Multivalent antibody constructs

[0001] This is a national phase filing of the Application No. PCT/DE99/01350, which was filed with the Patent Corporation Treaty on May 5, 1999, and is entitled to priority of the German Patent Application 198 19 846.9, filed May 5, 1998.

[0002] The present invention relates to multivalent F_v antibody constructs, expression plasmids which code for them, and a method for producing the F_vantibody constructs as well as the use thereof.

[0003] Natural antibodies are dimers and are therefore referred to as bivalent. They have four variable domains, namely two V_H domains and two V_L domains. The variable domains serve as binding sites for an antigen, a binding site being formed from a V_H domain and a V_L domain. Natural antibodies recognize one antigen each, so that they are also referred to as monospecific. Furthermore, they also have constant domains which add to the stability of the natural antibodies. On the other hand, they are also co-responsible for undesired immune responses which result when natural antibodies of various animal species are administered mutually.

[0004] In order to avoid such immune responses, antibodies are constructed which lack the constant domains. In particular, these are antibodies which only comprise the variable domains. Such antibodies are designated F_v antibody constructs. They are often available in the form of single-chain monomers paired with one another.

[0005] However, it showed that F_v antibody constructs only have little stability. Therefore, their usability for therapeutic purposes is strongly limited.

[0006] Thus, it is the object of the present invention to provide an antibody by means of which undesired immune responses can be avoided. Furthermore, it shall have a stability which makes it usable for therapeutic uses.

[0007] According to the invention this is achieved by the subject matters defined in the claims.

[0008] The present invention relates to a multivalent F_vantibody construct having at least four variable domains which are linked with each over via the peptide linkers 1, 2 and 3. The invention also concerns expression plasmids which code for such an F_vantibody construct and a method of producing the F_vantibody constructs as well as their use.

[0019] It is the object of the present invention to provide an antibody by means of which undesired immune responses can be avoided. Furthermore, it shall have a stability which makes it usable for therapeutic uses.

[0020] Therefore, the subject matter of the present invention relates to a multivalent F_v antibody construct which has great stability. Such a construct is suitable for diagnostic and therapeutic purposes.

[0021] The present invention is based on the applicant's insights that the stability of an F_v antibody construct can be increased if it is present in the form of a single-chain dimer where the four variable domains are linked with one another via three peptide linkers. The applicant also recognized that the F_v antibody construct folds with itself when the middle peptide linker has a length of about 10 to 30 amino acids. The applicant also recognized that the F_v antibody construct folds with other F_v antibody constructs when the middle peptide linker has a length of about up to 10 amino acids so as to obtain a multimeric, i.e., multivalent, F_v antibody construct. The applicant also realized that the F_v antibody construct can be multispecific.

[0022] According to the invention the applicant's insights are utilized to provide a multivalent F_v antibody construct which comprises at least four variable domains which are linked with one another via peptide linkers 1, 2 and 3.

[0023] The expression “F_v antibody construct” refers to an antibody which has variable domains but no constant domains.

[0024] The expression “multivalent F_v antibody construct” refers to an F_Vantibody which has several, but at least four, variable domains. This is achieved when the single-chain F_v antibody construct folds with itself so as to give four variable domains, or folds with other single-chain F_v antibody constructs. In the latter case, an F_v antibody construct is given which has 8, 12, 16, etc., variable domains. It is favorable for the F_v antibody construct to have four or eight variable domains, i.e., it is bivalent or tetravalent (FIG. 1). Furthermore, the variable domains may be equal or differ from one another, so that he antibody construct recognizes one or several antigens. The antibody construct preferably recognizes one or two antigens, i.e., it is monospecific and bispecific, respectively. Examples of such antigens are proteins CD19 and CD3.

[0025] The expression “peptide linkers 1, 3” refers to a peptide linker adapted to link variable domains of an F_v antibody construct with one another. The peptide linker may contain any amino acids, the amino acids glycine (G), serine (S) and proline (P) being preferred. The peptide linkers 1 and 3 may be equal or differ from each other. Furthermore, the peptide linker may have a length of about 0 to 10 amino acids. In the former case, the peptide linker is only a peptide bond from the COOH residue of one of the variable domains and the NH₂ residue of another of the variable domains. The peptide linker preferably comprises the amino acid sequence GG.

