US 6,969,598 B2Grant
Methods for producing high titre vectors and compositions used in such methods
Issue Date:2005-11-29
•39 Claims
•61 Drawing Sheets
Abstract
A method for producing viral vectors is described using packaging and producer cell lines is described. The producer cell comprises: (i) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; wherein the promoter is operably linked to at least one copy of a TRE; (ii) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator; (iii) a third NS encoding a retrovirus nucleocapsid protein; and (iv) a fourth NS comprising a retroviral sequence capable of being encapsidated in the nucleocapsid protein such that the retroviral vector particle titre obtainable from the producer cell is regulatable by tetracycline and an initial stimulus with sodium butyrate or functional analogues thereof.
Metadata
Assignees
- Oxford Biomedica (UK) Limited
- The University of North Carolina at Chapel Hill
Inventors
- John C. Olsen
- Kyriacos Andreou Mitrophanous
- Jonathan Rohll
- Alan John Kingsman
- Fiona Margaret Ellard
Application Information
Application Number:US 10/134,643
Filing Date:2002-04-30
Priority Date:2001-04-30
Art Unit:1648
Patent Drawings (61 sheets)
Description
FIELD OF THE INVENTION
[0001] The present invention relates to packaging and producer cell lines for producing recombinant viral vectors. In particular, the present invention relates to methods for producing pseudotyped viral vectors with a broad host range which can be produced at sufficient titres in packaging and/or producer cells. Most specifically, the invention relates to the generation of pseudotyped retroviral vectors, from stable producer cell lines, having vesicular stomatitis virus-G protein (VSV-G) as the membrane-associated viral envelope protein. The present invention also relates to VSV-G pseudotyped retroviral vectors useful in gene delivery and more specifically, to lentiviral vectors, in particular those derived from equine infectious anaemia virus (EIAV), useful in gene delivery to non-dividing and dividing cells.
BACKGROUND OF THE INVENTION
[0002] Retroviruses and vectors derived from them require an envelope protein in order to transduce efficiently a target cell. The envelope protein is expressed in the cell producing the virus or vector and becomes incorporated into the virus or vector particles. Retrovirus particles are composed of a proteinaceous core derived from the gag gene that encases the viral RNA. The core is then encased in a portion of cell membrane that contains an envelope protein derived from the viral env gene.
[0003] The envelope protein is produced as a precursor, which is processed into two or three units. These are the surface protein (SU) which is completely external to the envelope, the transmembrane protein (TM) which interacts with the SU and contains a membrane spanning region and a cytoplasmic tail (Coffin 1992 In The Retroviridae, Pleum Press, ed Levy). In some retroviruses a small peptide is removed from the TM.
[0004] In order to act as an effective envelope protein, capable of binding to a target cell surface and mediating viral entry, the envelope protein has to interact in a precise manner with the appropriate receptor or receptors on the target cell. This must occur in such a way as to result in intemalisation of the viral particle in an appropriate manner to deliver the genome to the correct compartment of the cell to allow a productive infection to occur.
[0005] There have been many attempts to use the envelope protein derived from one virus to package a different virus, this is known as pseudotyping. The efficiency of pseudotyping is highly variable and appears to be strongly influenced by interactions between the cytoplasmic tail of the envelope and the core proteins of the viral particle. The process by which envelope proteins are recruited into budding virions is poorly understood, although it is known that the process is in someway ordered as most cellular proteins are excluded from retroviral particles (Hunter 1994 Semin. Virol. 5:71-83). In some retroviruses budding may occur in the absence of envelope proteins indicating that the env is not necessary for this process but conversely the core can influence the efficiency of envelope incorporation into the particle (Einfeld 1996 Curr. Top. Microbiol. Immunol. 214:133-176; Kräusslich and Welker 1996 Curr. Top. Microbiol. Immunol. 214:25-63).
[0006] There is evidence for a precise molecular interaction between a cytoplasmic domain of the envelope protein and the viral core in some retroviruses. By way of example, Januszeski et al (1997 J. Virol. 71: 3613-3619) have shown that minor deletions or substitutions in the cytoplasmic tail of the murine leukemia virus (MLV) envelope protein strongly inhibit incorporation of the envelope protein into viral particles. In the case of HIV-1, Cosson (1996 EMBO J. 15:5783-5788) has shown a direct interaction between the matrix protein of HIV-1 and the cytoplasmic domain of its envelope protein. This interaction between the matrix and envelope protein plays a key role in the incorporation of the envelope protein into budding HIV-1 virions. This is shown by the fact that visna virus can only be efficiently pseudotyped with HIV-1 envelope protein if the amino terminus of the matrix domain of the visna virus gag polyprotein is replaced by the equivalent HIV-1 matrix domain (Dorfman et al, 1994 J. Virol. 68:1689-1696).
[0007] However the situation is complex, since truncation of the HIV-1 envelope protein is required for efficient pseudotyping of Molony murine leukemia virus (Mammano et al, 1997 J. Virol. 71:3341-3345), whilst truncation of the human foamy virus envelope protein reduced its ability to pseudotype murine leukemia virus (Lindemann et al, 1997 J. Virol. 71:4815-4820). There is also an environmental component to the interaction between the core of a retrovirus and the cytoplasmic tail of its envelope protein. Prolonged passage of EIAV in some cell lines results in a truncation of the glycoprotein, suggesting that host cell factors can select for a virus on the basis of the C-terminal domain of the envelope protein (Rice et al, 1990 J. Virol. 1990 64: 3770-3778).
[0008] These studies and those of many other workers indicate that it is not possible to predict that even closely related retroviruses may be able to pseudotype each other. Further more, if a given envelope protein fails to pseudotype a particular virus, it is not possible to predict the molecular changes that would confer the ability to pseudotype. Pseudotyping has met with some success, but is clearly constrained by the need for compatibility between the virus components and the heterologous envelope protein.
[0009] In the construction of retroviral vectors it is desirable to engineer vectors with different target cell specificities to the native virus, to enable the delivery of genetic material to an expanded or altered range of cell types. One manner in which to achieve this is by engineering the virus envelope protein to alter its specificity. Another approach is to introduce a heterologous envelope protein into the vector to replace or add to the native envelope protein of the virus.
[0010] The MLV envelope protein is capable of pseudotyping a variety of different retroviruses. MLV envelope protein from an amphotropic virus allows transduction of a broad range of cell types including human cells.
[0011] The envelope glycoprotein (G) of Vesicular stomatitis virus (VSV), a rhabdovirus, is another envelope protein that has been shown to be capable of pseudotyping certain retroviruses. Its ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope proteins was first shown by Emi et al (1991 Journal of Virology 65:1202-1207). WO94/294440 teaches that retroviral vectors may be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors may be used to transduce a wide range of mammalian cells. Even more recently, Abe et al (J Virol 1998 72(8) 6356-6361) teach that non-infectious retroviral particles can be made infectious by the addition of VSV-G.
[0012] Burns et al (1993 Proc. Natl. Acad. Sci. USA 90: 8033-7) successfully pseudotyped the retrovirus MLV with VSV-G and this resulted in a vector having an altered host range compared to MLV in its native form. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles and insects (Burns et al 1993 ibid). They have also been shown to be more efficient than traditional amphotropic envelopes for a variety of cell lines (Yee et al, 1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568, Lin, Emi et al, 1991 Journal of Virology 65:1202-1207). VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail is capable of interacting with the retroviral cores.
[0013] The provision of a non-retroviral pseudotyping envelope such as VSV-G protein gives the advantage that vector particles can be concentrated to a high titre without loss of infectivity (Akkina et al, 1996 J. Virol. 70: 2581-5). Retrovirus envelope proteins are apparently unable to withstand the shearing forces during ultracentrifugation, probably because they consist of two non-covalently linked subunits. The interaction between the subunits may be disrupted by the centrifugation. In comparison the VSV glycoprotein is composed of a single unit. VSV-G protein pseudotyping can therefore offer potential advantages.
[0014] However, there are certain disadvantages involved in using producer cell lines to manufacture retrovirus vectors pseudotyped with VSV-G. The first is the difficulty in producing stable cell lines that express VSV-G; the second is the limited life spans of such cell lines.
[0015] A number of workers have reported that constitutive high-level expression of VSV-G is toxic to most mammalian cells (eg Emi et al, 1991 Journal of Virology 65:1202-1207, Yee et al, 1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568). A variety of approaches have been used to solve these problems. By way of example, Yee et al (1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568) developed a scheme for producing VSV-G pseudotypes by first producing 293 cell lines that constitutively express gag-pol proteins and contain a retroviral genome. These cell lines were then transfected with a plasmid containing the VSV-G gene downstream of a human cytomegalovirus immediate early promoter followed by the splicing and polyadenylation signals derived from the rabbit β-globin gene. Maximal production of transducing particles was obtained between 48 and 72 hours after transfection.
[0016] WO96/35454 teaches that a tetracycline responsive promoter may be used in combination with a nucleotide sequence enocoding vesicular stomatitis virus (VSV-G) to derive a retroviral packaging cell line that inducibly expresses the VSV-G protein, at levels sufficient to support high level virus production, but without the toxic effects of constitutive expression of VSV-G. Ory et al (1996 Proc. Natl. Acad. Sci. USA 93:11400-11406) used the tetR/VP 16 transactivator and tetracycline responsive operator (tet0) minimal promoter system for inducible, tetracycline-regulatable expression of VSV-G in the production of packaging 293 cell lines. Yang et al (1995 Human Gene Therapy 6:1203-1213) used a similar strategy linking seven copies of the tet0 to a minimal HCMV promoter to construct packaging lines derived from NIH-3T3 cells. Chen et al (1996 Proc. Natl. Acad. Sci. USA 93: 10057-10062) modified the tetracycline-inducible system (Gossen & Bujard, 1992 Proc. Natl. Acad. Sci. USA 89: 5547-5551) by fusing the ligand binding domain of the estrogen receptor to the carboxy terminus of a tetracycline-regulated transactivator. Using this system, they constructed cell lines that expressed VSV-G in the absence of tetracycline. VSV-G expression could be induced by β-estradiol regardless of whether the cells were grown with or without tetracycline. However, induction of VSV-G expression was higher when tetracycline was not present. This allowed the construction of stable packaging cell lines that produced transducing viral particles.
[0017] Yoshida et al (1997) developed an adenovirus system to produce MoMLV vectors pseudotyped with VSV-G. First a cell line was produced containing a genome plasmid. Secondly this cell line was infected with three different adenoviruses, one encoding the gag-pol gene of MoMLV under the control of the tetracycline transactivator, the second encoding VSV-G under the control of the tetracycline transactivator and the third encoding a nuclear localising transactivator. Transducing particles could be harvested from the resultant cells for a limited time period. Other researchers developing systems to study the export and processing of VSV glycoprotein mutants have used vaccinia virus systems in which the glycoprotein gene was cloned downstream of a bacteriophage T7 promoter. Co-infection of cells with the glycoprotein encoding vaccinia and a vaccinia virus expressing T7 polymerase resulted in a high level of expression of the VSV-G protein (Lefkowitz et al, 1990, Virology 178;373-383).
[0018] Arai et al (1998 J. Virol. 72:1115-1121) commented on the fact that the cell lines, in which the expression of VSV-G was controlled by the tetracycline-inducible system, produced low titres of transducing particles in the presence of tetracycline when VSV-G expression should be repressed. This leaky virus production by these packaging cell lines before induction could cause both virus re-entry into the cell culture and accumulation of the vector DNA in the chromosomes during the process of selection and subsequent passages of the packaging cell lines harbouring the virus vector.
[0019] Arai et al (1998) reported the development of packaging cell lines in which a completely silent gene for the VSV glycoprotein was present to negate the above problem. This was achieved using a system in which a cassette was produced which encoded the CAG (the chicken β-actin gene promoter connected with the cytomegalovirus immediate-early promoter) followed by the 5′ loxP sequence followed by the neo gene with an associated poly A signal followed by the 3′ loxP sequence followed by the coding sequence for VSV-G and an associated poly A signal. When transfected into cells only the neo gene product is produced. If an adenovirus encoding the Cre recombinase is then introduced into the cell the neo sequence is removed by recombination and the VSV-G gene is expressed from the CAG promoter.
[0020] None of these approaches actually solve the problem associated with genome re-entry into cells once VSV-G expression has been initiated. Although the cell lines produced by Arai et al (1998) will be stable until infected with the Cre recombinase encoding adenoviruses, their results indicated that virus production dropped significantly 5 days after adenovirus infection allowing a limited number of harvests from each batch of producer cells.
[0021] Chen et al (1996 Proc. Natl. Acad. Sci. USA 93: 10057-10062) produced two tetracycline/β-estradiol-inducible cell lines which expressed VSV-G. The numbers of transducing particles produced every 48 hours increased over a sixteen days period after induction by either the removal of tetracycline from the medium or by the addition of β-estradiol in the absence of tetracycline in the cell line that produced the lowest level of VSV-G. However in the cell line that produced larger amounts of VSV-G, although an increase in titre was observed in the absence of tetracycline, a rapid fall in the number of transducing particles produced was found when high levels of VSV-G were produced upon β-estradiol induction in the absence of tetracycline. This fall was attributed to the toxic effects of high levels of VSV-G expression. Additional examples of proteins toxic to cells when expressed at high levels are the gag/pol proteins of FIV and HIV.
[0022] The present invention seeks to provide an improved method for regulating expression of toxic proteins required for vector production but which are inhibitory to cell growth.
SUMMARY OF THE INVENTION
[0023] It is well known that a regulatory system such as a tetracycline system has been used to control expression of VSV-G is the tetracycline system. This system has been used previously in construction of MLV and HIV vector producer lines. In these systems formation of infectious vector particles is initiated by either addition of, or withdrawal of the tetracycline analogue, doxycycline.
[0024] The present invention describes a novel system for producing high titre vectors, such as lentiviral vectors wherein the production of the vectors is activated by doxycycline, but only after an initial stimulus with sodium butyrate—full activation is not observed in the presence of doxycycline alone. However following an initial treatment with sodium butyrate, the system can be maintained in an active state by supplying doxycycline alone. This latter feature is a novel, advantageous and unexpected feature of the system described here.
[0025] Safety is an important feature of any viral vector system, such as a retroviral system, the main concern being the formation of replication competent retrovirus (RCR) from the packaging system. It is known that the safety profile of the producer system may be improved by minimising the amount of sequence overlap between the components of the system, i.e., the RNA's corresponding to vector genome, the gag/pol open reading frame and envelope. This has the effect of reducing the chance of homologous recombination events between these components. Recombination is thought to take place within the vector particle during the reverse transcription therefore a procedure which minimises the amount of gag/pol or envelope RNA, but particularly the former, in particles is desirable. The strategy of the present invention is to remove sequences which direct inclusion of the gag/pol transcript but which do not influence the levels of protein production.
[0026] A construct in which sequences upstream of the major splice donor were deleted was able to produce high levels of gag/pol protein when expressed in stable cell lines created in the selected HEK 293 clone. Transcripts produced from this were efficiently packaged into vector particles. This was a surprising result since although deletion analysis of vector RNA had indicated that the packaging signal was localised to within the R-U5-leader sequence and the 5′ 360 nucleotides of the gag open reading frame, it was assumed that sequences vital for packaging were likely to be located upstream of the major splice donor. Furthermore by analogy with observations on the location of the packaging signal in HIV-1 it was also expected that the psi sequence would be located upstream and just downstream of the major splice donor site. In order to reduce the packaging efficiency of gag/pol-encoding RNA the 5′ 360 nt of the gag ORF (the region of overlap with the vector RNA) were optimised for expression in human cells. This process results in a base change approximately every third base and would be expected to 1) disrupt any signals important for RNA packaging, 2) virtually eliminate the chance of recombination between the gag/pol and vector RNAs and 3) potentially improve expression of Gag/Pol. Surprisingly Gag/Pol protein production was severely reduced by this manipulation therefore codon optimisation of the entire Gag/Pol ORF was undertaken except for the region in which translational slippage occurs to allow polymerase synthesis and the region of overlap between the C-terminus of gag and the N-terminus of pol. An additional benefit that results from creation of this ‘synthetic’ gag/pol is that its expression becomes independent of REV/RRE. Therefore if expression of the vector component RNA can be made REV/RRE independent the potential problems of supplying REV at a sufficient level within a packaging cell to allow efficient production of infectious vector particles can be avoided. Previously we have discovered that high levels of REV expression can not be tolerated in TE671 or 293 cells. Thus, collectively our invention relates to a method for making a producer cell capable of making EIAV vector efficiently, safely and in an REV/RRE independent manner.
[0027] Previous experiments have shown that the titre obtained from EIAV vectors is increased if it carries an RNA sequence termed the RRE which is acted on by REV. It has been shown in other vector systems that the RRE/REV sequence can be substituted by other elements. For example the cytoplasmic transport element from Mason-Pfizer monkey virus, has been shown to operate effectively in the FIV vector system. However there have been no reports indicating that woodchuck post-transcriptional regulatory element (WPRE) can substitute for the REV/RRE. We have found that in the EIAV vector system this is indeed the case.
