based on the information of the fragment, it is not clear as to whether this fragment corresponds to a part that is functionally important in the protein. In other words, the reliability of the homology analysis based on the information of a fragment is doubtful, as information relating to the structure of the whole protein is not available. However, the homology analysis of the present invention is conducted based on the information of a full-length cDNA comprising the whole coding region of the cDNA, and therefore, the homology of various portions of the protein can be analyzed. Hence, the reliability of the homology analysis has been dramatically improved in the present invention.

[0015] The present invention relates to the polynucleotide mentioned below, a protein encoded by the polynucleotide, and their usage.

[0016] First, the present invention relates to

[0017] (1) an isolated polynucleotide selected from the group consisting of

(a) a polynucleotide comprising a coding region of the nucleotide sequence set forth in any one of the SEQ ID NOs in Table 1;

(b) a polynucleotide comprising a nucleotide sequence encoding a protein comprising the amino acid sequence set forth in any one of the SEQ ID NOs in Table 1;

[0018] (c) a polynucleotide comprising a nucleotide sequence encoding a protein comprising an amino acid sequence selected from the amino acid sequences set forth in the SEQ ID NOs in Table 1, in which one or more amino acids are substituted, deleted, inserted, and/or added, wherein said protein is functionally equivalent to the protein comprising said amino acid sequence selected from the amino acid sequences set forth in the SEQ ID NOs in Table 1;
(d) a polynucleotide that hybridizes with a polynucleotide comprising a nucleotide sequence selected from the nucleotide sequences set forth in the SEQ ID NOs in Table 1, and that comprises a nucleotide sequence encoding a protein functionally equivalent to the protein encoded by the nucleotide sequence selected from the nucleotide sequences set forth in the SEQ ID NOs in Table 1;
(e) a polynucleotide comprising a nucleotide sequence encoding a partial amino acid sequence of a protein encoded by the polynucleotide of (a) to (d);
(f) a polynucleotide comprising a nucleotide sequence with at least 70% identity to the nucleotide sequence set forth in any one of the SEQ ID NOs in Table 1.

[0019] Table 1 shows the name of the cDNA clones isolated in the examples described later, comprising the full-length cDNA of the present invention, the corresponding SEQ ID NOs. of the nucleotide sequences of the cDNA clones, and the corresponding SEQ ID NOs. of the amino acid sequences deduced from the cDNA nucleotide sequences.

[0020]

	TABLE 1
	Amino acid	Nucleotide	Clone
	sequence	sequence	Name
	SEQ ID NO: 2	SEQ ID NO: 1	PSEC0001
	SEQ ID NO: 4	SEQ ID NO: 3	nnnnnnnn
	SEQ ID NO: 6	SEQ ID NO: 5	PSEC0005
	SEQ ID NO: 8	SEQ ID NO: 7	PSEC0007
	SEQ ID NO: 10	SEQ ID NO: 9	PSEC0008
	SEQ ID NO: 12	SEQ ID NO: 11	PSEC0012
	SEQ ID NO: 14	SEQ ID NO: 13	PSEC0017
	SEQ ID NO: 16	SEQ ID NO: 15	PSEC0019
	SEQ ID NO: 18	SEQ ID NO: 17	PSEC0020
	SEQ ID NO: 20	SEQ ID NO: 19	PSEC0021
	SEQ ID NO: 22	SEQ ID NO: 21	PSEC0028
	SEQ ID NO: 24	SEQ ID NO: 23	PSEC0029
	SEQ ID NO: 26	SEQ ID NO: 25	PSEC0030
	SEQ ID NO: 28	SEQ ID NO: 27	PSEC0031
	SEQ ID NO: 30	SEQ ID NO: 29	PSEC0035
	SEQ ID NO: 32	SEQ ID NO: 31	PSEC0038
	SEQ ID NO: 34	SEQ ID NO: 33	PSEC0040
	SEQ ID NO: 36	SEQ ID NO: 35	PSEC0041
	SEQ ID NO: 38	SEQ ID NO: 37	PSEC0045
	SEQ ID NO: 40	SEQ ID NO: 39	PSEC0048
	SEQ ID NO: 42	SEQ ID NO: 41	PSEC0049
	SEQ ID NO: 44	SEQ ID NO: 43	PSEC0051
	SEQ ID NO: 46	SEQ ID NO: 45	PSEC0052
	SEQ ID NO: 48	SEQ ID NO: 47	PSEC0053
	SEQ ID NO: 50	SEQ ID NO: 49	PSEC0055
	SEQ ID NO: 52	SEQ ID NO: 51	PSEC0059
	SEQ ID NO: 54	SEQ ID NO: 53	PSEC0061
	SEQ ID NO: 56	SEQ ID NO: 55	PSEC0068
	SEQ ID NO: 58	SEQ ID NO: 57	PSEC0070
	SEQ ID NO: 60	SEQ ID NO: 59	PSEC0071
	SEQ ID NO: 62	SEQ ID NO: 61	PSEC0072
	SEQ ID NO: 64	SEQ ID NO: 63	PSEC0073
	SEQ ID NO: 66	SEQ ID NO: 65	PSEC0074
	SEQ ID NO: 68	SEQ ID NO: 67	PSEC0075
	SEQ ID NO: 70	SEQ ID NO: 69	PSEC0076
	SEQ ID NO: 72	SEQ ID NO: 71	PSEC0077
	SEQ ID NO: 74	SEQ ID NO: 73	PSEC0079
	SEQ ID NO: 76	SEQ ID NO: 75	PSEC0080
	SEQ ID NO: 78	SEQ ID NO: 77	PSEC0081
	SEQ ID NO: 80	SEQ ID NO: 79	PSEC0082
	SEQ ID NO: 82	SEQ ID NO: 81	PSEC0085
	SEQ ID NO: 84	SEQ ID NO: 83	PSEC0086
	SEQ ID NO: 86	SEQ ID NO: 85	PSEC0087
	SEQ ID NO: 88	SEQ ID NO: 87	PSEC0088
	SEQ ID NO: 90	SEQ ID NO: 89	PSEC0090
	SEQ ID NO: 92	SEQ ID NO: 91	PSEC0094
	SEQ ID NO: 94	SEQ ID NO: 93	PSEC0095
	SEQ ID NO: 96	SEQ ID NO: 95	PSEC0098
	SEQ ID NO: 98	SEQ ID NO: 97	PSEC0099
	SEQ ID NO: 100	SEQ ID NO: 99	PSEC0100
	SEQ ID NO: 102	SEQ ID NO: 101	PSEC0101
	SEQ ID NO: 104	SEQ ID NO: 103	PSEC0104
	SEQ ID NO: 106	SEQ ID NO: 105	PSEC0105
	SEQ ID NO: 108	SEQ ID NO: 107	PSEC0106
	SEQ ID NO: 110	SEQ ID NO: 109	PSEC0107
	SEQ ID NO: 112	SEQ ID NO: 111	PSEC0108
	SEQ ID NO: 114	SEQ ID NO: 113	PSEC0109
	SEQ ID NO: 116	SEQ ID NO: 115	PSEC0110
	SEQ ID NO: 118	SEQ ID NO: 117	PSEC0111
	SEQ ID NO: 120	SEQ ID NO: 119	PSEC0112
	SEQ ID NO: 122	SEQ ID NO: 121	PSEC0113
	SEQ ID NO: 124	SEQ ID NO: 123	PSEC0119
	SEQ ID NO: 126	SEQ ID NO: 125	PSEC0120
	SEQ ID NO: 128	SEQ ID NO: 127	PSEC0121
	SEQ ID NO: 130	SEQ ID NO: 129	PSEC0124
	SEQ ID NO: 132	SEQ ID NO: 131	PSEC0125
	SEQ ID NO: 134	SEQ ID NO: 133	PSEC0126
	SEQ ID NO: 136	SEQ ID NO: 135	PSEC0127
	SEQ ID NO: 138	SEQ ID NO: 137	PSEC0128
	SEQ ID NO: 140	SEQ ID NO: 139	PSEC0129
	SEQ ID NO: 142	SEQ ID NO: 141	PSEC0130
	SEQ ID NO: 144	SEQ ID NO: 143	PSEC0131
	SEQ ID NO: 146	SEQ ID NO: 145	PSEC0133
	SEQ ID NO: 148	SEQ ID NO: 147	PSEC0134
	SEQ ID NO: 150	SEQ ID NO: 149	PSEC0135
	SEQ ID NO: 152	SEQ ID NO: 151	PSEC0136
	SEQ ID NO: 154	SEQ ID NO: 153	PSEC0137
	SEQ ID NO: 156	SEQ ID NO: 155	PSEC0139
	SEQ ID NO: 158	SEQ ID NO: 157	PSEC0143
	SEQ ID NO: 160	SEQ ID NO: 159	PSEC0144
	SEQ ID NO: 162	SEQ ID NO: 161	nnnnnnnn
	SEQ ID NO: 164	SEQ ID NO: 163	PSEC0147
	SEQ ID NO: 166	SEQ ID NO: 165	PSEC0149
	SEQ ID NO: 168	SEQ ID NO: 167	PSEC0150
	SEQ ID NO: 170	SEQ ID NO: 169	PSEC0151
	SEQ ID NO: 172	SEQ ID NO: 171	PSEC0152
	SEQ ID NO: 174	SEQ ID NO: 173	PSEC0158
	SEQ ID NO: 176	SEQ ID NO: 175	PSEC0159
	SEQ ID NO: 178	SEQ ID NO: 177	PSEC0161
	SEQ ID NO: 180	SEQ ID NO: 179	PSEC0162
	SEQ ID NO: 182	SEQ ID NO: 181	PSEC0163
	SEQ ID NO: 184	SEQ ID NO: 183	PSEC0164
	SEQ ID NO: 186	SEQ ID NO: 185	PSEC0165
	SEQ ID NO: 188	SEQ ID NO: 187	PSEC0167
	SEQ ID NO: 190	SEQ ID NO: 189	PSEC0168
	SEQ ID NO: 192	SEQ ID NO: 191	PSEC0169
	SEQ ID NO: 194	SEQ ID NO: 193	PSEC0170
	SEQ ID NO: 196	SEQ ID NO: 195	PSEC0171
	SEQ ID NO: 198	SEQ ID NO: 197	PSEC0172
	SEQ ID NO: 200	SEQ ID NO: 199	PSEC0173
	SEQ ID NO: 202	SEQ ID NO: 201	PSEC0178
	SEQ ID NO: 204	SEQ ID NO: 203	PSEC0181
	SEQ ID NO: 206	SEQ ID NO: 205	PSEC0182
	SEQ ID NO: 208	SEQ ID NO: 207	PSEC0183
	SEQ ID NO: 210	SEQ ID NO: 209	PSEC0190
	SEQ ID NO: 212	SEQ ID NO: 211	PSEC0191
	SEQ ID NO: 214	SEQ ID NO: 213	PSEC0192
	SEQ ID NO: 216	SEQ ID NO: 215	PSEC0197
	SEQ ID NO: 218	SEQ ID NO: 217	PSEC0198
	SEQ ID NO: 220	SEQ ID NO: 219	PSEC0199
	SEQ ID NO: 222	SEQ ID NO: 221	PSEC0200
	SEQ ID NO: 224	SEQ ID NO: 223	PSEC0203
	SEQ ID NO: 226	SEQ ID NO: 225	PSEC0204
	SEQ ID NO: 228	SEQ ID NO: 227	PSEC0205
	SEQ ID NO: 230	SEQ ID NO: 229	PSEC0207
	SEQ ID NO: 232	SEQ ID NO: 231	PSEC0209
	SEQ ID NO: 234	SEQ ID NO: 233	PSEC0210
	SEQ ID NO: 236	SEQ ID NO: 235	PSEC0213
	SEQ ID NO: 238	SEQ ID NO: 237	PSEC0214
	SEQ ID NO: 240	SEQ ID NO: 239	PSEC0215
	SEQ ID NO: 242	SEQ ID NO: 241	PSEC0216
	SEQ ID NO: 244	SEQ ID NO: 243	PSEC0218
	SEQ ID NO: 246	SEQ ID NO: 245	PSEC0220
	SEQ ID NO: 248	SEQ ID NO: 247	PSEC0222
	SEQ ID NO: 250	SEQ ID NO: 249	PSEC0223
	SEQ ID NO: 252	SEQ ID NO: 251	PSEC0224
	SEQ ID NO: 254	SEQ ID NO: 253	PSEC0226
	SEQ ID NO: 256	SEQ ID NO: 255	PSEC0227
	SEQ ID NO: 258	SEQ ID NO: 257	PSEC0228
	SEQ ID NO: 260	SEQ ID NO: 259	PSEC0230
	SEQ ID NO: 262	SEQ ID NO: 261	PSEC0232
	SEQ ID NO: 264	SEQ ID NO: 263	PSEC0233
	SEQ ID NO: 266	SEQ ID NO: 265	PSEC0235
	SEQ ID NO: 268	SEQ ID NO: 267	PSEC0236
	SEQ ID NO: 270	SEQ ID NO: 269	PSEC0240
	SEQ ID NO: 272	SEQ ID NO: 271	PSEC0241
	SEQ ID NO: 274	SEQ ID NO: 273	PSEC0243
	SEQ ID NO: 276	SEQ ID NO: 275	PSEC0244
	SEQ ID NO: 278	SEQ ID NO: 277	PSEC0245
	SEQ ID NO: 280	SEQ ID NO: 279	PSEC0246
	SEQ ID NO: 282	SEQ ID NO: 281	PSEC0247
	SEQ ID NO: 284	SEQ ID NO: 283	PSEC0248
	SEQ ID NO: 286	SEQ ID NO: 285	PSEC0249
	SEQ ID NO: 288	SEQ ID NO: 287	PSEC0250
	SEQ ID NO: 290	SEQ ID NO: 289	PSEC0252
	SEQ ID NO: 292	SEQ ID NO: 291	PSEC0253
	SEQ ID NO: 294	SEQ ID NO: 293	PSEC0255
	SEQ ID NO: 296	SEQ ID NO: 295	PSEC0258
	SEQ ID NO: 298	SEQ ID NO: 297	PSEC0259
	SEQ ID NO: 300	SEQ ID NO: 299	PSEC0260
	SEQ ID NO: 302	SEQ ID NO: 301	PSEC0261
	SEQ ID NO: 304	SEQ ID NO: 303	PSEC0263
	SEQ ID NO: 306	SEQ ID NO: 305	PSEC0027
	SEQ ID NO: 308	SEQ ID NO: 307	PSEC0047
	SEQ ID NO: 310	SEQ ID NO: 309	PSEC0066
	SEQ ID NO: 312	SEQ ID NO: 311	nnnnnnnn
	SEQ ID NO: 314	SEQ ID NO: 313	PSEC0069
	SEQ ID NO: 316	SEQ ID NO: 315	PSEC0092
	SEQ ID NO: 318	SEQ ID NO: 317	PSEC0103
	SEQ ID NO: 320	SEQ ID NO: 319	PSEC0117
	SEQ ID NO: 322	SEQ ID NO: 321	PSEC0142
	SEQ ID NO: 324	SEQ ID NO: 323	PSEC0212
	SEQ ID NO: 326	SEQ ID NO: 325	PSEC0239
	SEQ ID NO: 328	SEQ ID NO: 327	PSEC0242
	SEQ ID NO: 330	SEQ ID NO: 329	PSEC0251
	SEQ ID NO: 332	SEQ ID NO: 331	PSEC0256
	SEQ ID NO: 334	SEQ ID NO: 333	PSEC0195
	SEQ ID NO: 336	SEQ ID NO: 335	PSEC0206
	SEQ ID NO: 342	SEQ ID NO: 341	PSEC0078
	SEQ ID NO: 344	SEQ ID NO: 343	PSEC0084
	SEQ ID NO: 346	SEQ ID NO: 345	PSEC0237
	SEQ ID NO: 348	SEQ ID NO: 347	PSEC0264
	SEQ ID NO: 350	SEQ ID NO: 349	PSEC0265

[0021] Furthermore, the present invention relates to the above polynucleotide, a protein encoded by the polynucleotide, and the use of them as described below.

[0022] (2) A substantially pure protein encoded by the polynucleotide of (1).

[0023] (3) Use of an oligonucleotide as a primer for synthesizing the polynucleotide comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 370–540 or the complementary strand thereof, wherein said oligonucleotide is complementary to said polynucleotide or the complementary strand thereof and comprises at least 15 nucleotides.

[0024] (4) A primer set for synthesizing polynucleotides, the primer set comprising an oligo-dT primer and an oligonucleotide complementary to the complementary strand of the polynucleotide comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 370–540, wherein said oligonucleotide comprises at least 15 nucleotides.

[0025] (5) A primer set for synthesizing polynucleotides, the primer set comprising a combination of an oligonucleotide comprising a nucleotide sequence complementary to the complementary strand of the polynucleotide comprising a 5′-end nucleotide sequence and an oligonucleotide comprising a nucleotide sequence complementary to the polynucleotide comprising a 3′-end nucleotide sequence, wherein said oligonucleotides comprise at least 15 nucleotides and wherein said combination of 5′-end nucleotide sequence/3′-end nucleotide sequence is selected from the combinations of 5′-end nucleotide sequence/3′-end nucleotide sequence set forth in the SEQ ID NOs in Table 342.

[0026] (6) A polynucleotide that can be synthesized with the primer set of (4) or (5).

[0027] (7) A polynucleotide comprising a coding region in the polynucleotide of (6).

[0028] (8) A protein encoded by polynucleotide of (7).

[0029] (9) A partial peptide of the protein of (8).

[0030] (10) An antibody against the protein or peptide of any one of (2), (8), and (9).

[0031] (11) A vector comprising the polynucleotide of (1) or (7).

[0032] (12) A transformant carrying the polynucleotide of (1) or (7), or the vector of (11).

[0033] (13) A transformant expressively carrying the polynucleotide of (1) or (7), or the vector of (11).

[0034] (14) A method for producing the protein or peptide of any one of (2), (8), and (9), comprising culturing the transformant of (13) and recovering the expression product.

[0035] (15) An oligonucleotide comprising the nucleotide sequence set forth in any one of the SEQ ID NOs in Table 1 or the nucleotide sequence complementary to the complementary strand thereof, wherein said oligonucleotide comprises 15 nucleotides or more.

[0036] (16) Use of the oligonucleotide of (15) as a primer for synthesizing a polynucleotide.

[0037] (17) Use of the oligonucleotide of (15) as a probe for detecting a gene.

[0038] (18) An antisense polynucleotide against the polynucleotide of (1), or the portion thereof.

[0039] (19) A method for synthesizing a polynucleotide, the method comprising:

a) synthesizing a complementary strand using a cDNA library as a template, and using the primer set of (4) or (5), or the primer of (16); and

b) recovering the synthesized product.

[0040] (20) The method of (19), wherein the cDNA library is obtainable by oligo-capping method.

[0041] (21) The method of (19), wherein the complementary strand is obtainable by PCR.

[0042] (22) A method for detecting the polynucleotide of (1), the method comprising:

a) incubating a target polynucleotide with the oligonucleotide of (15) under the conditions where hybridization occurs, and

b) detecting the hybridization of the target polynucleotide with the oligonucleotide of (15).

[0043] (23) A database of polynucleotides and/or proteins, the database comprising information on at least one sequence selected from the nucleotide sequences set forth in the SEQ ID NOs in Table 1 and/or the amino acid sequences set forth in the SEQ ID NOs in Table 1, or a medium on which the database is stored.

[0044] Table 342 shows a SEQ IDs of the nucleotide sequences defining 5′- and 3′-ends in the full-length cDNA of the present invention (173 clones), and the corresponding plasmid clones obtained in the examples described later, which contain the polynucleotides as an insert. Blank shows that the sequence of the 3′-end corresponding to the 5′-end has not been determined within the same clone. The SEQ ID of the 5′-sequence are shown on the right side of the name of the 5′-sequence, and the SEQ ID of the 3′-sequence are shown on the right side of the name of the 3′-sequence.

[0045] Any patents, patent applications, and publications cited herein are incorporated by reference.

[0054] Herein, “polynucleotide” is defined as a molecule in which multiple nucleotides are polymerized such as DNA or RNA. There are no limitations in the number of the polymerized nucleotides. In case that the polymer contains relatively low number of nucleotides, it is also described as an “oligonucleotide”. The polynucleotide or the oligonucleotide of the present invention can be a natural or chemically synthesized product. Alternatively, it can be synthesized using a template DNA by an enzymatic reaction such as PCR.

[0055] All the cDNA provided by the invention are full-length cDNA. Herein, a “full-length cDNA” is defined as a cDNA that contains both ATG codon (the translation start site) and the stop codon. Accordingly, the untranslated regions, which are originally found in the upstream or downstream of the protein coding region in natural mRNA, may or may not be contained.

[0056] An “isolated polynucleotide” is a polynucleotide the structure of which is not identical to that of any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid spanning more than three separate genes. The term therefore covers, for example,

[0057] (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs;

[0058] (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA;

[0059] (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and

[0060] (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of different (i) DNA molecules, (ii) transfected cells, or (iii) cell clones: e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.

[0061] The term “substantially pure” as used herein in reference to a given polypeptide means that the protein or polypeptide is substantially free from other biological macromolecules. The substantially pure protein or polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0062] The present invention provides substantially pure human secretory protein or membrane protein comprising the amino acid sequence as shown in any SEQ ID NO: 2–336 and SEQ ID NO: 342–350; the ID number is also in Table 1. The 156 proteins out of 173 proteins of the present invention are encoded by the cDNA clones, shown in List 1. These clones were “the clones isolated from the full-length-enriched human cDNA libraries constructed by the oligo-capping method, using the programs such as ATGpr, and predicted by the PSORT to be a secretory protein or membrane protein which has a signal sequence in the N-terminus”.

[0063] The list shown below indicates, in order, the following information separating each of these with a double-slash mark, //.

[0064] clone name (PSEC number),

[0065] length of cDNA,

[0066] length of amino acid sequence,

[0067] ATG No. from the 5′ end,

[0068] ATGpr1 value,

[0069] definition of annotation data,

[0070] Accession No. of annotation data,

[0071] P value,

[0072] length of compared sequence,

[0073] homology

[0074] The annotation data are not shown for clones that did not exhibit explicit homology as a result of BLAST analysis of GenBank and SwissProt. The ATG No. from the 5′ end means the position of ATG of the translation frame of the compared sequence counted from the 5′ end. In other words, for example, when comparing with the translation frame from the first ATG, it is shown as “1^st”, and when comparing with the transiation frame beginning with the second ATG, it is shown as the “2^nd”. The P value indicates similarity between two sequences as a score by considering the probability that the two sequences are accidentally similar. In general, as the value is lower, the similarity is higher. In general, as the value is lower, the homology is higher.