[0026] The expression “peptide linker 2” refers to a peptide linker adapted to link variable domains of an F_v antibody construct with one another. The peptide linker may contain any amino acids, the amino acids glycine (G), serine (S) and proline (P) being preferred. The peptide linker may also have a length of about 3 to 10 amino acids, in particular 5 amino acids, and most particularly the amino acid sequence GGPGS, which serves for achieving that the single-chain F_v antibody constructs. The peptide linker can also have a length of about 11 to 20 amino acids, in particular 15 to 20 amino acids, and most particularly the amino acid sequence (G₄S)₄, which serves for achieving that the single-chain F_v antibody construct folds with itself.

[0027] An F_v antibody constructs according to the invention can be produced by common methods. A method is favorable in which DNAs coding for the peptide linkers 1, 2 and 3 are ligated with DNAs coding for the four variable domains of an F_v antibody construct such that the peptide linkers link the variable domains with one another and the resulting DNA molecule is expressed in an expression plasmid. Reference is made to Example 1 to 6. As to the expressions “F_v antibody construct” and “peptide linker” reference is made to the above explanations and, by way of supplement, to Maniatis, T. et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, 1982.

[0028] DNAs which code for an F_v antibody construct according to the invention also represent a subject matter of the present invention. Furthermore, expression plasmids which contain such DNAs also represent a subject matter of the present invention. Preferred expression plasmids are pDISC3x19-LL, pDISC3x19-SL, pPIC-DISC-LL, pPIC-DISC-SL, pDISC5-LL and pDISC6-SL. The first four were deposited with the DSMZ (Deutsche Sammlung für Mikroorganismen und Zellen) [German-type collection for micro-organisms and cells] on Apr. 30, 1998 under DSM 12150, DSM 12149, DSM 12152 and DSM 12151, respectively.

[0029] Another subject matter of the present invention relates to a kit, comprising:

[0030] (a) an F_v antibody construct according to the invention, and/or

[0031] (b) an expression plasmid according to the invention, and

[0032] (c) conventional auxiliary agents, such as buffers, solvents and controls.

[0033] One or several representatives of the individual components may be present.

[0034] The present invention provides a multivalent F_v antibody construct where the variable domains are linked with one another via peptide linkers. Such an antibody construct distinguishes itself in that it contains no parts which can lead to undesired immune reactions. Furthermore, it has great stability. It also enables to bind several antigens simultaneously. Therefore, the F_v antibody construct according to the invention is perfectly adapted to be used not only for diagnostic but also for therapeutic purposes. Such purposes can be seen as regards any disease, in particular a viral, bacterial or tumoral disease.

[0035] The below examples explain the invention in more detail. The following preparations and examples are given to enable those skilled in the art to more clearly understand and to practice the present invention. The present invention, however, is not limited in scope by the exemplified embodiments, which are intended as illustrations of single aspects of the invention only, and methods which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