[0028] Although the experimental work disclosed herein is directed to cell lines for producing infectious, recombinant retroviral vectors, such as lentiviral vectors, the concepts and design are broadly applicable to cell lines for the production of any viral vector where harmful or otherwise undesirable viral proteins must be produced by the cell in order for the viral vector to be produced. The constructs and methods of invention are used to prevent or minimize the production of these proteins until they are needed. At that time, expression is induced for a period of time necessary for the production of the proteins and the assembly of the viral vectors. Examples of such viral vectors include other RNA viral vectors besides retroviral vectors, and DNA viral vectors, such as adenoviral vectors, adeno-associated viral vectors, Herpesvirus vectors (preferably Herpes simplex I virus vectors), and vaccinia virus vectors. Examples of hannful or undesirable proteins include, for adenoviral vectors, products of the E1, E2, E4, and major late genes; for adeno-associated viruses, the rep protein; and for Herpesvirus, the capsid protein. Methods for the construction of such cell lines will be readily apparent to those skilled in the art, given the teachings contained herein. A preferred application of this approach would be the induction of the E2 and E4 adenoviral proteins in the cell lines disclosed in U.S. patent application Ser. No. 08/355,087, “Improved Adenoviral Vectors and Producer Cells, II incorporated herein by reference.
[0029] In one broad aspect, the present invention relates to:
[0030] A packaging cell comprising:
-
- [0031] (a) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; wherein the promoter is operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a tetracycline responsive element (TRE);
- [0032] (b) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator; and
- [0033] (c) a third NS encoding a retrovirus nucleocapsid protein;
- [0034] such that the expression of the first NS is regulatable by tetracycline or a functional equivalent thereof and optionally an initial stimulus with sodium butyrate or a functional analogue thereof.
[0035] A producer cell comprising:
-
- [0036] (a) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; wherein the promoter is operably linked to at least one copy of a TRE;
- [0037] (b) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator;
- [0038] (c) a third NS encoding a retrovirus nucleocapsid protein;and
- [0039] (d) a fourth NS comprising a retroviral sequence capable of being encapsidated in the nucleocapsid protein;
- [0040] such that the retroviral vector particle titre obtainable from the producer cell is regulatable by tetracycline or a functional analogue thereof and optionally an initial stimulus with sodium butyrate or a functional analogue thereof.
[0041] A virus producer cell comprising:
-
- [0042] (a) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a TRE;
- [0043] (b) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator; and
- [0044] (c) a third NS comprising a viral sequence sufficient to produce viral vector particles from the cell;
- [0045] such that the viral vector particle titre obtainable from the producer cell is regulatable by tetracycline or a functional analogue thereof and optionally an initial stimulus with sodium butyrate or a functional analogue thereof.
[0046] A method for producing a retroviral vector wherein the method comprises:
-
- [0047] (i) selecting a host cell for retroviral vector production;
- [0048] (ii) introducing into the host cell:
- [0049] a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a TRE;
- [0050] a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator;
- [0051] a third NS encoding a retrovirus nucleocapsid protein;
- [0052] a fourth NS comprising a retroviral sequence capable of being encapsidated in the nucleocapsid protein; and
- [0053] (iii) incubating the host cell in a culture medium comprising tetracycline or a functional analogue thereof and optionally an initial stimulus withsodium butyrate or a functional analogue thereof.
- [0054] such that sufficient retroviral vector transducing particles are produced from the host cell.
DETAILED DISCLOSURE
[0055] Aspects of the present invention are presented in the accompanying claims and in the following description and drawings. These aspects are presented under separate section headings. However, it is to be understood that the teachings under each section are not necessarily limited to that particular section heading.
Surprising Findings/Advantages
[0056] The present invention demonstrates the surprising finding that VSV-G expression in these packaging/producer cells is regulatable by sodium butyrate and doxycycline or functional analogues thereof. Moreover, the present invention demonstrates that full activation of genes under the control of the tetracycline-responsive element (TRE) is only achieved in the presence of an initial stimulus with sodium butyrate. This is different to the performance of the tetracycline system in other situations.
[0057] The surprising findings of the present invention are advantageous because, after vector production has been regulated by treatment with sodium butyrate and doxycycline or functional analogues thereof for about 24 hours, sodium butyrate can be removed from the culture medium and vector production can be maintained for at least about five days. More specifically, vector production may be maintained by doxycycline alone. This feature of the producer system is advantageous because sodium butyrate is a toxic compound causing cell cycle arrest and thus is an important compound to remove from vector preparations.
[0058] Thus, the present invention is advantageous because it demonstrates that, despite the toxicity of VSV-G, it is possible to construct a stable retroviral producer line that is capable of producing transducing vector particles expressing VSV-G. Thus, the present invention demonstrates that the difficulty associated with producing stable cell lines capable of expressing VSV-G can be overcome.
[0059] In one embodiment of the invention, the inclusion of a codon-optimised gag/pol in the vector production system of the present invention is also advantageous because the expression of the gag/pol proteins becomes independent of REV/RRE. Therefore if expression of the vector component RNA can be made REV/RRE independent the potential problems of supplying REV at a sufficient level within a packaging cell to allow efficient production of infectious vector particles can be avoided. This effect is particularly advantageous for cells such as TE671 or HEK 293 cells that cannot tolerate high levels of Rev expression. Moreover, a codon-optimised gag/pol gene is advantageous because codon-optimised gag/pol gene is packaged significantly less efficiently than the wild type gene and represents a significant improvement to the safety profile of the system.
[0060] Other advantages are discussed and are made apparent in the following commentary.
Envelope Protein
[0061] As used herein, the term “viral envelope protein” refers to the protein embedded in the membrane which encapsulates the nucleocapsid and which protein is responsible for binding to and entry of the infectious virus into the target cell. The viral envelope protein may also be a fusogenic protein. A “fusogenic protein” refers to glycoproteins which cause cells within a culture to fuse in a multinucleate syncytia. Representative examples of fusogenic proteins include but are not limited to VSV-G and Rabies G protein.
Nucleocapsid
[0062] As used herein, the term “nucleocapsid” refers to at least the group specific viral core proteins (gag) and the viral polymerase (pl) of a retrovirus genome. These proteins encapsidate the retrovirus-packagable sequences and themselves are further surrounded by a membrane containing an envelope glycoprotein.
Packaging Cell
[0063] As used herein, the term “packaging cell” refers to a cell which contains those elements necessary for production of infectious recombinant virus which are lacking in a recombinant viral vector. Typically, such packaging cells contain one or more expression cassettes which are capable of expressing viral structural proteins (such as gag, pol and env) but they do not contain a packaging signal.
[0064] In preferred packaging and producer cells, the toxic envelope protein sequences, and nucleocapsid sequences are all stably integrated in the cell. However, one or more of these sequences could also exist in episomal form and gene expression could occur from the episome.
[0065] Packaging cell lines may be readily prepared (see also WO 92/05266), and utilised to create producer cell lines for the production of retroviral vector particles. A summary of the available packaging lines is presented in “Retroviruses” (see below). Packaging cell lines suitable for use with the present invention are readily prepared (see also WO 92/05266).
[0066] Simple packaging cell lines, comprising a provirus in which the packaging signal has been deleted, have been found to lead to the rapid production of undesirable replication competent viruses through recombination. In order to improve safety, second generation cell lines have been produced wherein the 3′LTR of the provirus is deleted. In such cells, two recombinations would be necessary to produce a wild type virus. A further improvement involves the introduction of the gag-pol genes and the env gene on separate constructs so-called third generation packaging cell lines. These constructs are introduced sequentially to prevent recombination during transfection.
[0067] Preferably, the packaging cell lines are second generation packaging cell lines.
[0068] Preferably, the packaging cell lines are third generation packaging cell lines.
[0069] In these split-construct, third generation cell lines, a further reduction in recombination may be achieved by changing the codons. This technique, based on the redundancy of the genetic code, aims to reduce homology between the separate constructs, for example between the regions of overlap in the gag-pol and env open reading frames.
[0070] The packaging cell lines are useful for providing the gene products necessary to encapsidate and provide a membrane protein for a high titre vector particle production. The packaging cell may be a cell cultured in vitro such as a tissue culture cell line. Suitable cell lines include but are not limited to mammalian cells such as murine fibroblast derived cell lines or human cell lines. Preferably the packaging cell line is a human cell line, such as for example: HEK 293, HEK 293T, TE671, HT1080.
[0071] Preferably the packaging cell line is selected from the group consisting of Phoenix, 293-SPA and BOSC retroviral vector packaging cell lines.
[0072] Preferably the packaging cell is derived from a HEK 293 cell.
[0073] Preferably the packaging cell is derived from a HEK 293 101 cell.
[0074] Alternatively, the packaging cell may be a cell derived from the individual to be treated such as a monocyte, macrophage, blood cell or fibroblast. The cell may be isolated from an individual and the packaging and vector components administered ex vivo followed by re-administration of the autologous packaging cells.
[0075] The packaging cell lines of the present invention provide the gene products necessary to encapsidate and provide a membrane protein for a viral vehicle such as a retrovirus and retrovirus nucleic gene delivery vehicle. As described below, when viral sequences such as retrovirus sequences are introduced into the packaging cell lines, such sequences are encapsidated with the nucleocapsid proteins and these units then bud through the cell membrane to become surrounded in cell membrane and to contain the envelope protein produced in the packaging cell line. These infectious retroviruses are useful as infectious units per se or as gene delivery vectors
Producer Cell
[0076] As used herein, the term “producer cell” or “vector producing cell” refers to a cell which contains all the elements necessary for production of a viral vector such as recombinant viral vectors, recombinant viral vector particles and retroviral delivery systems.
[0077] The process of making a producer cell for a viral vector, such as a retroviral or lentiviral vector, involves establishment of cell lines that express the components required for vector particle production (for example gag/pol, vector genome and envelope). In such cell lines, viral sequences such as retroviral sequences are capable of being packaged with the nucleocapsid proteins. Further, the viral sequences such as retroviral sequences that are capable of being packaged may also contain one or more heterologous nucleotide of interest (NOI) that are capable of being expressed in a target cell that is infected by the virions produced in the producer cell.
[0078] Preferably, the producer cell is obtainable from a stable producer cell line.
[0079] The producer cell lines of the present invention as utilised for the production of infectious pseudotyped retrovirus, and vector particles and especially high titer virions which may also contain one or more NOIs capable of being expressed in a target cell or tissue. The cells are thus useful for packaging a viral vector genome such as a retrovirus genome which may also contain a heterologous NOI capable of being expressed in a target cell or tissue.
[0080] There are two common procedures for generating viral producer cells such as retroviral producer cells. In one, the sequences encoding retroviral Gag, Pol and Env proteins are introduced into the cell and stably integrated into the cell genome; a stable cell line is produced which is referred to as the packaging cell line. The packaging cell line produces the proteins required for packaging retroviral RNA but it cannot bring about encapsidation due to the lack of a psi region. However, when a vector genome (having a psi region) is introduced into the packaging cell line, the helper proteins can package the psi-positive recombinant vector RNA to produce the recombinant vector stock. This can be used to transduce the NOI into recipient cells. The recombinant virus whose genome lacks all genes required to make viral proteins can infect only once and cannot propagate. Hence, the NOI is introduced into the host cell genome without the generation of potentially harmful retrovirus. As already mentioned above, a summary of the available packaging lines is presented in “Retroviruses” (1997 Cold Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E Varmus pp 449).
[0081] The second approach is to introduce the three different DNA sequences that are required to produce a retroviral vector particle i.e. the env coding sequences, the gag-pol coding sequence and the defective retroviral genome containing one or more NOIs into the cell at the same time by transient transfection and the procedure is referred to as transient triple transfection (Landau & Littman 1992; Pear et al 1993). The triple transfection procedure has been optimised (Soneoka et al 1995; Finer et al 1994). WO 94/29438 describes the production of producer cells in vitro using this multiple DNA transient transfection method. WO 97/27310 describes a set of DNA sequences for creating retroviral producer cells either in vivo or in vitro for re-implantation.
[0082] The components of the viral system which are required to complement the vector genome may be present on one or more “producer plasmids” for transfecting into cells. The present invention also provides a kit for producing a viral vector system, comprising
-
- [0083] (i) a viral vector genome which is incapable of encoding one or more proteins which are required to produce a vector particle;
- [0084] (ii) one or more producer plasmid(s) capable of encoding the protein which is not encoded by (i); and optionally
- [0085] (iii) a cell suitable for conversion into a producer cell.
[0086] In a preferred embodiment, the viral vector genome is incapable of encoding the proteins gag, pol and env. Preferably the kit comprises one or more producer plasmids encoding env, gag and pol, for example, one producer plasmid encoding env and one encoding gag-pol. Preferably the gag-pol sequence is codon optimised for use in the particular producer cell (see below).
[0087] The present invention also provides a producer cell expressing the vector genome and the producer plasmid(s) capable of producing a retroviral vector system useful in the present invention.
[0088] By using producer/packaging cell lines, it is possible to propagate and isolate quantities of retroviral vector particles (e.g. to prepare suitable titres of the retroviral vector particles) for subsequent transduction of, for example, a site of interest (such as adult brain tissue). Producer cell lines are usually better for large scale production or vector particles.
[0089] Transient transfection has some advantages over the packaging cell method. In this regard, transient transfection avoids the longer time required to generate stable vector-producing cell lines and is used if the vector genome or retroviral packaging components are toxic to cells. If the vector genome encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apoptosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die. Also, cell lines have been developed using transient infection that produce vector titre levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al 1993, PNAS 90:8392-8396). However, the transient method for production of vector has the disadvantage that it is labour intensive, it is not readily adapted to production of vector on a large scale and it is difficult to ensure uniformity between vectors produced by the method at different times.
[0090] Producer cells/packaging cells can be of any suitable cell type. Producer cells are generally mammalian cells but can be, for example, insect cells.
[0091] As used herein, the term “producer cell” or “vector producing cell” refers to a cell which contains all the elements necessary for production of retroviral vector particles.
[0092] Preferably, the producer cell is obtainable from a stable producer cell line.
[0093] Preferably, the producer cell is obtainable from a derived stable producer cell line.
[0094] Preferably, the producer cell is obtainable from a derived producer cell line.
[0095] As used herein, the term “derived producer cell line” is a transduced producer cell line which has been screened and selected for high expression of a marker gene. Such cell lines support high level expression from the retroviral genome. The term “derived producer cell line” is used interchangeably with the term “derived stable producer cell line” and the term “stable producer cell line.
[0096] Preferably the derived producer cell line includes but is not limited to a retroviral and/or a lentiviral producer cell.
[0097] Preferably the derived producer cell line is an HIV or EIAV producer cell line, more preferably an EIAV producer cell line.
[0098] Preferably the envelope protein sequences, and nucleocapsid sequences are all stably integrated in the producer and/or packaging cell. However, one or more of these sequences could also exist in episomal form and gene expression could occur from the episome.
Tetracycline Responsive Element (TRE)
[0099] The packaging/producer cell of the present invention comprises a tetracycline responsive element (TRE). In this regard, a first NS encoding a VSV-G env protein is operably linked to promoter and the promoter is operably linked to a TRE.
[0100] As used herein, the term “TRE” refers to an element required for activation of transcription in response to a tetracycline modulator. TREs contemplated for use in the present invention (relating to the modulation of expression of a env protein, such as a VSV-G protein), include native, synthetic as well as modified TREs. The TRE may be present in multiple copies and is operatively linked to suitable promoter for expression of the required env protein. As used herein the term “promoter” refers to a specific nucleotide sequence recognised by RNA polymerase, the enzyme that initiates RNA synthesis. This sequence is the site at which transcription can be specifically initiated under proper conditions. When a first NS encoding an env protein, operatively linked to a suitable promoter and a TRE is introduced into a packaging/producer cell, the expression of the env protein may be controlled by either the presence or absence of a tetracycline modulator which is not normally present in the packaging/producer cell.
Tetracycline Modulator
[0101] As used herein, the term “tetracycline modulator” refers to a system through which tetracycline compound effects activation of transcription of a first NS encoding an env protein. The actual effect of the tetracycline compound on the activational activity of the TRE will vary depending on the TRE with which the compound interacts. By way of example, in one embodiment of the present invention, the expression of an env protein, such as VSV-G protein, may be controlled, in part, by a tetracycline repressor protein. In this regard, a tetracycline repressor protein is capable of binding to the TRE in the absence of the antibiotic tetracycline or a functional analogue thereof. Thus, in the presence of the antibiotic tetracycline or a functional analogue thereof, the bound tetracycline repressor protein is displaced from the TRE and transcription of the first NS encoding an env protein, such as VSV-G is activated.
[0102] In another embodiment of the present invention, the tetracycline modulator may be a fusion product of the amino-terminal DNA binding domain of a tetracycline repressor protein and the carboxy-terminal activation domain of VP-16 from herpes simplex virus (see Gossen and Bujard 1992: PNAS (USA) 89: 1766-1769). In the absence of tetracycline, the modulator binds to the tet-responsive elements (TRE) and efficiently activates transcription. The association between the modulator and the TRE is prevented by tetracycline or a functional analogue thereof. Therefore, in the presence of low concentrations of tetracycline or a functional analogue thereof (such as doxycycline), transcription from TRE is turned off.
Initial Stimulus
[0103] The present invention demonstrates that full activation of genes under the control of the tetracycline-responsive element (TRE) is only achieved in the presence of an initial stimulus with sodium butyrate.
[0104] As used herein, the term “initial stimulus” with sodium butyrate or a functional analogue thereof means that the activation of genes under the control of a TRE is regulatable by treatment with an effective amount of sodium butyrate or a functional analogue thereof for an initial period of from about 15 hours to about 30 hours. Following this initial treatment with sodium butyrate or a functional analogue thereof the system can be maintained in an active state by supplying a tetracycline analogue alone, such as doxycycline.