[0075] (Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990) “Basic local alignment search tool.” J. Mol. Biol. 215:403–410; Gish, W. & States, D. J. (1993) “Identification of protein coding regions by database similarity search.” Nature Genet. 3:266–272)

[0076] List 1

[0077] PSEC0001//1992bp//226aa//1st//0.94//GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP (KIAA0108).//Q15012//3.90E-53//221aa//46%

[0078] nnnnnnnn//1883bp//326aa//1st//0.94//Homo sapiens death effector domain-containing testicular molecule mRNA, complete cds.//AF043733//3.10E-37//852bp//62%

[0079] PSEC0005//1366bp//220aa//1st//0.94//Homo sapiens CLDN6 gene for claudin-6.//AJ249735//5.00E-285//1295bp//99%

[0080] PSEC0007//3425bp//570aa//1st//0.94//Homo sapiens FK506-binding protein (FKBP63) mRNA, partial cds.//AF089745//0//1580bp//99%

[0081] PSEC0008//978bp//215aa//1st//0.94//HYPOTHETICAL 72.5 KD PROTEIN C2F7. 10 IN CHROMOSOME I.//Q09701//1.60E-13//119aa//36%

[0082] PSEC0012//1499bp//183aa//1st//0.82

[0083] PSEC0017//3125bp//273aa//1st//0.33//Mus musculus membrane protein TMS-2 mRNA, complete cds.//AF181685//3.00E-303//1949bp//82%

[0084] PSEC0009//1927bp//339aa//1st//0.9//Homo sapiens NPD003 mRNA, complete cds.//AF078855//0//1904bp//99%

[0085] PSEC0020//1483bp//393aa//1st//0.69

[0086] PSEC0021//1851bp//116aa//3rd//0.82

[0087] PSEC0028//2395bp//348aa//2nd//0. 56//VESICULAR INTEGRAL-MEMBRANE PROTEIN VIP36 PRECURSOR (VIP36).//P49256//9. 30E-100//355aa//54%

[0088] PSEC0029//1683bp//300aa//1st//0.9//OXIDOREDUCTASE UCPA (EC 1.-.-.-).//P37440//1.00E-21//217aa//32%

[0089] PSEC0030//1584bp//406aa//1st//0.26

[0090] PSEC0031//1336bp//136aa//2nd//0.2

[0091] PSEC0035//1729bp//406aa//1st//0.93//NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR(NOEL) (1B426B).//Q62609//6.30E-33//373aa//28%

[0092] PSEC0038//1883bp//223aa//1st//0.9//TRIOSE PHOSPHATE/PHOSPHATE TRANSLOCATOR, NON-GREEN PLASTID PRECURSOR (CTPT).//P52178//6.60E-13//157aa//33%

[0093] PSEC0040//2027bp//216aa//2nd//0.82

[0094] PSEC0041//2518bp//240aa//2nd//0.51

[0095] PSEC0045//1631bp//372aa//1st//0.85

[0096] PSEC0048//3707bp//383aa//2nd//0.71//Homo sapiens serine protease mRNA, complete cds.//AF015287//0//1638bp//99%

[0097] PSEC0049//2652bp//131aa//1st//0.35//Homo sapiens brain my047 protein mRNA, complete cds.//AF063605//0//2651bp//99%

[0098] PSEC0051//3293bp//227aa//3rd//0.63

[0099] PSEC0052//3635bp//578aa//2nd//0.94//AQUALYSIN I PRECURSOR (EC 3. 4. 21. -).//P08594//1.60E-46//348aa//36%

[0100] PSEC0053//2366bp//285aa//1st//0.94//COLLAGEN ALPHA 1(XII) CHAIN PRECURSOR (FIBROCHIMERIN).//P13944//1.50E-37//227aa//31%

[0101] PSEC0055//2147bp//331aa//2nd//0.92//UDP N-ACETYLGLUCOSAMINE TRANSPORTER (GOLGI UDP-GLCNAC TRANSPORTER).//Q00974//4.80E-42//314aa//31%

[0102] PSEC0059//2863bp//230aa//3rd//0.72//Mus musculus claudin-2 mRNA, complete cds.//AF072128//4.50E-127//777bp//86% PSEC0061//1931bp//464aa//1st//0.94//BETA-MANNOSYLTRANSFERASE (EC 2. 4. 1.-).//P16661//6.00E-42//356aa//35%

[0103] PSEC0068//1717bp//194aa//1st//0.64

[0104] PSEC0070//2510bp//286aa//3rd//0.94//OLIGOSACCHARYL TRANSFERASE STT3 SUBUNIT HOMOLOG.//P46975//2.50E-99//301aa//63%

[0105] PSEC0071//3558bp//875aa//1st//0.94//INTER-ALPHA-TRYPSIN INHIBITOR HEAVY CHAIN H3 PRECURSOR (ITI HEAVY CHAIN H3) (SERUM-DERIVED HYALURONAN-ASSOCIATED PROTEIN) (SHAP).//Q06033//9.30E-141//576aa//37%

[0106] PSEC0072//2092bp//350aa//1st//0. 94//Homo sapiens mRNA for putative vacuolar proton ATPase membrane sector associated protein M8–9.//Y17975//2.10E-133//622bp//99%

[0107] PSEC0073//2341bp//523aa//1st//0.94//UDP-GLUCURONOSYLTRANSFERASE 2C1 MICROSOMAL (EC 2. 4. 1. 17) (UDPGT) (FRAGMENT).//P36514//7.90E-71//477aa//36%

[0108] PSEC0074//2971bp//770aa//1st//0.89//Mus musculus mRNA for semaphorin W, complete cds.//AB021291//0//2579bp//85%

[0109] PSEC0075//2244bp//633aa//2nd//0.79

[0110] PSEC0076//3253bp//860aa//1st//0.94//MITOCHONDRIAL PRECURSOR PROTEINS IMPORT RECEPTOR (72 KD MITOCHONDRIAL OUTER MEMBRANE PROTEIN) (MITOCHONDRIAL IMPORT RECEPTOR FOR THE ADP/ATP CARRIER) (TRANSLOCASE OF OUTER MEMBRANE TOM70).//P23231//3.80E-11//194aa//28%

[0111] PSEC0077//2195bp//483aa//1st//0.94//TROPONIN T, CARDIAC MUSCLE ISOFORMS (TNTC).//P02642//0.00000018//120aa//28%

[0112] PSEC0079//1290bp//189aa//2nd//0.94

[0113] PSEC0080//3171bp//740aa//2nd//0.94//Homo sapiens mRNA for NAALADase II protein.//AJ012370//0//3131bp//99%

[0114] PSEC0081//2890bp//172aa//1st//0.94

[0115] PSEC0082//1878bp//331aa//1st//0.94//PROBABLE OXIDOREDUCTASE (EC 1. -. -. -).//Q03326//7.30E-30//269aa//34%

[0116] PSEC0085//2392bp//280aa//1st//0.85//PROBABLE PROTEIN DISULFIDE ISOMERASE P5 PRECURSOR (EC 5.3.4.1).//P38660//5.60E-10//105aa//39%

[0117] PSEC0086//1821bp//390aa//1st//0.83//CELL SURFACE A33 ANTIGEN PRECURSOR.//Q99795//2.30E-23//259aa//32%

[0118] PSEC0087//1808bp//441aa//1st//0.94//Homo sapiens G protein-coupled receptor mRNA, complete cds.//AF181862//5.40E-27//1114bp//60%

[0119] PSEC0088//2015bp//467aa//1st//0.94//CATHEPSIN B PRECURSOR (EC 3. 4. 22. 1).//P07688//1.10E-39//315aa//34%

[0120] PSEC0090//1722bp//543aa//1st//0.92//Homo sapiens heparanase (HPA) mRNA, complete cds.//AF144325//0//1722bp//99%

[0121] PSEC0094//2291bp//564aa//1st//0.93//PROTEIN PTM1 PRECURSOR.//P32857//7.10E-15//284aa//28%

[0122] PSEC0095//2080bp//349aa//1st//0.94

[0123] PSEC0098//2185bp//208aa//1st//0.94

[0124] PSEC0099//1627bp//350aa//2nd//0.91

[0125] PSEC0100//1391bp//172aa//1st//0.77//Homo sapiens clone 24952 mRNA sequence, complete cds.//AF131758//7.70E-308//1391bp//99%

[0126] PSEC0101//2547bp//258aa//2nd//0.92

[0127] PSEC0104//1430bp//418aa//2nd//0.79

[0128] PSEC0105//2506bp//494aa//1st//0.94

[0129] PSEC0106//2465bp//326aa//2nd//0.94

[0130] PSEC0107//2557bp//130aa//2nd//0.89

[0131] PSEC0108//3099bp//267aa//3rd//0.86//HYPOTHETICAL 49.3 KD PROTEIN C30D11.06C IN CHROMOSOME I.//Q09906//9.80E-17//307aa//28%

[0132] PSEC0109//2563bp//736aa//1st//0.94//Rattus norvegicus leprecan (leprel) mRNA, complete cds.//AF087433//0//2501bp//84%

[0133] PSEC0110//2179bp//344aa//1st//0.94

[0134] PSEC0111//3362bp//208aa//1st//0.83

[0135] PSEC0112//3598bp//349aa//4th//0.74

[0136] PSEC0113//2451bp//423aa//1st//0.79//36 KD NUCLEOLAR PROTEIN HNP36 (DELAYED-EARLY RESPONSE PROTEIN 12) (DER12).//Q61672//4.20E-22//169aa//34%

[0137] PSEC0119//2518bp//555aa//1st//0.87//HYPOTHETICAL 63.9 KD PROTEIN C1F12. 09 IN CHROMOSOME I.//Q10351//4.50E-26//240aa//30%

[0138] PSEC0120//2250bp//302aa//2nd//0.94//Human alpha-1,3-mannosyl-glycoprotein beta-1, 2-N-acetylglucosaminyltransferase (MGAT) gene, complete cds.//M61829//0//2235bp//92%

[0139] PSEC0021//1666bp//358aa//1st//0.94//HYPOTHETICAL 39.9 KD PROTEIN T15H9. 1 IN CHROMOSOME II PRECURSOR.//Q10005//4.10E-106//351aa//58% PSEC0124//1686bp//476aa//1st//0.91//VITELLOGENIC CARBOXYPEPTIDASE PRECURSOR (EC 3. 4. 16.-).//P42660//1.10E-103//444aa//45%

[0140] PSEC0125//1999bp//256aa//1st//0.74//Homo sapiens mRNA for type II membrane protein, complete cds, clone:HP10328.//AB015630//4.50E-306//1433bp//98%

[0141] PSEC0126//1906bp//102aa//1st//0.89//Homo sapiens mRNA for leukotriene B4 omega-hydroxylase, complete cds.//AB002454//3.90E-251//970bp//86%

[0142] PSEC0127//1773bp//218aa//1st//0.94

[0143] PSEC0128//2134bp//306aa//1st//0.94

[0144] PSEC0129//1828bp//135aa//1st//0.94

[0145] PSEC0130//2934bp//265aa//1st//0.68

[0146] PSEC0131//1658bp//297aa//1st//0.94

[0147] PSEC0133//2023bp//240aa//1st//0.94

[0148] PSEC0134//1898bp//144aa//6th//0.71

[0149] PSEC0135//1755bp//322aa//3rd//0.75//Homo sapiens lymphatic endothelium-specific hyaluronan receptor LYVE-1 mRNA, complete cds.//AF118108//0//1640bp//99%

[0150] PSEC0136//1907bp//392aa//1st//0.93

[0151] PSEC0137//2981bp//571aa//1st//0.94

[0152] PSEC0139//1361bp//218aa//2nd//0.89

[0153] PSEC0143//1976bp//125aa//1st//0.74//ENDOSOMAL P24A PROTEIN PRECURSOR (70 KD ENDOMEMBRANE PROTEIN) (PHEROMONE ALPHA-FACTOR TRANSPORTER) (ACIDIC 24 KD LATE ENDOCYTIC INTERMEDIATE COMPONENT).//P32802//1.00E-19//129aa//38%

[0154] PSEC0144//2067bp//247aa//1st//0.94//Homo sapiens CGI-78 protein mRNA, complete cds.//AF151835//0//1961bp//99%

[0155] nnnnnnnn//2807bp//346aa//7th//0.79//PUTATIVE G PROTEIN-COUPLED RECEPTOR GPR17 (R12).//Q13304//3.00E-44//308aa//36%

[0156] PSEC0147//1964bp//520aa//1st//0. 91//HYPOTHETICAL 52.8 KD PROTEIN T05E11.5 IN CHROMOSOME IV.//P49049//3.60E-19//203aa//38%

[0157] PSEC0149//1988bp//432aa//1st//0.94

[0158] PSEC0150//2259bp//217aa//1st//0. 94//Homo sapiens T-box protein TBX3 (TBX3) mRNA, complete cds.//AF170708//2.60E-140//673bp//98%

[0159] PSEC051//1688bp//467aa//1st//0.93//TISSUE ALPHA-L-FUCOSIDASE PRECURSOR (EC 3.2.1.51) (ALPHA-L-FUCOSIDASE I) (ALPHA-L-FUCOSIDE FUCOHYDROLASE).//P04066//5.20E-145//459aa//55%

[0160] PSEC0152//2130bp//374aa//2nd//0.86

[0161] PSEC0158//1836bp//137aa//4th//0.94//Homo sapiens lifeguard (LFG) mRNA, complete cds.//AF190461//2.50E-44//591bp//68%

[0162] PSEC0159//2198bp//372aa//1st//0.8//Homo sapiens mRNA for type II membrane protein, complete cds, clone:HP10328.//AB015630//0//2186bp//99%

[0163] PSEC0161//2222bp//496aa//1st//0.89//GLUCOSE TRANSPORTER TYPE 5, SMALL INTESTINE (FRUCTOSE TRANSPORTER).//P22732//8.10E-101//479aa//42%

[0164] PSEC0162//1320bp//271aa//1st//0.83

[0165] PSEC0163//2167bp//578aa//1st//0. 94//HYPOTHETICAL 67.8 KD PROTEIN IN IKI1-ERG9 INTERGENIC REGION.//P38875//3. 10E-48//228aa//36%

[0166] PSEC0164//1877bp//463aa//1st//0.93//GLIOMA PATHOGENESIS-RELATED PROTEIN (RTVP-1 PROTEIN).//P48060//1.80E-27//169aa//39%

[0167] PSEC0165//2111bp//242aa//1st//0.83

[0168] PSEC0167//874bp//103aa//7th//0.73

[0169] PSEC0168//2533bp//269aa//1st//0. 94//HYPOTHETICAL 42.5 KD PROTEIN IN TSM1-ARE1 INTERGENIC REGION.//P25625//2.50E-18//179aa//30%

[0170] PSEC0169//1792bp//204aa//1st//0.75//Homo sapiens transmembrane 4 superfamily protein mRNA, complete cds.//AF100759//0//1771bp//99%

[0171] PSEC0070//2622bp//353aa//1st//0.94//Homo sapiens E21G4 (E21G4) mRNA, complete cds.//AF191019//0//2542bp//99%

[0172] PSEC0171//2005bp//301aa//2nd//0.91

[0173] PSEC0172//2012bp//415aa//1st//0.92//Homo sapiens procollagen C-terminal proteinase enhancer protein 2 (PCOLCE2) mRNA, complete cds.//AF098269//0//1741bp//99%

[0174] PSEC0173//1740bp//406aa//1st//0.91//NEURONAL OLFACTOMEDIN-RELATED ER LOCALIZED PROTEIN PRECURSOR(NOEL) (1B426B).//Q62609//6.60E-33//373aa//28%

[0175] PSEC0178//2308bp//222aa//3rd//0.94

[0176] PSEC0181//1890bp//165aa//3rd//0.66

[0177] PSEC0182//2153bp//657aa//2nd//0.82//Homo sapiens mRNA for UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 7.//AJ002744//0//2006bp//99%

[0178] PSEC0183//2031bp//451aa//1st//0.88//CARTILAGE MATRIX PROTEIN PRECURSOR (MATRILIN-1).//P05099//5.50E-63//228aa//54%

[0179] PSEC0190//1841bp//194aa//1st//0.87

[0180] PSEC0191//1493bp//472aa//1st//0.87//ELASTIN PRECURSOR (TROPOELASTIN).//P15502//5.00E-113//367aa//67%

[0181] PSEC0192//1557bp//153aa//1st//0.93

[0182] PSEC0197//3555bp//576aa//2nd//0.85//PEROXISOMAL-COENZYME A SYNTHETASE (EC 6.-. -. -).//P38137//1.30E-33//169aa//32%

[0183] PSEC0198//2083bp//343aa//1st//0.94

[0184] PSEC0199//2586bp//283aa//1st//0.94

[0185] PSEC0200//1548bp//443aa//1st//0.94//Mus musculus immunosuperfamily protein B12 mRNA, complete cds.//AF061260//4.30E-243//1297bp//89%

[0186] PSEC0203//1457bp//323aa//1st//0.87

[0187] PSEC0204//1484bp//142aa//1st//0.74

[0188] PSEC0205//1656bp//435aa//1st//0.94//CELL DIVISION CONTROL PROTEIN 91.//P41733//7.70E-41//290aa//33%

[0189] PSEC0207//1754bp//262aa//3rd//0.94//Homo sapiens multispanning nuclear envelope membrane protein nurim (NRM29) mRNA, partial cds.//AF143676//0.00E+00//1399bp//99%

[0190] PSEC0209//2144bp//186aa//1st//0.93//Homo sapiens Pancreas-specific TSA305 mRNA complete cds.//AB020335//0//1770bp//99%

[0191] PSEC0210//1689bp//349aa//1st//0.71

[0192] PSEC0213//1824bp//323aa//1st//0.94

[0193] PSEC0214//1959bp//141aa//1st//0.94

[0194] PSEC0215//2112bp//551aa//2nd//0.94//Homo sapiens emilin precursor, mRNA, complete cds and 3′ UTR.//AF088916//0//1470bp//98%

[0195] PSEC0216//1765bp//410aa//2nd//0.89

[0196] PSEC0218//1369bp//242aa//1st//0.69//Homo sapiens torsinA (DYT1) mRNA, complete cds.//AF007871//3.10E-26//619bp//61%

[0197] PSEC0220//1584bp//365aa//1st//0.94//Mouse Wnt-6 mRNA, complete cds.//M89800//5.50E-198//1310bp//82%

[0198] PSEC0222//899bp//139aa//2nd//0.94

[0199] PSEC0223//1874bp//221aa//1st//0.94

[0200] PSEC0224//1463bp//170aa//1st//0.89//UROMODULIN PRECURSOR (TAMM-HORSFALL URINARY GLYCOPROTEIN) (THP).//P48733//8.30E-10//141aa//36%

[0201] PSEC0226//2103bp//477aa//1st//0.94//Mus musculus carboxypeptidase X2 mRNA, complete cds.//AF017639//1.00E-114//1057bp//66%

[0202] PSEC0227//1410bp//379aa//2nd//0.81//Cricetulus griseus SREBP cleavage activating protein (SCAP) mRNA, complete cds.//U67060//2.50E-231//1099bp//84%

[0203] PSEC0228//1483bp//146aa//1st//0.92//COP-COATED VESICLE MEMBRANE PROTEIN P24 PRECURSOR (P24A) (RNP21.4).//Q63524//5. 90E-21//110aa//32%

[0204] PSEC0230//1784bp//271aa//1st//0.76//SIGNAL RECOGNITION PARTICLE RECEPTOR BETA SUBUNIT (SR-BETA).//P47758//5.80E-123//271aa//90% PSEC0232//1709bp//246aa//1st//0. 75//30 KD ADIPOCYTE COMPLEMENT-RELATED PROTEIN PRECURSOR (ACRP30) (ADIPOCYTE SPECIFIC PROTEIN ADIP0Q).//Q60994//3.30E-24//242aa//32%

[0205] PSEC0233//2499bp//267aa//1st//0.82

[0206] PSEC0235//1601bp//211aa//1st//0.94

[0207] PSEC0236//1906bp//529aa//1st//0.94//LAMININ GAMMA-1 CHAIN PRECURSOR (LAMININ B2 CHAIN).//P1047//5.00E-181//472aa//62%

[0208] PSEC0240//1638bp//253aa//1st//0.94//WNT-11 PROTEIN PRECURSOR.//096014//3.40E-109//220aa//93%

[0209] PSEC0241//3593bp//622aa//1st//0.85//Homo sapiens cerebral cell adhesion molecule mRNA, complete cds.//AF177203//2.50E-121//1541bp//68%

[0210] PSEC0243//2835bp//743aa//3rd//0.77

[0211] PSEC0244//2063bp//287aa//1st//0.91

[0212] PSEC0245//2896bp//418aa//3rd//0.91//INTEGRAL MEMBRANE GLYCOPROTEIN GP210 PRECURSOR.//P11654//3.40E-205//483aa//78%

[0213] PSEC0246//2969bp//345aa//1st//0.94//LOW-DENSITY LIPOPROTEIN RECEPTOR-RELATED PROTEIN 2 PRECURSOR (MEGALIN) (GLYCOPROTEIN 330).//P98158//1.60E-22//126aa//42%

[0214] PSEC0247//2872bp//236aa//1st//0.94//PLATELET-ENDOTHELIAL TETRASPAN ANTIGEN 3 (PETA-3) (GP27) (MEMBRANE GLYCOPROTEIN SFA-1) (CD151 ANTIGEN).//035566//3.30E-28//237aa//29%

[0215] PSEC0248//2694bp//172aa//1st//0.84

[0216] PSEC0249//3320bp//534aa//1st//0.94//BUTYROPHILIN PRECURSOR (BT).//Q62556//1.10E-21//276aa//32%

[0217] PSEC0250//2179bp//223aa//2nd//0.74//TWISTED GASTRULATION PROTEIN PRECURSOR.//P54356//1.50E-34//231aa//35%

[0218] PSEC0252//2617bp//491aa//3rd//0.89//HYPOTHETICAL 56.2 KD PROTEIN IN ERG8-UBP8 INTERGENIC REGION.//Q04991//2.40E-15//208aa//29%

[0219] PSEC0253//2872bp//265aa//1st//0.69//PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE TYPE II ALPHA (EC 2.7.1.68) (PIP5KII-ALPHA) (1-PHOSPHATIDYLINOSITOL-4-PHOSPHATE KINASE) (PTDINS(4)P-5-KINASE B ISOFORM) (DIPHOSPHOINOSITIDE KINASE).//070172//1.30E-139//240aa//62%

[0220] PSEC0255//3774bp//687aa//2nd//0.89//Homo sapiens mRNA for TM7XN1 protein.//AJ11101//0//3700bp//99%

[0221] PSEC0258//3791bp//349aa//1st//0.94

[0222] PSEC0259//2583bp//242aa//2nd//0.89//CYTOCHROME B561 (CYTOCHROME B-561).//095245//3.70E-44//211aa//47%

[0223] PSEC0260//2492bp//496aa//1st//0.94

[0224] PSEC0261//3080bp//806aa//2nd//0.76//MITOCHONDRIAL PRECURSOR PROTEINS IMPORT RECEPTOR 72 MD MITOCHONDRIAL OUTER MEMBRANE PROTEIN) (MITOCHONDRIAL IMPORT RECEPTOR FOR THE ADT/ATP CARRIER) (TRANSLOCASE OF OUTER MEMBRANE TOM70).//P23231//4.60E-07//176aa//23%

[0225] PSEC0283//4144bp//971aa//2nd//0.94

[0226] PSEC0084//2788bp//335aa//1st//0.86//IMPLANTATION-ASSOCIATED PROTEIN.//035777//1.80E–167//335aa//92%

[0227] PSEC0237//1419bp//248aa//1st//0.81//Homo sapiens CTG4a mRNA, complete cds.//U80744//8.30E–22//157bp//61%

[0228] PSEC0264//2617bp/167aa//1st//0.94

[0229] PSEC0265//2646bp//192aa//1st//0.76

[0230] (Annotation 1) Clones with relatively low score in the ATGpr1 (PSEC0017, ATGpr1 0.33; PSEC0030, ATGpr1 0.26; PSEC0031, ATGpr1 0.20; PSEC0049, ATGpr1 0.35): These clones, in which data of the 5′-end sequence (one pass sequencing) was not sorted by the ATGpr, were selected as a clone having both the signal sequence and long ORF based on the data of the 5′-end sequence, and the sequence of their full-length cDNA clones was analyzed. All the clones have the signal sequence in the N-terminus. In addition, the above 4 clones except PSEC0049 had portions not contained in known EST in the 5′-end when compared to known EST. PSEC0049 had portions not contained in EST in the 5′-end within the ORF of the cDNA when compared with known EST. Thus, it turned out that these clones were full-length cDNA clones.

[0231] The next 15 proteins out of the 173 proteins of the present invention were encoded by the cDNA clones as shown in List 2 (PSEC0027, PSEC0047, PSEC0066, nnnnnnnn, PSEC0069, PSEC0078, PSEC0092, PSEC0103, PSEC0117, PSEC0142, PSEC0212, PSEC0239, PSEC0242, PSEC0251, and PSEC0256). These clones were predicted to encode a membrane protein (containing the transmembrane helix) by the MEMSAT (Jones D. T., Taylor W. R., and Thornton J. M. (1994) Biochemistry 33: 30308–3049). Similarly, the clones were predicted to encode a membrane protein by the SOSUI (Hirokawa T. et al. (1998) Bioinformatics 14:378–379) (Mitsui Information Development Inc.). Thus, the clones were those “isolated from the human cDNA libraries constructed by the oligo-capping method, predicted to be a full-length cDNA clone by ATGpr etc., and predicted to encode a membrane protein by both MEMSAT and SOSUI”. The protein encoded by the clones are also classified into the category of a secretory proteins or membrane proteins described above. Two clones among the 15 clones (PSEC0243, and PSEC0251) were predicted to encode a membrane protein without a signal sequence in the N-terminus. However, in both clones; if translation starts from the third ATG (having high scores in the ATGpr1), the resulting protein will contain a signal sequence in the N-terminus. Accordingly, it is possible that the two clones are classified into the category of secretory proteins or membrane proteins that contains a signal sequence in N-terminus.

[0232] The list shown below indicates PSEC number, length of cDNA, length of amino acid sequence, ATG No. from the 5′ end, ATGpr1 value, predicted result for signal sequence by PSORT, predicted result for membrane protein by MEMSAT and SOSUI, definition of annotation data, Accession No. of annotation data, P value, length of compared sequence, and homology in this order, separating each of these with a double-slash mark, //. The annotation data are not shown for clones that did not exhibit explicit homology as a result of BLAST analysis of GenBank and SwissProt.

[0233] List 2

[0234] PSEC0027//1085bp//271aa//1st//0.94//No //transmembrane

[0235] PSEC0047//2078bp//267aa//1st//0.94//No //transmembrane//INTEGRAL MEMBRANE PROTEIN 28 (TRANSMEMBRANE PROTEIN B3-16) //042204//1.80E-66//264aa//44%

[0236] PSBC0092//3624bp//465aa//1st//0.94//No //transmembrane//Homo sapiens mRNA for heparan-sulfate 6-sulfotransferase, complete eds.//AB006179//2.708-102//1057bp//71%

[0237] PSEC0066//2682bp//474aa//1st//0.79//No //transmembrane//TETRACYCLINE RESISTANCE PROTEIN, CLASS B (TETA (E)).//Q07232//7.508-19//173aa//315

[0238] nnnnnnnn//2406bp//730aa//1st//0.26//No //transmembrane//VERY-LONG-CHAIN AACYL-COA SYNTHETASE (EC 6. 2. 1.-) (VERY-LONG-CHAIN- FATTY-ACID-COA LINGASE).//035488//2.50E-140//520aa//45%

[0239] PSEC0069//2568bp//433aa//2nd//0.94//No //transmembrane

[0240] PSEC0103//2630bp//236aa//1st//0.94//No //transmembrane//Homo sapiens neuroendocrine-specific protein-like protein 1 (NSFL1) mRNA, complete cds.//AF119397//0//2594bp//99%

[0241] PSEC0117//1873bp//583aa//1st//0.94//No //transmembrane//Rattus norvegicus lipolysis-stimulated remnant receptor beta subunit mRNA, complete cds.//AF119689//2.005-221//1045bp//78%

[0242] PSEC0142//2153bp//343aa//2nd//0.94//No //transmembrane//PROBABLE G PROTEIN-COUPLED RECEPTOR RTA.//P23749//1.20E-159//343aa//84%

[0243] PSEC0212//1577bp//111aa//1st//0394//No //transmembrane//Homo sapiens NJAC protein (NJAC) mRNA, complete cds.//AF144108//1.408-237//1303bp//91%

[0244] PSEC0239//1712bp//423aa//2nd//0.18//No //transmembrane//Homo sapiens aspartyl proteins mRNA, complete eds.//AF050171//0111715bp//93%

[0245] PSEC0242//3017bp//401aa//1st//0.9//No //transmembrane

[0246] PSEC0251//2373bp//393aa//1st//0.78//No //transmembrane

[0247] PSEC0256//3520bp//612aa//1st//0.89//No //transmembrane//Homo sapiens protoadherin alpha 12 (PCDH-alpha 12) mRNA, complete eds.//AF162308//0//3520bp//99%

[0248] PSEC0078//2194bp//333aa//2nd//0.24//No //transmembrane//M-Sema F=e factor in neutral network development [mice, neonatal brain, mRNA, 3508 nt].//S79463//1.50E-282//1945bp//83%

[0249] (Annotation 1)

[0250] Clones with relatively low score in the ATGpr1 (PSEC0239, ATGpr1 0.18): PSEC0236 was selected as a clone having high score in the ATGpr based on the 5′-end sequence data (one pass sequencing), and also was predicted to be a membrane protein (containing the transmembrane helix) by the MBMSAT and SOSUL. In addition, the comparison with known ESTs revealed that the clone has a portion not contained in ESTs in the 5′-end of the cDNA.