[0036] The plasmids pHOG-αCD19 and pHOG-dmOKT3 which code for the scFv fragments derived from the hybridoma HD37 which is specific to human CD19 (Kipriyanov et al., 1996, J.-Immunol. Meth. 196:51–62) and from the hybridoma OKT3 which is specific to human CD3 (Kipriyanov et al., 1997, Protein Eng. 10:445–453), respectively, were used for the construction of expression plasmids for a single-chain F_v antibody construct. A PCR fragment 1 of the V_H domain of anti-CD 19, followed by a segment which codes for a GlyGly linker, was produced using the primers DP1, 5′-TCACACAGAATTC-TTAGATCTATTAAAGAGGAGAAATTAACC (SEQ ID NO:1) and DP2, 5′-AGCACACGATATCACCGCCAAGCTTGGGTGTTGTTTTGGC (SEQ ID NO:2) (FIG. 2). The PCR fragment 1 was cleaved by EcoRI and EcoRV and ligated with the EcoRI/EcoRV-linearized plasmid pHOG-dmOKT3 so as to produce the vector pHOG19-3. The PCR fragment 2 of the V_L domain of anti-CD19, followed by a segment which codes for a c-myc epitope and a hexahistidinyl tail, was produced using the primers DP3, 5;-AGCACACAAGCTTGGCGGTGATATCTTGCTCACCCAAAC-TCCA, (SEQ ID NO:3) and DP4, 5′-AGCACACTCTAGAGACACACAGATCTTTAGTGATGGTGAT-GGTGATGTGAGTT TAGG (SEQ ID NO:4). The PCR fragment 2 was cleaved by HindIII and XbaI and ligated with the HindIII/XbaI-linearized plasmid pHOG-dmOKT3 so as to obtain the vector pHOG3-19 (FIG. 2). The gene coding for the hybrid scFv-3-19 in the plasmid pHOG3-19 was amplified by means of PCR with the primers Bi3sk, 5′-CAGCCGGCCATGGCGCAGGTGCAACTGCAGCAG (SEQ ID NO:5) and either Li-1, 5′-TATATACTGCAGCTGCACCTGGCTACCACCACCACCGGAGCCG-CCACCACCGC TACCACCGCCGCCAGAACCACCACCACCAGCGGCCGCAGCATCAGCCCG, (SEQ ID NO:6) for the production of a long flexible (Gly₄Ser)₄ inter-scFV linker (PCR fragment 3, FIG. 2) or Li-2, 5′-TATATA-CTGCAGCTGCACCTGCGACCCTGGGCCACCAGCGGCCGCAGCATCA GCCG, (SEQ ID NO:7) for the production of a short rigid GGPGS linker (PCR fragment 4, FIG. 2). The expression plasmids pDISC3x19-LL and pDISC3x19-SL were constructed by ligating the NcoI/PvuII restriction fragment from pHOG19-3, comprising the vector framework and the NcoI/PVuII-cleaved PCR fragments 3 and 4, respectively (FIGS. 3 and 4). The complete nucleotide and protein sequences of the bivalent and tetravalent F_v antibody constructs are indicated in FIGS. 5 and 6, respectively.

[0037] (A) Construction of pPIC-DISC-SL

[0038] The vector pPICZαA (Invitrogen BV, Leek, Netherlands) for the expression and secretion of recombinant proteins in the yeast Pichia pastoris was used as a starting material. It contains a gene which codes for the Saccharomyces cerevisiae α-factor secretion signal, followed by a polylinker. The secretion of this vector is based on the dominant selectable marker, Zeocin™ which is bifunctional in both Pichia and E. coli. The gene which codes for the tetravalent F_v antibody construct (scDia-SL) was amplified by means of PCR by the template pDIC3x19-SL using the primers 5-PIC, 5′-CCGTGAATTCCAGGTGCAACTGCAGCAGTCTGGGGCTGAACTGGC, and pSEXBn (SEQ ID NO:8). 5′-GGTCGACGTTAACCGACAAACAACAGATAAAACG (SEQ ID NO:9). The resulting PCR product was cleaved by EcoRI and XbaI and ligated in EcoRI/XbaI-linearized pPICZaA. The expression plasmid pPIC-DISC-SL was obtained. The nucleotide and protein sequences of the tetravalent F_v antibody construct are shown in FIG. 7.

[0039] (B) Construction of pPIC-DISC-LL

[0040] The construction of pPIC-DISC-LL was carried out on the basis of pPICZαA (Invitrogen BV, Leek, Netherlands) and pDISC3x19-LL (FIG. 3). The plasmid-DNA pPICZαA was cleaved by EcoRI. The overhanging 5′-ends were filled using a Klenow fragment of the E. coli DNA polymerase I. The resulting DNA was cleaved by XbaI, and the large fragment comprising the pPIC vector was isolated. Analogous thereto the DNA of pDISC3x19-LL was cleaved by NcoI and treated with a Klenow fragment. Following the cleavage using XbaI a small fragment, comprising a gene coding for the bivalent F_v antibody, was isolated. Its ligation with a pPIC-derived vector-DNA resulted in the plasmid pPIC-DISC-LL. The nucleotide and protein sequences of the bivalent F_v antibody construct are shown in FIG. 8.