[0105] Preferably the activation of genes under the control of a TRE is regulatable by treatment with sodium sodium butyrate or a functional analogue thereof for an initial period of from about 18 hours to about 28 hours.
[0106] Preferably the activation of genes under the control of a TRE is regulatable by treatment with sodium butyrate or a functional analogue thereof for a period of from about 20 hours to about 25 hours.
[0107] Preferably the activation of genes under the control of a TRE is regulatable by treatment with sodium butyrate or a functional analogue thereof for a period of from about 22 hours to about 24 hours.
[0108] As used herein, the term “initial stimulus” can also include an additional treatment of the genes under the control of a TRE, with an effective amount of sodium butyrate or a functional analogue, after the initial stimulus in order to boost viral vector production.
[0109] Preferably the additional treatment of genes under the control of a TRE with sodium butyrate or a functional analogue thereof is initiated about 5 days after the intial stimulus with sodium butyrate or a functional analogue thereof.
[0110] Preferably the additional treatment of genes under the control of a TRE with sodium butyrate or a functional analogue thereof is initiated at a time after the intial stimulus with sodium butyrate or a functional analogue thereof when viral vector production has started to decline.
Functional Analogues
[0111] As used herein, the term “functional analogue” refers to any compound that can modulate the activity of a TRE and thus modulate transcription of a NS maintained under the control of the TRE such as a first NS encoding an env protein. By way of example, a functional analogue of tetracycline includes but is not limited to doxycycline. A functional analogue of sodium butyrate includes but is not limited to calcium butyrate.
[0112] The constructs of the present invention are incorporated into vectors for introduction into the packaging/producer cells of the present invention.
Vector
[0113] As it is well known in the art, a vector is a tool that allows or faciliates the transfer of an entity from one environment to another. In accordance with the present invention, and by way of example, some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a host and/or a target cell for the purpose of replicating the vectors comprising the nucleotide sequences (NS) of the present invention and/or expressing the proteins of the invention encoded by the nucleotide sequences (NS) of the present invention. Examples of vectors used in recombinant DNA techniques include but are not limited to plasmids, chromosomes, artificial chromosomes or viruses.
[0114] The term “vector” includes expression vectors and/or transformation vectors.
[0115] The term “transformation vector” means a construct capable of being transferred from one species to another.
[0116] The term “expression vector” means a construct capable of in vivo or in vitrolex vivo expression.
Expression Vector
[0117] Preferably, a nucleotide sequence (NS) of present invention which is inserted into a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The NS produced by a host recombinant cell may be secreted or may be contained intracellularly depending on the sequence and/or the vector used.
Expression Vector
[0118] The term “expression vector” as used in the present invention refers to an assembly which is capable of directing the expression of a nucleotide sequence. The NS expression vector must include a promoter which, when transcribed, is operably linked to the NS, as well as a polyadenylation sequence. Within other embodiments of the invention, the expression vectors described herein may be contained within a plasmid construct.
Expression Cassette
[0119] The term “expression cassette” refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host cell such as a packaging cell. Nucleic acid sequences necessary for expression in eucaryotic cells usually include promoters, enhancers, and termination and polyadenylation signals. The cassette can be removed and inserted into a vector or plasmid as a single unit.
Expression in Vitro
[0120] The vectors of the present invention may be transformed or transfected into a suitable host cell (such as a packaging/producer cell) as described below to provide for expression of an NS. This process may comprise culturing a host cell and/or target cell transformed with an expression vector under conditions to provide for expression by the vector of an NS and optionally recovering the expressed NS. The vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. The expression of the NOI may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, the production of the NOI may be initiated when required by, for example, addition of an inducer substance to the culture medium, for example tetracycline or a functional analogue thereof.
Non-Viral Delivery
[0121] Alternatively, the vectors comprising nucleotide sequences (NS) of the present invention may be introduced into suitable host cells, such as packaging cells, using a variety of non-viral techniques known in the art, such as transfection, transformation, electroporation and biolistic transformation.
[0122] As used herein, the term “transfection” refers to a process using a non-viral vector to deliver a gene to a target mammalian cell.
[0123] Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationiC enzyme-mediated, cationic facial amphiphiles (CFAs) (Nature Biotechnology 1996 14; 556), multivalent cations such as spermine, cationic lipids or polylysine, 1, 2,-bis (oleoyloxy)-3-(trimethylammonio) propane (DOTAP)-cholesterol complexes (Wolff and Trubetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof.
[0124] Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents. Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam and transfectam™). Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.
Viral Vectors
[0125] The producer cells of the present invention are used to produce viral vectors.
[0126] Preferably the vector is a recombinant viral vectors. Suitable recombinant viral vectors include but are not limited to adenovirus vectors, adeno-associated viral (AAV) vectors, herpes-virus vectors, a retroviral vector, lentiviral vectors, baculoviral vectors, pox viral vectors or parvovirus vectors (see Kestler et al 1999 Human Gene Ther 10(10):1619-32).
Retroviral Vectors
[0127] Examples of retroviruses include but are not limited to: murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis virus (AEV).
[0128] Preferred vectors for use in accordance with the present invention are recombinant viral vectors, in particular recombinant retroviral vectors (RRV) such as lentiviral vectors.
[0129] The term “recombinant retroviral vector” (RRV) refers to a vector with sufficient retroviral genetic information to allow packaging of an RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target cell includes reverse transcription and integration into the target cell genome. The RRV carries non-viral coding sequences which are to be delivered by the vector to the target cell. An RRV is incapable of independent replication to produce infectious retroviral particles within the final target cell. Usually the RRV lacks a functional gag-pol and/or env gene and/or other genes essential for replication. The vector of the present invention may be configured as a split-intron vector. A split intron vector is described in PCT patent application WO 99/15683.
[0130] A detailed list of retroviruses may be found in Coffin et al(“Retroviruses” 1997 Cold Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E Varmus pp 758-763).
Viral Particles
[0131] In the present invention, several terms are used interchangeably. Thus, “virion”, “virus”, “viral particle”, “viral vector”, and “vector particle” mean virus and virus-like particles that are capable of introducing a nucleic acid into a cell through a viral-like entry mechanism. Such vector particles can, under certain circumstances, mediate the transfer of NOIs into the cells they infect. By way of example, a retrovirus is capable of reverse transcribing its genetic material into DNA and incorporating this genetic material into a target cell's DNA upon transduction. Such cells are designated herein as “target cells”.
Lentiviral Vectors
[0132] In one embodiment of the present invention, lentiviral vectors are produced.
[0133] Lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include but are not limited to: the human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype “slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).
[0134] A distinction between the lentivirus family and other types of retroviruses is that lentiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al1992 EMBO. J 11: 3053-3058; Lewis and Emerman 1994 J. Virol. 68: 510-516). In contrast, other retroviruses—such as MLV—are unable to infect non-dividing cells such as those that make up a large proportion of, for example, muscle, brain, lung and liver tissue.
[0135] Preferred vectors for use in accordance with the present invention are recombinant retroviral vectors, in particular recombinant lentiviral vectors, in particular minimal lentiviral vectors, teachings relating to which are disclosed in WO 99/32646 and in WO98/17815.
[0136] Preferably the recombinant lentiviral vector (RLV) of the present invention has a minimal viral genome.
[0137] As used herein, the term “minimal viral genome” means that the viral vector has been manipulated so as to remove the non-essential elements and to retain the essential elements in order to provide the required functionality to infect, transduce and deliver a nucleotide sequence of interest to a target host cell.
Minimal Symptoms
[0138] It has been demonstrated that a primate lentivirus minimal system can be constructed which requires none of the HIV/SIV additional genes vif, vpr, vpx, vpu, tat, rev and nef for either vector production or for transduction of dividing and non-dividing cells. It has also been demonstrated that an EIAV minimal vector system can be constructed which does not require S2 for either vector production or for transduction of dividing and non-dividing cells. The deletion of additional genes is highly advantageous. Firstly, it permits vectors to be produced without the genes associated with disease in lentiviral (e.g. HIV) infections. In particular, tat is associated with disease. Secondly, the deletion of additional genes permits the vector to package more heterologous DNA. Thirdly, genes whose function is unknown, such as S2, may be omitted, thus reducing the risk of causing undesired effects. Examples of minimal lentiviral vectors are disclosed in WO-A-99/32646 and in WO-A-98/17815.
[0139] Thus, preferably, the delivery system used in the invention is devoid of at least tat and S2 (if it is an EIAV vector system), and possibly also vif, vpr, vpx, vpu and nef. More preferably, the systems of the present invention are also devoid of rev. Rev was previously thought to be essential in some retroviral genomes for efficient virus production. For example, in the case of HIV, it was thought that rev and RRE sequence should be included. However, it has been found that the requirement for rev and RRE can be reduced or eliminated by codon-optimisation (see below) or by replacement with other functional equivalent systems such as the Mason-Pfizer monkey virus (MPMV) constitutive transport element (CTE) system. As expression of the codon optimised gag-pol is REV independent, RRE can be removed from the gag-pol expression cassette, thus removing any potential for recombination with any RRE contained on the vector genome.
[0140] In a preferred embodiment, the viral genome of the present invention lacks the Rev response element (RRE).
[0141] In another preferred embodiment, the viral genome of the present invention comprises a polynucleotide response element.
[0142] Preferably the retroviral genome of the present invention comprises a polynucleotide response element.
[0143] Preferably the polynucleotide response element is an RRE.
[0144] Preferably the polynucleotide response element is responsive to a nucleus to cytoplasm transport factor.
[0145] Preferably the polynucleotide response element is a wood chuck hepatitis virus post-transcriptional regulatory element (WHV PRE).
[0146] In a preferred embodiment, the system used in the present invention is based on a so-called “minimal” system in which some or all of the additional genes have be removed.
[0147] A minimal lentiviral genome for use in the present invention will therefore comprise (5′) R-U5—one or more first nucleotide sequences—U3-R (3′). However, the plasmid vector used to produce the lentiviral genome within a host cell/packaging cell will also include transcriptional regulatory control sequences operably linked to the lentiviral genome to direct transcription of the genome in a host cell/packaging cell. These regulatory sequences may be the natural sequences associated with the transcribed retroviral sequence, i.e. the 5′ U3 region, or they may be a heterologous promoter such as another viral promoter, for example the CMV promoter. Some lentiviral genomes require additional sequences for efficient virus production. For example, in the case of HIV, rev and RRE sequence are preferably included. However the requirement for rev and RRE may be reduced or eliminated by codon optimisation.
Codon Optimisation
[0148] As used herein, the terms “codon optimised” and “codon optimisation” refer to an improvement in codon usage. By way of example, alterations to the coding sequences for viral components may improve the levels of expression of those sequences in the mammalian cells or other cells which are to act as the producer cells for retroviral vector particle production. This is referred to as “codon optimisation”. Many viruses, including HIV and other lentiviruses, use a large number of rare codons and by changing these to correspond to commonly used mammalian codons, increased expression of the packaging components in mammalian producer cells can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms.
[0149] Codon optimisation has previously been described in WO99/41397. Different cells differ it their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence so that they are tailored to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. By the same token, it is possible to decrease expression by deliberately choosing codons for which the corrsponding tRNAs are known to be rare in the particular cell type. Thus, an additional degree of translational control is available.
[0150] Many viruses, including HIV and other lentiviruses, use a large number of rare codons and by changing these to correspond to commonly used mammalian codons, increased expression of the packaging components in mammalian producer cells can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms.
[0151] Codon optimisation has a number of other advantages. By virtue of alterations in their sequences, the nucleotide sequences encoding the packaging components of the viral particles, for example lentiviral particles, required for assembly of viral particles in the producer cells/packaging cells have RNA instability sequences (INS) eliminated from them. At the same time, the amino acid sequence coding sequence for the packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the packaging components is not compromised.
[0152] Codon optimisation also overcomes the Rev/RRE requirement for nuclear-cytoplasmic export of lentiviral gag/pol mRNA, rendering expression from the codon-optimised sequences Rev-independent. Codon optimisation also reduces the potential for homologous recombination between different constructs within the vector system (for example between the regions of overlap in the vector, gag-pol and env open reading frames). The overall effect of codon optimisation is therefore a notable increase in viral titre and improved safety.
[0153] The gag-pol sequences of the present invention are codon optimised in their entirety, with the exception of the sequence encompassing the frameshift site.
[0154] The gag-pol gene comprises two overlapping reading frames encoding the gag-pol proteins. The expression of both proteins depends on a frameshift during translation. This frameshift occurs as a result of ribosome “slippage” during translation. This slippage is thought to be caused at least in part by ribosome-stalling RNA secondary structures. Such secondary structures exist downstream of the frameshift site in the -gag-pol gene. For HIV, the region of overlap extends from nucleotide 1222 downstream of the beginning of gag (wherein nucleotide 1 is the A of the gag ATG) to the end of gag (nt 1503). Consequently, a 281 bp fragment spanning the frameshift site and the overlapping region of the two reading frames is not codon optimised. Retaining this fragment enables more efficient expression of the gag-pol proteins.
[0155] For EIAV the beginning of the overlap has been taken to be nt 1262 (where nucleotide 1 is the A of the gag ATG). The end of the overlap is at 1461 bp. In order to ensure that the frameshift site and the gag-pol overlap are preserved, the wild type sequence has been retained from nt 1156 to 1465.
[0156] Derivations from optimal codon usage may be made, for example, in order to accommodate convenient restriction sites, and conservative amino acid changes may be introduced into the gag-pol proteins.
[0157] In a highly preferred embodiment, codon optimisation may be based on highly expressed mammalian genes. The third and sometimes the second and third base may be changed.
[0158] Due to the degenerate nature of the Genetic Code, it will be appreciated that numerous gag-pol sequences may be achieved by a skilled worker. Also there are many retroviral variants described which can be used as a starting point for generating a codon optimised gag-pol sequence. Lentiviral genomes can be quite variable. For example there are many quasi-species of HIV-1 which are still functional. This is also the case for EIAV. These variants may be used to enhance particular parts of the transduction process. Examples of HIV-1 variants may be found at http://hiv-web.lanl.gov. Details of EIAV clones may be found at the NCBI database: http://www.ncbi.nlm.nih.gov.
[0159] The strategy for codon optimised gag-pol sequences can be used in relation to any retrovirus. This would apply to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1 and HIV-2. In addition this method could be used to increase expression of genes from HTLV-1, HTLV-2, HFV, HSRV and human endogenous retroviruses (HERV), MLV and other retroviruses.
[0160] In one embodiment, the he vector of the present invention is produced using a codon-optimised gag-pol in the vector production system.
[0161] A codon-optimised gag/pol gene is advantageous because codon-optimised gag/pol gene is packaged significantly less efficiently than the wild type gene and represents a significant improvement to the safety profile of the system.
[0162] An additional benefit that results from creation of a ‘synthetic’ codon-optimised gag/pol is that its expression becomes independent of REV/RRE. Therefore if expression of the vector component RNA can be made REV/RRE independent the potential problems of supplying REV at a sufficient level within a packaging cell to allow efficient production of infectious vector particles can be avoided. Thus, the use of a codon-optimised gag/pol gene is advantageous in cells, such as TE671 or 293 cells, where high levels of REV expression can not be tolerated,
[0163] As described above, the packaging components for a retroviral vector include expression products of gag, pol and env genes. In addition, efficient packaging may depend on a short sequence of 4 stem loops followed by a partial sequence from gag and env (the “packaging signal”). Thus, inclusion of a deleted gag sequence in the retroviral vector genome (in addition to the full gag sequence on the packaging construct) may optimise vector titre. To date efficient packaging has been reported to require from 255 to 360 nucleotides of gag in vectors that still retain env sequences, or about 40 nucleotides of gag in a particular combination of splice donor mutation, gag and env deletions. The present invention demonstrates the surprising finding that a deletion of all but the N-termnial 360 or so nucleotides in gag leads to an increase in vector titre. Thus, preferably, the retroviral vector genome includes a gag sequence which comprises one or more deletions, more preferably the gag sequence comprises about 360 nucleotides derivable from the N-terminus.
Self-Inactivating (SIN) Vector
[0164] In one embodiment of the present invention, the viral vector, such as a lentiviral vector, is a self-inactivating vector.
[0165] By way of example, self-inactivating retroviral vectors have been constructed by deleting the transcriptional enhancers or the enhancers and promoter in the U3 region of the 3′ LTR. After a round of vector reverse transcription and integration, these changes are copied into both the 5′ and the 3′ LTRs producing a transcriptionally inactive provirus (Yu et al 1986 Proc Natl Acad Sci 83: 3194-3198; Dougherty and Temin 1987 Proc Natl Acad Sci 84: 1197-1201; Hawley et al 1987 Proc Natl Acad Sci 84: 2406-2410; Yee et al 1987 Proc Natl Acad Sci 91: 9564-9568). However, any promoter(s) internal to the LTRs in such vectors will still be transcriptionally active. This strategy has been employed to eliminate effects of the enhancers and promoters in the viral LTRs on transcription from internally placed genes. Such effects include increased transcription (Jolly et al 1983 Nucleic Acids Res 11: 1855-1872) or suppression of transcription (Emerman and Temin 1984 Cell 39: 449-467). This strategy can also be used to eliminate downstream transcription from the 3′ LTR into genomic DNA (Herman and Coffin 1987 Science 236: 845-848). This is of particular concern in human gene therapy where it is of critical importance to prevent the adventitious activation of an endogenous oncogene.