[0251] (Annotation)

[0252] PSEC0242 and PSEC0251: The clones are classified into the category of the cDNA encoding the polypeptide “containing the signal sequence in the N-terminus”, if translation starts from the third ATG.

[0253] PSEC0242: No.3 ATG, ATGpr1 0.82, SP-Yes, ORF 171-1343, 391 aa, Signal peptide 24 aa;

[0254] PSEC0251: No.3 ATG, ATGpr1 0.77, SP-Yes, ORF 116-1256, 380 aa, Signal peptide 28 aa.

[0255] Herein, “SP-Yes” means that a signal sequence is present at the N-terminus predicted by the PSORT.

[0256] (Annotation 3) The ATGpr1 value for PSEC0078 was 0.24. This is a clone exhibited high ATGpr1 value based on the 5′-end sequence data (one pass sequencing), and also has been predicted to be a membrane protein (having a transmembrane helix) by MHMSAT and SOSUI analyses. In addition, in comparison with EST sequences, the cDNA sequence was not found to be 50 bp or more shorter than any FT sequences, the cDNA sequence was not found to be 50 bp or more shorter than any FST sequence at their 5′-end, and therefore the clone was not judged to be a incomplete cDNA clone by using ESTs as criteria for the judgement.

[0257] The last 2 proteins among the 173 proteins of the present invention were encoded by the cDNA clones shown in List 3 (PSEC0195, and PSEC0206). As a result of the homology search of the SwissProt, PSEC0195, and PSEC0206 were fund to have relatively high homology with mouse plasma membrane adapter HA2/AP2 adaptin alpha C subunit, and human carboxypeptidase H precursor (prohormone processing carboxypeptidase) in the secretory granule, respectively. Accordingly, the proteins are classified into the category of secretory proteins or membrane proteins.

List 3

[0258] The list shown below indicates PSEC number, length of cDNA, length of amino acid sequence, ATG No. from the 5′ end, ATGpr1 value, predicted result for signal sequence by PSORT, predicted result for membrane protein by MEMSAT and SOSUI, definition of annotation data, Accession No. of annotation data, P value, length of compared sequence, and homology in this order, separating each of these with a double-slash mark, //.

PSEC0195//1979bp//467aa//2nd//0.80//No//No//ALPHA-ADAPTIN C (CLATHRIN ASSEMBLY PROTEIN COMPLEX 2 ALPHA-C LARGE CHAIN) (100 KD COATED VESICLE PROTEIN C) (PLASMA MEMBRANE ADAPTOR HA2/AP2 ADAPTIN ALPHA C SUBUNIT).//P17427//1.8E-144//281aa//98%

PSEC0206//1606bp//430aa//3rd//0.90//No//No//CARBOXYPEPTIDASE H PRECURSOR (EC 3.4.17.10) (CPH) (CARBOXYPEPTIDASE E) (CPE) (ENKEPHALIN CONVERTASE) (PROHORMONE PROCESSING CARBOXYPEPTIDASE).//P15087//1.8E-103//397aa//49%

[0259] Since the amino acid sequence of the secretory protein or membrane protein of the present invention has been determined, it is possible to analyze its biological function(s) by expressing it as a recombinant protein utilizing an appropriate expression system, or by using a specific antibody against it.

[0260] For example, the biological activity of a secretory protein or membrane protein can be analyzed according to the methods described in “Glycobiology” (Fukuda M., and Kobata A. edit., (1993)), “Growth Factors” (McKay I., and Leigh I. edit., (1993)), and “Extracellular Matrix” (Haralson M. A., Hassell J. R. edit., (1995)) in the series of “The Practical Approach” (IRL PRESS), or “Glycoprotein Analysis in Biomedicine” (Hounsell E. F. edit., (1993)) in the series of “Method in Molecular Biology” (Humana Press). Alternatively, the methods disclosed in “New protocols in biochemical experiments Vol. 7: Growth and differentiation factors and their receptors” (Japan Biochemistry Society edit. (1991)) (Tokyo Kagaku-Dojin), or “Vol. 296: Neurotransmitter Transporters”, “Vol. 294: Ion Channels (Part C)”, “Vol. 293: Ion Channels (Part B)”, “Vol. 292: ABC Transporters”, “Vol. 288: Chemokine Receptors”, “Vol. 287: Chemokines”, “Vol. 248: Proteolytic Enzymes”, “Vol. 245: Extracellular Matrix Components”, “Vol. 244: Proteolytic Enzymes”, “Vol. 230: Guide to Techniques in Glycobiology”, “Vol. 198: Peptide Growth Factors”, “Vol. 192: Biomembranes”, “Vol. 191: Biomembranes”, and “Vol. 149: Drug and Enzyme Targeting” in the series of “Methods in Enzymology” (Academic Press) may be used to analyze the biological activity of a secretory protein or membrane protein.

[0261] As for secretory proteins and membrane proteins, in the search of the Online Mendelian Inheritance in Man (OMIM) using the following keywords, the results obtained with each keyword, suggest the association of the proteins with many diseases, as described below. Therefore, the secretory proteins and membrane proteins are useful as a target in the medicinal industry.

[0262] New information is constantly updated in the OMIM database. Therefore, it is possible for one skilled in the art to find a new relationship between a particular disease and a gene of the present invention in the updated database.

[0263] Keywords used in the search of the OMIM

[0264] (1) secretion protein

[0265] (2) membrane protein

[0266] Shown in the search result are only the accession numbers in the OMIM. Using the number, data showing the relationship between a disease and a gene or protein can be seen. The OMIM data has been renewed everyday.

[0267] 1) Secretion Protein

268 entries found, searching for “secretion protein”

[0268]

104760, 176860, 160900, 107400, 118910, 139320, 603850, 147572, 176880, 600946, 603215,
157147, 600174, 151675, 170280, 179512, 179513, 138120, 179509, 246700, 179510, 600626,
179511, 600998, 109270, 601489, 154545, 179490, 185860, 603216, 122559, 601746, 147290,
602672, 146770, 603062, 179508, 131230, 601591, 602421, 139250, 167805, 167770, 600041,
600564, 118825, 601146, 300090, 600753, 601652, 600759, 600768, 602434, 182590, 603166,
308230, 602534, 603489, 107470, 150390, 104610, 173120, 158106, 143890, 306900, 308700,
134797, 137350, 227500, 176300, 107730, 600760, 138079, 120180, 120160, 120150, 124092,
138160, 101000, 227600, 600509, 601199, 142410, 104311, 193400, 201910, 107300, 122560,
272800, 217000, 590050, 147670, 133170, 176730, 300300, 134370, 274600, 120140, 162151,
158070, 152790, 120120, 106100, 300200, 192340, 190160, 138040, 147470, 147620, 173350,
147380, 152200, 152760, 157145, 153450, 264080, 113811, 600937, 600840, 188545, 202110,
600514, 186590, 603372, 136435, 137241, 252800, 214500, 207750, 138850, 139191, 142640,
138130, 189907, 603692, 600633, 603355, 107270, 600377, 147892, 232200, 600281, 232800,
602358, 137035, 601771, 601769, 253200, 601933, 118444, 600270, 120700, 600945, 603732,
147660, 600761, 172400, 600823, 600877, 130080, 171060, 107740, 307800, 602843, 130660,
152780, 124020, 601124, 601340, 601604, 601610, 171050, 312060, 232700, 300159, 142703,
600734, 125255, 168450, 123812, 188540, 147940, 188450, 600839, 182452, 188400, 182280,
176760, 263200, 600264, 188826, 252650, 601185, 162641, 137216, 601398, 601538, 118888,
118445, 601745, 190180, 601922, 182098, 602008, 147440, 602384, 600031, 109160, 602663,
151670, 602682, 602730, 602779, 146880, 603061, 142704, 603140, 106150, 600732, 153620,
603318, 139392, 600042, 102200, 603493, 182100, 264300, 603795, 184600

[0269] 2) Membrane Protein

1017 entries found, searching for “membrane protein”

[0270]

130500, 305360, 153330, 173610, 170995, 109270, 170993, 309060, 120920, 602333, 133740,
133710, 602690, 133730, 159430, 600897, 133090, 601178, 602413, 602003, 109280, 603237,
602173, 107776, 602334, 125305, 602335, 182879, 154045, 309845, 600594, 603718, 603241,
603214, 603657, 603177, 600182, 601476, 602879, 136950, 600723, 601114, 185880, 185881,
300096, 602257, 160900, 177070, 603062, 603344, 602977, 310200, 600959, 300100, 186945,
600039, 600267, 128240, 182900, 601097, 136430, 600946, 602534, 601047, 143450, 603141,
603700, 600579, 256540, 159440, 602414, 600403, 602048, 188860, 137290, 158343, 184756,
602910, 603179, 600279, 108733, 107770, 173335, 602625, 154050, 219800, 603850, 601028,
600447, 104225, 186946, 601767, 603143, 121015, 603215, 227400, 603735, 600179, 602421,
180721,
176801, 176860, 600753, 603142, 176790, 600266, 601239, 115501, 143890, 121014, 121011,
125950, 603534, 304040, 601134, 600754, 601510, 601595, 190315, 300172, 602216, 602261,
602262, 602461, 131560, 179514, 179512, 176981, 142461, 139310, 312080, 176640, 128239,
185470, 310300, 601403, 601757, 273800, 151460, 176943, 104311, 168468, 120130, 602887,
600164, 601531, 601832, 104775, 600040, 603583, 176894, 602631, 166945, 182180, 120620,
141180, 601014, 139150, 182860, 177061, 600174, 180069, 191275, 104760, 601693, 300017,
603518, 601009, 134651, 601107, 603868, 600168, 136425, 603531, 603291, 600917, 603216,
102720, 300118, 179590, 135630, 602285, 107450, 602296, 303630, 176878, 120090, 600322,
138160, 601212, 603293, 131230, 112205, 600763, 600718, 300187, 170715, 601966, 300051,
602474,
120070, 600691, 600855, 182309, 602101, 602857, 194355, 162230, 600874, 113730, 155550,
602701, 306400, 601789, 231200, 107271, 175100, 182870, 305100, 301000, 601313, 157147,
147670, 139200, 603593, 157655, 600934, 155970, 602049, 155960, 155760, 118990, 135620,
308230, 602694, 162060, 300023, 160993, 153619, 153432, 120131, 603823, 603167, 601023,
600816, 165040, 601681, 166490, 300112, 120190, 300145, 163970, 600772, 602926, 602933,
602202, 400015, 151510, 600759, 602672, 602654, 603821, 116952, 151430, 602632, 155975,
602217, 150370, 600752, 601179, 600932, 603048, 603234, 601805, 603822, 603869, 601717,
601181, 313440, 139130, 107777, 109190, 603452, 191163, 191164, 602370, 176877, 103195,
600523, 191328, 601275, 204200, 602426, 603820, 600551, 600695, 600552, 600553, 602306,
601523,
602507, 602299, 600583, 114070, 600632, 603498, 185430, 600587, 235200, 173470, 603199,
601633, 602500, 208900, 180297, 156225, 516020, 190195, 141900, 102680, 193300, 101000,
193400, 300011, 107400, 257220, 107741, 180380, 203200. 111700. 600024, 304800, 600065,
110750, 179605, 113705, 601638, 222900, 120120, 602509, 602469, 600930, 601383, 176261,
602574, 602997, 311770, 131550, 603616, 308700, 603372, 256100, 224100, 276903, 305900,
516000, 131195, 314555, 601567, 603866, 306900, 103390, 186720, 173850, 601050, 602505,
186590, 246530, 602689, 194380, 300041, 162643, 152790, 120150, 600682, 600106, 272750,
188040, 602382, 601497, 113811, 182138, 212138, 601309, 109690, 114760, 176805, 601253,
123900, 602581, 189980, 191190, 110700, 600163, 137167, 600580, 601610, 190000, 123825,
603491,
600135, 186591, 173910, 138140, 107266, 120950, 601081, 603690, 244400, 312700, 171060,
601199, 601758, 170500, 277900, 601997, 314850, 601880, 603009, 120220, 603126, 164920,
602934, 164730, 163890, 603434, 107269, 602909, 600877, 256550, 164761, 602872, 120110,
126150, 158070, 266200, 223360, 250800, 269920, 252650, 603355, 154582, 138190, 300035,
602640, 227650, 158120, 153700, 182380, 155740, 204500, 603401, 601975, 300135, 136350,
602924, 300167, 185050, 176100, 300189, 151525, 300200, 165180, 230800, 602158, 602676,
603411, 193245, 120325, 601848, 192500, 603102, 147795, 245900, 137060, 147557, 120650,
602377, 307800, 120930, 308100, 142800, 191092, 232300, 173510, 602225, 180470, 190930,
186357, 134638, 600544, 601373, 600509, 600359, 603784, 600395, 600653, 603754, 601597,
601066,
600185, 601295, 600978, 205400, 603274, 600418, 600839, 516050, 601691, 601007, 600650,
600308, 603261, 601193, 600004, 600017, 516040, 253800, 276901, 600019, 257200, 108780,
300037, 300104, 300126, 255125, 203300, 300191, 426000, 302060, 304700, 201475, 252010,
193210, 311030, 306250, 248600, 191740, 108360, 131244, 600423, 232200, 191305, 231680,
103320, 190180, 600493, 111200, 226200, 312600, 600170, 111680, 186910, 203100, 600536,
600238, 186830, 186760, 186745, 186711, 106180, 112203, 103180, 182530, 182160, 600644,
307030, 192321, 600667, 125647, 179080, 114207, 114860, 176000, 116930, 600748, 173515,
173325, 600377, 171760, 171050, 118425, 170260, 191315, 600798, 600821, 600823, 600444,
600840, 159465, 600857, 158380, 600867, 154360, 152427, 150330, 110900, 147840, 147360,
147280,
146880, 312610, 120940, 142871, 142790, 600937, 142600, 134390, 111250, 600979, 600997,
142460, 186845, 134635, 601017, 139191, 139090, 138850, 601040, 138720, 122561, 131100,
123610, 217070, 100500, 603377, 602354, 603302, 603207, 603086, 602188, 602095, 603867,
603842, 603798, 602602, 601194, 602607, 603713, 603681, 601252, 603648, 603646, 603644,
601282, 601284, 603667, 603712, 603594, 601872, 603425, 601843, 603263, 603208, 601411,
603201, 603189, 601463, 603164, 603152, 603087, 602874, 601492, 602893, 602057, 602859,
602746, 603879, 603510, 602458, 603380, 601581, 603765, 603283, 601599, 601733, 601852,
602316, 601615, 601617, 602184, 602894, 603005, 603030, 603861. 602835, 602136, 600153,
600074, 600046, 600023, 601625, 516006, 600018, 600016, 516002, 601590, 313475, 313470,
600244,
600528, 601611, 600282, 600327, 601568, 600368, 601730, 601535, 601745, 601929, 300169,
300150, 300132, 601533, 600385, 600464, 600424, 600429, 601756, 601488, 516005, 251100,
516004, 600918, 516003, 602192, 516001, 240500, 600465, 602241, 602243, 230200, 601485,
601478, 601416, 602297, 601459, 601839, 602314, 193065, 193001, 191306, 600504, 601020,
191191, 602372, 190181, 600534, 188380, 186854, 186360, 600530, 185250, 182331, 600535,
182305, 601296, 600582, 600732, 600734, 600742, 600782, 176802, 176266, 600769, 601883,
600864, 601901, 176260, 173490, 600910, 601905, 171890, 600916, 601987, 602679, 162651,
161555, 160994, 602714, 602715, 602724, 602736, 300007, 602783, 275630, 602836, 270200,
602871, 159460, 602876, 154540, 153900, 602890, 601153, 602190, 602905, 153634, 153337,
602914,
152310, 151690, 151625, 602935, 602974, 150325, 602992, 150320, 250790, 603006, 603007,
603008, 150292, 233690, 603046, 150210, 603061, 147940, 603063, 221770, 223100, 603097,
147880, 603118, 147730, 146928, 146630, 142622, 603149, 603150, 603151, 600923, 138981,
138590, 138330, 216950, 603192, 138297, 603202, 601002, 602343, 138230, 136131, 603217,
603220, 134660, 131390, 131235, 603242, 603243, 130130, 602345, 126455, 601123, 126064,
125240, 602359, 603312, 602380, 603318, 123890, 123836, 603356, 603361, 603366, 123830,
179610, 188060, 123620, 120980, 186355, 118510, 114835, 114217, 113810, 603499, 182310,
111740, 109610, 603548, 603564, 108740, 603598, 603613, 107273, 603626, 602518, 179410,
603647, 602515, 603652, 106195, 602573, 178990, 105210, 104615, 167055, 603717, 104614,
603728,
104210, 603749, 603750, 103850, 602608, 603787, 603788, 603796, 173445, 103220, 102910,
102681, 102670, 102642, 603833, 173391, 102576, 102575, 171833, 102573, 101800, 603875,
601108

[0271] There are several methods for analyzing the expression levels of genes associated with diseases. Differences in gene expression levels between diseased and normal tissues are studied by the analytical methods, for example, Northern hybridization and differential display. Other examples include a method with high-density cDNA filter, a method with DNA microarray and methods with PCR amplification (Experimental Medicine, Vol. 17, No. 8, 980–1056 (1999); Cell Engineering (additional volume) DNA Microarray and Advanced PCR Methods, Muramatsu & Naba (eds.), Shujunsya). The levels of gene expression between diseased tissues and normal tissues can be studied by any of these analytical methods. When explicit difference in expression level is observed for a gene, it can be concluded that the gene is closely associated with a disease or disorder. Instead of diseased tissues, cultured cells can be used for the assessment. Similarly, when gene expression is explicitly different between normal cells and cells reproducing disease-associated specific features, it can be concluded that the gene is closely associated with a disease or disorder. When the expression levels of genes are evidently varied during major cellular events (such as differentiation and apoptosis), the genes are involved in the cellular events and accordingly are candidates for disease- and/or disorder-associated genes. Further, genes exhibiting tissue-specific expression are genes playing important parts in the tissue functions and, therefore, can be candidates for genes associated with diseases and/or disorders affecting the tissues.

[0272] For example, non-enzymic protein glycation reaction is believed to be a cause for a variety of chronic diabetic complications. Accordingly, genes, of which expression levels are elevated or decreased in a glycated protein-dependent manner, are associated with diabetic complications caused by glycated proteins (Diabetes 1996, 45 (Suppl. 3), S67–S72; Diabetes 1997, 46 (Suppl. 2). S19–S25). The onset of rheumatoid arthritis is thought to be involved in the proliferation of synovial cells covering inner surfaces of joint cavity and in inflammatory reaction resulted from the action of cytokines produced by leukocytes infiltrating into the joint synovial tissues (Rheumatism Information Center). Recent studies have also revealed that tissue necrosis factor (TNF)-α participates in the onset (Current opinion in immunology 1999, 11, 657–662). When the expression of a gene exhibits responsiveness to the action of TNF on synovial cells, the gene is considered to be involved in rheumatoid arthritis. Genes associated with neural differentiation can be candidates for causative genes for neurological diseases as well as candidates for genes usable for treating the diseases.

[0273] Clones exhibiting differences in the expression levels thereof can be selected by using gene expression analysis. The selection comprises, for example; analyzing cDNA clones by using high-density cDNA filter; and statistically treating the multiple signal values (signal values of radioisotope in the radiolabeled probes or values obtained by measuring fluorescence intensities emitted from the fluorescent labels) for the respective clones by two-sample t-test, where the signal values are determined by multiple experiments of hybridization. The clones of interest are selectable based on the statistically significant differences in the signal distribution at p<0.05. However, selectable clones with significant difference in the expression levels thereof may be changed depending on the partial modification of statistical treatment. For example, the clones may be selected by conducting statistical treatment with two-sample t-test at p<0.01; or genes exhibiting more explicit differences in the expression levels thereof can be selected by performing statistical treatment with a pre-determined cut-off value for the significant signal difference. An alternative method is that the expression levels are simply compared with each other, and then, the clones of interest are selected based on the ratio of the expression levels thereof.

[0274] Clones exhibiting differences in the expression levels thereof can also be selected by comparing the expression levels by PCR analysis, for example, by using the method of determining the band intensities representing the amounts of PCR products with ethidium bromide staining; or the method of determining the values of radioisotope signals or fluorescence intensities of the probes hybridized to the PCR products when radiolabeled or fluorescent dye-labeled probes, respectively, are used in the hybridization. If the expression level ratios obtained in multiple PCR experiments are constantly at least 2-fold, such a clone can be judged to exhibit the difference in the expression level thereof. When the ratios are several-fold or not less than 10-fold, the clone can be selected as a gene exhibiting the explicit difference in the expression level thereof.

[0275] A survey of genes of which expression levels are varied in response to TNF α (Tumor Necrosis Factor-alpha) in the primary cell culture of synovial tissue detected the following clones with elevated expression levels in the presence of TNF α:

PSEC0070, PSEC0073, PSEC0084, PSEC0100, PSEC0109, PSEC0120, PSEC0131, PSEC0161, PSEC0183, PSEC0192, PSEC0197, PSEC0205, PSEC0207, PSEC0210, PSEC0213, PSEC0222, PSEC0230, PSEC0241, PSEC0252, PSEC0259.

[0276] On the other hand, clones with decreased expression levels in the presence of TNF α are PSEC0105 and PSEC0245. These clones are candidates for rheumatoid arthritis-associated genes.

[0277] A survey of genes of which expression levels are varied in response to the stimulation for inducing cell differentiation (stimulation using retinoic acid (RA)) in cultured cells of neural strain, NT2, detected the following clones with varied expression levels: PSEC005, PSEC0048, PSEC0059, PSEC0200, and PSEC0232. These are important genes associated with neural differentiation. The following clones also had varied their expression levels: PSEC0017, PSEC0019, PSEC0021, PSEC0030, PSEC0041, PSEC0047, PSEC0049, PSEC0055, PSEC0066, PSEC0070, PSEC0071, PSEC0072, PSEC0074, PSEC0075, PSEC0076, PSEC0080, PSEC0081, PSEC0084, PSEC0088, PSEC0094, PSEC0103, PSEC0104, PSEC0105, PSEC0112, PSEC0113, PSEC0117, PSEC0119, PSEC0120, PSEC0127, PSEC0129, PSEC0136, PSEC0139, PSEC0143, PSEC0144, PSEC0152, PSEC0161, PSEC0169, PSEC0171, PSEC0181, PSEC0182, PSEC0192, PSEC0195, PSEC0203, PSEC0215, PSEC0223, PSEC0235, PSEC0239, PSEC0243, PSEC0251, PSEC0255, PSEC0265.

[0278] These clones are also associated with neural differentiation and, therefore, are candidates for genes associated with neurological diseases.

[0279] Based on the functional analyses using a secretory protein or membrane protein, it is possible to develop a medicine.

[0280] In case of a membrane protein, it is most likely to be a protein that that functions as a receptor or ligand on the cell surface. Therefore, it is possible to reveal a new relationship between a ligand and receptor by screening the membrane protein of the invention based on the binding activity with the known ligand or receptor. Screening can be performed according to the known methods.

[0281] For example, a ligand against the protein of the invention can be screened in the following manner. Namely, a ligand that binds to a specific protein can be screened by a method comprising the steps of: (a) contacting a test sample with the protein of the invention or a partial peptide thereof, or cells expressing these, and (b) selecting a test sample that binds to said protein, said partial peptide, or said cells.

[0282] On the other hand, for example, screening using cells expressing the protein of the present invention that is a receptor protein can also be performed as follows. It is possible to screen receptors that is capable of binding to a specific protein by using procedures (a) attaching the sample cells to the protein of the invention or its partial peptide, and (b) selecting cells that can bind to the said protein or its partial peptide.

[0283] In a following screening as an example, first the protein of the invention is expressed, and the recombinant protein is purified. Next, the purified protein is labeled, binding assay is performed using a various cell lines or primary cultured cells, and cells that are expressing a receptor are selected (Growth and differentiation factors and their receptors, Shin-Seikagaku Jikken Kouza Vol. 7 (1991) Honjyo, Arai, Taniguchi, and Muramatsu edit, p 203–236, Tokyo-Kagaku-Doujin). A protein of the invention can be labeled with RI such as ¹²⁵I, and enzyme (alkaline phosphatase etc.). Alternatively, a protein of the invention may be used without labeling and then detected by using a labeled antibody against the protein. The cells that are selected by the above screening methods, which express a receptor of the protein of the invention, can be used for the further screening of an agonists or antagonists of the said receptor.

[0284] Once the ligand binding to the protein of the invention, the receptor of the protein of the invention or the cells expressing the receptor are obtained by screening, it is possible to screen a compound that binds to the ligand and receptor. Also it is possible to screen a compound that can inhibit both bindings (agonists or antagonists of the receptor, for example) by utilizing the binding activities.

[0285] When the protein of the invention is a receptor, the screening method comprises the steps of (a) contacting the protein of the invention or cells expressing the protein of the invention with the ligand, in the presence of a test sample, (b) detecting the binding activity between said protein or cells expressing said protein and the ligand, and (c) selecting a compound that reduces said binding activity when compared to the activity in the absence of the test sample. Furthermore, the protein of the invention is a ligand, the screening method comprises the steps of (a) contacting the protein of the invention with its receptor or cells expressing the receptor in the presence of samples, (b) detecting the binding activity between the protein and its receptor or the cells expressing the receptor, and (c) selecting a compound that can potentially reduce the binding activity compared to the activity in the absence of the sample.