[0041] E. coli XL1-blue cells (Strategene, La Jolla, Calif.) which had been transformed with the expression plasmids pDISC3x19-L1 and pDISC3x19-SL, respectively, were cultured overnight in 2xYT medium with 50 μg/ml ampicillin and 100 mM glucose (2xYT_Ga) at 37° C. 1:50 dilutions of the overnight cultures in 2xYT_GA were cultured as flask cultures at 37° C. while shaking with 200 rpm. When the cultures had reached an OD₆₀₀ value of 0.8, the bacteria were pelleted by 10-minute centrifugation with 1500 g at 20° C. and resuspended in the same volume of a fresh 2xYT medium containing 50 λg ampicillin and 0.4 M saccharose. IPTG was added up to a final concentration of 0.1 mM, and the growth was continued at room temperature (20–22° C.) for 18–20 h. The cells were harvested by 10-minute centrifugation with 5000 g at 4° C. The culture supernatant was held back and stored on ice. In order to isolate the soluble periplasmic proteins, the pelleted bacteria were resuspended in 5% of the initial volume of ice-cold 50 mM Tris HCl, 20% saccharose, 1 mM EDTA, pH 8.0. Following 1 hour of incubation on ice with occasional stirring the spheroplasts were centrifuged with 30,000 g at 4° C. for 30 minutes, the soluble periplasmic extract being obtained as supernatant and the spheroplasts with the insoluble periplasmic material being obtained as pellet. The culture supernatant and the soluble periplasmic extract were combined and clarified by further centrifugation (30,000 g, 4° C., 40 min.). The recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70% saturation). The protein precipitate was obtained by centrifugation (10,000 g, 4° C., 40 min.) and dissolved in 10% of the initial volume of 50 mM Tris-HCl, 1 M NaCl, pH 7.0. An immobilized metal affinity chromatography (IMAC) was carried out at 4° C. using a 5 ml column of chelating sepharose (Pharmacia) which was charged with Cu²⁺ and had been equilibrated with 50 mM Tris-HCl, 1 M NaCl, pH 7.0 (starting buffer). The sample was loaded by passing it over the column. It was then washed with twenty column volume of starting buffer, followed by starting buffer with 50 mM imidazole until the absorption at 280 nm of the effluent was at a minimum (about thirty column volumes). The absorbed material was eluted with 50 mM Tris-HCl, 1 M NaCl, 250 mM imidazole, pH 7.0. The protein concentrations were determined with the Bradford dye binding test (Bradford, 1976, Anal. Biochem. 72:248–254) using the Bio-Rad (Munich, Germany) protein assay kit. The concentrations of the purified tetravalent and bivalent F_v antibody constructs were determined from the A₂₈₀ values using the extinction coefficients ε^{1 mg/ml}=1.96 and 1.93, respectively.

[0042] Competent P. pastoris GS155 cells (Invitrogen) were electroporated in the presence of 10 μg plasmid-DNA of pPIC-DISC-LL and pPIC-DISC-SL, respectively, which had been linearized with SacI. The transformants were selected for 3 days at 30° C. on YPD plates containing 100 μg Zeocin™. The clones which secreted the bivalent and/or tetravalent F_v antibody constructs were selected by plate screening using an anti-c-myc-mAK 9E10 (IC chemikalien, Ismaning, Germany).

[0043] For the expression of the bivalent F_v antibody constructs and tetravalent F_v antibody constructs, respectively, the clones were cultured in YPD medium in shaking flasks for 2 days at 30° C. with stirring. The cells were centrifuged resuspended in the same volume of the medium containing methanol and incubated for another 3 days at 30° C. with stirring. The supernatants were obtained after the centrifguation. The recombinant product was isolated by ammonium sulfate precipitation, followed by IMAC as described above.

[0044] (A) Size Exclusion Chromatography

[0045] An analytical gel filtration of the F_v antibody constructs was carried out in PBS using a superdex 200-HR10/30 column (Pharmacia). The sample volume and the flow rate were 200 μl/min and 0.5 ml/min, respectively. The column was calibrated with high-molecular and low-molecular gel filtration calibration kits (Pharmacia).