[0166] Although a SIN vector may improve biosafety, the self-inactivating feature of some SIN vectors precludes vector transduction of packaging cell lines as a method of generating stable SIN vector-producing lines. Although stable SIN vector-producing cell lines have been generated by co-transfecting vector DNA with a selection marker gene into packaging cells and screening for stable cell clones yielding the highest vector titres, this approach has the shortcoming that most of the positively screening clones are genetically unstable and often subject to transcription shut off.
[0167] Recently, another approach has been the generation of stable SIN lentivirus vector producer cell lines by transduction using a conditional SIN (cSIN) vector. This approach allows efficient transcription and packaging of full length vector RNA in vector-transduced packaging cells only, yet retains its self-inactivating properties when infecting normal target cells. In this regard, Xu et al (Mol Therapy 2001 3 (1): 97-104) have developed a new vector design using a tetracycline-inducible system in which the 3′LTR U3 transcription regulatory elements (including the TATA box) with the Tetracycline responsive element (TRE) which contains seven copies of the 42 bp tet operator sequence. Consequently, after transduction, transcription of full-length vector RNA becomes dependent on the presence of the synthetic tetracycline-regulated transactivator (tTA). The Xu et al study demonstrates that a stable SIN lentivirus vector producer line can be produced using a non transient production protocol. Thus, high vector titres can be produced from stable packaging cell lines which retain the vectors' self-inactivating properties in target cells that do not express tTA.
[0168] Thus, in one embodiment of the present invention, preferably the SIN vector is a conditional SIN (cSIN) vector.
Pseudotyping
[0169] In the design of viral vector systmes it is desirable to engineer particles with different target cell specificities to the native virus, to enable the delivery of genetic material to an expanded or altered range of cell types. One manner in which to achieve this is by engineering the virus envelope protein to alter its specificity. Another approach is to introduce a heterologous envelope protein into the vector particle to replace or add to the native envelope protein of the virus.
[0170] As used herein, the term “pseudotyping” refers to a a technique or strategy whereby an env gene is replaced with a heterologous env gene. Pseudotyping is not a new phenomenon and examples may be found in WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400, WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841-847. Thus, the term “pseudotype” refers to progeny virions bearing the genome of one virus encapsidated by the envelope protein of another.
[0171] Pseudotyping can improve retroviral vector stability and transduction efficiency. A pseudotype of murine leukemia virus packaged with lymphocytic choriomeningitis virus (LCMV) has been described (Miletic et al (1999) J. Virol. 73:6114-6116) and shown to be stable during ultracentrifugation and capable of infecting several cell lines from different species.
[0172] Preferably the env protein is an LCMV env protein.
[0173] In one embodiment of the present invention the vector system may be pseudotyped with at least a part of a rabies G protein or a mutant, variant, homologue or fragment thereof, or at least a part of a VSV G protein or a mutant, variant, homologue or fragment thereof.
[0174] The heterologous env region may be encoded by a gene which is present on a producer plasmid. The producer plasmid may be present as part of a kit for the production of retroviral vector particles.
Rabies G Protein
[0175] In one embodiment of the present invention the vector system may be pseudotyped with at least a part of a rabies G protein or a mutant, variant, homologue or fragment thereof.
[0176] Teachings on the rabies G protein, as well as mutants thereof, may be found in in WO 99/61639 and well as Rose et al., 1982 J. Virol. 43: 361-364, Hanham et al., 1993 J. Virol.,67, 530-542, Tuffereau et al.,1998 J. Virol., 72, 1085-1091, Kucera et al., 1985 J. Virol 55, 158-162, Dietzschold et al., 1983 PNAS 80, 70-74, Seif et al., 1985 J.Virol., 53, 926-934, Coulon et al.,1998 J. Virol., 72, 273-278, Tuffereau et al.,1998 J. Virol., 72, 1085-10910, Burger et al., 1991 J.Gen. Virol. 72. 359-367, Gaudin et al 1995 J Virol 69, 5528-5534, Benmansour et al 1991 J Virol 65, 4198-4203, Luo et al 1998 Microbiol Immunol 42, 187-193, Coll 1997 Arch Virol 142, 2089-2097, Luo et al 1997 Virus Res 51, 35-41, Luo et al 1998 Microbiol Immunol 42, 187-193, Coll 1995 Arch Virol 140, 827-851, Tuchiya et al 1992 Virus Res 25, 1-13, Morimoto et al 1992 Virology 189, 203-216, Gaudin et al 1992 Virology 187, 627-632, Whitt et al 1991 Virology 185, 681-688, Dietzschold et al 1978 J Gen Virol 40, 131-139, Dietzschold et al 1978 Dev Biol Stand 40, 45-55, Dietzschold et al 1977 J Virol 23, 286-293, and Otvos et al 1994 Biochim Biophys Acta 1224, 68-76. A rabies G protein is also described in EP-A-0445625.
[0177] The use of rabies G protein provides vectors which, in vivo, preferentially transduce targeted cells which rabies virus preferentially infects. This includes in particular neuronal target cells in vivo. For a neuron-targeted vector, rabies G from a pathogenic strain of rabies such as ERA may be particularly effective. On the other hand rabies G protein confers a wider target cell range in vitro including nearly all mammalian and avian cell types tested (Seganti et al., 1990 Arch Virol. 34,155-163; Fields et al., 1996 Fields Virology, Third Edition, vol.2, Lippincott-Raven Publishers, Philadelphia, New York).
[0178] The tropism of the pseudotyped vector particles may be modified by the use of a mutant rabies G which is modified in the extracellular domain. Rabies G protein has the advantage of being mutatable to restrict target cell range. The uptake of rabies virus by target cells in vivo is thought to be mediated by the acetylcholine receptor (AchR) but there may be other receptors to which in binds in vivo (Hanham et al., 1993 J. Virol.,67, 530-542; Tuffereau et al.,1998 J. Virol., 72, 1085-1091). It is thought that multiple receptors are used in the nervous system for viral entry, including NCAM (Thoulouze et al (1998) J. Virol 72(9):7181-90) and p75 Neurotrophin receptor (Tuffereau C et al (1998) Embo J 17(24) 7250-9).
[0179] The effects of mutations in antigenic site III of the rabies G protein on virus tropism have been investigated, this region is not thought to be involved in the binding of the virus to the acetylcholine receptor (Kucera et al., 1985 J. Virol 55, 158-162; Dietzschold et al., 1983 Proc Natl Acad Sci 80, 70-74; Seif et al., 1985 J.Virol., 53, 926-934; Coulon et al.,1998 J. Virol., 72, 273-278; Tuffereau et al.,1998 J. Virol., 72, 1085-10910). For example a mutation of the arginine at amino acid 333 in the mature protein to glutamine can be used to restrict viral entry to olfactory and peripheral neurons in vivo while reducing propagation to the central nervous system. These viruses were able to penetrate motor neurons and sensory neurons as efficiently as the wild type virus, yet transneuronal transfer did not occur (Coulon et al., 1989, J. Virol. 63, 3550-3554). Viruses in which amino acid 330 has been mutated are further attenuated, being unable to infect either motor neurons or sensory neurons after intra-muscular injection (Coulon et al.,1998 J. Virol., 72, 273-278).
[0180] Alternatively or additionally, rabies G proteins from laboratory passaged strains of rabies may be used. These can be screened for alterations in tropism. Such strains include the following:
[0181]
| Genbank accession number | Rabies Strain | |
|---|---|---|
| J02293 | ERA | |
| U52947 | COSRV | |
| U27214 | NY 516 | |
| U27215 | NY771 | |
| U27216 | FLA125 | |
| U52946 | SHBRV | |
| M32751 | HEP-Flury | |
[0182] By way of example, the ERA strain is a pathogenic strain of rabies and the rabies G protein from this strain can be used for transduction of neuronal cells. The sequence of rabies G from the ERA strains is in the GenBank database (accession number J02293). This protein has a signal peptide of 19 amino acids and the mature protein begins at the lysine residue 20 amino acids from the translation initiation methionine. The HEP-Flury strain contains the mutation from arginine to glutamine at amino acid position 333 in the mature protein which correlates with reduced pathogenicity and which can be used to restrict the tropism of the viral envelope.
[0183] WO 99/61639 discloses the nucleic and amino acid sequences for a rabies virus strain ERA (Genbank locus RAVGPLS, accession M38452).
VSV-G Protein
[0184] The envelope glycoprotein (G) of Vesicular stomatitis virus (VSV), a rhabdovirus, is another envelope protein that has been shown to be capable of pseudotyping certain retroviruses.
[0185] Its ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope proteins was first shown by Emi et al (1991 Journal of Virology 65:1202-1207). WO94/294440 teaches that retroviral vectors may be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors may be used to transduce a wide range of mammalian cells. Even more recently, Abe et al (J Virol 1998 72(8) 6356-6361) teach that non-infectious retroviral particles can be made infectious by the addition of VSV-G.
[0186] Burns et al (1993 Proc. Natl. Acad. Sci. USA 90: 8033-7) successfully pseudotyped the retrovirus MLV with VSV-G and this resulted in a vector having an altered host range compared to MLV in its native form. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles and insects (Burns et al 1993 ibid). They have also been shown to be more efficient than traditional amphotropic envelopes for a variety of cell lines (Yee et al, 1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568, Lin, Emi et al, 1991 Journal of Virology 65:1202-1207). VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail is capable of interacting with the retroviral cores. The provision of a non-retroviral pseudotyping envelope such as VSV-G protein gives the advantage that vector particles can be concentrated to a high titre without loss of infectivity (Akkina et al, 1996 J. Virol. 70: 2581-5). Retrovirus envelope proteins are apparently unable to withstand the shearing forces during ultracentrifugation, probably because they consist of two non-covalently linked subunits. The interaction between the subunits may be disrupted by the centrifugation. In comparison the VSV glycoprotein is composed of a single unit. VSV-G protein pseudotyping can therefore offer potential advantages.
[0187] WO 00/52188 describes the generation of pseudotyped retroviral vectors, from stable producer cell lines, having vesicular stomatitis virus-G protein (VSV-G) as the membrane-associated viral envelope protein, and provides a gene sequence for the VSV-G protein.
Mutants, Variants, Homologues and Fragments
[0188] In one embodiment, the retroviral vector system used in the present invention may be pseudotyped with a mutant, variant, homologue or fragment of the wild-type Rabies G or VSV-G protein.
[0189] The term “wild type” is used to mean an polypeptide having a primary amino acid sequence which is identical with the native protein (i.e., the viral protein).
[0190] The term “mutant” is used to mean a polypeptide having a primary amino acid sequence which differs from the wild type sequence by one or more amino acid additions, substitutions or deletions. A mutant may arise naturally, or may be created artificially (for example by site-directed mutagenesis).Preferably the mutant has at least 90% sequence identity with the wild type sequence. Preferably the mutant has 20 mutations or less over the whole wild-type sequence. More preferably the mutant has 10 mutations or less, most preferably 5 mutations or less over the whole wild-type sequence.
[0191] The term “variant” is used to mean a naturally occurring polypeptide which differs from a wild-type sequence. A variant may be found within the same viral strain (i.e. if there is more than one isoform of the protein) or may be found within a different strains. Preferably the variant has at least 90% sequence identity with the wild type sequence. Preferably the variant has 20 mutations or less over the whole wild-type sequence. More preferably the variant has 10 mutations or less, most preferably 5 mutations or less over the whole wild-type sequence.
[0192] Here, the term “homologue” means an entity having a certain homology with the wild type amino acid sequence and the wild type nucleotide sequence. Here, the term “homology” can be equated with “identity”.
[0193] In the present context, an homologous sequence is taken to include an amino acid sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence. Typically, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
[0194] In the present context, an homologous sequence is taken to include a nucleotide sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence. Typically, the homologues will comprise the same sequences that code for the active sites etc. as the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
[0195] Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
[0196] % homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, orie residue at a time. This is called an “ungapped” alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.
[0197] Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to try to maximise local homology.
[0198] However, these more complex methods assign “gap penalties” to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible—reflecting higher relatedness between the two compared sequences—will achieve a higher score than one with many gaps. “Affine gap costs” are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is −12 for a gap and −4 for each extension.
[0199] Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al., 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 ibid—Chapter 18), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and [email protected]).
[0200] Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix—the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
[0201] Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
[0202] The sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.
[0203] Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
[0204]
| ALIPHATIC | Non-polar | G A P | |
| I L V | |||
| Polar-uncharged | C S T M | ||
| N Q | |||
| Polar-charged | D E | ||
| K R | |||
| AROMATIC | H F W Y | ||
[0205] The present invention also encompasses homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non-homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as omithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.
[0206] Replacements may also be made by unnatural amino acids include; alpha* and alpha-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-amino butyric acid*, L-γ-amino butyric acid*, L-α-amino isobutyric acid*, L-ε-amino caproic acid#, 7-amino heptanoic acid*, L-methionine sulfone#*, L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline#, L-thioproline*, methyl derivatives of phenylalanine (Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino)#, L-Tyr (methyl)*, L-Phe (4-isopropyl)*, L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L-diaminopropionic acid # and L-Phe (4-benzyl)*. The notation * has been utilised for the purpose of the discussion above (relating to homologous or non-homologous substitution), to indicate the hydrophobic nature of the derivative whereas # has been utilised to indicate the hydrophilic nature of the derivative, #* indicates amphipathic characteristics.
[0207] Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or β-alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, “the peptoid form” is used to refer to variant amino acid residues wherein the α-carbon substituent group is on the residue's nitrogen atom rather than the α-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example Simon R J et al., PNAS (1992) 89(20), 9367-9371 and Horwell D C, Trends Biotechnol. (1995) 13(4), 132-134.
[0208] The term “fragment” indicates that the polypeptide comprises a fraction of the wild-type amino acid sequence. It may comprise one or more large contiguous sections of sequence or a plurality of small sections. The polypeptide may also comprise other elements of sequence, for example, it may be a fusion protein with another protein. Preferably the polypeptide comprises at least 50%, more preferably at least 65%, most preferably at least 80% of the wild-type sequence.
[0209] With respect to function, the mutant, variant, homologue or fragment should be capable of transducing the target cell when used to pseudotype an appropriate vector.
[0210] The viral delivery system used in the present invention may comprise nucleotide sequences that can hybridise to the nucleotide sequence presented herein (including complementary sequences of those presented herein). In a preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention under stringent conditions (e.g. 65° C. and 0.1 SSC) to the nucleotide sequence presented herein (including complementary sequences of those presented herein).
[0211] A potential advantage of using the rabies glycoprotein in comparison to the VSV glycoprotein is the detailed knowledge of its toxicity to man and other animals due to the extensive use of rabies vaccines. In particular phase I clinical trials have been reported on the use of rabies glycoprotein expressed from a canarypox recombinant virus as a human vaccine (Fries et al., 1996 Vaccine 14, 428-434), these studies concluded that the vaccine was safe for use in humans.
Adenovirus Vectors
[0212] In one embodiment of the present invention, adenoviral vectors are produced.
[0213] The adenovirus is a double-stranded, linear DNA virus that does not go through an RNA intermediate. There are over 50 different human serotypes of adenovirus divided into 6 subgroups based on the genetic sequence homology. The natural target of adenovirus is the respiratory and gastrointestinal epithelia, generally giving rise to only mild symptoms. Serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections in the young.
[0214] Adenoviruses are nonenveloped, regular icosohedrons. A typical adenovirus comprises a 140 nm encapsidated DNA virus. The icosahedral symmetry of the virus is composed of 152 capsomeres: 240 hexons and 12 pentons. The core of the particle contains the 36 kb linear duplex DNA which is covalently associated at the 5′ ends with the Terminal Protein (TP) which acts as a primer for DNA replication. The DNA has inverted terminal repeats (ITR) and the length of these varies with the serotype.
[0215] Entry of adenovirus into cells involves a series of distinct events. Attachment of the virus to the cell occurs via an interaction between the viral fibre (37 nm) and the fibre receptors on the cell. This receptor has recently been identified for Ad2/5 serotypes and designated as CAR (Coxsackie and Adeno Receptor, Tomko et al (1997 Proc Natl Acad Sci 94: 3352-2258). Internalisation of the virus into the endosome via the cellular αvβ3 and αvβ5 integrins is mediated by and viral RGD sequence in the penton-base capsid protein (Wickham et al., 1993 Cell 73: 309-319). Following internalisation, the endosome is disrupted by a process known as endosomolysis, an event which is believed to be preferentially promoted by the cellular αvβ5 integrin (Wickham et al., 1994 J Cell Biol 127: 257-264). In addition, there is recent evidence that the Ad5 fibre knob binds with high affinity to the MHC class 1 α2 domain at the surface of certain cell types including human epithelial and B lymphoblast cells (Hong et al., 1997 EMBO 16: 2294-2306).
[0216] Subsequently the virus is translocated to the nucleus where activation of the early regions occurs and is shortly followed by DNA replication and activation of the late regions. Transcription, replication and packaging of the adenoviral DNA requires both host and viral functional protein machinery.
[0217] Viral gene expression can be divided into early (E) and late (L) phases. The late phase is defined by the onset of viral DNA replication. Adenovirus structural proteins are generally synthesised during the late phase. Following adenovirus infection, host cellular mRNA and protein synthesis is inhibited in cells infected with most serotypes. The adenovirus lytic cycle with adenovirus 2 and adenovirus 5 is very efficient and results in approximately 10,000 virions per infected cell along with the synthesis of excess viral protein and DNA that is not incorporated into the virion. Early adenovirus transcription is a complicated sequence of interrelated biochemical events but it entails essentially the synthesis of viral RNAs prior to the onset of DNA replication.