[0286] Samples to screen include cell extracts, expressed products from a gene library, synthesized low molecular compound, synthesized peptide, and natural compounds, for example, but are not construed to be listed here. A compound that is isolated by the above screening using a binding activity of the protein of the invention can also be used as a sample.

[0287] A compound isolated by the screening may be a candidate to be an agonist or an antagonist of the receptor of the protein. By utilizing an assay that monitors a change in the intracellular signaling such as phosphorylation that results from reduction of the binding between the protein and its receptor, it is possible to identify whether the obtained compound is an agonist or antagonist of the receptor. Also, the compound may be a candidate of a molecule that can inhibit the interaction between the protein and its associated proteins (including a receptor) in vivo. Such compounds can be used for developing drugs for precaution or cures of a disease with which the protein is associated.

[0288] Secretory proteins may regulate cellular conditions such as growth and differentiation. It is possible to find out a novel factor that regulates cellular conditions by adding the secretory protein of the invention to a certain kind of cell, and performing a screening by utilizing the cellular changes in growth or differentiation, or activation of a particular gene.

[0289] The screening can be performed, for example, as follows. First, the protein of the invention is expressed and purified in a recombinant form. Then, the purified protein is added to a various kind of cell lines or primary cultured cells, and the change in the cell growth and differentiation is monitored. The induction of a particular gene that is known to be involved in a certain cellular change is detected with the amounts of mRNA and protein. Alternatively, the amount of an intracellular molecule (low molecular compounds, etc.) that is changed by the function of a gene product (protein) that is known to be functioning in a certain cellular change is used for the detection.

[0290] Once the screening reveals that the protein of the invention can regulate cellular conditions or the functions, it is possible to apply the protein as a pharmaceutical and diagnostic medicine for associated diseases by itself or by altering a part of it into an appropriate composition.

[0291] As is above described for membrane proteins, the secretory protein provided by the invention may be used to explore a novel ligand-receptor interaction using a screening based on the binding activity to a known ligand or receptor. A similar method can be used to identify an agonist or the antagonist. The resulting compounds obtained by the methods can be a candidate of a compound that can inhibit the interaction between the protein of the invention and an interacting molecule (including a receptor). The compounds may be able to use as a preventive, therapeutic, and diagnostic medicine for the diseases, in which the protein may play a certain role.

[0292] If the protein or gene of the invention is associated with diseases, it is possible to screen a gene or compound that can regulate its expression and/or activity either directly or indirectly by utilizing the protein of the present invention.

[0293] For example, the protein of the invention is expressed and purified as a recombinant protein. Then, the protein or gene that interacts with the protein of the invention is purified, and screened based on the binding. Alternatively, the screening can be performed by adding with a compound of a candidate of the inhibitor added in advance and monitoring the change of binding activity. The compound obtained by the screening can be used for developing pharmaceutical and diagnostic medicines for the diseases with which the protein of the present invention is associated. Similarly, if the regulatory factor obtained by the screening is a protein, the protein itself can be used as a pharmaceutical, and if there is a compound that affects the original expression level and/or activity of the protein, it also can be used for the same purpose.

[0294] If the secrete or membrane protein of the present invention has an enzymatic activity, it is possible to identify the activity by adding a compound to the protein of the present invention under an appropriate condition, and monitoring the change of the compound. It is also possible to screen a compound that inhibits the activity of the protein of the invention by utilizing the activity as an index.

[0295] In a screening given as an example, the protein of the invention is expressed and the recombinant protein is purified. Then, compounds are contacted with the purified protein, and the amount of the compound and the reaction products is examined. Alternatively, compounds that are candidates of an inhibitor are pretreated, then a compound (substrate) that can react with the purified protein is added, and the amount of the substrate and the reaction products is examined.

[0296] The compounds obtained in the screening may be used as a medicine for diseases with which the protein of the invention is associated. Also they can be applied for tests that examine whether the protein of the invention functions normally in vivo.

[0297] Whether the secretory or membrane protein of the present invention is a novel protein associated with diseases or not is determined in another method than described above, by obtaining a specific antibody against the protein of the invention, and examining the relationship between the expression or activity of the protein and a certain disease. In an alternative way, it may be analyzed referred to the methods in “Molecular Diagnosis of Genetic Diseases” (Elles R. edit, (1996) in the series of “Method in Molecular Biology” (Humana Press).

[0298] The secrete or membrane protein of the present invention can be prepared as a recombinant protein or a natural protein. For example, a recombinant protein can be prepared by introducing a vector containing a DNA insert encoding the protein of the invention into an appropriate host cell, and purifying the expressed products from the transformant, as described below. On the other hand, a natural protein can be prepared, for example, by utilizing an affinity column which is bound with the antibody against the protein of the invention, as described below (“Current Protocols in Molecular Biology” Ausubel et al. edit. (1987) John Wily & Sons, Section 16.1–16.19). The antibody used in the preparation of an affinity column can be a monoclonal antibody or polyclonal antibody. Alternatively, it is possible to prepare the protein of the invention by in vitro translation (See “On the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system.” Dasso M. C., and Jackson R. J. (1989) Nucleic Acids Res. 17: 3129–3144).

[0299] Proteins functionally equivalent to the proteins of the present invention can be prepared based on the activities, which were clarified in the above-mentioned manner, of the proteins of the present invention. Using the biological activity possessed by the protein of the invention as an index, it is possible to verify whether or not a particular protein is functionally equivalent to the protein of the invention by examining whether or not the protein has said activity.

[0300] Proteins functionally equivalent to the proteins of the present invention can be prepared by those skilled in the art, for example, by using a method for introducing mutations into an amino acid sequence of a protein (for example, site-directed mutagenesis (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 8.1–8.5). Besides, such proteins can be generated by spontaneous mutations. The present invention comprises the proteins having one or more amino acid substitutions, deletions, insertions and/or additions in the amino acid sequences of the proteins of the present invention (Table 1), as far as the proteins have the equivalent functions to those of the proteins identified in the present Examples described later.

[0301] There are no limitations in the number and sites of amino acid mutations, as far as the proteins maintain the functions thereof. The number of mutations is typically 30% or less, or 20% or less, or 10% or less, preferably within 5% or less, or 3% or less of the total amino acids, more preferably within 2% or less or 1% or less of the total amino acids. From the viewpoint of maintaining the protein function, it is preferable that a substituted amino has a similar property to that of the original amino acid. For example, Ala, Val, Leu, Ile, Pro, Met, Phe and Trp are assumed to have similar properties to one another because they are all classified into a group of non-polar amino acids. Similarly, substitution can be performed among non-charged amino acid such as Gly, Ser, Thr, Cys, Tyr, Asn, and Gln, acidic amino acids such as Asp and Glu, and basic amino acids such as Lys, Arg, and His.

[0302] In addition, proteins functionally equivalent to the proteins of the present invention can be isolated by using techniques of hybridization or gene amplification known to those skilled in the art. Specifically, using the hybridization technique (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.3–6.4)), those skilled in the art can usually isolate a DNA highly homologous to the DNA encoding the protein identified in the present Example based on the identified nucleotide sequence (Table 1) or a portion thereof and obtain the functionally equivalent protein from the isolated DNA. The present invention include proteins encoded by the DNAs hybridizing with the DNAs encoding the proteins identified in the present Example, as far as the proteins are functionally equivalent to the proteins identified in the present Example. Organisms from which the functionally equivalent proteins are isolated are illustrated by vertebrates such as human, mouse, rat, rabbit, pig and bovine, but are not limited to these animals.

[0303] Washing conditions of hybridization for the isolation of DNAs encoding the functionally equivalent proteins are usually “1×SSC, 0.1% SDS, 37“C”; more stringent conditions are “0.5×SSC, 0.1% SDS, 42“C”; and still more stringent conditions are “0.1×SSC, 0.1% SDS, 65° C.”. Alternatively, the following conditions can be given as hybridization conditions of the present invention. Namely, conditions in which the hybridization is done at “6×SSC, 40% Formamide, 25“C”, and the washing at “1×SSC, 55“C” can be given. More preferable conditions are those in which the hybridization is done at “6×SSC, 40% Formamide, 37“C”, and the washing at “0.2×SSC, 55“C”. Even more preferable are those in which the hybridization is done at “6×SSC, 50% Formamide, 37“C”, and the washing at “0.1×SSC, 62° C.”. The more stringent the conditions of hybridization are, the more frequently the DNAs highly homologous to the probe sequence are isolated. Therefore, it is preferable to conduct hybridization under stringent conditions. Examples of stringent conditions in the present invention are, washing conditions of “0.5×SSC, 0.1% SDS, 42“C”, or alternatively, hybridization conditions of “6×SSC, 40% Formamide, 37“C”, and the washing at “0.2×SSC, 55“C”. However, the above-mentioned combinations of SSC, SDS and temperature conditions are indicated just as examples. Those skilled in the art can select the hybridization conditions with similar stringency to those mentioned above by properly combining the above-mentioned or other factors (for example, probe concentration, probe length and duration of hybridization reaction) that determines the stringency of hybridization.

[0304] The amino acid sequences of proteins isolated by using the hybridization techniques usually exhibit high homology to those of the proteins of the present invention, which are shown in Table 1. The present invention encompasses a polynucleotide comprising a nucleotide sequence that has a high identity to the nucleotide sequence of claim 1 (a). Furthermore, the present invention encompasses a peptide, or protein comprising an amino acid sequence that has a high identity to the amino acid sequence encoded by the encoded polynucleotide of claim 1 (b). The term “high identity” indicates sequence identity of at least 40% or more; preferably 60% or more; and more preferably 70% or more. Alternatively, more preferable is identity of 90% or more, or 93% or more, or 95% or more, furthermore, 97% or more, or 99% or more. The identity can be determined by using the BLAST search algorithm.

[0305] With the gene amplification technique (PCR) (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.3–6.4)) using primers designed based on the DNA sequence (Table 1) or a portion thereof identified in the present Example, it is possible to isolate a DNA fragment highly homologous to the DNA sequence or a portion thereof and to obtain functionally equivalent protein to a particular protein identified in the present Example based on the isolated DNA fragment.

[0306] The “percent identity” of two amino acid sequences or of two nucleic acids is determined using the algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87:2264–2268, 1990), modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90:5873–5877, 1993). Such an algorithm is incorporated into the BLASTN and BLASTX program of Altschul et al. (J. Mol. Biol. 215:403–410, 1990). BLAST nucleotide searches are performed with BLASTN programs, score=100, wordlength=12. BLAST protein searches are performed with BLASTX program, score=50, wordlength=3. When gaps exist between two sequences, Gapped BLAST is utilized as described in Altschul et al. (Nucleic Acids Res. 25:3389–3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTX and BALSTN) are used.

[0307] The present invention also includes a partial peptide of the proteins of the invention. The partial peptide comprises a protein generated as a result that a signal peptide has been removed from a secretory protein. If the protein of the present invention has an activity as a receptor or a ligand, the partial peptide may function as a competitive inhibitor of the protein and may bind to the receptor (or ligand). In addition, the present invention comprises an antigen peptide for raising antibodies. For the peptides to be specific for the protein of the invention, the peptides comprise at least 7 amino acids, preferably 8 amino acids or more, more preferably 9 amino acids or more, and even more preferably 8 amino acids or more. The peptide can be used for preparing antibodies against the protein of the invention, or competitive inhibitors of them, and also screening for a receptor that binds to the protein of the invention. The partial peptides of the invention can be produced, for example, by genetic engineering methods, known methods for synthesizing peptides, or digesting the protein of the invention with an appropriate peptidase.

[0308] The present invention also relates to a polynucleotide encoding the protein of the invention. The polynucleotide of the invention can be provided in any form as far as it encodes the protein of the invention, and thus includes cDNA, genomic DNA, and chemically synthesized DNA, etc. The polynucleotide also includes a DNA comprising any nucleotide sequence that is obtained based on the degeneracy of the genetic code, as far as it encodes the protein of the invention. The polynucleotide of the invention can be isolated by the standard methods such as hybridization using a probe DNA comprising the nucleotide sequence set forth in odd SEQ ID NOs of SEQ ID NO: 1 to SEQ ID NO: 335, or the portions of them, or by PCR using primers that are synthesized based on the nucleotide sequence.

[0309] For example, all the clones provided by the present invention, which were isolated in the example mentioned below, (173 clones) are novel and full-length, and encode a secretory protein or membrane protein. All the cDNA clones provided by the invention are characterized as follows.

[0310] A full-length-enriched cDNA library that is obtained by the oligo-capping method, and selected based on the features of the 5′-end sequence: by the score in the ATGpr (or described as ATGpr1), which predicts the fullness ratio of the 5′-end, and by the PSORT, which predicts the presence of the signal sequence, as those containing the signal sequence in the 5′-end, or transmembrane region in the protein coding region. Furthermore, as a result of the homology search using the 5′-end sequences, the clones were found to be not identical to any of the known human mRNA (therefore to be novel).

[0311] The present invention also relates to a vector into which the polynucleotide of the invention is inserted. The vector of the invention is not limited as long as it contains the inserted polynucleotide stably. For example, if E. coli is used as a host, vectors such as pBluescript vector (Stratagene) are preferable as a cloning vector. To produce the protein of the invention, expression vectors are especially useful. Any expression vector can be used as far as it is capable of expressing the protein in vitro, in E. coli, in cultured cells, or in vivo. For example, pBEST vector (Promega) is preferable for in vitro expression, pET vector (Invitrogen) for E. coli, pME18S-FL3 vector (GenBank Accession No. AB009864) for cultured cells, and pME18S vector (Mol. Cell. Biol. (1988) δ: 466–472) for in vivo expression. To insert the polynucleotide of the invention, ligation utilizing restriction sites can be performed according to the standard method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wily & Sons, Section 11.4–11.11).

[0312] The present invention also relates to a transformant carrying the polynucleotide or the vector of the invention. Any cell can be used as a host into which the vector of the invention is inserted, and various kinds of host cells can be used depending on the purposes. For strong expression of the protein in eukaryotic cells, COS cells or CHO cells can be used, for example.

[0313] Introduction of the vector into host cells can be performed, for example, by calcium phosphate precipitation method, electroporation method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wily & Sons, Section 9.1–9.9), lipofectamine method (GIBCO-BRL), or microinjection method, etc.

[0314] The present invention also relates to a oligonucleotide having a length of at least 15 nucleotides, comprising a nucleotide sequence that is complementary to a polynucleotide comprising the nucleotide sequence set forth in odd SEQ ID NOs of SEQ ID NO: 1 to SEQ ID NO: 335, or its complementary strand. The oligonucleotide of the present invention hybridizes with a polynucleotide of odd SEQ ID NOs of SEQ ID NO: 1 to SEQ ID NO: 335 encoding the protein of the invention, or its complementary strand, under the standard conditions for hybridization, or preferably under stringent conditions, and in principle does not preferably hybridize with DNA encoding other proteins. Such oligonucleotide can be used as a probe for isolation and detection of the polynucleotide of the invention, and as a primer for amplifying the polynucleotide of the present invention. As a primer, the DNA usually has a length of 15–100 bp, preferably 15–50 bp, and more preferably has a length of 15–35 bp. As a probe, the DNA contains the entire sequence of the DNA of the invention, or at least the portion of it, and has a length of at least 15 bp, preferably 30 bp or more, and more preferably 50 bp or more.

[0315] Any sequence shown in SEQ ID NOs: 370–540 and that shown in SEQ ID NOs: 541–679 can be chosen as the nucleotide sequence comprising the 5′-end primer and the 3′-end primer, respectively, to synthesize the full-length cDNAs of the present invention. Although, among these nucleotide sequences, some nucleotide sequences have already been known as EST sequences, the primers designed based on the present invention is novel in that they make it possible to synthesize full-length cDNA. The known EST sequences do not serve to design such primers because the EST sequences lack the crucial information about the location thereof within the corresponding cDNAs.

[0316] Each of the full-length cDNAs of the present inventions can be synthesized by PCR (Current Protocols in Molecular Biology, ed., Ausubel et al., (1987) John Wiley & Sons, Section 6.1–6.4) using a pair of primers selected from the 5′-end sequences and the 3′-end sequences or using a primer pair consisting of a primer selected from the 5′-end sequences and a primer with oligo(dT) sequence complementary to the poly(A) sequence.

[0317] Specifically, PCR can be performed using an oligonucleotide that has 15 nucleotides longer, and specifically hybridizes with the complementary strand of the polynucleotide that contains the nucleotide sequence selected from the 5′-end sequences shown in Table 342 (SEQ ID NO: 370–540), and an oligo-dT primer as a 5′-, and 3′-primer, respectively. The length of the primers is usually 15–100 bp, and favorably between 15–35 bp. In case of LA PCR, which is described below, the primer length of 25–35 bp may provide a good result.

[0318] A method to design a primer that enables a specific amplification based on the given nucleotide sequence is known to those skilled in the art (Current Protocols in Molecular Biology, Ausubel et al. edit, (1987) John Wiley & Sons, Section 6.1–6.4). In designing a primer based on the 5′-end sequence, the primer is designed so as that, in principle, the amplification products will include the translation start site. Accordingly, in case that a given 5′-end nucleotide sequence is the 5′-untranslated region (5′UTR), any part of the sequence can be used as a 5′-primer as far as the specificity toward the target cDNA is insured. The translation start site can be predicted using a known method such as the ATGpr as described below.

[0319] When synthesizing a full-length cDNA, the target nucleotide sequence to be amplified can extend to several thousand bp in some cDNA. However, it is possible to amplify such a long nucleotides by using such as LA PCR (Long and Accurate PCR). It is advantageous to use LA PCR when synthesizing long DNA. In LA PCR, in which a special DNA polymerase having 3′ 5′ exonuclease activity is used, misincorporated nucleotides can be removed. Accordingly, accurate synthesis of the complementary strand can be achieved even with a long nucleotide sequence. By using LA PCR, it is reported that amplification of a nucleotide with 20 kb longer can be achieved under desirable condition (Takeshi Hayashi (1996) Jikken-lgaku Bessatsu, “Advanced Technologies in PCR” Youdo-sha).

[0320] A template DNA for synthesizing the cDNA of the present invention can be obtained by using cDNA libraries that are prepared by various methods. The full-length cDNA clones obtained here are those with high fullness ratio, which were obtained using a combination of (1) a method to prepare a full-length-enriched cDNA library using the oligo-capping method, and (2) an estimation system for fullness using the 5′-end sequence (selection based on the estimation by the ATGpr after removing clones that are non-full-length compared to the ESTs). However, it is possible to easily obtain a full-length cDNA by using the primers that are provided by the present invention, not by the above described specialized method.

[0321] The problem with the cDNA libraries prepared by the known methods or commercially available is that mRNA contained in the libraries has very low fullness ratio. Thus, it is difficult to screen full-length cDNA clone directly from the library using ordinary cloning methods. The present invention has revealed a primer that is capable of synthesizing a full-length cDNA. If provided with primers, it is possible to synthesize a target full-length cDNA by using enzymatic reactions such as PCR. In particular, a full-length-enriched cDNA library, synthesized by methods such as oligo-capping, is desirable to synthesize a full-length cDNA with more reliability.

[0322] Transcriptional regulatory regions including promoters in the genotype can be isolated by utilizing the 5′-end sequences of the full-length cDNA clones of the present invention. The rough draft (slightly inaccurate sequencing result obtained in the analysis of human genome) covering 90% or more of the entire human genome is expected to be achieved in the spring of 2000, and the entire analysis of human genome sequence is expected to be completed by 2003. Because of the presence of long introns, it is hard to determine the transcription initiation sites in human genome by using analytical software. The utilization of the 5′-end sequences of the full-length cDNA sequences of the present invention makes it easy to isolate promoter-containing genomic regions that are located upstream of transcription initiation sites and are involved in mRNA transcription regulation. This is because the mRNA transcription initiation sites in the genome can be identified easily based on the 5′-end sequences of the full-length cDNAs.

[0323] The polynucleotide of the present invention can be used for examination and diagnosis of the abnormality of the protein of the invention. For example, it is possible to examine the abnormal expression of the gene encoding the protein using the polynucleotide of the invention as a probe for Northern hybridization or as a primer for RT-PCR. Also, the polynucleotide of the invention can be used as a primer for polymerase chain reaction (PCR) such as the genomic DNA-PCR, and RT-PCR to amplify the polynucleotide encoding the protein of the invention, or the regulatory region of the expression, with which it is possible to examine and diagnose the abnormality of the sequence by RFLP analysis, SSCP, and direct sequencing, etc.

[0324] Furthermore, the “polynucleotide having a length of at least 15 nucleotides, comprising a nucleotide sequence that is complementary to a polynucleotide comprising the nucleotide sequence set forth in odd SEQ ID NOs of SEQ ID NO: 1 to SEQ ID NO: 335, or its complementary strand” includes an antisense polynucleotide for suppressing the expression of the protein of the invention. To exert the antisense effect, the antisense polynucleotide has a length of at least 15 bp or more, for example, 50 bp or more, preferably 100 bp or more, and more preferably 500 bp or more, and has a length of usually 3000 bp or less and preferably 2000 bp or less. The antisense DNA can be used in the gene therapy of the diseases that are caused by the abnormality of the protein of the invention (abnormal function or abnormal expression). Said antisense DNA can be prepared, for example, by the phosphorothioate method (“Physicochemical properties of phosphorothioate oligodeoxynucleotides.” Stein (1988) Nucleic Acids Res. 16: 3209–3221) based on the nucleotide sequence of the DNA encoding the protein (for example, the DNA set forth in odd SEQ ID NOs of SEQ ID NO: 1 to SEQ ID NO: 335).

[0325] The polynucleotide or antisense DNA of the present invention can be used in gene therapy, for example, by administrating it into a patient by the in vivo or ex vivo method with virus vectors such as retrovirus vectors, adenovirus vectors, and adeno-associated virus vectors, or non-virus vectors such as liposome.

[0326] The present invention also relates to antibodies that bind to the protein of the invention. There are no limitations in the form of the antibodies of the invention. They include polyclonal antibodies, monoclonal antibodies, or their portions that can bind to the antigen. They also include antibodies of all classes. Furthermore, special antibodies such as humanized antibodies are also included.

[0327] The polyclonal antibody of the invention can be obtained according to the standard method by synthesizing an oligopeptide corresponding to the amino acid sequence and immunizing rabbits with the peptide (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wily & Sons, Section 11.12–11.13). The monoclonal antibody of the invention can be obtained according to the standard method by purifying the protein expressed in E. coli, immunizing mice with the protein, and producing a hybridoma cell by fusing the spleen cells and myeloma cells (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wily & Sons, Section 11.4–11.11).

[0328] The antibody binding to the protein of the present invention can be used for purification of the protein of the invention, and also for detection and/or diagnosis of the abnormalities of the expression and structure of the protein. Specifically, proteins can be extracted, for example, from tissues, blood, or cells, and the protein of the invention is detected by Western blotting, immunoprecipitation, or ELISA, etc. for the above purpose.

[0329] Furthermore, the antibody binding to the protein of the present invention can be utilized for treating the diseases that associates with the protein of the invention. If the antibodies are used for treating patients, human antibodies or humanized antibodies are preferable in terms of their low antigenicity. The human antibodies can be prepared by immunizing a mouse whose immune system is replaced with that of human (“Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice” Mendez M. J. et al. (1997) Nat. Genet. 15: 146–156, for a reference). The humanized antibodies can be prepared by recombination of the hypervariable region of a monoclonal antibody (Methods in Enzymology (1991) 203: 99–121).

[0330] The present invention further relates to databases comprising at least a sequence of polynucleotides and/or protein, or a medium recorded in such databases, selected from the sequence data of the nucleotide and/or the amino acids indicated in Table 1. The term “database” means a set of accumulated information as machine-searchable and readable information of nucleotide sequence. The databases of the present invention comprise at least one of the novel nucleotide sequences of polynucleotides provided by the present invention. The databases of the present invention can consist of only the sequence data of the novel polynucleotides provided by the present invention or can comprise other information on nucleotide sequences of known full-length cDNAs or ESTs. The databases of the present invention can be comprised of not only the information on the nucleotide sequences but also the information on the gene functions revealed by the present invention. Additional information such as names of DNA clones carrying the full-length cDNAs can be recorded or linked together with the sequence data in the databases.

[0331] The database of the present invention is useful for gaining complete gene sequence information from partial sequence information of a gene of interest. The database of the present invention comprises nucleotide sequence information of full-length cDNAs. Consequently, by comparing the information in this database with the nucleotide sequence of a partial gene fragment yielded by differential display method or subtraction method, the information on the full-length nucleotide sequence of interest can be gained from the sequence of the partial fragment as a starting clue.

[0332] The sequence information of the full-length cDNAs constituting the database of the present invention contains not only the information on the complete sequences but also extra information on expression frequency of the genes as well as homology of the genes to known genes and known proteins. Thus the extra information facilitates rapid functional analyses of partial gene fragments. Further, the information on human genes is accumulated in the database of the present invention, and therefore, the database is useful for isolating a human homologue of a gene originating from other species. The human homologue can be isolated based on the nucleotide sequence of the gene from the original species.