[0046] (B) Flow Cytometry

[0047] The human CD3⁺/CD19⁻-acute T-cell leukemia line Jurkat and the CD19⁺/CD3⁻ B-cell line JOK-1 were used for flow cytometrie. 5×10⁵ cells in 50 μl RPMI 1640 medium (GIBCO BRL, Eggestein, Germany) which was supplemented with 10% FCS and 0.1% sodium azide (referred to as complete medium) were incubated with 100 μl of the F_v antibody preparations for 45 minute on ice. After washing using the complete medium the cells were incubated with 100 μl 10 μg/ml anti-c-myc-Mak 9E10 (IC Chemikalien) in the same buffer for 45 min on ice. After a second wash cycle, the cells were incubated with 100 μl of the FITC-labeled goat-anti-mouse-IgG (GIBCO BRL) under the same conditions as before. The cells were then washed again and resuspended in 100 μl 1 μg/ml propidium iodide solution (Sigma, Deisenhofen, Germany) in complete medium with the exclusion of dead cells. The relative fluorescence of the stained cells was measured using a FACScan flow cytometer (Becton Dickinson, Mountain View, Calif.).

[0048] (C) Cytotoxicity Text

[0049] The CD19-expressing Burkitt lymphoma cell line Raji and Namalwa were used as target cells. The cells were incubated in RPMI (GIBCO BRL) which was supplemented with 10% heat-inactivated FCS (GIBCO BRL), 2 mM glutamine and 1 mM pyruvate, at 37° C. in a dampened atmosphere with 7.5% CO₂. The cytotoxic T-cell tests were carried out in RPMI-1640 medium supplemented with 10% FCS, 10 mM HEPES, 2 mM glutamine, 1 mM pyruvate and 0.05 mM 2-ME. The cytotoxic activity was evaluated using a standard [⁵¹Cr] release test; 2×10⁶ target cells were labeled with 200 μCi Na[⁵¹Cr]O₄ (Amersham-Buchler, Braunschweig, Germany) and washed 4 times and then resuspended in medium in a concentration of 5×10⁶/ml. Increasing amounts of CTLs in 100 μl were titrated to 10⁴ target cells/well or cavity in 50 μl. 50 μl antibodies were added to each well. The entire test was prepared three times and incubated at 37° C. for 4 h. 100 μl of the supernatant were collected and tested for [⁵¹Cr] release in a gamma counter (Cobra Auto Gamma; Canberra Packard, Dreieich, Germany). The maximum release was determined by incubation of the target cells in 10% SDS, and the spontaneous release was determined by incubation of the cells in medium alone. The specific lysis (%) was calculated as: (experimental release−spontaneous release)/(maximum release−spontaneous release)×100.

[0050] Expression vectors were prepared which contained the hok/sok plasmid-free cell suicide system and a gene which codes for the skp/OmpH periplasmic factor for a greater production of recombinant antibodies. The skp gene was amplified by PCR using the primers skp-1, 5′-CGA ATT CTT AAG ATA AGA AGG AGT TTA TTG TGA AAA AGT GGT TAT TAG CTG CAG G (SEQ ID NO:10) and skp-2, 5′-CGA ATT AAG CTT CAT TAT TTA ACC TGT TTC AGT ACG TCG G (SEQ ID NO:11) using the plasmid pGAH317 (Holck and Kleppe, 1988, Gene 67:117–124). The resulting PCR fragment was cleaved by Af1II and HindIII and inserted in the Af1II/HindIII-linearized plasmid pHKK (Hom et al., 1996, Appl. Microbiol. Biotechnol. 46, 524–532) so as to obtain the vector pSKK. The genes obtained in the plasmids pDISC3x19-LL and pDISC3×19-SL and coding for the scFv antibody constructs were amplified by means of the primers fe-1, 5′-CGA ATT TCT AGA TAA GAA GGA GAA ATT AAC CAT GAA ATA CC (SEQ ID NO:12) and fe-2, 5′-CGA ATT CTT AAG CTA TTA GTG ATG GTG ATG GTG ATG TGA G (SEQ ID NO:13). The XbaI/Af1II-cleaved PCR-fragments were inserted in pSKK-before the skp insert so as to obtain the expression plasmids pDISC5-LL and pDISC6-SL, respectively, which contain tri-cistronic operons under the control of the lac promoter/operator system (FIGS. 9 and 10).

[0051] All references cited within the body of the instant specification are hereby incorporated by reference in their entirety.