[0218] The Schematic diagram presented in FIG. 28 is of the adenovirus genome showing the relative direction and position of early and late gene transcription:
[0219] The organisation of the adenovirus genome is similiar in all of the adenovirus groups and specific functions are generally positioned at identical locations for each serotype studied. Early cytoplasmic messenger RNAs are complementary to four defined, noncontiguous regions on the viral DNA. These regions are designated E1-E4. The early transcripts have been classified into an array of intermediate early (E1a), delayed early (E1b, E2a, E2b, E3 and E4), and intermediate regions.
[0220] The early genes are expressed about 6-8 hours after infection and are driven from 7 promoters in gene blocks E1-4.
[0221] The E1a region is involved in transcriptional transactivation of viral and cellular genes as well as transcriptional repression of other sequences. The E1a gene exerts an important control function on all of the other early adenovirus messenger RNAs. In normal tisssues, in order to transcribe regions E1b, E2a, E2b, E3 or E4 efficiently, active E1a product is required. However, the E1a function may be bypassed. Cells may be manipulated to provide E1a-like functions or may naturally contain such functions. The virus may also be manipulated to bypass the E1a function. The viral packaging signal overlaps with the E1a enhancer (194-358 nt).
[0222] The E1b region influences viral and cellular metabolism and host protein shut-off. It also includes the gene encoding the pIX protein (3525-4088 nt) which is required for packaging of the full length viral DNA and is important for the thermostability of the virus. The E1b region is required for the normal progression of viral events late in infection. The E1b product acts in the host nucleus. Mutants generated within the E1b sequences exhibit diminished late viral mRNA accumulation as well as impairment in the inhibition of host cellular transport normally observed late in adenovirus infection. E1b is required for altering functions of the host cell such that processing and transport are shifted in favour of viral late gene products. These products then result in viral packaging and release of virions. E1b produces a 19 kD protein that prevents apoptosis. E1b also produces a 55 kD protein that binds to p53. For a review on adenoviruses and their replication, see WO 96/17053.
[0223] The E2 region is essential as it encodes the 72 kDa DNA binding protein, DNA polymerase and the 80 kDa precurser of the 55 kDa Terminal Protein (TP) needed for protein priming to initiate DNA synthesis.
[0224] A 19 kDa protein (gp19K) is encoded within the E3 region and has been implicated in modulating the host immune response to the virus. Expression of this protein is upregulated in response to TNF alpha during the first phase of the infection and this then binds and prevents migration of the MHC class I antigens to the epithelial surface, thereby dampening the recognition of the adenoviral infected cells by the cytotoxic T lymphocytes. The E3 region is dispensible in in vitro studies and can be removed by deletion of a 1.9 kb XbaI fragment.
[0225] The E4 region is concerned with decreasing the host protein synthesis and increasing the DNA replication of the virus.
[0226] There are 5 families of late genes and all are initiated from the major late promoter. The expression of the late genes includes a very complex post-transcriptional control mechanism involving RNA splicing. The fibre protein is encoded within the L5 region. The adenoviral genome is flanked by the inverted terminal repeat which in Ad5 is 103 bp and is essential for DNA replication. 30-40 hours post infection viral production is complete.
[0227] Adenoviruses may be converted for use as vectors for gene transfer by deleting the E1 gene, which is important for the induction of the E2, E3 and E4 promoters. The E1-replication defective virus may be propagated in a cell line that provides the E1 polypeptides in trans, such as the human embryonic kidney cell line 293. A therapeutic gene or genes can be inserted by recombination in place of the E1 gene. Expression of the gene is driven from either the E1 promoter or a heterologous promoter.
[0228] Even more attenuated adenoviral vectors have been developed by deleting some or all of the E4 open reading frames (ORFs): However, certain second generation vectors appear not to give longer-term gene expression, even though the DNA seems to be maintained. Thus, it appears that the function of one or more of the E4 ORFs may be to enhance gene expression from at least certain viral promoters carried by the virus.
[0229] An alternative approach to making a more defective virus has been to “gut” the virus completely maintaining only the terminal repeats required for viral replication. The “gutted” or “gutless” viruses can be grown to high titres with a first generation helper virus in the 293 cell line but it has been difficult to separate the “gutted” vector from the helper virus.
[0230] The adenovirus provides advantages as a vector over other gene delivery vector systems for the following reasons:
[0231] It is a double stranded DNA nonenveloped virus that is capable of in vivo and in vitro transduction of a broad range of cell types of human and non-human origin. These cells include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cells and post-mitotically terminally differentiated cells such as neurons.
[0232] Adenoviral vectors are also capable of transducing non dividing cells. This is very important for diseases, such as cystic fibrosis, in which the affected cells in the lung epithelium, have a slow turnover rate. In fact, several trials are underway utilising adenovirus-mediated transfer of cystic fibrosis transporter (CFTR) into the lungs of afflicted adult cystic fibrosis patients.
[0233] Adenoviruses have been used as vectors for gene therapy and for expression of heterologous genes. The large (36 kilobase) genome can accommodate up to 8 kb of foreign insert DNA and is able to replicate efficiently in complementing cell lines to produce very high titres of up to 1012. An adenovirus vector system is thus one of the best systems to study the expression of genes in primary non-replicative cells.
[0234] The expression of viral or foreign genes from the adenovirus genome does not require a replicating cell. Adenoviral vectors enter cells by receptor mediated endocytosis. Once inside the cell, adenovirus vectors rarely integrate into the host chromosome. Instead, it functions episomally (independently from the host genome) as a linear genome in the host nucleus. Hence the use of recombinant adenovirus alleviates the problems associated with random integration into the host genome.
[0235] In one embodiment of the present invention, the features of adenoviruses may be combined with the genetic stability of retroviruses/lentiviruses which can be used to transduce target cells to become transient retroviral producer cells capable of stably infect neighbouring cells. Such retroviral producer cells which are engineered to express an NOI of the present invention can be implanted in organisms such as animals or humans for use in the treatment of disease such as cancer.
Pox Viruses
[0236] In one embodiment of the present invention, poxviral vectors are produced.
[0237] Pox viral vectors may be used in accordance with the present invention, as large fragments of DNA are easily cloned into its genome and recombinant attenuated vaccinia variants have been described (Meyer, et al., 1991, J. Gen. Virol. 72: 1031-1038, Smith and Moss 1983 Gene, 25:21-28).
[0238] Examples of pox viral vectors include but are not limited to leporipoxvirus: Upton, et al J. Virology 60:920 (1986) (shope fibroma virus); capripoxvirus: Gershon, et al J. Gen. Virol. 70:525 (1989) (Kenya sheep-1); orthopoxvirus: Weir, et al J. Virol 46:530 (1983) (vaccinia); Esposito, et al Virology 135:561 (1984) (monkeypox and variola virus); Hruby, et al PNAS, 80:3411 (1983) (vaccinia); Kilpatrick, et al Virology 143:399 (1985) (Yaba monkey tumour virus); avipoxvirus: Binns, et al J. Gen. Virol 69:1275 (1988) (fowlpox); Boyle, et al Virology 156:355 (1987) (fowlpox); Schnitzlein, et al J. Virological Method, 20:341 (1988) (fowlpox, quailpox); entomopox (Lytvyn, et al J. Gen. Virol 73:3235-3240 (1992)]. Poxvirus vectors are used extensively as expression vehicles for genes of interest in eukaryotic cells. Their ease of cloning and propagation in a variety of host cells has led, in particular, to the widespread use of poxvirus vectors for expression of foreign protein and as delivery vehicles for vaccine antigens (Moss, B. 1991, Science 252: 1662-7).
[0239] Preferred vectors for use in accordance with the present invention are recombinant pox viral vectors such as fowl pox virus (FPV), entomopox virus, vaccinia virus such as NYVAC, canarypox virus, MVA or other non-replicating viral vector systems such as those described for example in WO 95/30018. Pox virus vectors have also been described where at least one immune evasion gene has been deleted (see WO 00/29428).
[0240] In one preferred embodiment, the pox virus vector is an entomopox virus vector.
Vaccinia Viral Vectors
[0241] Preferably the pox viral vector is a vaccinia viral vector.
[0242] Preferably, the vector is a vaccinia virus vector such as MVA or NYVAC. Most preferred is the vaccinia strain modified virus ankara (MVA) or a strain derived therefrom. Alternatives to vaccinia vectors include avipox vectors such as fowlpox or canarypox known as ALVAC and strains derived therefrom which can infect and express recombinant proteins in human cells but are unable to replicate.
[0243] Preferred vectors for use in accordance with the present invention are recombinant pox viral vectors such as fowl pox virus (FPV), entomopox virus, vaccinia virus such as NYVAC, canarypox virus, MVA or other non-replicating viral vector systems such as those described for example in WO 95/30018.
Hybrid Viral Vectors
[0244] In a further broad aspect, the present invention provides a hybrid viral vector system for in vivo delivery of a nucleotide sequence encoding an NOI of the present invention, which system comprises one or more primary viral vectors which encode a secondary viral vector, the primary vector or vectors capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell.
[0245] Preferably the primary vector is obtainable from or is based on an adenoviral vector and/or the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector.
Retroviral Vector Structure
[0246] In one embodiment of the present invention, retroviral vectors are produced.
[0247] By way of background information, each retroviral genome comprises genes called gag, pol and env which code for virion proteins and enzymes. The viral core proteins (gag) and the viral polymerase (po) proteins encapsidate the retrovirus-packagable sequences and themselves are further surrounded by a membrane containing an envelope glycoprotein (also known as env).
[0248] In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for proviral integration, and transcription. They also serve as enhancer-promoter sequences. In other words, the LTRs can control the expression of the viral gene. Encapsidation of the retroviral RNAs occurs by virtue of a psi sequence located at the 5′ end of the viral genome.
[0249] As used herein, the term “long terminal repeat (LTR) is used in reference to domains of base pairs located at the end of retroviral DNAs.
[0250] The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5. U3 is derived from the sequence unique to the 3′ end of the RNA. R is derived from a sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5′ end of the RNA. The sizes of the three elements can vary considerably among different retroviruses.
[0251] For ease of understanding, a simple, generic structures (not to scale) of the RNA and the DNA forms of the MLV retroviral genome is presented in FIG. 29 in which the elementary features of the LTRs and the relative positioning of gag/pol and env are indicated. Please note that (i) gag/pol and env are normally not spaced apart; and (ii) the overlap normally present between the pco and env genes and the poly A tail normally present at the 3′ end of the RNA transcript are not illustrated in FIG. 29.
[0252] The basic molecular organisation of an infectious retroviral RNA genome is (5′) R-U5—gag/pol, env—U3-R (3′). In a defective retroviral vector genome gag, pol and env may be absent or not functional. The R regions at both ends of the RNA are repeated sequences. U5 and U3 represent unique sequences at the 5′ and 3′ ends of the RNA genome respectively.
[0253] Upon cellular transduction, reverse transcription of the virion RNA into double stranded DNA takes place in the cytoplasm and involves two jumps of the reverse transcriptase from the 5′ terminus to the 3′ terminus of the template molecule. The result of these jumps is a duplication of sequences located at the 5′ and 3′ ends of the virion RNA. These sequences then occur fused in tandem on both ends of the viral DNA, forming the long terminal repeats (LTRs) which comprise R U5 and U3 regions. On completion of the reverse transcription, the viral DNA is translocated into the nucleus where the linear copy of the retroviral genome, called a preintegration complex (PIC), is randomly inserted into chromosomal DNA with the aid of the virion integrase to form a stable provirus. The number of possible sites of integration into the host cellular genome is very large and very widely distributed.
[0254] Preferably the retroviral genome is introduced into packaging cell lines using retroviral transduction.
[0255] Preferably retroviral vector particles (such as MLV vector particles) are prepared in a transient expression system with a different envelope pseudotype to the packaging cell, and used to transduce a retroviral packaging cell.
[0256] Preferably the retroviral transduction step identifies retroviral insertions in integration sites that support high level expression of the resulting regulated retroviral genome.
Regulated Retroviral Vectors
[0257] In one aspect of the present invention, the retroviral vector is a regulated retroviral vector.
[0258] As used herein, the term “regulated retroviral vectors” means a retroviral vector comprising a “regulatable 3′LTR region. As used herein, the terms “regulatable LTR” and “regulatable 3′LTR” include vectors which contain responsive elements which are present in retroviral 3′ LTR sequences, either by design or by their nature. Within the regulatable 3′LTR region, the 3′U3 sequence contains most of the transcriptional control elements of the provirus, which include the promoter and multiple enhancer sequences responsive to cellular and in some cases, viral transcriptional activator proteins.
Viral Delivery Systems
[0259] When the vector particles are used to transfer NOIs into cells which they transduce, such vector particles also designated “viral delivery systems” or “retroviral delivery systems”. Viral vectors, including retroviral vectors, have been used to transfer NOIs efficiently by exploiting the viral transduction process. NOIs cloned into the retroviral genome can be delivered efficiently to cells susceptible to transduction by a retrovirus. Through other genetic manipulations, the replicative capacity of the retroviral genome can be destroyed. The vectors introduce new genetic material into a cell but are unable to replicate.
[0260] Preferably the genome of the vector system used in the present invention comprises a cPPT sequence.
[0261] The presence of a sequence termed the central polypurine tract (cPPT) may improve the efficiency of gene delivery to non-dividing cells (see WO 00/31200). This cis-acting element is located, for example, in the EIAV polymerase coding region element.
High Titre
[0262] It is highly desirable to use high-titre virus preparations in both experimental and practical applications. Techniques for increasing viral titre include using a psi plus packaging signal, as discussed above, and concentration of viral stocks.
[0263] As used herein, the term “high titre” means an effective amount of a viral vector or particle which is capable of transducing a target site such as a cell.
[0264] As used herein, the term “effective amount” means an amount of a regulated viral or vector particle which is sufficient to induce expression of the NOIs at a target site. In some instances, the term “sufficient amount” is used interchangeably with the term “effective amount”.
[0265] A high-titre viral preparation for a producer/packaging cell is usually of the order of 105 to 107 t.u. per ml. (The titer is expressed in transducing units per ml (t.u./ml) as titred on the canine osteosarcoma D17 cell line). For transduction in tissues such as the brain, it is necessary to use very small volumes, so the viral preparation is concentrated by ultracentrifugation. The resulting preparation should have at least 108 t.u./ml, preferably from 108 to 109 t.u./ml, more preferably at least 109 t.u./ml.
[0266] Preferably the retroviral vector is produced at high titre.
[0267] Preferably the retroviral vector produced at high titre is a lentiviral vector.
[0268] Preferably a recombinase assisted mechanism is used which facilitates the production of high titre regulated lentiviral vectors from the producer cells of the present invention.
[0269] As used herein, the term “recombinase assisted system” includes but is not limited to a system using the Cre recombinase/loxP recognition sites of bacteriophage P1 or the site-specific FLP recombinase of S. cerevisiae which catalyses recombination events between 34 bp FLP recognition targets (FRTs).
[0270] The site-specific FLP recombinase of S. cerevisiae which catalyses recombination events between 34 bp FLP recognition targets (FRTs) has been configured into DNA constructs in order to generate high level producer cell lines using recombinase-assisted recombination events (Karreman et al (1996) NAR 24:1616-1624). A similar system has been developed using the Cre recombinase/loxP recognition sites of bacteriophage P1 (see PCT/GB00/03837; Vanin et al (1997) J. Virol 71:7820-7826). This was configured into a lentiviral genome such that high titre lentiviral producer cell lines were generated.
[0271] Preferably a high titre retroviral vector is produced using a modified and/or extended packaging signal.
Packaging Signal
[0272] As used herein, the term “packaging signal” which is refered to interchangeably as “packaging sequence” or “psi” is used in reference to the non-coding sequence located within the retroviral genome which is required for encapsidation of retroviral RNA strands during viral particle formation. In HIV-1, this sequence has been mapped to loci extending from upstream of the major splice donor site (SD) to at least the gag start codon. Several retroviral vectors use the minimal packaging signal (also referred to as the psi sequence) needed for encapsidation of the viral genome. By way of example, this minimal packaging signal encompasses bases 212 to 563 of the Mo-MLV genome (Mann et al 1983: Cell 33:153
[0273] As used herein, the term “extended packaging signal” or “extended packaging sequence” refers to the use of sequences around the psi sequence with further extension into the gag gene. The inclusion of these additional packaging sequences may increase the efficiency of insertion of vector RNA into viral particles.
[0274] Preferably a high titre lentiviral vector is produced using a modified packaging signal.
[0275] Preferably the lentiviral construct is a based on an EIAV vector genome where all the accessory genes are removed.
Accessory Genes
[0276] As used herein, the term “accessory genes” refer to a variety of virally encoded accessory proteins capable of modulating various aspects of retroviral replication and infectivity. These proteins are discussed in Coffin et al (ibid) (Chapters 6 and 7). Examples of accessory proteins in lentiviral vectors include but are not limited to tat, rev, nef, vpr, vpu, vif, vpx. An example of a lentiviral vector useful in the present invention is one which has all of the accessory genes removed.
Transcriptional Control
[0277] The control of proviral transcription remains largely with the noncoding sequences of the viral LTR. The site of transcription initiation is at the boundary between U3 and R in the 5′LTR (as shown in FIG. 29 ) and the site of poly (A) addition (termination) is at the boundary between R and U5 in the 3′LTR (as shown in FIG. 29). The U3 sequence contains most of the transcriptional control elements of the provirus, which include the promoter and multiple enhancer sequences responsive to cellular and in some cases, viral transcriptional activator proteins.