[0333] At present, information on a wide variety of gene fragments can be obtained by differential display method and subtraction method. In general, these gene fragments are utilized as tools for isolating the full-length sequences thereof. When the gene fragment corresponds to an already-known gene, the full-length sequence is easily obtained by comparing the partial sequence with the information in known databases. However, when there exists no information corresponding to the partial sequence of interest in the known databases, cDNA cloning should be carried out for the full-length cDNA. It is often difficult to obtain the full-length nucleotide sequence using the partial sequence information as an initial clue. If the full-length of the gene is not available, the amino acid sequence of the protein encoded by the gene remains unidentified. Thus the database of the present invention can contribute to the identification of full-length cDNAs corresponding to gene fragments, which cannot be revealed by using databases of known genes. The present invention has provided 173 proteins that are novel secretory proteins or membrane proteins, and full-length cDNA clones encoding the proteins. It has great significance to provide a novel full-length cDNA clone of humans, as only few a of which have been isolated. It was found that the secretory proteins and membrane proteins of the present invention are associated with many diseases. Those genes and proteins associated with diseases are useful for developing medicines as they can be used as a diagnostic marker, or a target for gene therapy or developing medicines that is capable of regulating their expression and activity. Especially, the cDNA clones encoding a secretory protein are extremely important for medicinal industry since the protein itself is expected to be effective as a medicine, and also the gene may have potential to be associated with many diseases. Moreover, those proteins such as membrane proteins and the genes encoding the proteins may be used as a disease marker. These cDNA clones are also important for medicinal industry as they may be effective for treating diseases through the regulation of the expression and activity of their encoded proteins.

[0334] The invention is illustrated more specifically with reference to the following examples, but is not to be construed as being limited thereto.

[0335] The NT-2 neuron progenitor cells (Stratagene), a teratocarcinoma cell line from human embryo testis, which can differentiate into neurons by treatment with retinoic acid were used. The NT-2 cells were cultured according to the manufacturer's instructions as follows.

• • [0336] (1) NT-2 cells were cultured without induction by retinoic acid treatment (NT2RM1).
  • [0337] (2) After cultured, NT-2 cells were induced by adding retinoic acid, and then were cultured for 48 hours (NT2RP1).
  • [0338] (3) After cultured, NT-2 cells were induced by adding retinoic acid, and then were cultured for 2 weeks (NT2RP2).

[0339] The cells were harvested separately, from which mRNA was extracted by the method described in the literature (Molecular Cloning 2nd edition. Sambrook J., Fritsch, E. F., and Maniatis T. (1989) Cold Spring Harbor Laboratory Press). Furthermore, poly(A)⁺ RNA was purified from the mRNA using oligo-dT cellulose.

[0340] Similarly, human placenta tissues (PLACE1), human ovary cancer tissues (OVARC1), and human embryo-derived tissues that were enriched with brain (HEMBA1) were used to extract mRNA by the method described in the literature (Molecular Cloning 2nd edition. Sambrook J., Fritsch, E. F., and Maniatis T. (1989) Cold Spring Harbor Laboratory Press). Furthermore, poly(A)⁺RNA was purified from the mRNA using oligo-dT cellulose.

[0341] Each poly(A)⁺RNA was used to construct a cDNA library by the oligo-capping method (Maruyama M. and Sugano S. (1994) Gene 138: 171–174). Using the Oligo-cap linker (SEQ ID NO: 337) and the Oligo-dT primer (SEQ ID NO: 338), BAP (bacterial alkaline phosphatase) treatment, TAP (tobacco acid phosphatase) treatment, RNA ligation, the first strand cDNA synthesis, and removal of RNA were performed as described in the reference (Suzuki and Kanno (1996) Protein Nucleic acid and Enzyme. 41: 197–201; Suzuki Y. et al. (1997) Gene 200: 149–156). Next, 5′- and 3′-PCR primers (SEQ ID NO: 339, and 340, respectively) were used for performing PCR (polymerase chain reaction) to convert the cDNA into double stranded cDNA, which was then digested with SfiI. Then, the DraIII-cleaved pUC19FL3 vector (FIG. 1; for NT2RM1, and NT2RP1), or the DraIII-cleaved pME18SFL3 (FIG. 1) (GenBank AB009864, expression vector; for NT2RP2, NT2RP3, PLACE1, OVARC1, and HEMBA1) was used for cloning the cDNA in an unidirectional manner, and cDNA libraries were obtained. The clones having an insert cDNA with a length of 1 kb or less were discarded from NT2RM1, NT2RP1, NT2RP2, PLACE1, OVARC1, and HEMBA1, and the clones having an insert cDNA with a length of 2 kb or less were discarded from NT2RP3. Then, the nucleotide sequence of the 5′- and 3′-ends of the cDNA clones was analyzed with a DNA sequencer (ABI PRISM 377, PE Biosystems) after sequencing reactions were performed with the DNA sequencing reagents (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine Terminator Cycle Sequencing FS Ready Reaction Kit, or BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, from by PE Biosystems) according to the instructions.

[0342] The so analyzed 5′-end and 3′-end nucleotide sequences of the clones are shown in SEQ ID NOs: 370–540 and in SEQ ID NOs: 541–679, respectively. The SEQ IDs and the corresponding PSEC clones are as indicated in Table 342.

[0343] The cDNA libraries of NT2RP2 and HEMBA1 were constructed using eukaryotic expression vector pME18SFL3. The vector contains SRα promoter and SV40 small t intron in the upstream of the cloning site, and SV40 polyA added signal sequence site in the downstream. As the cloning site of pME18SFL3 has asymmetrical DraIII sites, and the ends of cDNA fragments contain SfiI sites complementary to the DraIII sites, the cloned cDNA fragments can be inserted into the downstream of the SRα promoter unidirectionally. Therefore, clones containing full-length cDNA can be expressed transiently by introducing the obtained plasmid directly into COS cells. Thus, the clones can be analyzed very easily in terms of the proteins that are the gene products of the clones, or in terms of the biological activities of the proteins.

[0344] The fullness ratio at the 5′-end sequences of the cDNA clones in the libraries constructed by the oligo-capping method was determined as follows. Of all the clones whose 5′-end sequences were found in those of known human mRNA in the public database, a clone was judged to be “full-length”, if it had a longer 5′-end sequence than that of the known human mRNA, or, even though the 5′-end sequence was shorter, if it contained the translation initiation codon. A clone that did not contain the translation initiation codon was judged to be “non-full-length”. The fullness ratio ((the number of full-length clones)/(the number of full-length and non-full-length clones)) at the 5′-end of the cDNA clones from each library was determined by comparing with the known human mRNA (NT2RM1: 69%; NT2RP1: 75%; NT2RP2: 62% NT2RP3: 61%, PLACE1: 68%; OVARC1: 59%; and HEMBA1: 53%). The result indicates that the fullness ratio at the 5′-end sequence was extremely high.

[0345] The relationship between the cDNA libraries and the clones is shown below.

• • [0346] NT2RM1: PSEC0001-PSEC0017
  • [0347] NT2RP1: PSEC0019-PSEC0047
  • [0348] NT2RP2: PSEC0048-PSEC0085, PSEC0092-PSEC0109, PSEC0111-PSEC0113, PSEC0173
  • [0349] NT2RP3: PSBC0241-PSBC0265
  • [0350] PLACE1: PSEC0086-PSEC0090, PSEC0110, PSEC0117-PSBC0172
  • [0351] OVARC1: PSEC0178-PSEC0183, PSEC0239-PSEC0240

[0352] Estimation of the fullness ratio at the 5′-end of the cDNA by the ATGpr and the ESTiMateFL. The ATGpr, developed by Salamov A. A., Nishikawa T., and Swindells, M. B. in the Helix Research Institute, is a program for prediction of the translation initiation codon based on the characteristics of the sequences in the vicinity of the ATG codon [A. A. Salamov, T. Nishikawa, and M. B. Swindells, Bioinformatics, 14:384–390 (1998)]. The results are shown with expectations (also described as ATGpr1 below) that an ATG is a true initiation codon (0.05–0.94). When the program was applied to the 5′-end sequences of the clones from the cDNA library that was obtained by the oligo-capping method and that had 65% fullness ratio, the sensitivity and specificity of estimation of a full-length clones (clone containing the N-terminal end of ORF) were improved to 82–83% by selecting only clones having the ATGpr1 score 0.6 or higher. Furthermore, the 17,365 clones in which the 5′-end sequence is identical to a known human mRNA and which were cloned from the human cDNA libraries constructed by the oligo-capping method, were estimated by the program. Briefly, the maximal ATGpr1 score of the clones was determined, and then their 5′-end sequence was compared with the known human mRNA to estimate whether the clone is full-length or not. The result was summarized in Table 2. It is indicated that the method for the selection through the combination of the ATGpr and the clones isolated from the human cDNA library that was constructed by the oligo-capping method was very efficient.

[0353]

	TABLE 2
		number of
		full-length	number
	maximal	and	of
	ATGpr1	not-full-length	full-length	fullness
	Score	clones	clones	ratio
	>=0.70	10,226	8,428	82.4%
	>=0.50	12,171	9,422	77.4%
	>=0.30	14,102	10,054	71.3%
	>=0.17	15,647	10,385	66.4%
	>=0.05	17,365	10,608	61.1%
	* number of full-length clones, the number of the clones which contain the N-terminus of the ORF; the number of not-full-length clones, number of the clones which does not contain the N-terminus of the ORF; fullness ratio, the resulting number of (the number of full-length clones)/(the number of full-length and not-full-length clones)

[0354] The ESTiMateFL, developed by Nishikawa and Ota in the Helix Research Institute, is a method for the selection of a clone with high fullness ratio by comparing with the 5′-end or 3′-end sequences of ESTs in the public database.

[0355] By the method, a cDNA clone is judged presumably not to be full-length if there are any ESTs that have longer 5′-end or 3′-end sequences than the clone. The method is systematized for high throughput analysis. A clone is judged to be full-length if the clone has a longer 5′-end sequence than ESTs in the public database. Even if a clone has a shorter 5′-end, the clone is judged to be full-length if the difference in length is within 50 bases, and otherwise judged not to be full-length, for convenience. The precision of the prediction by comparing cDNA clones with ESTs is improved with increasing number of ESTs to be compared. However, when only a limited number of ESTs are available, the reliability becomes low. Thus, the method is effective in excluding clones with high probability of being not-full-length, from the cDNA clones that is synthesized by the oligo-capping method and that have the 5′-end sequences with about 60% fullness ratio. In particular, the ESTiMateFL is efficiently used to estimate the fullness ratio at the 3′-end sequence of cDNA of a human unknown mRNA that has a significant number of ESTs in the public database.

[0356] The results were summarized in Tables 3 and 4. It was confirmed that, in estimating the fullness ratio at the 5′-end sequence of the clones of the human cDNA library that was constructed by the oligo-capping method, the fullness ratio was improved even for the clones having low score in the ATGpr by combining the ATGpr and ESTiMateFL. The result was applied to the estimation of the fullness ratio at the 5′-end sequence of the clones whose complete cDNA sequences were determined. The number of full-length clones, the number of not-full-length clones, and the fullness ratio indicate the number of the clones which contain the N-terminus of the ORF, the number of the clones which does not contain the N-terminus of the ORF, and the resulting number of (the number of full-length clones)/(the number of full-length and not-full-length clones), respectively.

[0357]

TABLE 3
The fullness ratio at the 5′-end sequence of the cDNA clones that were
judged to be full-length by comparing the ORF of the known human
mRNA and that were obtained by the oligo-capping method, wherein the
ratio was evaluated by comparing the cDNA clones with ESTs.
			number
	maximal	number of	of
	ATGpr1	full-length	not-full-length	fullness
	Score	clones	clones	ratio
	>=0.30	8,646	907	90.5%
	>=0.17	10,158	1,150	89.8%
	>=0.05	15,351	2,728	84.9%

[0358]

TABLE 4
The fullness ratio at the 5′-end sequence of the cDNA clones that were
judged to be not-full-length by comparing the ORF of the known human
mRNA and that were obtained by the oligo-capping method, wherein the
ratio was evaluated by comparing the cDNA clones with ESTs.
			number
	maximal	number of	of
	ATGpr1	full-length	not-full-length	fullness
	Score	clones	clones	ratio
	>=0.30	1,271	2,156	37.1%
	>=0.17	1,678	2,907	36.6%
	>=0.05	2,512	4,529	35.7%

[0359] From the clones in each library constructed by the oligo-capping method, those clones predicted to contain the signal sequence (most likely to be a secretory protein or membrane protein) were specifically selected by analyzing the amino acid sequence that are predicted by all the ATG codons within the 5′-end sequence, for the presence of the signal peptide, which is characteristic in the N-terminus of many secretory proteins, by using the PSORT, developed by Nakai and Kanehisa, which predicts the localization of a protein.

[0360] PSEC0001-PSEC0066 were not selected by the ATGpr score of the 5′-end sequence (one pass sequencing), but selected by the presence of both the signal sequence (analyzed by the PSORT), and the ORF (Open reading frame; a region translated to be amino acids) in the 5′-end sequence. PSEC0068-PSEC0265 were selected as those having the maximal ATGpr1 score of the 5′-end sequence (one pass sequencing) 0.7 or higher, in which both the signal sequence (analyzed by the PSORT) and the ORF exist in the 5′-end sequence.

[0361] For the 173 clones selected in Example 3, the nucleotide sequence of the full-length cDNA and the deduced amino acid sequences were determined. The nucleotide sequences were finally determined by overlapping completely the partial nucleotide sequences of the full-length following three methods. The amino acid sequences were deduced from the determined cDNA sequences. The results were shown in SEQUENCE LISTING (Only the results of the 173 clones that were classified into a secretory protein or membrane protein were shown).

• • [0362] (1) Long-read sequencing from both ends of the cDNA inserts a Licor DNA sequencer (After sequence reactions were performed according to the manual for the Licor sequencer (Aroka), DNA sequence was determined by the sequencer.)
  • [0363] (2) Nested sequencing by the Primer Island method which utilizes the in vitro transfer of AT2 transposon (Devine S. E., and Boeke J. D. (1994) Nucleic Acids Res. 22: 3765–3772) (After clones were obtained using a kit from PE Biosystems, sequence reactions were performed using the DNA sequencing reagents from the company, according to the manufacturer's instructions, and DNA sequence was determined using an ABI PRISM 377 sequencer.)
  • [0364] (3) Primer walking by the dideoxy terminator method using custom synthesized DNA primers (After sequencing reactions were performed using the DNA sequencing reagents from PB Biosystems and custom synthesized DNA primers according to the manufacturer's instructions, DNA sequence was determined using an ABI PRISM 377 sequencer).

[0365] These sequences were subjected to the analysis by the ATGpr and PSORT and also to the BLAST search of the GenBank and SwissProt. As a result, most clones (152 clones out of 173) were predicted to be a secretory protein or membrane protein that contains a signal sequence in the N-terminus. Furthermore, those clones, in which a signal sequence was not found by the PSORT, (PSEC0027, PSEC0047, PSEC0066, nnnnnnnn, PSEC0069, PSEC0092, PSEC0103, PSEC0117, PSEC0142, PSEC0212, PSEC0239, PSEC0242, PSEC0251, PSEC0256, PSEC0006, PSEC0043, PSEC0058, PSEC0195, PSEC0206, and PSEC0211) were subjected to the analysis by the MEMSAT and SOSUI for the identity as a membrane protein (containing the transmembrane helix). As a result, 14 clones among the 20 clones were predicted to contain the transmembrane helix (PSEC0027, PSEC0047, PSEC0066, nnnnnnnn, PSEC0069, PSEC0092, PSEC0103, PSEC0117, PSEC0142, PSEC0212, PSEC0239, PSEC0242, PSEC0251, and PSEC0256). Thus, the clones were predicted to be a membrane protein. As a result of the homology search of the SwissProt, PSEC0195 and PSEC0206 were found to have relatively high homology with mouse plasma membrane adapter HA2/AP2 adaptin α C subunit, and human carboxypeptidase H precursor (prohormone processing carboxypeptidase) in the secretory granule, respectively.

[0366] The above results were shown in List 1, List 2, and List 3. Therein, the function of each cDNA clone (annotation) was shown as well. The categories of the 168 clones out of 173 clones were shown in the followings.

[0367] 1. Clones that are predicted to be a full-length cDNA clone encoding a secretory protein or membrane protein (168 clones)

(Most clones have the ATGpr1 score 0.5 or higher).

[0368] 1) Clones that are predicted to be a full-length cDNA clone encoding a secretory protein or membrane protein, in which a signal sequence is present in the N-terminus (152 clones, List 1).

PSEC0001 PSEC0049 PSEC0085 PSEC0113

nnnnnnnn PSEC0051 PSEC0086 PSEC0119

PSEC0005 PSEC0052 PSEC0087 PSEC0120

PSEC0007 PSEC0053 PSEC0088 PSEC0121

PSEC0008 PSEC0055 PSEC0090 PSEC0124

PSEC0012 PSEC0059 PSEC0094 PSEC0125

PSEC0017 PSEC0061 PSEC0095 PSEC0126

PSEC0019 PSEC0068 PSEC0098 PSEC0127

PSEC0020 PSEC0070 PSEC0099 PSEC0128

PSEC0021 PSEC0071 PSEC0100 PSEC0129

PSEC0028 PSEC0072 PSEC0101 PSEC0130

PSEC0029 PSEC0073 PSEC0104 PSEC0131

PSEC0030 PSEC0074 PSEC0105 PSEC0133

PSEC0031 PSEC0075 PSEC0106 PSEC0134

PSEC0035 PSEC0076 PSEC0107 PSEC0135

PSEC0038 PSEC0077 PSEC0108 PSEC0136

PSEC0040 PSEC0079 PSEC0109 PSEC0137

PSEC0041 PSEC0080 PSEC0110 PSEC0139

PSEC0045 PSEC0081 PSEC0111 PSEC0143

PSEC0048 PSEC0082 PSEC0112 PSEC0144

nnnnnnnn PSEC0178 PSEC0216 PSEC0247

PSEC0147 PSEC0181 PSEC0218 PSEC0248

PSEC0149 PSEC0182 PSEC0220 PSEC0249

PSEC0150 PSEC0183 PSEC0222 PSEC0250

PSEC0151 PSEC0190 PSEC0223 PSEC0252

PSEC0152 PSEC0191 PSEC0224 PSEC0253

PSEC0158 PSEC0192 PSEC0226 PSEC0255

PSEC0159 PSEC0197 PSEC0227 PSEC0258

PSEC0161 PSEC0198 PSEC0228 PSEC0259

PSEC0162 PSEC0199 PSEC0230 PSEC0260

PSEC0163 PSEC0200 PSEC0232 PSEC0261

PSEC0164 PSEC0203 PSEC0233 PSEC0263

PSEC0165 PSEC0204 PSEC0235

PSEC0167 PSEC0205 PSEC0236

PSEC0168 PSEC0207 PSEC0240

PSEC0169 PSEC0209 PSEC0241

PSEC0170 PSEC0210 PSEC0243

PSEC0171 PSEC0213 PSEC0244

PSEC0172 PSEC0214 PSEC0245

PSEC0173 PSEC0215 PSEC0246

[0369] (Annotation 1)

[0370] Clones that have the ATGpr1 score 0.5 or lower (PSEC0017, ATGpr1 0.33; PSEC0030, ATGpr1 0.26; PSEC0031, ATGpr1 0.20; PSEC0049, ATGpr1 0.35): These clones, in which data of the 5′-end sequence (one pass sequencing) was not sorted by the ATGpr, were selected as a clone having both the signal sequence and long ORF based on the data of the 5′-end sequence, and the sequence of their full-length cDNA clones was determined. All the clones have a signal sequence in the N-terminus. In addition, the above 4 clones except PSEC0049 have longer 5′-end compared to the corresponding EST. PSEC0049 has an ORF that has longer 5′-end than that of EST. Thus, these clones turned out to be full-length cDNA clones.

[0371] 2) Clones that are predicted to be, a full-length cDNA encoding a secretory protein or membrane protein, in which the signal sequence is not present in the N-terminus, and predicted to be a membrane protein (14 clones, List 2).

[0372] PSEC0027

[0373] PSEC0047

[0374] PSEC0066

[0375] nnnnnnnn

[0376] PSEC0069

[0377] PSEC0092

[0378] PSEC0103

[0379] PSEC0117

[0380] PSEC0142

[0381] PSEC0212

[0382] PSEC0239

[0383] PSEC0242

[0384] PSEC0251

[0385] PSEC0256

[0386] (Annotation 3)

[0387] Clones that have the ATGpr1 score 0.5 or lower (PSEC0239, ATGpr1 0.18): PSEC0239 was selected as a clone having high ATGpr1 score of the 5′-end sequence (one pass sequencing), in which the signal sequence was predicted to be present. Although this clone was predicted to be without the signal sequence in the N-terminus according to the predicted ORF after complete sequencing, the clone was predicted to be a membrane protein (having the transmembrane helix) by the MEMSAT and SOSUI. In addition, the clone was found to contain a longer 5′-sequence than ESTs by comparing with them.

[0388] (Annotation 4)

[0389] PSEC0242 and PSEC0251: Both clones are classified into the cDNA encoding the polypeptide “containing a signal sequence in the N-terminus”, if translation starts from their third ATG codon.

[0390] PSEC0242: No.3 ATG, ATGpr1 0.82, SP-Yes, ORF 171-1343 391 aa, Signal peptide 24;

[0391] PSEC0251: No.3 ATG, ATGpr1 0.77, SP-Yes, ORF 116-1256 380 aa, Signal peptide 28.

[0392] 2. Clones that are predicted to be neither of a secretory protein or membrane protein by the PSORT, MEMSAT, and SOSUI, but predicted to be full-length by the ATGpr, which were isolated from the full-length-enriched human cDNA libraries constructed by the oligo-capping method (2 clones)

[0393] (Both clones have the ATGpr score 0.5 or higher).

[0394] PSEC0195, and PSEC0206.

[0395] According to the result of the homology search of the SwissProt, PSEC0195 and PSEC0206 were found to have relatively high homology with mouse plasma membrane adapter HA2/AP2 adaptin α C subunit, and human carboxypeptidase H precursor (prohormone processing carboxypeptidase) in the secretory granule, respectively. Thus, the proteins are classified into the category of “a secretory protein or membrane protein” (see List 3).

[0396] Specific selection was carried out for clones predicted to have signal sequences (having high probability of being secretory and/or membrane proteins) by testing the presence of a sequence predicted as a characteristic signal peptide found in amino-terminal sequences of many secretory proteins. The selection was performed by surveying all the possible amino acid sequences that are initiated with distinct ATG codons located in the 5′-end sequence and that are encoded by a cDNA isolated from each library prepared by oligo-capping method, by using a computer program, “PSORT” developed for predicting domain localization in a protein by Nakai and Kanehisa. Specifically, based on the 5′-end sequence data (one pass sequencing), the clones were selected under the conditions that the signal sequence (analyzed by PSORT) had a maximal ATGpr1 value of 0.7 or higher and the corresponding ORF was found in the 5′-end sequence.

[0397] The correspondence between the clones and the cDNA libraries is as follows:

NT2RP2: PSEC0078, PSEC0084

NT2RP3: PSEC0264, PSEC0265

HEMBA1: PSEC0237

[0398] Nucleotide sequences were determined for the 5 full-length cDNAs selected in Example 5 by assembling the sequence data derived from both strands. Amino acid sequences were then deduced from the full-length nucleotide sequences. The sequences were subjected to the analyses with ATGpr and PSORT programs. Furthermore, databases such as GenBank and SwissProt were searched for the full-length sequences by BLAST. There were 4 clones (PSEC0084, PSEC0237, PSEC0264, and PSEC0265) that were predicted to encode secretory proteins having signal sequences at their N-termini. As for another clone (PSEC0078), no signal sequence was detected in the deduced amino acid sequence thereof by PSORT. By using MEMSAT and SOSUI programs, this clone was further analyzed to assess whether or not the protein encoded by this clone was a membrane protein (having a transmembrane helix). The result showed that a transmembrane helix was predicted to be present in this protein. In other words, the protein was presumed to be a membrane protein.

[0399] From the matching data obtained by BLAST analysis, matching data including information on proteins whose functions were relatively easy to be predicted were chosen to present them herein. Some clones were, however, selected simply because of the high homology in the matching data. These results are shown in List 1 and List 2 together with the annotation of the function of each cDNA clone. The categorization of the 5 clones is described below.

[0400] Results obtained by BLAST analysis are presented herein for the above-mentioned clones other than the 5 clones based on the same criterion as mentioned above for the selection. Clones predicted to cover the full-length cDNA sequences and to encode secretory and/or membrane proteins (5 clones)

clones predicted to cover the full-length cDNA sequences and to encode secretory and/or membrane proteins with signal sequences at the N-terminal ends thereof (4 clones) (List 1)

(ATGpr1 value is 0.5 or higher)

PSEC0084, PSEC0237, PSEC0264, PSEC0265

a clone predicted to cover the full-length cDNA sequence and to encode secretory and/or membrane protein without signal sequence at the N-terminal end thereof (1 clones) (List 2)

PSEC0078

[0401] (Annotation) The ATGpr1 value was 0.24. This is a clone exhibiting high ATGpr1 value and selected as having a signal sequence in the prediction based on the 5′-end sequence data (one pass sequencing). However, based on the ORF deduced from the full-length sequence determined later, this clone has been finally judged not to have the signal sequence at the N-terminus thereof. Nonetheless, the clone has been predicted to encode a membrane protein (having a transmembrane helix) by MEMSAT and SOSUI analyses. In addition, in comparison with EST sequences, the cDNA sequence was not found to be 50 bp or more shorter than any EST sequence at their 5′-end, and therefore the clone was not judged to be a incomplete cDNA clone by using ESTs as criteria for the judgment.

[0402] Nylon membrane for DNA spotting was prepared according to the following procedure. E. coli was cultured in each well of a 96-well plate (in a LB medium at 37° C. for 16 hours). A sample of each culture was suspended in 10 μl of sterile water in a well of a 96-well plate. The plate was heated at 100° C. for 10 minutes. Then, the boiled samples were analyzed by PCR. PCR was performed in a 20 μl solution by using TaKaRa PCR Amplification Kit (Takara) according to the supplier's protocol. Primers used for the amplification of an insert cDNA in a plasmid were a pair of sequencing primers, ME761FW (5′ tacggaagtgttacttctgc 3′) and ME1250RV (5′ tgtgggaggttttttctcta 3′), or a pair of primers, M13M4 (5′ gttttcccagtcacgac 3′) and M13RV (5′ caggaaacagctatgac 3′). PCR was performed using a thermal cycler, GeneAmp System 9600 (PE Biosystems) at 95° C. for 5 minutes; at 95° C. for 10 seconds and at 68° C. for 1 minute for 10 cycles; at 98° C. for 20 seconds and at 60° C. for 3 minutes for 20 cycles; and at 72° C. for 10 minutes. After the PCR, the 20 μl reaction solution was loaded onto a 1% agarose gel and fractionated by electrophoresis. DNA on the gel was stained with ethidium bromide to confirm the amplification of cDNA. When cDNAs were not amplified by PCR, plasmids containing the corresponding insert cDNAs were prepared by the alkali-extraction method (J. Sambrook, E. F., Fritsh, & T. Maniatis, “Molecular Cloning, A laboratory manual/2nd edition, Cold Spring Harbor Laboratory Press, 1989).