[0278] An LTR present, for example, in a construct of the present invention and as a 3′LTR in the provirus of, for example, a target cell of the invention may be a native LTR or a heterologous regulatable LTR. It may also be a transcriptionally quiescent LTR for use in SIN vector technology.
[0279] The term “regulated LTR” also includes an inactive LTR such that the resulting provirus in the target cell can not produce a packagable viral genome (self-inactivating (SIN) vector technology).
[0280] Preferably the regulated retroviral vector of the present invention is a self-inactivating (SIN) vector.
Targeted Vector
[0281] The term “targeted vector” refers to a vector whose ability to infect/transfect/transduce a cell or to be expressed in a host and/or target cell is restricted to certain cell types within the host organism, usually cells having a common or similar phenotype. Preferably the targeted vector comprises a nucleotide sequence of interest (NOI) for delivery to a specific cell type.
Nucleotide Sequence of Interest (NOI)
[0282] With the present invention, the term NOI (i.e. nucleotide sequence of interest) includes any suitable nucleotide sequence, which need not necessarily be a complete naturally occuring DNA sequence. Thus, the DNA sequence can be, for example, a synthetic DNA sequence, a recombinant DNA sequence (i.e. prepared by use of recombinant DNA techniques), a cDNA sequence or a partial genomic DNA sequence, including combinations thereof. The DNA sequence need not be a coding region. If it is a coding region, it need not be an entire coding region. In addition, the DNA sequence can be in a sense orientation or in an anti-sense orientation. Preferably, it is in a sense orientation. Preferably, the DNA is or comprises cDNA.
[0283] The NOI or NOIs may be under the expression control of an expression regulatory element, usually a promoter or a promoter and enhancer. The enhancer and/or promoter may be preferentially active in a hypoxic or ischaemic or low glucose environment, such that the NOI is preferentially expressed in the particular tissues of interest, such as in the environment of a tumour, arthritic joint or other sites of ischaemia. Thus any significant biological effect or deleterious effect of the NOI on the individual being treated may be reduced or eliminated. The enhancer element or other elements conferring regulated expression may be present in multiple copies. Likewise, or in addition, the enhancer and/or promoter may be preferentially active in one or more specific cell types—such as any one or more of macrophages, endothelial cells or combinations thereof. Further examples include include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cess and post-mitotically terminally differentiated non-replicating cells such as macrophages neurons.
NOIs
[0284] In accordance with the present invention, suitable NOI sequences include those that are of therapeutic and/or diagnostic application such as, but are not limited to: sequences encoding cytokines, chemokines, hormones, antibodies, engineered immunoglobulin-like molecules, a single chain antibody, fusion proteins, enzymes, immune co-stimulatory molecules, immunomodulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a tumour suppressor protein and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives therof (such as with an associated reporter group). When included, such coding sequences may be typically operatively linked to a suitable promoter, which may be a promoter driving expression of a ribozyme(s), or a different promoter or promoters, such as in one or more specific cell types.
[0285] Suitable NOIs for use in the invention in the treatment or prophylaxis of cancer include NOIs encoding proteins which: destroy the target cell (for example a ribosomal toxin), act as: tumour suppressors (such as wild-type p53); activators of anti-tumour immune mechanisms (such as cytokines, co-stimulatory molecules and immunoglobulins); inhibitors of angiogenesis; or which provide enhanced drug sensitivity (such as pro-drug activation enzymes); indirectly stimulate destruction of target cell by natural effector cells (for example, strong antigen to stimulate the immune system or convert a precursor substance to a toxic substance which destroys the target cell (for example a prodrug activating enzyme). Encoded proteins could also destroy bystander tumour cells (for example with secreted antitumour antibody-ribosomal toxin fused protein), indirectly stimulated destruction of bystander tumour cells (for example cytokines to stimulate the immune system or procoagulant proteins causing local vascular occlusion) or convert a precursor substance to a toxic substance which destroys bystander tumour cells (eg an enzyme which activates a prodrug to a diffusible drug).
[0286] Also, the delivery of NOI(s) encoding antisense transcripts or ribozymes which interfere with expression of cellular genes for tumour persistence (for example against aberrant myc transcripts in Burkitts lymphoma or against bcr-abl transcripts in chronic myeloid leukemia. The use of combinations of such NOIs is also envisaged.
[0287] Suitable NOIs for use in the treatment or prevention of ischaemic heart disease include NOIs encoding plasminogen activators. Suitable NOIs for the treatment or prevention of rheumatoid arthritis or cerebral malaria include genes encoding anti-inflammatory proteins, antibodies directed against tumour necrosis factor (TNF) alpha, and anti-adhesion molecules (such as antibody molecules or receptors specific for adhesion molecules).
[0288] Examples of hypoxia regulatable therapeutic NOIs can be found in PCT/GB95/00322 (WO-A-9521927).
[0289] The expression products encoded by the NOIs may be proteins which are secreted from the cell. Alternatively the NOI expression products are not secreted and are active within the cell. In either event, it is preferred for the NOI expression product to demonstrate a bystander effector or a distant bystander effect; that is the production of the expression product in one cell leading to the killing of additional, related cells, either neighbouring or distant (e.g. metastatic), which possess a common phenotype.
[0290] The NOI or NOIs of the present invention may also comprise one or more cytokine-encoding NOIs. Suitable cytokines and growth factors include but are not limited to: ApoE, Apo-SAA, BDNF, Cardiotrophin-1, EGF, ENA-78, Eotaxin, Eotaxin-2, Exodus-2, FGF-acidic, FGF-basic, fibroblast growth factor-10 (Marshall 1998 Nature Biotechnology 16: 129) FLT3 ligand (Kimura et al (1997), Fractalkine (CX3C), GDNF, G-CSF, GM-CSF, GF-β1, insulin, IFN-γ, IGF-I, IGF-II, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (72 a.a.), IL-8 (77 a.a.), IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), Inhibin α, Inhibin β, IP-10, keratinocyte growth factor-2 (KGF-2), KGF, Leptin, LIF, Lymphotactin, Mullerian inhibitory substance, monocyte colony inhibitory factor, monocyte attractant protein (Marshall 1998 ibid), M-CSF, MDC (67 a.a.), MDC (69 a.a.), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MDC (67 a.a.), MDC (69 a.a.), MIG, MIP-1α, MIP-1β, MIP-3α, MIP-3β, MIP-4, myeloid progenitor inhibitor factor-1 (MPIF-1), NAP-2, Neurturin, Nerve growth factor, β-NGF, NT-3, NT-4, Oncostatin M, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, RANTES, SDF1α, SDF1β, SCF, SCGF, stem cell factor (SCF), TARC, TGF-α, TGF-β, TGF-β2, TGF-β3, tumour necrosis factor (TNF), TNF-α, TNF-β, TNIL-1, TPO, VEGF, GCP-2, GRO/MGSA, GRO-β, GRO-γ, HCC1, 1-309.
Replication Vectors
[0291] The nucleotide sequences encoding a NOI may be incorporated into a recombinant replicable vector. The vector may be used to replicate the nucleotide sequence in a compatible host cell. Thus in one embodiment of the present invention, the invention provides a method of delivering an NOI by introducing an NOI into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell.
Fusion Protein
[0292] The NOI of the invention may also be produced as fusion proteins, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6×His (SEQ ID NO: 25), GAL4-(DNA binding and/or transcriptional activation domains) and β-galactosidase. Other examples of fusion protein partners include but are not limited to a fused recombinant MKP-1 enzyme protein comprising an antigenic co-protein such as GST, J3-galactosidase or the lipoprotein D from Haemophilus influenzae which are relatively large co-proteins, which solubilize and facilitate production and purification thereof. Alternatively, the fused protein may comprise a carrier protein such as bovine serum albumin (BSA) or keyhole limpet haemocyanin (KLH). In certain embodiments of the present invention, the marker sequence is hexa-histidine peptide, as provided in the pQE vector (Qiagen Inc) and described in Gentz et al (1989 PNAS 86: 821-824). Such fusion proteins are readily expressable in yeast culture (as described in Mitchell et al 1993 Yeast 5: 715-723) and are easily purified by affinity chromatography.
[0293] Other recombinant constructions may join the NOI to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins (Kroll D J et al(1993) DNA Cell Biol 12:441-53). Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals (Porath J (1992) Protein Expr Purif 3- 0.26328 1), protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp, Seattle, Wash.).
[0294] It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences. By way of example, a fusion protein may also be engineered to contain a cleavage site located between the nucleotide sequence encoding the NOI and the heterologous protein sequence, so that the NOI may be cleaved and purified away from the heterologous moiety. The inclusion of a cleavable linker sequence such as Factor XA or enterokinase (Invitrogen, San Diego, Calif.) between the purification domain and the NOI may also be useful to facilitate purification. Preferably the fusion protein will not hinder the activity of the NOI comprising the amino acid sequence of the present invention.
Target Cells
[0295] Target cells transduced by the viral vector of the present invention may be used to express the NOI of the present invention under in vitro, in vivo and ex vivo conditions
[0296] The term “target cell” includes any cell derivable from a suitable organism which a vector is capable of transfecting or transducing. Examples of target cells can include but are not limited to cells capable of expressing the NOI of the present invention under in vitro, in vivo and ex vivo conditions. Examples of such cells include but are not limited to macrophages, endothelial cells or combinations thereof. Further examples include but are not limited to hematopoietic stem cells, lymphocytes, vascular endothelial cells, respiratory epithelial cells, keratinocytes, skeletal and cardiac muscle cells, neurons, cancer cells respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cells and post-mitotically terminally differentiated non-replicating cells such as macrophages and/or neurons.
[0297] In a preferred embodiment, the target cell is a mammalian cell.
[0298] In a highly preferred embodiment, the target cell is a human cell.
[0299] The term “organism” includes any suitable organism. In a preferred embodiment, the organism is a mammal. In a highly preferred embodiment, the organism is a human.
[0300] The present invention also provides a method comprising transforming a host cell (such as a packaging/producer cell) with a NS(s) of the present invention and/or target cell with a viral vector comprising a NOI of the present invention
[0301] The term “transformed cell” means a host cell and/or a target cell having a modified genetic structure. With the present invention, a cell has a modified genetic structure when a vector comprising an NOI according to the present invention has been introduced into the cell.
[0302] Host cells and/or a target cells may be cultured under suitable conditions which allow expression of the NS and/or NOI of the present invention.
[0303] The present invention also provides a method comprising culturing a transformed host cell—which cell has been transformed with one or more NS (s) according to the present invention and/or under conditions suitable for the expression of a POI encoded by an NOI.
Regulation of Expression in Vitro/Vivo/Ex Vivo
[0304] The present invention also encompasses gene delivery using a viral vector whereby the expression of the NOI is regulated in vitro/in vivo/ex vivo. For example, expression regulation may be accomplished by administering compounds that bind to the NOI, or control regions associated with the NOI or its corresponding RNA transcript to modify the rate of transcription or translation.
Control Sequences
[0305] Control sequences operably linked to sequences encoding the NOI include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell and/or target cell in which an expression vector comprising an NS and/or a viral vector comprising an NOI is designed to be used. The control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators.
Operably Linked
[0306] The term “operably linked” means that the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence “operably linked” to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
[0307] Preferably the nucleotide sequence of the present invention is operably linked to a transcription unit.
[0308] The term “transcription unit(s)” as described herein are regions of nucleic acid containing coding sequences and the signals for achieving expression of those coding sequences independently of any other coding sequences. Thus, each transcription unit generally comprises at least a promoter, an optional enhancer and a polyadenylation signal.
Promoters
[0309] The term promoter is well-known in the art and is used in the normal sense of the art, e.g. an RNA polymerase binding site. The term encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.
[0310] The promoter is typically selected from promoters which are functional in mammalian, cells, although prokaryotic promoters and promoters functional in other eukaryotic cells may be used. The promoter is typically derived from promoter sequences of viral or eukaryotic genes. For example, it may be a promoter derived from the genome of a cell in which expression is to occur. With respect to eukaryotic promoters, they may be promoters that function in a ubiquitous manner (such as promoters of α-actin, β-actin, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase).
[0311] Preferably the promoter is a constitutive promoter such as CMV.
[0312] Preferably the promoters of the present invention are tissue specific.
Hypoxic Promoters/Enhancers
[0313] The enhancer and/or promoter may be preferentially active in a hypoxic or ischaemic or low glucose environment, such that an NOI is preferentially expressed in the particular tissues of interest, such as in the environment of a tumour, arthritic joint or other sites of ischaemia. Thus, any significant biological effect or deleterious effect of the expressed NOI on the individual being treated may be reduced or eliminated. The enhancer element or other elements conferring regulated expression may be present in multiple copies. Likewise, or in addition, the enhancer and/or promoter may be preferentially active in one or more specific cell types—such as any one or more of macrophages, endothelial cells or combinations thereof. Further examples may include but are not limited to respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cells and post-mitotically terminally differentiated non-replicating cells such as macrophages and/or neurons.
Tissue-Specific Promoters
[0314] The promoters of the present invention may be tissue-specific promoters. Examples of suitable tissue restricted promoters/enhancers are those which are highly active in tumour cells such as a promoter/enhancer from a MUC1 gene, a CEA gene or a 5T4 antigen gene. Examples of temporally restricted promoters/enhancers are those which are responsive to ischaemia and/or hypoxia, such as hypoxia response elements or the promoter/enhancer of a grp78 or a grp94 gene. The alpha fetoprotein (AFP) promoter is also a tumour-specific promoter. One preferred promoter-enhancer combination is a human cytomegalovirus (hCMV) major immediate early (MIE) promoter/enhancer combination.
[0315] Preferably the promoters of the present invention are tissue specific. That is, they are capable of driving transcription of an NOI (s) in one tissue while remaining largely “silent” in other tissue types.
[0316] The term “tissue specific” means a promoter which is not restricted in activity to a single tissue type but which nevertheless shows selectivity in that they may be active in one group of tissues and less active or silent in another group. A desirable characteristic of the promoters of the present invention is that they possess a relatively low activity in the absence of activated hypoxia-regulated enhancer elements, even in the target tissue. One means of achieving this is to use “silencer” elements which suppress the activity of a selected promoter in the absence of hypoxia.
[0317] The level of expression of an NOI under the control of a particular promoter may be modulated by manipulating the promoter region. For example, different domains within a promoter region may possess different gene regulatory activities. The roles of these different regions are typically assessed using vector constructs having different variants of the promoter with specific regions deleted (that is, deletion analysis). This approach may be used to identify, for example, the smallest region capable of conferring tissue specificity or the smallest region conferring hypoxia sensitivity.
[0318] A number of tissue specific promoters, described above, may be particularly advantageous in practising the present invention. In most instances, these promoters may be isolated as convenient restriction digestion fragments suitable for cloning in a selected vector. Alternatively, promoter fragments may be isolated using the polymerase chain reaction. Cloning of the amplified fragments may be facilitated by incorporating restriction sites at the 5′ end of the primers.
[0319] Preferably the ischaemic responsive promoter is a tissue restricted ischaemic responsive promoter.
[0320] Preferably the tissue restricted ischaemic responsive promoter is a macrophage specific promoter restricted by repression.
[0321] Preferably the tissue restricted ischaemic responsive promoter is an endothelium specific promoter.
[0322] Preferably the tissue restricted ischaemic responsive promoter of the present invention is an ILRE responsive promoter.
[0323] Preferably the vector comprising ILRE responsive promoter is a lentiviral vector.
[0324] Preferably the vector comprising ILRE responsive promoter is an autoregulated hypoxia responsive lentiviral vector.
[0325] Preferably the vector of the present invention is regulated by glucose concentration.
[0326] For example, the glucose-regulated proteins (grp's) such as grp78 and grp94 are highly conserved proteins known to be induced by glucose deprivation (Attenello and Lee 1984 Science 226 187-190). The grp 78 gene is expressed at low levels in most normal healthy tissues under the influence of basal level promoter elements but has at least two critical “stress inducible regulatory elements” upstream of the TATA element (Attenello 1984 ibid; Gazit et al 1995 Cancer Res 55: 1660-1663). Attachment to a truncated 632 base pair sequence of the 5′end of the grp78 promoter confers high inducibility to glucose deprivation on reporter genes in vitro (Gazit et al 1995 ibid). Furthermore, this promoter sequence in retroviral vectors was capable of driving a high level expression of a reporter gene in tumour cells in murine fibrosarcomas, particularly in central relatively ischaemic/fibrotic sites (Gazit et al 1995 ibid).
Inducible Promoters
[0327] The promoters of the present invention may also be promoters that respond to specific stimuli, for example promoters that bind steroid hormone receptors. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE promoter.
[0328] It may also be advantageous for the promoters to be inducible so that the levels of expression of the heterologous gene can be regulated during the life-time of the cell. Inducible means that the levels of expression obtained using the promoter can be regulated.
Enhancer
[0329] In addition, any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences. Chimeric promoters may also be used comprising sequence elements from two or more different promoters described above.
[0330] The term “enhancer” includes a DNA sequence which binds to other protein components of the transcription initiation complex and thus facilitates the initiation of transcription directed by its associated promoter.
[0331] The in vitrol in vivo/ex vivo expression of an NOI may be used in combination with a protein of interest (POI) or a nucleotide sequence of interest (NOI) encoding same.