[0403] Preparation of DNA array was carried out by the following procedure. A sample of a DNA solution was added in each well of a 384-well plate. DNA was spotted onto a nylon membrane (Boehringer) by using a 384-pin tool of Biomek 2000 Laboratory Automation System (Beckman-Coulter). Specifically, the 384-well plate containing the DNA was placed under the 384-pin tool. The independent 384 needles were simultaneously dipped into the DNA solution for DNA deposition. The needles were gently pressed onto a nylon membrane and the DNA deposited at the tips of needles was spotted onto the membrane. Denaturation of the spotted DNA and immobilization of the DNA on the nylon membrane were carried out according to standard methods (J. Sambrook, E. F., Fritsh, & T. Maniatis, “Molecular Cloning, A laboratory manual/2nd edition, Cold Spring Harbor Laboratory Press, 1989).

[0404] A probe for hybridization was radioisotope-labeled first strand cDNA. Synthesis of the first strand cDNA was performed by using Thermoscript™ RT-PCR System (GIBCO). Specifically, the first strand cDNA was synthesized by using 1.5 μg of mRNAs from various human tissues (Clontech), 1 μl of 50 μM Oligo(dT) 20 and 50 μCi [α³³P]dATP according to an attached protocol. Purification of a probe was carried out by using ProbeQuant™ G-50 micro column (Amersham-Pharmacia Biotech) according to an attached protocol. In the next step, 2 units of E. coli RNase H were added to the reaction mixture. The mixture was incubated at room temperature for 10 minutes, and then, 100 μg of human COT-1 DNA (GIBCO) was added thereto. The mixture was incubated at 97° C. for 10 minutes and then was allowed to stand on ice to give hybridization probe.

[0405] Hybridization of the radioisotope-labeled probe to the DNA array was performed according to standard methods (J. Sambrook, E. F., Fritsh, & T. Maniatis, Molecular Cloning, A laboratory manual/2nd edition, Cold Spring Harbor Laboratory Press, 1989). The membrane was washed as follows: the nylon membrane was washed 3 times by incubating it in Washing solution 1 (2×SSC, 1% SDS) at room temperature (about 26° C.) for 20 minutes; then the membrane was washed 3 times by incubating it in Washing solution 2 (0.1×SSC, 1% SDS) at 65° C. for 20 minutes.

[0406] Autoradiography was performed by using an image plate for BAS2000 (Fuji Photo Film Co., Ltd.). Specifically, the nylon membrane with probe hybridized thereon was wrapped with a piece of Saran Wrap and brought into tight contact with the image plate on the light-sensitive surface. The membrane with the image plate was placed in an imaging cassette for radioisotope and allowed to stand in dark place for 4 hours. The radioactivity recorded on the image plate was analyzed by using BAS2000 (Fuji Photo Film Co., Ltd.). The activity was subjected to electronic conversion and recorded as an image file of autoradiogram. The signal intensity of each DNA spot was analyzed by using Visage High Density Grid Analysis Systems (Genomic Solutions Inc.). The signal intensity was converted into numerical data. The data were taken in duplicate. The reproducibility was assessed by comparing the signal intensities of the corresponding spots on the duplicated DNA filters that were hybridized to a single DNA probe (FIG. 2). In 95% of entire spots, the ratio between the corresponding spots falls within a range of 2 or less, and the correlation coefficient is r=1.97. Thus, the reproducibility is satisfactory.

[0407] The detection sensitivity in gene expression analysis was estimated by examining increases in the signal intensity of probe concentration-dependent spot in hybridization using a probe complementary to the DNA spotted on the nylon membrane. DNA used was PLACE1008092 (the same as DNA deposited in GenBank under an Accession No. AF107253). The DNA array with DNA of PLACE1008092 was prepared according to the above-mentioned method. The probe used was prepared as follows: mRNA was synthesized in vitro from the clone, PLACE1008092. By using this mRNA as a template, radioisotope-labeled first strand cDNA was synthesized in the same manner as described above, and the cDNA was used as the probe. In order to synthesize mRNA from PLACE1008092 in vitro, a plasmid in which the 5′ end of the cDNA PLACE1008092 was ligated to the T7 promoter of pBluescript SK(−) was constructed. Specifically, the PLACE1008092 insert was cut out from pME18SFL3 carrying the cDNA at a DraIII site thereof by XhoI digestion. The resulting PLACE1008092 fragment was ligated to XhoI-predigested pBluescript SK(−) by using DNA ligation kit ver.2 (Takara). The in vitro mRNA synthesis from PLACE1008092 inserted into pBluescript SK(−) was carried out by using Ampliscribe™ T7 high yield transcription kit (Epicentre technologies). Hybridization and the analysis of signal intensity of each DNA spot were performed by the same methods as described above. When the probe concentration is 1×10⁷ μg/ml or less, there was no increase of signal intensity proportional to the probe concentration. Therefore, it was assumed to be difficult to compare the signals with one another in this concentration range. Thus, the spots with the intensity of 40 or less were uniformly taken as low level signals (FIG. 3). Within a concentration of the probe ranging from 1×10⁷ μg/ml to 0.1 μg/ml, the signal was found to increase in a probe concentration-dependent manner. The detection limit represented as the ratio of the expression level of test mRNA to that of total mRNA in a sample was 1:100,000.

[0408] Tables 5–161 (also containing clones without description in Examples) show the expression of each cDNA in human normal tissues (heart, lung, pituitary gland, thymus, brain, kidney, liver and spleen). The expression levels are indicated with numerical values of 0–10,000. Genes that were expressed in at least a single tissue are indicated below by the corresponding clone names:

[0409] clone: HEMBA1000446, HEMBA000675, HEMBA100322, HEMBA1001552, HEMBA1001680, HEMBA1001879, HEMBA1002441, HEMBA1002706, HEMBA1002715, HEMBA1002913, HEMBA1002981, HEMBA1003280, HEMBA1003702, HEMBA1003764, HEMBA1004100, HEMBA1004633, HEMBA1005096, HEMBA1005452, HEMBA1005628, HEMBA1005833, HEMBA1006099, HEMBA1006391, HEMBA1006813, HEMBA1007104, HEMBA1007186, NT2RM1000558, NT2RP1000125, NT2RP1000279, NT2RP1000837, NT2RP1001023, NT2RP2000396, NT2RP2000428, NT2RP2000557, NT2RP2000601, NT2RP2000720, NT2RP2001087, NT2RP2001142, NT2RP2001270, NT2RP2001341, NT2RP2001499, NT2RP2001508, NT2RP2001768, NT2RP2002429, NT2RP2002695, NT2RP2002907, NT2RP2002927, NT2RP2002934, NT2RP2003050, NT2RP2003115, NT2RP2003227, NT2RP2003902, NT2RP2004130, NT2RP2004755, NT2RP2004795, NT2RP2004966, NT2RP2005219, NT2RP2005322, NT2RP2005671, NT2RP2005970, NT2RP2006435, NT2RP3000234, NT2RP3000266, NT2RP3000326, NT2RP3000638, NT2RP3000719, NT2RP3001359, NT2RP3001613, NT2RP3001861, NT2RP3003097, NT2RP3003235, NT2RP3003258, NT2RP3003368, NT2RP3003549, NT2RP3003731, NT2RP3003789, NT2RP3004541, OVARC1000636, OVARC1001849, PLACE1000456, PLACE1001098, PLACE1001300, PLACE1001904, PLACE1002376, PLACE1002379, PLACE1003405, PLACE1003724, PLACE1004113, PLACE1004273, PLACE1004757, PLACE1004850, PLACE1005047, PLACE1005760, PLACE1006472, PLACE1006610, PLACE1007635, PLACE1009580, PLACE1010330, PLACE1010482, PLACE1011134, PLACE1011146, PLACE1011360, PLACE1011386, PLACE1011514, PLACE1011835.

[0410] Genes that were expressed in all the tissues tested are indicated below by the corresponding clone names:

clone: HEMBA1002715, NT2RP1001023, NT2RP2000396, NT2RP2003902, NT2RP2005970, NT2RP3003258, NT2RP3003731, PLACE1003405, PLACE1003724.

[0411] Genes that were expressed at low levels in any of the tissues tested are indicated below by the corresponding clone names:

[0412] clone: HEMBA1000296, HEMBA1001490, HEMBA1004078, HEMBA1004149, HEMBA1005301, HEMBA1005703, HEMBA1006019, HEMBA1006549, HEMBA1007053, NT2RM1000066, NT2RM1000566, NT2RM1000634, NT2RM1000726, NT2RM1000853, NT2RM101103, NT2RP1000255, NT2RP1000477, NT2RP1000533, NT2RP1000544, NT2RP 1000567, NT2RP1000593, NT2RP1000769, NT2RP1000905, NT2RP1000921, NT2RP1001042, NT2RP2000028, NT2RP2000116, NT2RP2000168, NT2RP2000279, NT2RP2000358, NT2RP2002115, NT2RP2003471, NT2RP2004036, NT2RP2004049, NT2RP2004076, NT2RP2004974, NT2RP2005670, NT2RP2006028, NT2RP2006400, NT2RP2006476, NT2RP3001619, NT2RP3001874, NT2RP3002337, NT2RP3003536, NT2RP3004059, NT2RP3004063, OVARC1000363, OVARC1001499, OVARC1001510, OVARC1001636, PLACE1001022, PLACE1003085, PLACE1003378, PLACE1003549, PLACE1004170, PLACE1004322, PLACE1004507, PLACE1004904, PLACE1006269, nnnnnnnnnnnn, PLACE1007190, PLACE1007338, PLACE1007878, PLACE1007885, PLACE1008738, PLACE1008994, PLACE1009772, PLACE1010021, PLACE1010978.

[0413] Genes exhibiting characteristic features in the expression thereof were selected by statistical analysis of these data. Two examples are shown below to describe the selection of genes of which expression is varied greatly among tissues. The β-actin gene is used frequently as a control in gene expression analysis. Genes of which expression is varied greatly among tissues as compared that of the β-actin gene were determined as follows. Specifically, sum of squared deviation was calculated in the signal intensity of β-actin observed in each tissue, which was divided by 7 degrees of freedom to determine a variance S_a². Next, sum of squared deviation was calculated in the signal intensity of a compared gene in each tissue, which was divided by 7 degrees of freedom to determine a variance S_b². By taking variance ratio F as F=S_b²/S_a², genes with a significance level of 5% or more were extracted in the F distribution. Genes extracted are indicated below by the corresponding clone names: NT2RP1001023(PSEC0045).

[0414] Gene of OVARC1000037 (heterogeneous nuclear ribonucleoprotein (hnRNP)) which expression is varied little. Genes of which expression is varied greatly among tissues as compared that of the OVARC1000037 gene were determined as follows. Specifically, sum of squared deviation was calculated in the signal intensity of β-actin observed in each tissue, which was divided by 7 degrees of freedom to determine a variance S_a². Next, sum of squared deviation was calculated in the signal intensity of a gene to be compared observed in each tissue, which was divided by 7 degrees of freedom to determine a variance S_b². By taking variance ratio F as F=S_b²/S_a², genes with a significance level of 5% or more were extracted in the F distribution. Genes extracted are indicated below by the corresponding clone names: clone: NT2RP 1001023 (PSEC0045), NT2RP2005970 (PSEC0084),

[0415] Thus, characteristic features in the expression of a gene are illustrated by comparing and statistically analyzing the expression of many genes.

[0416] Analysis of genes associated with neural cell differentiation

[0417] Genes involved in neural cell differentiation are useful for treating neurological diseases. It is possible that genes with varying expression levels in response to induction of cellular differentiation in neural cells are associated with neurological diseases.

[0418] A survey was performed for genes of which expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA)) in cultured cells of a neural strain, NT2.

[0419] The NT2 cells were treated basically according to supplier's instruction manual. “Undifferentiated NT2 cells” means NT2 cells successively cultured in an Opti-MEM I (GIBCO-BRL; catalog No. 31985) containing 10% (v/v) fetal bovine serum and 1% (v/v) penicillin-streptomycin (GIBCO BRL). NT2 cells cultured in the presence of retinoic acid” means the cells resulted from transferring undifferentiated NT2 cells into a retinoic acid-containing medium, which consists of D-MEM (GIBCO BRL; catalog No. 11965), 10% (v/v) fetal bovine serum, 1% (v/v) penicillin-streptomycin and 10 μM retinoic acid (GIBCO-BRL), and the subsequent successive culture therein for 5 weeks. “NT2 cells that were cultured in the presence of retinoic acid and then further cultured in the presence of cell-division inhibitor added” means NT2 cells resulted from transferring NT2 cells cultured in the presence of retinoic acid for 5 weeks into a cell-division inhibitor-containing medium, which consisted of D-MEM (GIBCO BRL; catalog No.11965), 10% (v/v) fetal bovine serum, 1% (v/v) penicillin-streptomycin, 10 μM retinoic acid, 10 μM FudR (5-fluoro-2′-deoxyuridine: GIBCO BRL), 10 μM Urd (Uridine: GIBCO BRL) and 1 μg M araC (Cytosine β-D-Arabinofuranoside: GIBCO BRL), and the subsequence successive culture for 2 weeks. Each of the cells were treated with trypsin and then harvested. Total RNAs were extracted from the cells by using S.N.A.P.™ Total RNA Isolation kit (Invitrogen^(r)). The labeling of probe used for hybridization was carried out by using 10 μg of the total RNA according to the same methods as described above. The data were obtained in triplicate (n=3). The data of signal value representing gene expression level in the cells in the presence of stimulation for inducing differentiation were compared with those in the absence of the stimulation. The comparison was performed by statistical treatment of two-sample t-test. Clones with significant difference in the signal distribution were selected under the condition of p<0.05. In this analysis, clones with the difference can be statistically detected even when the signals were low. Accordingly, clones with signal value of 40 or less were also assessed for the selection.

[0420] Tables 162–341 show the expression level of each cDNA in undifferentiated NT2 cells, NT2 cells cultured in the presence of RA, and NT2 cells that were cultured in the presence of RA and that were further cultured in the presence of cell-division inhibitor added.

[0421] Averaged signal values (M₁, M₂) and sample variances (s₁², s₂²) were calculated for each gene in each of the cells, and then, the pooled sample variances s² were obtained from the sample variances of the two types of cells to be compared. The t values were determined according to the following formula: t=(M1−M2)/s/(⅓+⅓)^1/2. When the determined t-value was greater than a t-value at P, which means the probability of significance level, of 0.05 or 0.01 in the t-distribution table with 4 degrees of freedom, the difference was judged to be found in the expression level of the gene between the two types of cells at p<0.05 or p<0.01, respectively. The tables also include the information on an increase (+) or decrease (−) in the expression level of a gene in the treated cells when the level is compared with that of untreated undifferentiated cells.

[0422] Clones of which expression levels increased by RA are as follows:

[0423] PSEC0017, PSEC0021, PSEC0041, PSEC0047, PSEC0049, PSEC0055, PSEC0066, PSEC0070, PSEC0071, PSEC0072, PSEC0074, PSEC0075, PSEC0076, PSEC0080, PSEC0084, PSEC0088, PSEC0094, PSEC0103, PSEC0105, PSEC0112, PSEC0113, PSEC0119, PSEC0127, PSEC0129, PSEC0139, PSEC0143, PSEC0144, PSEC0152, PSEC0171, PSEC0181, PSEC0182, PSEC0192, PSEC0195, PSEC0200, PSEC0203, PSEC0215, PSEC0223, PSEC0235, PSEC0239, PSEC0243, PSEC0255, PSEC0265.

[0424] Clones of which expression levels increase by RA/inhibitor are as follows:

[0425] PSEC0017, PSEC0019, PSEC0030, PSEC0041, PSEC0047, PSEC0048, PSEC0049, PSEC0059, PSEC0066, PSEC0072, PSEC0081, PSEC0084, PSEC0094, PSEC0104, PSEC0117, PSEC0119, PSEC0120, PSEC0129, PSEC0136, PSEC0139, PSEC0143, PSEC0152, PSEC0161, PSEC0169, PSEC0181, PSEC0182, PSEC0192, PSEC0203, PSEC0223, PSEC0235, PSEC0251, PSEC0265.

[0426] Clones of which expression levels increase in the presence of both RA and RA/inhibitor are as follows:

PSEC0017, PSEC0041, PSEC0047, PSEC0049, PSEC0066, PSEC0072, PSEC0084, PSEC0094, PSEC0119, PSEC0129, PSEC0139, PSEC0143, PSEC0152, PSEC0181, PSEC0182, PSEC0192, PSEC0203, PSEC0223, PSEC0235, PSEC0265.

[0427] These are neurological disease-associated clones.

[0428] Analysis of rheumatoid arthritis-associated genes

[0429] The onset of rheumatoid arthritis is thought to be involved in the proliferation of synovial cells covering inner surfaces of joint cavity and in inflammatory reaction resulted from the action of cytokines produced by leukocytes infiltrating into the joint synovial tissues (Rheumatism Information Center). Recent studies have also revealed that tissue necrosis factor (TNF)-α participates in the onset (Current opinion in immunology 1999, 11, 657–662). When the expression of a gene exhibits responsiveness to the action of TNF on synovial cells, the gene is considered to be involved in rheumatoid arthritis.

[0430] A survey was performed for genes of which expression levels are varied in response to TNF-α in the primary cell culture of synovial tissue. The primary cultured cells of the smooth muscle (Cell Applications) were grown to be confluent in a culture dish, and then, human TNF-α (Boehringer-Mannheim) was added at a final concentration of 10 ng/ml thereto. The culture was further continued for 24 hours.

[0431] Total RNA was extracted from the cells by using S.N.A.P.™ Total RNA Isolation kit (Invitrogen). The labeling of probe used for hybridization was carried out by using 10 μg of the total RNA according to the same methods as described above. The data were obtained in triplicates (n=3). The data of signal value representing gene expression level in the cells in the presence of TNF stimulation were compared with those in the absence of the stimulation. The comparison was performed by statistical treatment of two-sample t-test. Clones with significant difference in the signal distribution were selected under the condition of p<0.05. In this analysis, clones with the difference can be statistically detected even when the signals were low. Accordingly, clones with signal value of 40 or less were also assessed for the selection.

[0432] Table 343 shows the expression level of each cDNA in synovial cells cultured in the absence or presence of TNF.

[0433] Averaged signal values (M₁, M₂) and sample variances (s₁², s₂²) for each gene were calculated in each of the cells, and then, the pooled sample variances s² were obtained from the sample variances of the two types of cells to be compared. The t-values were determined according to the following formula: t=(M₁−M₂)/s/(⅓+⅓)^1/2. When the determined t-value was greater than a t-value at P, which means the probability of significance level, of 0.05 or 0.01 in the t-distribution table with 4 degrees of freedom, the difference was judged to be found in the expression level of the gene between the two types of cells at p<0.05 or p<0.01, respectively. The tables also include the information of an increase (+) or decrease (−) in the expression level of a gene in the stimulated cells when the level is compared with that of unstimulated cells.

[0434] PSEC clones of which expression levels are elevated by TNF-α are as follows:

PSEC0070, PSEC0073, PSEC0084, PSEC0100, PSEC0109, PSEC0120, PSEC0131, PSEC0161, PSEC0183, PSEC0192, PSEC0197, PSEC0205, PSEC0207, PSEC0210, PSEC0213, PSEC0222, PSEC0230, PSEC0241, PSEC0252, PSEC0259.

[0435] PSEC clones of which expression levels decrease by TNF-α are as follows:

PSEC0105, PSEC0245.

[0436] These are rheumatoid arthritis-associated clones.

[0437]

TABLE 5
Expression of each cDNA in human tissues (containing clones that are not described in Examples.)
Clone_name	Heart	Lung	P.gland	Thymus	Brain	Kidney	Liver	Spleen
GAPDH(Cr1)	38.210	32.670	23.820	13.580	11.230	21.120	24.910	22.440
β actin(Cr2)	279.280	368.870	111.100	117.500	92.880	114.650	82.990	256.790
ADRGL1000005	53.882	23.005	32.749	22.858	26.564	24.940	22.644	27.001
ADRGL1000007	94.778	85.185	160.457	67.191	101.768	62.489	67.150	73.543
ADRGL1000009	11.141	50.520	10.357	7.177	6.013	5.219	14.272	21.225
ADRGL1000011	71.656	24.579	29.358	19.473	24.898	30.747	49.220	22.221
ADRGL1000027	36.238	25.252	20.855	7.328	11.196	14.298	19.658	11.288
ADRGL1000058	66.209	129.497	55.226	49.241	30.219	55.872	67.027	243.436
ADRGL1000069	38.630	23.459	28.991	12.540	27.353	33.633	28.774	20.911
ADRGL1000077	97.465	63.656	448.427	83.412	71.108	53.740	67.906	89.439
ADRGL1000092	89.423	45.692	55.810	26.033	44.148	73.339	96.037	73.091
ADRGL1000099	73.675	24.424	36.128	17.024	25.964	41.391	42.837	29.666
ADRGL1000136	141.745	63.974	77.017	24.777	33.549	58.986	295.009	84.985
ADRGL1000147	394.563	155.829	271.210	92.899	165.627	251.266	253.420	150.294
ADRGL1000159	50.073	25.425	39.296	15.194	16.125	20.040	33.720	23.278
ADRGL1000160	69.386	31.051	59.416	20.154	39.799	27.027	47.169	20.716
ADRGL1000171	57.047	23.011	43.063	23.860	40.581	59.814	117.055	32.630
ADRGL1000181	45.892	18.666	34.476	15.434	34.225	32.962	39.693	16.334
BCGI11000015	153.242	42.337	92.865	41.003	45.168	88.524	85.990	73.392
BGGI11000016	177.367	94.731	119.688	34.159	30.249	98.806	98.783	39.204
BGGI11000017	84.712	32.614	38.131	20.878	18.769	32.340	39.666	20.750
BGGI11000022	52.468	20.452	67.167	12.167	11.158	18.241	19.197	11.937
BGGI11000031	30.008	17.072	40.883	12.585	13.313	15.525	16.757	13.406
BGGI11000042	49.926	36.336	51.176	26.964	43.122	43.770	49.107	38.776
BGGI11000046	31.618	26.472	34.182	31.854	12.650	25.784	18.430	25.385
BNGH41000020	5031.103	2993.496	1444.841	537.162	6973.542	6029.124	3350.527	3649.144
BNGH41000025	91.717	35.026	73.901	27.713	30.765	36.523	37.596	47.074
BNGH41000026	176.757	77.439	98.345	35.807	56.991	91.310	75.797	70.241
BNGH41000027	65.029	56.353	25.896	22.494	12.763	23.748	17.836	23.859
BNGH41000035	148.779	66.776	119.727	56.576	60.996	96.959	72.461	64.458
BNGH41000037	79.500	29.611	43.438	18.317	20.857	36.272	27.525	24.771
BNGH41000042	224.484	110.084	168.448	104.351	102.259	125.323	86.783	122.959
BNGH41000048	56.144	32.253	54.063	14.729	27.312	22.435	29.566	28.937
BNGH41000056	67.258	18.694	30.075	15.602	10.072	20.735	16.100	7.642
BNGH41000087	98.262	46.173	77.657	35.329	40.900	50.029	50.841	45.285
BNGH41000091	50.895	16.985	28.392	10.147	5.469	22.794	10.725	12.410
BNGH41000157	69.043	34.730	40.597	18.088	27.072	22.074	25.410	24.950
BNGH41000169	44.850	21.770	28.655	11.403	25.991	28.509	25.634	25.843
BNGH41000181	17.163	15.689	13.948	3.996	9.287	13.139	15.553	16.575
BNGH41000198	81.510	36.250	60.860	20.585	26.929	35.751	31.695	28.325
BNGH41000219	30.302	25.156	22.187	13.757	11.208	15.235	27.285	35.709
BNGH41000229	252.790	65.948	93.499	51.108	92.555	101.245	96.716	78.266
BNGH41000237	85.757	46.997	55.170	26.780	33.764	47.456	37.007	39.131
BNGH41000238	17.744	36.938	42.360	14.922	35.749	42.848	39.238	13.241
BNGH41000243	45.446	23.667	44.798	20.875	10.516	23.918	22.443	27.033
BNGH41000270	60.889	18.651	29.618	10.724	15.979	12.351	19.152	22.314
BRAWH1000004	43.673	28.539	7.640	11.388	19.198	14.903	32.353	23.777
BRAWH1000018	59.409	17.941	102.270	17.107	709.078	25.732	24.214	24.767
BRAWH1000021	104.772	29.951	51.142	21.042	1169.154	55.762	66.754	27.969
BRAWH1000027	152.205	47.310	67.089	32.199	64.521	70.731	79.670	40.928
BRAWH1000029	106.376	49.221	55.840	40.856	59.552	56.487	64.886	100.132
BRAWH1000040	29.419	16.761	31.101	16.622	30.633	18.200	17.998	15.196
BRAWH1000050	161.264	71.786	118.976	51.863	61.542	97.720	81.271	69.194
BRAWH1000051	74.067	34.341	44.047	20.726	30.434	42.055	53.856	24.624
BRAWH1000060	68.789	22.598	35.012	16.493	19.127	38.662	34.923	28.094
BRAWH1000075	17.318	16.898	36.437	8.901	18.133	17.219	9.321	11.200
BRAWH1000081	43.025	12.998	28.267	7.655	123.677	17.673	15.924	9.844
BRAWH1000084	174.384	42.178	80.534	47.752	152.188	77.111	110.167	102.296
BRAWH1000095	118.239	59.676	64.528	28.174	116.975	53.814	746.700	35.985
BRAWH1000096	146.112	44.967	85.882	27.491	145.013	52.880	52.427	58.678
BRAWH1000097	95.841	72.506	174.954	65.637	64.200	73.707	63.827	63.762
BRAWH1000100	11.943	19.037	18.950	13.536	92.145	16.582	16.646	10.218
BRAWH1000101	134.838	57.232	106.632	40.741	96.396	71.642	88.432	57.336

[0438]

TABLE 6
BRAWH1000104	25.414	18.303	14.825	7.695	38.918	23.970	23.794	11.048
BRAWH1000107	16.949	5.616	12.463	5.518	6.355	5.084	9.107	6.573
BRAWH1000110	615.476	492.704	869.088	383.612	368.156	369.621	277.348	340.450
BRAWH1000111	175.556	68.459	92.209	45.974	64.703	81.723	90.369	57.301
BRAWH1000135	199.303	38.098	72.093	26.809	57.720	91.668	87.016	35.866
BRAWH1000190	56.386	41.640	57.914	22.782	55.671	40.034	35.280	40.134
HEMBA1000005	11.985	23.427	18.882	9.766	12.656	9.959	23.443	21.677
HEMBA1000006	37.398	24.521	24.529	15.587	22.317	13.336	16.038	15.295
HEMBA1000012	81.820	57.193	66.828	26.683	55.423	58.731	85.614	66.259
HEMBA1000020	157.967	64.157	115.635	51.940	77.293	77.321	83.989	74.362
HEMBA1000030	82.882	35.447	66.058	26.464	40.990	60.871	47.058	50.652
HEMBA1000034	47.434	17.878	50.696	5.594	14.005	6.673	24.652	7.134
HEMBA1000042	147.376	94.003	330.908	69.071	76.472	55.477	37.783	60.479
HEMBA1000045	28.478	20.289	20.548	12.445	11.835	22.788	11.196	15.775
HEMBA1000046	85.160	84.475	242.940	57.017	68.488	45.288	37.098	47.486
HEMBA1000047	21.380	18.899	18.166	11.393	11.185	12.292	6.491	12.018
HEMBA1000048	243.559	55.114	84.448	24.247	43.131	99.333	57.041	37.362
HEMBA1000050	22.711	11.876	21.972	7.477	4.096	13.675	10.347	7.770
HEMBA1000053	45.071	26.410	38.158	15.982	30.754	36.740	34.184	24.269
HEMBA1000060	101.197	34.766	50.643	19.938	34.641	54.061	42.309	22.530
HEMBA1000072	240.166	213.938	224.688	163.030	115.246	207.809	112.361	276.098
HEMBA1000073	23.202	9.580	10.815	1.698	6.680	18.155	12.304	14.973
HEMBA1000076	95.997	46.783	177.931	32.617	48.964	50.792	33.947	44.142
HEMBA1000084	66.603	25.710	48.434	18.006	22.553	38.118	40.479	29.683
HEMBA1000087	70.084	17.515	26.544	8.450	17.590	29.220	19.519	22.565
HEMBA1000088	15.474	8.614	19.903	4.775	4.519	11.446	34.905	6.528
HEMBA1000091	80.622	38.604	59.393	23.956	44.939	49.760	33.946	24.614
HEMBA1000111	85.814	95.270	270.642	75.147	54.384	70.071	29.529	55.422
HEMBA1000121	55.476	43.368	146.465	37.419	29.398	30.694	17.702	30.398
HEMBA1000128	37.278	27.165	34.516	13.619	17.702	28.069	12.834	23.965
HEMBA1000129	51.488	19.659	44.907	12.208	27.243	30.959	24.383	26.851
HEMBA1000141	12.961	24.515	32.107	14.353	13.502	11.152	8.907	20.635
HEMBA1000146	29.273	11.479	20.418	8.202	9.575	14.877	10.000	7.817
HEMBA1000150	534.562	326.814	684.147	211.774	218.448	322.246	235.752	256.883
HEMBA1000154	95.272	92.253	101.483	54.276	42.896	75.526	92.689	188.019
HEMBA1000156	50.177	72.591	58.026	31.149	21.865	38.964	27.634	50.220
HEMBA1000158	260.718	63.920	89.680	36.337	44.915	93.421	111.344	53.562
HEMBA1000168	74.416	61.152	62.826	30.512	23.287	34.966	44.005	33.564
HEMBA1000180	28.502	22.412	28.571	11.701	19.230	10.903	11.731	14.102
HEMBA1000185	115.723	50.661	213.994	51.166	43.435	56.261	38.862	44.992
HEMBA1000188	21.302	14.879	16.948	11.392	11.821	10.656	12.501	6.979
HEMBA1000193	14.122	8.318	11.905	7.519	4.736	3.349	8.544	7.842
HEMBA1000194	54.688	49.534	143.817	37.736	20.221	34.328	23.359	56.497
HEMBA1000201	21.062	14.098	8.690	6.237	5.109	5.059	9.317	10.522
HEMBA1000213	22.388	25.532	25.777	8.470	17.320	9.084	8.469	11.766
HEMBA1000216	65.935	51.368	92.680	19.202	33.659	40.971	36.328	34.891
HEMBA1000227	52.577	31.332	34.925	19.503	18.411	21.504	22.590	25.781
HEMBA1000231	114.369	54.299	131.256	38.550	43.246	29.778	24.266	30.410
HEMBA1000237	91.024	91.360	199.338	58.292	93.250	57.000	49.319	59.288
HEMBA1000243	53.456	43.969	117.519	38.431	25.396	32.604	38.910	32.153
HEMBA1000244	173.469	104.733	115.584	33.079	65.527	124.532	90. 927	78.610
HEMBA1000251	22.709	12.333	14.367	9.019	16.095	13.221	11.516	11.018
HEMBA1000254	74.060	35.626	130.009	20.848	37.481	24.002	20.553	13.215
HEMBA1000264	29.478	15.248	23.537	9.473	3.863	11.228	13.690	3.797
HEMBA1000269	36.718	13.465	28.932	20.412	9.705	12.833	7.348	24.793
HEMBA1000275	66.201	39.367	84.077	38.846	77.871	49.267	36.211	38.871
HEMBA1000280	33.299	36.073	54.357	24.720	38.017	35.751	21.696	30.785
HEMBA1000282	93.815	121.083	171.037	93.484	123.971	70.384	56.916	92.414
HEMBA1000287	12.439	24.935	29.793	10.840	37.925	9.632	2.866	7.311
HEMBA1000288	45.269	30.009	145.363	25.471	9.769	16.272	9.701	15.510
HEMBA1000290	14.803	5.750	10.615	5.725	2.559	8.602	8.358	9.224
HEMBA1000296	27.085	22.625	21.195	9.790	16.909	12.402	15.289	17.159
HEMBA1000300	98.491	119.119	304.884	73.660	85.595	48.175	43.496	66.547
HEMBA1000302	23.840	15.442	27.722	16.143	13.081	13.879	8.259	12.569

[0439]

TABLE 7
HEMBA1000303	129.286	51.013	88.777	32.513	50.462	82.994	44.818	49.271
HEMBA1000304	112.022	67.470	328.677	54.678	79.305	43.526	38.469	55.762
HEMBA1000307	14.054	22.013	31.964	13.167	15.571	7.974	10.014	8.685
HEMBA1000312	97.082	69.330	183.923	45.322	45.087	52.968	37.741	38.246
HEMBA1000318	16.164	16.264	18.766	11.688	3.620	10.732	8.295	14.675
HEMBA1000327	29.404	59.618	81.347	41.731	85.004	48.526	49.421	46.866
HEMBA1000333	16.964	13.930	14.530	1.872	5.776	1.571	0.392	3.743
HEMBA1000338	121.878	62.572	348.751	55.463	49.114	38.561	30.698	40.644
HEMBA1000343	25.229	29.781	46.395	20.673	5.872	16.551	10.139	14.088
HEMBA1000349	23.061	12.586	31.755	7.020	17.658	11.622	14.807	15.611
HEMBA1000351	92.847	57.338	196.577	41.762	37.094	35.370	27.645	28.615
HEMBA1000355	85.210	38.388	64.299	18.101	33.114	43.511	37.808	26.628
HEMBA1000356	60.438	38.786	62.442	20.784	17.694	38.058	40.431	28.899
HEMBA1000357	84.898	55.990	206.803	54.151	42.793	39.432	26.076	44.579
HEMBA1000366	47.131	42.031	90.450	27.056	20.718	23.499	14.632	23.547
HEMBA1000369	71.428	40.685	54.384	17.613	21.422	34.985	37.622	36.900
HEMBA1000370	16.354	14.949	22.988	7.916	18.390	15.359	13.426	6.647
HEMBA1000376	80.183	75.300	201.705	55.266	66.687	44.612	55.386	56.070
HEMBA1000387	100.497	129.367	351.196	80.257	104.250	74.007	57.619	79.876
HEMBA1000389	69.342	34.021	71.118	22.346	27.319	47.936	53.026	34.161
HEMBA1000390	19.206	25.788	21.028	12.401	18.372	13.751	16.243	15.036
HEMBA1000392	19.400	22.884	44.179	8.776	11.742	10.594	12.266	12.463
HEMBA1000396	75.409	50.195	81.870	27.979	30.393	31.235	17.771	19.584
HEMBA1000411	35.966	24.397	25.987	10.341	31.398	31.214	50.056	18.580
HEMBA1000418	8.165	10.778	14.987	4.031	12.495	7.913	6.363	2.306
HEMBA1000422	93.699	38.329	85.266	39.826	45.992	44.729	42.886	34.308
HEMBA1000428	51.017	30.690	79.229	26.579	24.840	17.767	18.424	18.608
HEMBA1000434	1.747	3.214	11.346	1.210	1.602	2.927	2.788	2.756
HEMBA1000442	21.750	7.698	16.227	7.252	3.336	17.969	11.723	10.645
HEMBA1000443	67.291	35.910	34.775	26.420	16.860	31.691	47.856	102.287
HEMBA1000446	236.986	69.546	90.283	32.233	34.107	119.377	108.645	60.266
HEMBA1000456	95.368	37.560	63.451	22.640	41.092	65.256	62.972	43.493
HEMBA1000459	28.924	35.333	74.945	20.475	25.324	26.253	13.654	31.317
HEMBA1000460	18.649	27.246	21.973	9.613	15.230	14.091	9.746	16.955
HEMBA1000462	220.184	42.636	96.490	31.332	83.626	109.503	92.971	62.126
HEMBA1000464	34.277	15.137	27.210	10.862	15.595	20.793	16.716	16.539
HEMBA1000468	41.755	41.852	68.356	10.400	23.452	43.909	24.048	22.968
HEMBA1000469	68.229	71.011	256.705	47.636	29.853	34.188	22.568	39.190
HEMBA1000477	185.220	47.546	102.939	26.276	40.188	95.247	52.454	28.109
HEMBA1000481	47.276	37.528	24.407	17.115	24.182	29.826	20.717	25.819
HEMBA1000488	96.226	31.249	71.522	21.667	27.715	44.499	53.708	33.306
HEMBA1000490	29.915	13.747	32.568	14.002	12.056	6.900	11.274	7.559
HEMBA1000491	80.198	22.903	47.786	20.675	32.551	52.682	37.109	28.282
HEMBA1000498	191.186	112.767	454.998	88.614	102.997	82.927	53.205	120.837
HEMBA1000501	57.318	55.923	180.158	44.170	27.291	34.954	18.532	34.117
HEMBA1000504	1.033	5.893	7.152	1.726	0.520	2.245	2.551	1.091
HEMBA1000505	55.746	36.631	48.155	21.562	14.691	34.729	19.508	31.925
HEMBA1000507	204.165	114.530	305.249	86.138	81.505	97.289	230.331	95.150
HEMBA1000508	205.724	105.067	309.791	72.709	70.180	77.388	63.849	45.940
HEMBA1000518	39.157	29.100	31.505	16.650	14.796	15.847	24.729	17.601
HEMBA1000519	166.937	142.676	468.435	148.478	123.978	128.646	85.670	111.078
HEMBA1000520	0.000	0.000	0.000	10.341	10.619	1.488	9.513	9.395
HEMBA1000523	38.708	22.090	40.875	13.852	21.603	32.384	20.478	21.422
HEMBA1000531	21.874	34.044	40.027	12.264	11.034	29.775	20.421	12.540
HEMBA1000534	0.000	0.000	0.000	34.434	48.940	25.365	41.242	72.583
HEMBA1000538	0.000	0.000	0.000	17.833	19.981	17.606	26.698	23.904
HEMBA1000540	21.974	47.343	33.145	42.629	27.059	33.931	16.639	31.893
HEMBA1000542	64.656	33.152	58.093	30.174	35.278	55.508	47.917	47.623
HEMBA1000545	148.870	136.401	48.802	8.499	12.534	7.119	25.484	15.094
HEMBA1000547	14.825	20.199	32.694	7.058	22.359	12.020	13.535	20.227
HEMBA1000551	163.806	171.089	543.876	131.764	115.775	116.646	69.596	152.516
HEMBA1000555	10.531	20.199	25.801	24.488	14.071	15.431	5.986	10.933
HEMBA1000557	80.051	48.396	168.724	37.150	32.863	31.872	22.800	30.926
HEMBA1000561	56.992	22.797	51.047	10.187	16.301	34.904	24.661	22.470

[0440]

TABLE 8
HEMBA1000563	9.473	11.545	18.205	6.139	12.689	10.132	7.939	14.253
HEMBA1000567	41.385	38.483	27.881	32.207	15.544	26.052	15.086	86.601
HEMBA1000568	44.686	33.379	126.524	26.300	22.533	17.402	26.970	18.707
HEMBA1000569	58.184	27.187	41.012	21.787	12.925	36.191	33.944	23.225
HEMBA1000575	155.833	155.759	434.526	92.140	79.143	69.949	59.928	71.189
HEMBA1000588	41.087	26.072	31.610	14.580	18.024	18.458	23.553	13.279
HEMBA1000590	29.693	17.090	23.618	7.069	6.633	16.725	20.068	13.042
HEMBA1000591	106.772	54.874	98.079	34.099	31.776	57.170	48.488	32.766
HEMBA1000592	7.408	10.031	9.435	9.551	8.209	5.142	7.480	10.319
HEMBA1000594	18.401	11.048	22.547	15.327	9.596	12.099	8.751	6.852
HEMBA1000604	96.047	78.462	146.030	49.571	36.099	70.815	41.797	47.748
HEMBA1000607	46.819	15.606	46.037	9.438	19.149	21.038	17.317	25.404
HEMBA1000608	8.985	3.040	6.705	0.000	7.378	4.453	0.000	5.544
HEMBA1000622	45.570	55.746	113.666	40.310	18.167	19.390	15.895	29.149
HEMBA1000634	126.532	49.146	138.073	29.094	95.787	79.662	50.271	71.657
HEMBA1000636	151.899	51.270	126.200	39.161	51.864	62.611	54.056	39.415
HEMBA1000637	33.241	23.587	39.380	18.047	16.265	30.075	28.226	24.559
HEMBA1000655	80.165	70.766	219.283	58.901	61.320	45.821	40.741	62.639
HEMBA1000657	60.961	31.993	41.401	18.008	30.565	35.201	35.611	42.178
HEMBA1000662	8.600	8.490	11.263	5.475	2.201	6.140	1.557	2.504
HEMBA1000664	14.358	5.082	3.637	2.670	3.516	4.913	3.094	3.579
HEMBA1000671	11.588	15.473	26.067	17.940	8.865	7.647	10.779	21.196
HEMBA1000673	73.174	77.410	193.253	46.051	34.388	33.975	25.896	31.646
HEMBA1000675	7.666	12.047	22.123	5.764	42.036	15.788	10.254	15.555
HEMBA1000678	7.453	12.314	21.083	12.174	14.897	12.628	6.969	6.584
HEMBA1000682	118.965	125.696	255.731	86.894	61.443	66.299	49.060	82.939
HEMBA10006S6	25.079	17.463	23.126	12.722	10.282	13.835	21.393	18.154
HEMBA1000702	206.683	94.357	266.585	62.386	79.930	90.914	98.397	60.559
HEMBA1000705	25.430	25.862	47.190	13.191	19.599	26.364	25.013	18.833
HEMBA1000713	56.893	25.288	70.751	17.660	24.138	23.311	21.805	21.736
HEMBA1000718	50.149	43.869	128.515	28.289	23.213	18.458	10.003	17.419
HEMBA1000719	37.969	17.467	28.513	12.147	12.768	22.643	14.744	14.432
HEMBA1000722	15.150	9.762	14.699	6.768	11.726	12.080	5.907	9.953
HEMBA1000726	159.817	111.276	463.937	91.448	109.093	58.587	46.517	70.087
HEMBA1000727	22.867	26.803	28.886	21.475	11.199	14.966	8.634	30.401
HEMBA1000732	28.630	11.011	12.790	4.617	3.548	13.325	19.978	13.472
HEMBA1000736	24.568	21.982	21.410	7.431	11.376	41.026	31.698	16.801
HEMBA1000743	0.741	4.467	1.793	1.637	1.227	3.642	4.563	3.368
HEMBA1000745	8.930	7.067	14.546	3.314	10.067	5.403	9.225	6.085
HEMBA1000747	21.442	12.487	25.662	17.081	5.384	10.287	9.865	8.267
HEMBA1000748	22.924	14.885	35.721	12.634	3.045	11.508	4.110	11.756
HEMBA1000749	67.267	50.826	159.211	43.879	20.345	29.613	19.447	31.693
HEMBA1000752	54.929	35.778	162.005	28.209	31.540	25.132	15.650	20.776
HEMBA1000753	120.889	83.878	155.892	48.092	54.307	53.238	38.941	39.331
HEMBA1000757	20.234	22.592	52.608	29.935	23.071	24.503	14.548	43.779
HEMBA1000760	12.599	38.665	19.973	15.800	30.188	14.155	10.570	39.229
HEMBA1000769	114.956	74.924	304.424	66.815	39.365	48.405	39.918	55.931
HEMBA1000773	2.162	5.360	11.883	4.445	0.965	3.158	3.956	2.663
HEMBA1000774	128.563	115.732	330.111	84.461	69.618	59.363	42.656	56.152
HEMBA1000780	6.850	7.130	24.176	6.924	6.903	6.546	6.667	9.576
HEMBA1000783	8.127	5.076	13.701	3.276	8.863	6.241	5.435	4.429
HEMBA1000791	41.433	51.546	108.542	29.633	42.735	44.515	43.187	40.856
HEMBA1000793	108.761	30.885	54.568	18.670	31.512	54.669	45.458	34.788
HEMBA1000802	15.062	11.125	9.052	10.300	11.505	12.950	15.354	16.952
HEMBA1000813	106.763	52.683	69.701	32.507	44.369	65.862	59.842	56.799
HEMBA1000817	19.480	7.070	17.915	4.016	15.239	18.434	11.273	8.079
HEMBA1000822	9.520	10.358	15.760	7.218	8.704	11.185	6.639	4.662
HEMBA1000827	96.001	12.420	24.041	8.305	24.000	6.709	3.488	8.591
HEMBA1000833	53.675	28.970	35.897	14.604	26.383	29.036	20.591	14.341
HEMBA1000835	74.696	67.353	83.737	34.349	42.834	61.145	66.784	52.015
HEMBA1000843	74.227	54.197	92.042	37.825	58.573	98.943	87.569	55.077
HEMBA1000851	23.913	14.070	13.081	6.847	8.634	12.419	19.200	22.286
HEMBA1000852	56.702	54.074	105.085	31.127	34.200	31.843	28.843	30.311
HEMBA1000867	15.548	10.247	11.912	6.256	1.227	12.374	8.518	5.611

[0441]

TABLE 9
HEMBA1000869	19.696	18.785	34.039	15.061	6.930	13.298	14.305	14.112
HEMBA1000870	64.189	38.246	44.665	12.647	23.970	41.195	21.911	17.508
HEMBA1000872	46.848	46.546	86.933	36.087	40.608	42.532	43.479	36.141
HEMBA1000875	35.460	41.166	32.238	11.297	35.077	29.781	19.453	23.540
HEMBA1000876	89.976	56.654	194.869	42.595	57.670	53.567	36.331	40.884
HEMBA1000907	22.959	9.656	10.917	3.599	3.363	5.327	13.032	10.676
HEMBA1000908	45.409	18.456	30.665	12.448	8.174	19.529	24.789	16.299
HEMBA1000910	47.107	13.681	26.933	5.866	7.073	19.938	22.971	11.592
HEMBA1000918	67.437	29.880	114.873	25.206	16.670	25.895	26.769	24.710
HEMBA1000919	44.938	29.704	40.184	22.126	16.008	24.639	23.073	20.233
HEMBA1000934	162.546	35.314	59.012	18.820	30.796	53.492	33.824	20.798
HEMBA1000935	16.284	29.481	71.669	12.587	23.834	13.188	7.830	13.322
HEMBA1000940	44.243	39.296	75.619	25.080	28.113	39.401	25.948	30.168
HEMBA1000942	126.095	96.812	260.912	62.657	49.118	47.891	35.814	49.631
HEMBA1000943	14.439	12.702	14.690	4.792	8.391	11.856	11.039	7.414
HEMBA1000946	15.461	5.506	18.692	9.000	5.772	0.000	19.405	9.939
HEMBA1000960	179.860	151.073	343.747	107.319	85.691	117.093	82.928	94.494
HEMBA1000962	73.395	34.803	60.061	26.562	28.789	47.944	60.067	31.619
HEMBA1000968	14.529	12.486	35.270	18.733	6.213	7.458	7.214	4.624
HEMBA1000971	50.148	19.281	37.515	12.222	19.562	29.874	22.045	23.135
HEMBA1000972	51.100	33.450	188.137	28.972	24.576	23.736	13.731	27.272
HEMBA1000974	5.609	10.649	12.866	2.929	2.603	3.800	6.104	4.964
HEMBA1000975	34.417	19.132	42.499	15.644	4.009	16.478	14.192	14.353
HEMBA1000979	90.061	38.532	99.641	19.754	27.516	38.801	31.347	36.440
HEMBA1000981	35.338	31.281	38.672	19.544	34.385	38.280	24.897	29.059
HEMBA1000983	71.391	34.501	58.683	22.640	32.825	32.384	27.465	31.286
HEMBA1000985	9.290	20.363	22.497	4.058	6.343	9.035	7.852	3.257
HEMBA1000986	128.714	74.713	236.019	56.662	52.957	85.340	63.718	54.892
HEMBA1000991	72.707	55.780	160.717	34.676	32.494	41.317	23.483	37.846
HEMBA1001007	123.690	42.563	69.807	23.525	34.263	47.777	47.496	48.154
HEMBA1001008	124.864	47.842	83.746	18.125	25.490	52.693	30.668	24.961
HEMBA1001009	37.843	29.269	36.715	11.055	17.115	17.937	17.701	22.055
HEMBA1001014	109.049	83.356	233.234	60.123	61.977	94.424	47.095	74.625
HEMBA1001017	50.408	20.212	48.394	16.020	28.537	31.917	27.876	24.283
HEMBA1001019	7.327	7.582	14.865	6.154	10.598	5.643	3.920	77188
HEMBA1001020	53.067	55.646	115.814	31.640	25.647	24.596	23.146	27.169
HEMBA1001021	115.724	42.415	59.434	28.828	26.181	64.484	64.173	29.614
HEMBA1001022	37.883	25.835	28.969	18.452	20.270	22.790	25.194	20.783
HEMBA1001024	23.524	15.235	16.511	8.023	11.818	13.894	8.606	8.098
HEMBA1001026	21.343	12.515	18.851	6.888	7.288	12.663	8.419	7.418
HEMBA1001043	10.374	11.995	9.892	10.750	19.163	9.299	8.047	8.589
HEMBA1001051	124.869	115.181	387.345	100.376	67.510	61.660	46.295	68.994
HEMBA1001052	38.892	13.860	19.067	12.855	11.445	24.382	15.726	12.323
HEMBA1001059	98.097	41.525	66.565	27.826	26.220	46.725	42.356	36.506
HEMBA1001060	116.857	74.020	161.485	61.750	50.524	52.957	38.575	52.612
HEMBA1001064	32.251	24.026	33.937	14.007	7.907	13.710	17.387	16.720
HEMBA1001071	25.850	16.043	19.924	7.855	3.425	9.530	6.779	24.242
HEMBA1001077	24.689	23.055	64.486	19.413	16.821	16.858	13.165	12.873
HEMBA1001078	33.254	26.761	41.713	26.498	24.531	31.498	25.302	23.636
HEMBA1001080	57.701	23.951	31.254	22.489	24.848	33.265	31.880	26.484
HEMBA1001084	62.698	41.625	171.096	31.438	31.760	24.829	17.487	26.581
HEMBA1001085	159.252	116.909	294.247	77.235	81.384	76.498	59.989	55.574
HEMBA1001088	74.704	42.537	46.695	19.266	25.146	33.498	44.927	26.310
HEMBA1001093	30.048	28.810	72.081	20.831	14.610	11.033	15.558	22.531
HEMBA1001094	5.535	8.779	10.059	3.089	4.628	4.521	4.834	4.468
HEMBA1001099	18.322	24.021	14.814	7.146	13.778	16.055	11.044	10.190
HEMBA1001104	21.919	13.788	35.048	9.637	18.058	24.450	21.559	18.527
HEMBA1001109	186.384	190.240	540.908	155.496	134.630	93.324	78.690	116.187
HEMBA1001114	89.023	252.529	187.547	75.857	35.109	66.259	69.432	341.702
HEMBA1001121	32.820	25.812	89.860	19.710	34.244	18.209	9.519	15.621
HEMBA1001122	3.304	6.213	8.316	4.763	19.120	5.650	4.506	23.059
HEMBA1001123	108.859	55.807	190.789	41.415	39.028	42.683	25.551	30.174
HEMBA1001133	50.744	21.167	36.786	14.764	34.752	26.702	23.524	11.367
HEMBA1001137	38.685	21.659	46.297	21.567	13.174	15.867	11.767	25.508