ILRE
[0332] The term “ischaemia like response element”—otherwise written as ILRE—includes an element that is responsive to or is active under conditions of ischaemia or conditions that are like ischaemia or are caused by ischaemia. By way of example, conditions that are like ischaemia or are caused by ischaemia include hypoxia and/or low glucose concentration(s).
[0333] Ischaemia can be an insufficient supply,of blood to a specific organ or tissue. A consequence of decreased blood supply is an inadequate supply of oxygen to the organ or tissue (hypoxia). Prolonged hypoxia may result in injury to the affected organ or tissue.
[0334] A preferred ILRE is an hypoxia response element (HRE).
HRE
[0335] In one preferred aspect of the present invention, there is hypoxia or ischaemia regulatable expression of the retroviral vector components. In this regard, hypoxia is a powerful regulator of gene expression in a wide range of different cell types and acts by the induction of the activity of hypoxia-inducible transcription factors such as hypoxia inducible factor-1 (HIF-1; Wang & Semenza 1993 Proc Natl Acad Sci 90:430), which bind to cognate DNA recognition sites, the hypoxia-responsive elements (HREs) on various gene promoters. Dachs et al (1997 Nature Med 5: 515) have used a multimeric form of the HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth et al 1994 Proc Natl Acad Sci 91:6496-6500) to control expression of both marker and therapeutic genes by human fibrosarcoma cells in response to hypoxia in vitro and within solid tumours in vivo (Dachs et al ibid).
[0336] Hypoxia response enhancer elements (HREEs) have also been found in association with a number of genes including the erythropoietin (EPO) gene (Madan et al 1993 Proc Natl Acad Sci 90: 3928; Semenza and Wang 1992 Mol Cell Biol 1992 12: 5447-5454). Other HREEs have been isolated from regulatory regions of both the muscle glycolytic enzyme pyrivate kinase (PKM) gene (Takenaka et al 1989 J Biol Chem 264: 2363-2367), the human muscle-specific β-enolase gene (ENO3; Peshavaria and Day 1991 Biochem J 275: 427-433) and the endothelin-1(ET-1) gene (Inoue et al 1989 J Biol Chem 264: 14954-14959).
[0337] Preferably the HRE of the present invention is selected from, for example, the erythropoietin HRE element (HREE1), muscle pyruvate kinase (PKM), HRE element, phosphoglycerate kinase (PGK) HRE, β-enolase (enolase 3; ENO3) HRE element, endothelin-1 (ET-1)HRE element and metallothionein II (MTII) HRE element.
Responsive Element
[0338] Preferably the ILRE is used in combination with a transcriptional regulatory element, such as a promoter, which transcriptional regulatory element is preferably active in one or more selected cell type(s), preferably being only active in one cell type.
[0339] This combination aspect of the present invention is called a responsive element.
[0340] Preferably the responsive element comprises at least the ILRE as herein defined.
[0341] Non-limiting examples of such a responsive element are presented as OBHRE1 and XiaMac. Another non-limiting example includes the ILRE in use in conjunction with an MLV promoter and/or a tissue restricted ischaemic responsive promoter. These responsive elements are disclosed in WO99/15684.
[0342] Other examples of suitable tissue restricted promoters/enhancers are those which are highly active in tumour cells such as a promoter/enhancer from a MUC1 gene, a CEA gene or a 5T4 antigen gene. The alpha fetoprotein (AFP) promoter is also a tumour-specific promoter. One preferred promoter-enhancer combination is a human cytomegalovirus (hCMV) major immediate early (MIE) promoter/enhancer combination.
[0343] In one embodiment of the present invention, preferably the responsive elemtn is an ecdysone response element (see WO 97/38117 and WO 99/58155).
Combination with POIs/NOIs
[0344] The POI or NOI encoding same may be used in combination with a POI, such as a pro-drug activating enzyme either directly or by vector delivery to, for example, a target cell or target such as an ischaemic target tissue. Instead of or as well as being selectively expressed in target tissues, the POI or NOI encoding same may be used in combination with another POI such as a pro-drug activation enzyme or enzymes or with a nucleotide sequences of interest (NOI) or NOIs which encode a pro-drug activation enzyme or enzymes. These pro-drug activation enzyme or enzymes may have no significant effect or no deleterious effect until the individual is treated with one or more pro-drugs upon which the appropriate pro-drug enzyme or enzymes act. In the presence of the active POI or NOI encoding same, treatment of an individual with the appropriate pro-drug may lead to enhanced reduction in the disease condition such as a reduction in tumour growth or survival.
Pro-Drug POIs
[0345] A POI, such as a pro-drug activating enzyme, may be delivered to a disease site, such as a tumour site for the treatment of a cancer. In each case, a suitable pro-drug is used in the treatment of the patient in combination with the appropriate pro-drug activating enzyme. An appropriate pro-drug may be administered in conjunction with the enzyme or vector comprising the nucleotide sequence encoding same. Examples of pro-drugs include: etoposide phosphate (with alkaline phosphatase, Senter et al1988 Proc Natl Acad Sci 85: 4842-4846); 5-fluorocytosine (with cytosine deaminase, Mullen et al1994 Cancer Res 54: 1503-1506); Doxorubicin-N-p-hydroxyphenoxyacetamide (with Penicillin-V-Amidase, Kerr et al1990 Cancer Immunol Immunother 31: 202-206); Para-N-bis(2-chloroethyl) aminobenzoyl glutamate (with carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates (with βb-lactamase); SR4233 (with P450 Reductase); Ganciclovir (with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85: 7572-7576); mustard pro-drugs with nitroreductase (Friedlos et al1997 J Med Chem 40: 1270-1275) and Cyclophosphamide (with P450 Chen et al1996 Cancer Res 56: 1331-1340).
[0346] Examples of suitable pro-drug activation enzymes for use in the invention include a thymidine phosphorylase which activates the 5-fluoro-uracil pro-drugs capcetabine and furtulon; thymidine kinase from Herpes Simplex Virus which activates ganciclovir; a cytochrome P450 which activates a pro-drug such as cyclophosphamide to a DNA damaging agent; and cytosine deaminase which activates 5-fluorocytosine. Preferably, a pro-drug activating enzyme of human origin is used.
POIs and NOIs
[0347] Other suitable proteins of interest (POIs) or NOIs encoding same for use in the present invention include those that are of therapeutic and/or diagnostic application such as, but are not limited to: sequences encoding cytokines, chemokines, hormones, antibodies, engineered immunoglobulin-like molecules, a single chain antibody, fusion proteins, enzymes, immune co-stimulatory molecules, immunomodulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a tumour suppressor protein and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives therof (such as with an associated reporter group). When included, the POIs or NOIs encoding same may be typically operatively linked to a suitable promoter, which may be a promoter driving expression of a ribozyme(s), or a different promoter or promoters, such as in one or more specific cell types.
Cytokines
[0348] In one aspect of the present invention the NOI(s) encodes a POI(s) wherein the POI is a cytokine.
[0349] As used herein, the term “cytokines” refers to any varied group of proteins that are released from mammalian cells and act on other cells through specific receptors. The term “cytokine” is often used interchangeably with the term “mediator”. Cytokines may elicit from the target cell a variety of responses depending on the cytokine and the target cell. By way of example, cytokines may be important in signalling between cells as inflammatory reactions develop. In the initial stages, cytokines such as IL-1 and IL-6 may be released from cells of the tissue where the inflammatory reaction is occurring. Once lymphocytes and mononuclear cells have started to enter the inflammatory site, they may become activated by antigen and release cytokines of their own such as IL-1, TNF, IL-4 and IFNγ which further enhance cellular migration by their actions on the local endothelium. Other cytokines, such as IL-8, are chemotactic or can activate incoming cells. The term “cytokine” includes but is not limited to factors such as cardiotrophin, EGF, FGF-acidic, FGF-basic, flt3 Ligand, G-CSF, GM-CSF, IFN-γ, IGF-I, IGF-II, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), KGF, LIF, M-CSF, Oncostatin M, PDGF-A, PDGF-AB, PDGF-BB, SCF, SCGF, TGF-α, TGF-β1, TNF-α, TNF-β, TPO and VEGF.
Tumour Necrosis Factor (TNF)
[0350] Preferably the POI is TNF.
[0351] As used herein, the term “tumour necrosis factor (TNF) refers to either of two structurally and functionally related proteins. These are TNF-α (also known as cachectin) and TNF-β (also known as lymphotoxin) TNF-α is producted mainly by monocytes and macrophages, whereas TNF-β is produced by lymphoid cells. The two proteins are about 30% homologous at the amino-acid level, and bind to the same cell surface receptors; both exist as homotrimers. Both TNF-α (cachectin) and TNF-β (lymphotoxin) were originally thought of as selective antitumour agents, but are now known to have a multiplicity of actions. In binding to their receptors, present on virtually all cells examined, they activate a large array of cellular genes and also multiple signal-transduction pathways, kinases, and transcription factors. Their genes are single-copy genes, closely linked within the MHC cluster.
Tumour Necrosis Factor α (TNF-α)
[0352] Preferably the POI is TNF-α.
[0353] As used herein, the term tumour necrosis factor α (TNF-α) (also known as cachectin) refers to a cytokine that is produced by macrophages, monocytes, endothelial cells, neutrophils, smooth muscle cells, activated lymphocytes, and astrocytes. It is a transmembrane glycoprotein and cytotoxin with a variety of functions, including the ability to mediate the expression of genes for growth factors, cytokines, transcription factors, and receptors. It can cause cytolysis of certain tumour cell lines, it has been implicated in the induction of cachexia (which is a condition caused by chronic disease, such as cancer), it is a potent pyrogen, causing fever by direct action or by stimulation of interleukin 1 secretion, and it can stimulate cell proliferation and induce cell differentiation under certain conditions. The molecule is a homotrimer. Inflammatory stimulators such as TNF-α also cause a rapid (<1 hour) inhibition of chemotactic migration of monocytes with similar kinetics to hypoxia. TNF-α increases HIF-1 binding to DNA and TNF-α is hypoxia-responsive in many cell types, including macrophages.
Chemokines
[0354] In one aspect of the present invention the POI is a chemokine
[0355] As used herein, the term “chemokine” (also known as intercrine) refers to any of a superfamily of soluble proteins implicated in a wide range of acute and inflammatory processes and other immunoregulatory functions. The chemokines may related by primary structure, especially conservation of a motif of four cysteines, the first two of which are either adjacent of separated by one other residue. As used herein, the term “chemokines” includes a group of at least 18 heparin-binding molecules, including IL-8, which are released at inflammatory sites. These chemokines act via a group of three receptors (so far identified) that are expressed on different leucocyte populations (see Immunology 1996 4th Ed Roitt Brostoff and Male, Mosby publishers, page Chapter 14, page 14.7). Some of the chemokines act selectively on particular populations of leucocytes. Some of the chemokines can activate cells, some are primarily chemotactic, some have both functions. Several inflammatory mediators may be chemotactic. By way of example, several molecules are chemotactic for neutrophils and macrophages. These molecules include C5a, f.Met-Leu-Phe, LTB4 which act on neutrophils, eosinophils and macrophages (see FIG. 14. 12 Immunology 1996 4th Ed Roitt Brostoff and Male, Mosby publishers, page Chapter 14, page 14.7). Other chemokines, such as IL-8, macrophage inflammatory protein alpha (MIP-α), inflammatory protein beta (MIP-β) and RANTES which have selective actions on different leucocyte populations. In this respect, the term “chemokines” includes but is not limited to factors such as ENA-78, Eotaxin, Eotaxin-2, Exodus-2, Fractalkine (CX3C), GCP-2, GRO/MGSA, GRO-β, GRO-γ, HCC1, 1-309, IL-8 (72 a.a.), IL-8 (77 a.a.), IP-10, Lymphotactin, MDC (67 a.a.), MDC (69a.a.), MCP-1 (MCAF), Human MCP-2, MCP-3, MCP-4, MDC (67 a.a.), MDC (69 a.a.), MIG, MIP-1α, MIP-1β, MIP-3α, MIP-3β, Human MIP-4, NAP-2, PF-4, RANTES, SDF1α, SDF1α, TARC, C-10, Eotaxin, Exodus-2, JE (MCP-1), KC, MCP-3, MCP-5, MIP-1α, MIP-1γ, RANTES, GROβ/MIP-2 and MCP-1(MCAF).
Bystander Effect
[0356] The POI and/or NOI encoding same may be proteins which are secreted from a cell. Alternatively the POI expression products are not secreted and are active within the cell. In either event, it is preferred for the POI expression product to demonstrate a bystander effector or a distant bystander effect; that is the production of the expression product in one cell leading to the killing of additional, related cells, either neighbouring or distant (e.g. metastatic), which possess a common phenotype.
[0357] Suitable POIs or NOIs encoding same for use in the present invention in the treatment or prophylaxis of cancer include proteins which: destroy the target cell (for example a ribosomal toxin), act as: tumour suppressors (such as wild-type p53); activators of anti-tumour immune mechanisms (such as cytokines, co-stimulatory molecules and immunoglobulins); inhibitors of angiogenesis; or which provide enhanced drug sensitivity (such as pro-drug activation enzymes); indirectly stimulate destruction of target cell by natural effector cells (for example, strong antigen to stimulate the immune system or convert a precursor substance to a toxic substance which destroys the target cell (for example a prodrug activating enzyme). Encoded proteins could also destroy bystander tumour cells (for example with secreted antitumour antibody-ribosomal toxin fusion protein), indirectly stimulate destruction of bystander tumour cells (for example cytokines to stimulate the immune system or procoagulant proteins causing local vascular occlusion) or convert a precursor substance to a toxic substance which destroys bystander tumour cells (eg an enzyme which activates a prodrug to a diffusible drug).
[0358] Also, the delivery of NOI(s) encoding antisense transcripts or ribozymes which interfere with expression of cellular genes for tumour persistence (for example against aberrant myc transcripts in Burkitts lymphoma or against bcr-abl transcripts in chronic myeloid leukemia. The use of combinations of such POIs and/or NOIs encoding same is also envisaged.
[0359] Examples of hypoxia regulatable therapeutic NOIs can be found in PCT/GB95/00322 (WO-A-95/21927).
Pharmaceutical Compositions
[0360] In one aspect, the present invention provides a pharmaceutical composition, which comprises a viral vector according to the present invention and optionally a pharmaceutically acceptable carrier, diluent or excipient (including combinations thereof).
[0361] The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as—or in addition to—the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).
[0362] Preservatives, stabilizers, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.
[0363] There may be different composition/formulation requirements dependent on the different delivery systems. By way of example, the pharmaceutical composition of the present invention may be formulated to be delivered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route. Alternatively, the formulation may be designed to be delivered by both routes.
[0364] Where the pharmaceutical composition is to be delivered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.
[0365] Where appropriate, the pharmaceutical compositions can be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose or chalk, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
Administration
[0366] The invention further provides a method of preventing and/or treating a disorder, such as a cancer disorder in an individual, the method comprising, for example, administering to an individual an viral vector and/or pharmaceutical composition comprising same to a target site.
[0367] As used herein, the term “administered” includes but is not limited to delivery by a mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestable solution such as by an oral route, or by a parenteral route where delivery is by an injectable form, such as, for example, by a rectal, ophthalmic (including intravitreal or intracameral), nasal, topical (including buccal and sublingual), intrauterine, vaginal or parenteral (including subcutaneous, intraperitoneal, intramuscular, intravenous, intradermal, intracranial, intratracheal, and epidural) transdermal, intraperitoneal, intracranial, intracerebroventricular, intracerebral, intravaginal, intrauterine, or parenteral (e.g., intravenous, intraspinal, intracavemosal, subcutaneous, transdermal or intramuscular) route.
[0368] The viral vector and/or pharmaceutical composition comprising same of the present invention may be administered alone but will generally be administered in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
[0369] For example, the viral vector and/or pharmaceutical composition or modified monocyte/macrophage comprising same can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
[0370] The tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
[0371] Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the agent may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
[0372] The viral vector and/or pharmaceutical composition comprising same can also be administered parenterally, for example, intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrasternally, intracranially, intramuscularly or subcutaneously, or it may be administered by infusion techniques. For such parenteral administration it is best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.
[0373] Thus tablets or capsules of the viral vector and/or pharmaceutical composition or comprising same may contain active compound for administration singly or two or more at a time, as appropriate. The physician in any event will determine the actual dosage which will be most suitable for any individual patient and it will vary with the age, weight and response of the particular patient. The above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention. The skilled person will appreciate that, in the treatment of certain conditions the agent may be taken as a single dose as needed or desired.
[0374] The viral vector and/or pharmaceutical composition or modified monocyte/macrophage comprising same of the present invention can also be administered intranasally or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134A [trade mark]) or 1,1,1,2,3,3,3-heptafluoropropane (HFA 227EA [trade mark]), carbon dioxide or other suitable gas. In the case of a pressurised aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. The pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate. Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of the agent and a suitable powder base such as lactose or starch.
[0375] Alternatively, the viral vector and/or pharmaceutical composition comprising same of the present invention can be administered in the form of a suppository or pessary, or it may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder. The viral vector and/or pharmaceutical composition comprising same of the present invention may also be dermally or transdermally administered, for example, by the use of a skin patch. They may also be administered by the pulmonary or rectal routes. They may also be administered by the ocular route. For ophthalmic use, the compounds can be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.
[0376] For application topically to the skin, the agent of the present invention can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, it can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
Individual
[0377] As used herein, the term “individual” refers to vertebrates, particularly members of the mammalian species, more in particular, humans.