[0442]

TABLE 10
HEMBA1001140	60.453	66.122	169.353	48.837	60.363	44.403	30.367	43.561
HEMBA1001144	278.126	195.811	643.688	207.291	166.089	101.134	106.337	142.120
HEMBA1001145	58.539	241.368	206.084	46.342	39.316	61.827	91.170	66.852
HEMBA1001158	29.417	28.121	43.877	13.337	24.176	19.965	18.089	28.622
HEMBA1001172	74.727	47.695	213.708	37.115	24.460	26.620	19.178	32.709
HEMBA1001174	6.279	8.617	8.831	7.914	2.574	8.031	3.119	4.980
HEMBA1001175	29.561	34.909	43.568	19.819	34.829	16.588	19.883	17.824
HEMBA1001182	136.762	64.608	105.979	44.066	83.417	86.736	126.297	79.785
HEMBA1001184	16.758	9.703	22.060	9.016	11.018	10.205	6.347	9.176
HEMBA1001192	15.119	10.798	11.626	6.559	5.736	3.435	9.089	11.273
HEMBA1001197	82.571	114.743	110.687	83.431	56.396	68.797	99.959	173.379
HEMBA1001208	40.250	30.964	37.220	19.514	11.451	24.172	27.637	12.469
HEMBA1001213	81.501	37.345	57.618	18.958	24.480	52.160	51.978	31.326
HEMBA1001214	36.798	16.011	20.958	17.612	12.418	20.697	19.108	21.328
HEMBA1001221	14.108	10.456	11.382	7.001	17.058	10.307	7.980	11.111
HEMBA1001225	13.961	14.077	13.384	5.925	5.876	13.456	12.076	5.825
HEMBA1001226	173.501	137.685	444.754	120.060	113.306	75.167	63.960	67.304
HEMBA1001228	115.971	48.677	102.518	36.755	64.214	50.002	60.915	35.178
HEMBA1001229	246.802	111.161	135.886	43.460	94.703	148.387	156.871	115.302
HEMBA1001235	43.880	86.102	81.818	36.769	54.172	65.830	70.065	66.201
HEMBA1001238	67.342	62.561	136.273	36.471	33.652	41.838	26.195	28.747
HEMBA1001242	55.562	43.106	58.593	41.382	47.200	38.498	43.114	44.230
HEMBA1001247	28.768	22.129	16.518	10.576	8.758	17.031	9.651	13.385
HEMBA1001253	58.130	60.415	66.640	18.982	45.992	54.071	95.073	63.393
HEMBA1001257	33.557	18.509	24.256	10.657	12.732	31.261	24.849	9.134
HEMBA1001261	585.214	143.415	243.791	98.186	169.988	310.109	234.388	125.796
HEMBA1001262	27.336	17.339	19.088	5.647	15.678	20.899	11.464	19.889
HEMBA1001265	36.604	28.090	152.221	27.730	49.893	34.423	16.502	26.993
HEMBA1001266	69.367	67.414	170.657	45.898	31.802	39.554	41.287	52.480
HEMBA1001269	69.921	44.649	36.964	34.126	22.232	42.207	49.848	39.719
HEMBA1001272	20.406	15.416	11.514	7.843	8.604	7.893	20.960	13. 545
HEMBA1001279	113.597	76.085	147.371	41.113	50.841	58.248	43.344	47.548
HEMBA1001281	45.326	37.551	65.225	44.536	46.787	41.371	32.229	56.625
HEMBA1001286	370.697	150.949	236.623	103.571	123.976	219.461	196.233	117.566
HEMBA1001289	41.041	24.670	40.151	15.175	30.612	27.627	26.637	19.344
HEMBA1001291	76.537	40.444	50.226	18.776	38.423	55.355	46.692	35.972
HEMBA1001294	82.258	72.319	157.642	42.143	20.735	29.333	17.711	34.443
HEMBA1001296	53.487	17.150	31.045	10.275	15.918	21.120	15.842	13.595
HEMBA1001297	13.397	24.306	19.513	11.631	14.701	4.543	9.800	8.121
HEMBA1001299	122.378	135.140	326.747	90.817	73.749	56.152	49.803	80.999
HEMBA1001302	56.839	29.036	56.412	19.108	20.078	34.481	51.929	37.087
HEMBA1001303	14.975	18.442	43.778	16.797	10.985	11.442	9.787	19.264
HEMBA1001306	262.869	135.864	244.234	109.949	109.582	147.334	146.509	115.543
HEMBA1001308	174.017	96.705	220.049	56.953	61.486	74.225	56.171	58.657
HEMBA1001310	103.029	52.915	67.714	22.895	38.245	67.233	49.204	51.006
HEMBA1001312	98.664	47.333	61.080	18.118	33.555	47.007	41.795	38.627
HEMBA1001319	2.396	8.234	13.960	1.828	5.485	3.003	5.682	3.780
HEMBA1001322	139.794	39.912	105.709	27.700	41.977	70.428	70.602	46.470
HEMBA1001323	33.347	16.728	25.356	11.399	17.982	11.181	6.356	12.033
HEMBA1001326	86.190	37.984	69.933	24.331	30.078	49.223	46.365	16.347
HEMBA1001327	7.232	9.387	23.180	7.314	5.185	9.563	4.423	5.267
HEMBA1001330	115.768	106.951	275.315	73.389	24.661	70.535	40.088	77.680
HEMBA1001348	15.770	21.874	26.347	9.575	13.666	23.703	12.647	13.724
HEMBA1001350	75.857	38.749	51.454	16.428	34.291	56.400	34.055	24.753
HEMBA1001351	52.274	55.313	56.544	30.521	46.408	29.604	44.212	30.972
HEMBA1001352	68.321	46.617	54.427	17.559	29.887	39.484	52.789	29.131
HEMBA1001353	39.891	57.492	54.971	31.425	27.945	45.687	29.741	66.188
HEMBA1001358	45.659	52.406	59.774	46.865	40.225	47.618	32.581	59.101
HEMBA1001361	22.908	16.519	28.635	11.897	15.569	13.635	13.938	16.914
HEMBA1001364	18.896	17.205	23.355	7.224	9.469	13.379	76.125	15.026
HEMBA1001375	61.506	22.179	38.795	12.798	25.778	40.077	21.715	22.300
HEMBA1001377	140.430	131.029	307.084	83.191	100.026	74.475	63.988	96.351
HEMBA1001383	23.974	26.206	28.704	11.442	17.819	19.160	16.899	7.766
HEMBA1001387	58.343	34.130	63.677	19.556	30.371	42.397	40.247	49.239

[0443]

TABLE 11
HEMBA1001388	48.601	24.690	39.877	18.958	10.634	32.922	22.224	33.218
HEMBA1001390	132.003	94.390	254.352	56.412	64.490	47.169	44.169	57.312
HEMBA1001391	18.302	9.686	12.994	6.299	10.600	8.500	7.116	5.544
HEMBA1001398	91.232	50.992	142.408	36.081	29.548	29.490	28.704	29.984
HEMBA1001405	58.645	22.354	32.227	15.864	9.285	19.993	24.564	13.964
HEMBA1001406	36.434	22.693	105.808	18.094	19.994	13.316	18.019	16.592
HEMBA1001407	38.781	19.637	24.599	18.935	13.107	23.014	18.826	15.060
HEMBA1001411	28.412	7.180	21.950	8.303	9.708	14.302	8.598	6.663
HEMBA1001413	66.736	26.480	35.635	15.400	24.013	18.356	24.304	20.769
HEMBA1001414	20.720	7.567	18.414	12.522	9.722	12.903	18.283	18.581
HEMBA1001415	76.802	54.702	159.510	34.156	20.989	32.235	21.694	26.676
HEMBA1001416	41.784	23.474	29.453	12.230	24.881	24.993	25.847	28.651
HEMBA1001432	74.066	60.077	190.870	40.409	63.619	36.879	66.751	33.675
HEMBA1001433	132.672	110.163	246.542	77.852	61.676	50.447	37.821	64.403
HEMBA1001435	138.669	108.645	334.104	89.523	68.855	59.723	58.393	56.483
HEMBA1001442	13.093	8.604	11.177	7.985	15.704	7.291	6.742	6.336
HEMBA1001446	102.450	63.255	146.442	40.086	27.976	37.353	30.266	41.647
HEMBA1001450	72.339	35.494	55.103	30.799	31.322	42.457	42.764	41.349
HEMBA1001454	146.726	128.060	438.247	88.679	43.129	54.712	41.131	31.250
HEMBA1001455	5.879	8.197	8.325	5.561	4.437	5.252	4.300	7.359
HEMBA1001459	17.432	15.927	16.490	6.749	2.733	5.888	7.836	10.963
HEMBA1001461	61.531	52.734	57.136	38.874	24.764	19.473	23.241	32.318
HEMBA1001462	10.875	14.911	16.843	12.984	13.465	48.381	7.061	25.992
HEMBA1001463	137.907	83.753	340.496	93.114	51.866	61.784	37.705	68.960
HEMBA1001469	85.416	21.757	29.463	15.911	84.887	77.440	27.033	29.537
HEMBA1001473	20.582	31.855	36.498	8.307	3.680	16.703	21.371	19.890
HEMBA1001476	135.720	113.851	246.800	65.595	57.431	63.903	65.229	67.697
HEMBA1001477	5.228	2.001	4.505	2.645	1.540	3.243	1.426	2.876
HEMBA1001478	14.335	10.180	12.692	5.468	4.474	5.444	2.171	4.539
HEMBA1001480	88.891	28.381	49.689	21.660	14.126	36.334	38.272	30.563
HEMBA1001483	29.872	5.156	20.900	4.647	5.264	9.545	13.805	4.424
HEMBA1001490	6.867	6.967	14.148	7.289	1.585	5.016	5.792	5.999
HEMBA1001495	431.282	118.073	203.714	73.985	176.836	195.947	194.164	146.945
HEMBA1001497	93.817	60.807	227.867	55.576	41.006	34.182	23.206	45.223
HEMBA1001510	174.254	120.414	343.336	76.008	76.932	73.234	61.531	76.899
HEMBA1001515	45.158	26.337	67.169	15.756	15.962	10.664	9.567	12.346
HEMBA1001517	51.005	47.728	80.287	34.595	28.246	21.020	17.229	33.972
HEMBA1001522	7.431	8.980	7.032	7.566	5.011	6.466	6.447	4.824
HEMBA1001526	48.774	21.300	32.732	18.831	22.395	22.767	23.530	17.914
HEMBA1001533	129.423	85.570	262.800	70.163	46.649	44.926	26.457	37.421
HEMBA1001547	59.442	26.656	27.947	8.053	15.558	53.508	108.861	25.371
HEMBA1001552	41.663	33.242	115.535	26.222	30.447	18.258	21.358	25.853
HEMBA1001553	58.388	75.765	66.228	32.264	36.396	54.513	64.874	41.905
HEMBA1001557	182.516	80.827	161.852	69.344	80.644	123.765	111.732	70.946
HEMBA1001563	39.649	31.429	85.246	26.057	12.157	15.987	10.065	17.083
HEMBA1001566	37.835	49.964	108.284	35.793	23.255	25.180	21.368	39.375
HEMBA1001569	75.584	44.631	109.624	35.487	130.340	63.130	44.960	55.257
HEMBA1001570	198.300	125.319	444.153	119.332	74.267	79.979	64.732	90.896
HEMBA1001579	103.128	60.654	48.704	22.469	22.629	67.058	24.391	34.300
HEMBA1001581	153.698	126.225	312.570	131.687	142.104	91.884	67.267	94.418
HEMBA1001582	3.551	7.087	15.302	4.019	8.190	4.888	4.671	5.144
HEMBA1001585	27.271	18.375	25.179	14.108	5.648	14.993	7.628	12.297
HEMBA1001589	109.877	22.722	49.216	20.427	22.904	64.665	57.120	21.314
HEMBA1001595	71.600	62.349	46.938	34.447	29.362	34.516	45.233	35.562
HEMBA1001604	41.253	27.004	34.167	16.004	6.061	21.932	18.414	23.101
HEMBA1001608	35.073	29.270	41.525	21.276	22.867	22.699	14.094	15.366
HEMBA1001615	556.575	105.703	103.519	47.686	27.311	81.914	42.373	58.652
HEMBA1001620	134.940	29.972	79.824	31.924	62.056	54.423	64.359	36.203
HEMBA1001621	70.036	30.704	63.807	15.048	19.545	42.391	33.266	40.516
HEMBA1001635	39.932	29.397	35.653	16.214	18.765	19.655	22.405	14.095
HEMBA1001636	73.726	18.596	35.798	14.928	12.865	24.352	31.819	22.414
HEMBA1001640	48.402	45.105	79.588	28.452	22.449	25.101	30.009	43.819
HEMBA1001647	82.402	39.456	75.907	35.084	26.220	48.859	71.158	46.463
HEMBA1001651	390.307	66.648	181.929	51.802	112.530	208.201	178.161	96.640

[0444]

TABLE 12
HEMBA1001655	60.366	18.983	58.438	20.404	25.072	27.162	29.260	26.673
HEMBA1001658	6.754	15.270	17.542	13.420	5.060	4.800	4.973	4.979
HEMBA1001661	87.199	20.304	32.793	13.056	8.394	24.098	22.916	24.583
HEMBA1001665	160.583	20.830	54.460	12.363	48.457	86.024	73.847	21.248
HEMBA1001670	16.953	38.651	17.002	34.999	14.855	17.849	22.906	29.478
HEMBA1001672	32.013	18.885	29.000	10.798	7.763	13.782	17.314	12.393
HEMBA1001673	38.188	67.401	34.336	38.037	14.401	17.612	30.520	43.461
HEMBA1001675	25.652	15.594	33.810	5.390	15.796	13.173	20.020	12.830
HEMBA1001676	91.000	54.310	85.397	92.681	131.468	50.365	47.230	68.405
HEMBA1001678	218.382	128.995	336.408	93.889	115.305	80.843	48.879	83.933
HEMBA1001680	82.159	51.521	165.818	33.978	36.449	33.368	38.495	35.261
HEMBA1001681	1.654	0.785	0.840	2.142	2.581	2.772	2.146	2.424
HEMBA1001684	143.985	84.151	377.154	72.850	69.097	61.638	30.820	52.077
HEMBA1001695	16.068	10.112	14.571	6.860	4.930	4.572	6.164	7.330
HEMBA1001702	26.509	13.637	8.186	8.466	4.041	2.043	3.870	3.613
HEMBA1001709	67.279	26.552	35.845	13.982	21.742	28.610	24.540	19.603
HEMBA1001711	20.072	29.559	39.037	20.902	21.639	12.713	14.718	33.127
HEMBA1001712	80.448	25.222	51.628	19.393	12.482	38.014	39.474	14.831
HEMBA1001714	360.368	55.902	142.225	33.748	51.048	144.094	124.654	59.543
HEMBA1001717	78.599	137.380	18.549	12.298	5.575	38.689	10.120	6.047
HEMBA1001718	51.621	52.280	151.597	31.305	21.166	29.146	14.075	24.411
HEMBA1001723	17.072	13.658	8.525	5.653	8.811	9.350	11.097	7.268
HEMBA1001731	35.728	22.781	41.531	15.151	12.421	15.292	14.020	16.584
HEMBA1001734	52.546	40.599	99.556	25.099	24.031	28.537	17.389	32.936
HEMBA1001736	177.269	58.328	110.046	33.820	58.955	108.630	91.464	62.571
HEMBA1001741	41.432	12.649	29.883	14.886	16.207	10.446	11.420	7.286
HEMBA1001744	5.531	6.849	12.961	13.191	14.151	4.519	8.367	8.623
HEMBA1001745	41.752	17.786	36.239	12.476	21.118	23.635	15.410	16.514
HEMBA1001746	27.437	14.874	24.099	8.668	21.929	19.488	11.306	10.070
HEMBA1001761	93.148	46.911	179.597	28.212	33.421	34.026	19.164	25.901
HEMBA1001762	55.612	45.069	102.148	38.307	35.260	33.316	21.274	45.248
HEMBA1001781	13.298	21.385	26.693	6.898	17.098	52.601	11.768	23.068
HEMBA1001784	89.965	43.765	70.064	26.575	31.708	50.347	52.265	31.618
HEMBA1001791	182.379	81.719	171.066	44.628	49.350	82.856	58.215	48.207
HEMBA1001794	248.582	163.789	153.778	73.632	50.595	152.279	178.827	132.329
HEMBA1001800	23.432	21.165	27.668	11.281	20.728	24.910	36.900	22.729
HEMBA1001803	17.343	8.333	22.801	6.620	6.043	7.560	6.613	10.079
HEMBA1001804	109.775	44.797	59.456	29.337	34.849	44.372	36.696	35.851
HEMBA1001808	78.129	23.567	38.056	15.858	23.507	27.136	14.673	12.332
HEMBA1001809	66.887	31.733	54.127	33.314	26.179	35.618	41.552	46.141
HEMBA1001811	58.974	24.196	37.583	17.314	16.018	21.582	15.074	19.831
HEMBA1001815	71.286	63.775	155.707	37.153	29.944	35.297	25.257	24.172
HEMBA1001816	38.494	19.017	16.797	7.139	5.598	16.061	22.304	14.646
HEMBA1001819	18.590	21.371	38.109	20.938	21.358	15.313	14.917	25.144
HEMBA1001820	10.884	9.530	8.017	3.507	4.470	3.473	2.999	3.099
HEMBA1001822	74.239	95.719	91.314	62.121	28.285	42.988	38.222	47.532
HEMBA1001824	155.543	93.583	301.248	95.135	67.478	89.045	64.562	61.114
HEMBA1001835	23.616	7.706	25.753	5.777	19.660	19.809	12.020	10.462
HEMBA1001844	149.876	52.023	230.213	48.968	42.113	39.652	33.559	40.495
HEMBA1001847	52.045	19.220	40.636	20.235	5.196	35.109	20.186	35.814
HEMBA1001849	101.048	104.708	250.547	53.025	28.022	40.644	33.371	35.250
HEMBA1001850	105.331	27.032	39.813	15.808	31.525	42.751	44.306	18.213
HEMBA1001861	3.104	4.469	6.763	3.292	4.454	2.945	0.995	3.121
HEMBA1001862	50.279	145.708	102.412	25.750	34.563	40.833	22.588	71.713
HEMBA1001864	24.313	31.572	50.378	32.237	24.991	21.182	21.031	28.126
HEMBA1001866	57.711	54.190	146.615	31.714	19.527	26.041	22.874	21.249
HEMBA1001869	55.280	99.559	58.454	35.799	45.195	40.562	22.644	40.891
HEMBA1001871	75.011	44.336	77.195	41.540	39.300	54.584	34.598	42.631
HEMBA1001876	34.287	31.955	30.568	85.092	19.827	15.356	8.554	21.861
HEMBA1001878	17.361	17.619	17.545	15.644	5.481	11.657	14.965	18.117
HEMBA1001879	57.004	22.429	37.128	16.562	20.200	35.414	21.946	17.114
HEMBA1001884	68.009	84.640	41.930	38.470	27.460	36.604	25.345	26.320
HEMBA1001886	12.711	12.605	37.824	31.827	15.893	14.038	6.697	38.737
HEMBA1001888	63.251	46.960	165.623	41.706	21.154	29.117	21.131	33.090

[0445]

TABLE 13
HEMBA1001890	42.902	42.848	42.779	30.112	25.432	24.430	22.605	26.730
HEMBA1001896	66.448	24.720	44.103	21.972	17.708	30.703	19.628	23.571
HEMBA1001899	36.251	25.553	24.121	14.701	12.301	21.838	17.455	20.813
HEMBA1001904	54.904	256.020	233.857	243.646	55.587	234.548	188.571	526.744
HEMBA1001910	40.309	10.865	13.738	11.244	8.226	15.367	15.894	13.300
HEMBA1001911	35.962	23.128	26.357	25.151	11.860	24.224	22.870	18.238
HEMBA1001912	59.924	66.966	97.679	51.180	45.903	33.336	33.019	40.551
HEMBA1001913	175.368	39.664	67.432	33.132	26.376	63.459	70.607	52.824
HEMBA1001915	14.756	14.666	30.224	8.295	7.629	17.718	6.737	8.522
HEMBA1001918	5.018	8.961	27.591	7.538	11.032	8.265	4.852	4.772
HEMBA1001921	4.431	8.444	18.196	11.252	12.587	7.417	7.668	2.769
HEMBA1001931	3.948	0.000	4.664	1.422	3.480	2.935	1.127	2.898
HEMBA1001939	94.821	24.679	81.706	24.209	16.692	37.223	29.835	13.058
HEMBA1001940	54.512	33.931	145.138	26.273	27.653	18.649	13.136	19.614
HEMBA1001942	38.572	16.710	32.402	18.718	14.782	25.435	26.410	16.143
HEMBA1001944	210.898	71.197	96.883	48.156	38.533	82.132	92.097	74.740
HEMBA1001945	31.531	17.019	14.533	10.175	3.037	17.421	12.222	11.694
HEMBA1001950	7.103	7.424	9.611	3.281	4.091	7.632	5.310	4.044
HEMBA1001951	46.024	19.234	101.026	19.207	13.212	23.714	20.006	19.402
HEMBA1001958	44.554	12.806	35.277	17.321	13.181	22.652	28.735	20.948
HEMBA1001960	20.513	7.802	16.888	8.822	2.948	8.826	10.834	12.935
HEMBA1001962	4.367	5.104	4.205	2.811	3.031	4.870	2.364	2.994
HEMBA1001964	35.944	22.281	62.761	18.757	6.663	17.775	8.068	8.601
HEMBA1001967	47.345	29.504	42.717	13.526	22.051	33.555	23.601	37.521
HEMBA1001979	35.138	6.478	16.732	12.797	5.919	13.447	10.355	9.155
HEMBA1001987	60.083	52.275	190.331	45.735	24.898	26.381	17.514	28.891
HEMBA1001991	111.286	79.833	276.566	56.455	50.862	50.789	40.252	54.919
HEMBA1002003	66.389	23.989	53.710	17.039	17.174	30.547	28.422	24.474
HEMBA1002005	86.885	41.457	150.127	33.935	15.339	24.541	24.237	27.345
HEMBA1002008	32.101	25.375	86.511	18.349	8.912	7.593	18.519	14.967
HEMBA1002018	66.105	22.380	36.174	16.334	21.482	27.922	34.098	27.804
HEMBA1002022	13.986	8.018	13.490	0.000	2.985	5.730	6.036	1.433
HEMBA1002029	132.547	305.823	115.974	144.692	70.087	74.071	37.046	204.730
HEMBA1002030	17.077	10.337	14.524	5.906	8.466	5.897	6.258	6.824
HEMBA1002035	48.658	12.959	10.324	14.325	7.176	14.446	14.084	13.506
HEMBA1002037	16.343	34.097	27.567	14.451	12.568	15.087	13.819	12.140
HEMBA1002038	68.477	31.733	91.391	16.935	8.370	6.020	17.500	19.367
HEMBA1002039	15.944	22.707	17.807	13.914	7.910	3.306	4.716	11.003
HEMBA1002042	41.657	27.877	32.654	21.111	14.815	10.217	24.300	22.659
HEMBA1002043	149.364	92.912	208.642	70.906	53.861	84.089	81.242	61.829
HEMBA1002048	137.253	29.889	60.279	19.894	21.605	66.594	55.483	30.137
HEMBA1002049	98.417	84.099	271.170	63.157	87.434	48.247	39.557	53.676
HEMBA1002053	33.636	19.194	25.821	11.890	16.358	16.441	25.376	27.152
HEMBA1002055	67.115	34.916	39.511	37.518	17.449	25.297	28.606	39.067
HEMBA1002056	13.684	12.039	16.129	14.136	1.311	8.564	4.481	12.538
HEMBA1002061	11.815	14.960	29.478	10.168	10.973	11.179	9.701	8.124
HEMBA1002080	59.350	80.319	81.497	43.371	72.416	39.904	45.653	53.581
HEMBA1002084	11.331	7.502	15.981	7.301	10.773	13.652	6.835	5.555
HEMBA1002085	69.868	62.174	111.196	13.760	19.083	101.175	43.117	14.011
HEMBA1002092	127.409	33.016	60.924	24.219	32.654	72.141	50.433	27.770
HEMBA1002098	34.645	16.695	25.357	15.741	15.632	18.082	12.882	20.451
HEMBA1002100	118.301	90.733	129.453	60.276	41.079	89.713	44.294	67.352
HEMBA1002101	57.160	69.427	106.418	34.067	32.565	38.238	15.932	74.139
HEMBA1002102	104.746	76.058	178.766	45.801	50.114	53.399	40.628	54.459
HEMBA1002105	35.380	25.812	31.300	14.131	14.867	29.842	22.894	23.960
HEMBA1002107	62.621	45.738	65.486	28.199	31.808	52.057	163.850	77.437
HEMBA1002113	745.018	396.517	1335.986	321.385	369.500	391.825	236.013	348.025
HEMBA1002119	35.812	23.546	72.351	18.292	19.991	18.086	26.533	25.611
HEMBA1002125	42.106	14.033	45.440	15.858	20.474	47.217	28.894	33.563
HEMBA1002131	84.269	29.512	46.944	12.807	29.311	40.381	49.691	37.106
HEMBA1002133	37.736	19.103	27.034	45.990	11.161	21.694	20.410	24.305
HEMBA1002139	25.756	10.925	20.941	4.978	11.839	9.451	7.795	9.431
HEMBA1002141	20.036	14.349	19.713	9.608	3.638	14.521	10.225	10.190
HEMBA1002144	86.896	68.335	193.756	56.749	45.612	36.918	23.020	39.262