Treatment
[0378] It is to be appreciated that all references herein to treatment include curative, polliative and prophylactic treatment.
Combination Therapy
[0379] The viral vector and/or pharmaceutical composition comprising same may be administered alone or in combination for the treatment of a disorder, such as a disorder associated with hypoxia and/or inflammation.
[0380] By way of further example, the viral vector and/or pharmaceutical composition may be administered with another agent, such as an NOI at the same moment in time and at the same site. Alternatively, viral vector and/or pharmaceutical composition comprising same may be delivered at a different time and to a different site. In one embodiment, the viral vector and/or pharmaceutical composition comprising same may even be delivered in the same delivery vehicle for the prevention and/or treatment of a disorder associated with hypoxia and/or inflammation.
[0381] Preferably the viral vector and/or pharmaceutical composition comprising same is/are administered simultaneously, separately or sequentially.
Dosage
[0382] The dosage of the viral vector and/or pharmaceutical composition comprising same of the present invention will depend on the disease state or condition being treated and other clinical factors such as weight and condition of the individual and the route of administration of the compound. Depending upon the half-life of the viral vector in the particular individual, the viral vector and/or pharmaceutical composition comprising same can be administered between several times per day to once a week. It is to be understood that the present invention has application for both human and veterinary use. The methods of the present invention contemplate single as well as multiple administrations, given either simultaneously or over an extended period of time.
[0383] Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular patient and severity of the condition. The dosages below are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited.
[0384] In addition or in the alternative the compositions (or component parts thereof) of the present invention may be administered by direct injection. In addition or in the alternative the compositions (or component parts thereof) of the present invention may be administered topically. In addition or in the alternative the compositions (or component parts thereof) of the present invention may be administered by inhalation. In addition or in the alternative the compositions (or component parts thereof) of the present invention may also be administered by one or more of: a mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestable solution such as by an oral route, or by a parenteral route where delivery is by an injectable form, such as, for example, by a rectal, ophthalmic (including intravitreal or intracameral), nasal, topical (including buccal and sublingual), intrauterine, vaginal or parenteral (including subcutaneous, intraperitoneal, intramuscular, intravenous, intradermal, intracranial, intratracheal, and epidural) transdermal, intraperitoneal, intracranial, intracerebroventricular, intracerebral, intravaginal, intrauterine, or parenteral (e.g., intravenous, intraspinal, intracavemosal, subcutaneous, transdermal or intramuscular) route.
[0385] By way of further example, the pharmaceutical composition of the present invention may be administered in accordance with a regimen of 1 to 10 times per day, such as once or twice per day. The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy.
Disorders
[0386] The present invention is believed to have a wide therapeutic applicability—depending on inter alia the selection of the one or more NOIs.
[0387] For example, the present invention may be useful in the treatment of the disorders listed in WO-A-98/05635. For ease of reference, part of that list is now provided: cancer, inflammation or inflammatory disease, dermatological disorders, fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, HIV infection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion injury, meningitis, migraine and aspirin-dependent anti-thrombosis; tumour growth, invasion and spread, angiogenesis, metastases, malignant, ascites and malignant pleural effusion; cerebral ischaemia, ischaemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis; psoriasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal ulceration, retinopathy and surgical wound healing; rhinitis, allergic conjunctivitis, eczema, anaphylaxis; restenosis, congestive heart failure, endometriosis, atherosclerosis or endosclerosis.
[0388] In addition, or in the alternative, the present invention may be useful in the treatment of disorders listed in WO-A-98/07859. For ease of reference, part of that list is now provided: cytokine and cell proliferation/differentiation activity; immunosuppressant or immunostimulant activity (e.g. for treating immune deficiency, including infection with human immune deficiency virus; regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity); regulation of haematopoiesis, e.g. treatment of myeloid or lymphoid diseases; promoting growth of bone, cartilage, tendon, ligament and nerve tissue, e.g. for healing wounds, treatment of bums, ulcers and periodontal disease and neurodegeneration; inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g. for treating haemophilia and stroke); antiinflammatory activity (for treating e.g. septic shock or Crohn's disease); as antimicrobials; modulators of e.g. metabolism or behaviour; as analgesics; treating specific deficiency disorders; in treatment of e.g. psoriasis, in human or veterinary medicine.
[0389] In addition, or in the alternative, the present invention may be useful in the treatment of disorders listed in WO-A-98/09985. For ease of reference, part of that list is now provided: macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity; anti-immune activity, i.e. inhibitory effects against a cellular and/or humoral immune response, including a response not associated with inflammation; inhibit the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction and inflammation including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urologic diseases, otitis or other oto-rhino-laryngological diseases, dermatitis or other dermal diseases, periodontal diseases or other dental diseases, orchitis or epididimo-orchitis, infertility, orchidal trauma or other immune-related testicular diseases, placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia and other immune and/or inflammatory-related gynaecological diseases, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, intraocular inflammation, e.g. retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g. following glaucoma filtration operation, immune and/or inflammation reaction against ocular implants and other immune and inflammatory-related ophthalmic diseases, inflammation associated with autoimmune diseases or conditions or disorders where, both in the central nervous system (CNS) or in any other organ, immune and/or inflammation suppression would be beneficial, Parkinson's disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, inflammatory components of stokes, post-polio syndrome, immune and inflammatory components of psychiatric disorders, myelitis, encephalitis, subacute sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham chora, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS trauma or infections of the CNS, inflammatory components of muscular atrophies and dystrophies, and immune and inflammatory related diseases, conditions or disorders of the central and peripheral nervous systems, post-traumatic inflammation, septic shock, infectious diseases, inflammatory complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, inflammatory and/or immune complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or inflammation associated with AIDS, to suppress or inhibit a humoral and/or cellular immune response, to treat or ameliorate monocyte or leukocyte proliferative diseases, e.g. leukaemia, by reducing the amount of monocytes or lymphocytes, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
EXAMPLES
[0390] The invention will now be further described only by way of example in which reference is made to the following Figures:
[0391] FIG. 1A which shows a graphical representation;
[0392] FIG. 1B which shows a graphical representation;
[0393] FIG. 2 which shows a schematic representation;
[0394] FIG. 3 which provides a sequence listing;
[0395] FIG. 4 which shows a schematic representation;
[0396] FIG. 5 which provides a sequence listing;
[0397] FIG. 6 which shows a schematic representation;
[0398] FIG. 7 which provides a sequence listing;
[0399] FIG. 8 which shows a schematic representation;
[0400] FIG. 9 which provides a sequence listing;
[0401] FIG. 10 which shows a schematic representation;
[0402] FIG. 11 which provides a sequence listing;
[0403] FIG. 12A which shows a graphical representation;
[0404] FIG. 12B which shows a graphical representation;
[0405] FIG. 13 which shows a graphical representation;
[0406] FIG. 14 which shows a schematic representation;
[0407] FIG. 15 which provides a sequence listing;
[0408] FIG. 16 which shows a photographic representation;
[0409] FIG. 17 which shows a schematic representation;
[0410] FIG. 18 which provides a sequence listing;
[0411] FIG. 19 which shows a schematic representation;
[0412] FIG. 20 which provides a sequence listing;
[0413] FIG. 21 which provides a sequence listing;
[0414] FIG. 22 which shows a comparison of sequence listings;
[0415] FIG. 23A which shows a schematic representation;
[0416] FIG. 23B which provides a sequence listing
[0417] FIG. 24 which shows a graphical representation;
[0418] FIG. 25A which shows a graphical representation;
[0419] FIG. 25B which shows a photographic representation;
[0420] FIG. 26 which shows a photographic representation;
[0421] FIG. 27 which shows a schematic representation and a graphical representation;
[0422] FIG. 28 which shows a schematic representation;
[0423] FIG. 29 which shows a schematic representation;
[0424] FIG. 30 provides a primer sequence listing;
[0425] FIG. 31 provides a plasmid map;
[0426] FIG. 32 provides a plasmid map; and
[0427] FIG. 33 provides a sequence listing.
EXAMPLES
Example 1
Identification of Clonal Cell Lines for Efficient EIAV Vector Production.
[0428] EIAV packaging cells were derived following a series of steps in which clonal cell lines were derived and tested for various properties desirable in a vector production system. As a starting point, a library of 105 clonal HEK 293-based cell lines was tested for high transfection efficiency and efficient vector production. To do this, a three-plasmid system was used to generate EIAV vectors in each clonal cell line. This consisted of the following:
-
- [0429] 1) A non-infectious EIAV protein expression cassette plasmid, pEV53 (WO 98/51810), used to provide, in trans, the structural and regulatory proteins required for vector production;
- [0430] 2) The plasmid encoding the EIAV vector, in which a CMV promoter drove production of the vector RNA. The vector RNA contained cis-acting elements required for packaging, reverse transcription and integration of the vector as well as either cassettes for expression of either a lacZ reporter gene, which encodes β-galactosidase (pEC-lacZ; WO 98/51810), or a puromycin resistance marker (pEC-puro; WO 98/51810); and
- [0431] 3) A third expression plasmid, pCI-VSV-G, encoding the vesicular stomatitis virus G protein (VSV-G) used to supply envelope for pseudotyping the viral particles (Johnson L G, Mewshaw J P, Ni H, Friedmann T, Boucher R C, Olsen J C. J. Virol., (1998), 72, 8861-8872. and WO 98/51810).
[0432] Transducing vectors encoding β-galactosidase were used for initial screening of the HEK 293-derived cell lines for both estimation of transfection efficiency and for rapid assessment of vector production. Transfection was carried out by the calcium phosphate method. In these studies the transfected cell clones were stained for β-galactosidase expression upon harvesting vector. Vector was then used for transduction of D-17 canine osteosarcoma cells, which were stained for β-galactosidase expression 48 hours after transduction. All of the cell lines showed reasonably good transfection efficiency (>70%), however, some clones, for example, clones 6, 16, and 101 demonstrated superior transfection ability (>98%). By contrast to transfection ability, a marked variability in EIAV vector production was observed for the various cell lines. Almost 60% of the cell lines (62/105) did not produce a significant vector titer (<10 infectious vector particles/ml). This lack of vector production was specific to EIAV vectors, since all of the cell lines produced MuLV vectors with titers greater than 105 infectious vector particles/ml, using an analogous 3-plasmid vector system. The MuLV vector system plasmids were pCI-GPZ and pHIT-SIN2000-CZ, which are the Gag/Pol and vector genome expression plasmids, respectively. pHIT-SIN2000-CZ was derived from pHIT-SIN (Wilcox D A, Olsen J C, Ishizawa L, Griffith M, White G C, 2nd. Proc Natl Acad Sci U S A 1999;96(17):9654-9]. This vector is an empty cloning vector, and was modified to have a unique NotI site in the multiple cloning site region. Then the EcoRI-NotI sequence, containing the CMV promoter-lacZ cassette from pECG3-CZR was cloned into the unique EcoRI-NotI sites of HIT-SIN2000-CZ in a two step procedure, in which the CMV promoter was transferred first and then the lacZ gene.
[0433] Cell lines that were positive for EIAV vector production were tested in a second round of screening that included testing for the affects of sodium butyrate on vector production. We previously showed that sodium butyrate can have marked effects on retroviral vector production, both in transient producer systems and from clonal producer cell lines [Olsen J C and Sechelski J (1995) Use of sodium butyrate to enhance production of retroviral vectors expressing CFTR cDNA. Human Gene Therapy 6: 1195-1202; and Soneoka Y, Cannon P M, Ramsdale E E, Griffiths J C, Romano G, Kingsman S M, Kingsman A J (1995) A transient three-plasmid system for the production of high titer retroviral vectors. Nucleic Acids Research 23: 628-633]. In contrast, other researchers (such as Kiges et al Molecular Therapy 2000, 2(2), 170-176) have noted that the addition of sodium butyrate, was neither required or beneficial for the full induction of the LVG clones of a HEK 293 cell line.
[0434] Kafri et al (1999) (J Virol 73(1); 576-584) also provides teachings relating to the production of a tetracycline-inducible VSV-G pseudotyped lentivirus packaging cell line using sodium butyrate. However, Kafri et al teaches that: all HIV genes are transcribed in the cell line from a single expression cassette which is regulated by tetracycline whereas the present invention provides only an env gene which is regulated by a tetracycline inducible system and optionally a tetracycline responsive element in the retroviral genome. Moreover, the present invention provides the advantageous feature of full activation of genes under the control of the tetracycline-responsive element (TRE) in the presence of initial stimulus with sodium butyrate. This is different to the performance of the tetracycline system in other situations. By way of example, the continuous production of proteins in the Kafri et al (1999) vector production system requires a continual and sustained stimulus with sodium butyrate and doxycycline whereas the vector production system of the present invention only requires an initial stimulus with sodium butyrate or a functional analogue thereof.
Results I
[0435] FIG. 1A shows the variation in the titres of vector produced by various clones and also the variable effect of sodium butyrate treatment on vector production by different cell clones. For example, sodium butyrate had no effect on production of the puromycin-containing vector in cell clone 34. In contrast, vector production was increased in clone 101 cells approximately 20-fold, to titers greater than 2×105 colony forming units (CFU)/ml.
[0436] FIG. 1B shows the induction profile for EIAV and MuLV vector production from two clonal cell lines. Both clone 16 and clone 101 cells produce MuLV vectors with titers greater than 5×106 infectious units per ml after sodium butyrate treatment. EIAV production is nearly as efficient as MuLV production in clone 101 cells. In clone 16 cells, EIAV vector production was barely detectable.
Discussion I
[0437] Collectively, these results illustrate the variability in EIAV vector production, even among clonal sublines derived from a single, parental cell line (HEK 293), and emphasize the importance of a careful selection procedure for choosing the optimal cell line for making vector producers.
Example 2
[0438] Construction of stable packaging cell lines
[0439] Human cell lines modified to express EIAV gag/pol
[0440] The clonal 101 cell line described above was chosen as the starting material for making stable producer lines, and termed 293.101. This cell line was transfected using a standard calcium phosphate procedure with the EIAV gag-pol expression cassette pEV53B.
[0441] pEV53B is similar to pEV53A (WO 98/51810) except that all EIAV leader sequences up to 3 nt upstream of the major splice donor have been removed. To construct pEV53B the gag gene and part of pol was amplified from pEV53 by PCR using the primers
[0442]
| (SEQ ID NO: 18) | |
| 5′-TTTGGCGCGCCAGGTAAGATGGGAGACCCTTTGAC-3′ | (forward) |
| and | |
| (SEQ ID NO: 19) | |
| 5′-CTACTTGATCCTTCTCCTTGAC-3′. | (reverse) |
[0443] An AscI restriction site (underlined) was included in the forward primer for cloning purposes. The ATG start codon for gag in the forward primer is indicated in bold and EIAV sequences are shown in italic for the forward primer. The resulting 1.4 kb PCR product was digested with AscI and BsrGI and cloned into AscI-BsrGI digested pEV53A. This resulted in pEV53B (FIGS. 2 and 3). Sequence analysis was used to verify that the gag-pol sequences amplified by PCR were correct.
[0444] The cells were selected for G418 (Geneticin) resistance. Individual colonies were selected, expanded, and tested for expression of EIAV Gag/Pol by release of particle-associated reverse transcriptase activity, and the ability to complement viral vector production after transfection with pECG3-CZR (FIGS. 4 and 5 ) and pCI-VSV-G, which are expression plasmids for an EIAV vector and VSV-G. pECG3-CZR was derived from pEC-LacZ by 1) reduction of gag sequences so that only the first 200 nt of gag, rather than the first 577nt, was included and 2) inclusion of the two sequences shown to have RRE activity (Martarano L, Stephens R, Rice N, Derse D J Virol 1994 May;68(5):3102-11). The RRE sequences were included in the vector as a fusion of the two regions shown to have RRE activity, placed downstream of the reporter gene. The EIAV sequences were nt 5303-5746 and 6477-7684 with respect to pER2.1 (Acc. No. M87581).
[0445] Clonal packaging cells showing the greatest activity were frozen or maintained for analysis of persistence of packaging activity. Altogether 245 colonies were initially screened. Cell derived from eight of the colonies were chosen to assess persistence of packaging activity and reanalyzed. One particular clone, B-241, showed stable packaging activity for at least three months.
Generation of VSV-G Pseudotyping EIAV Packaging Cells.
[0446] The B-241 cell line was stably modified to express VSV-G under regulation by the tetracycline repressor. This was done by co-transfection of a plasmid expressing VSV-G under transcriptional control of a doxycycline regulatable CMV promoter (pTOG) and a plasmid expressing the tetracycline repressor (pcDNA6/TR; Invitrogen). Doxycycline is an analogue of tetracycline. pTOG is a derivative of pcDNA4/TO (Invitrogen) in which a HindIII-NotI fragment from pCI-VSV-G containing the VSV-G gene was cloned into the HindIII-NotI site. For construction of B-241 derivatives capable of inducibly expressing VSV-G, pTOG was co-transfected with pcDNA6/TR at a ratio of 1:7. Prior to transfection both plasmids were linearised with BstZ17 I. These plasmids also expressed zeocin and blasticidin drug selection markers, respectively. Cells were placed under dual selection with blasticidin and zeocin. Drug resistant colonies were expanded and 60 colonies were tested for the ability to complement viral vector production following transfection of the EIAV vector plasmid, pECG3-CZR. Six clonal cell lines were chosen for further comparison, and one of these cell lines, BiG-45, was chosen for all further studies.
Modification of EIAV Packaging Cells to Make an EIAV Vector, Producer Cell
[0447] To generate stable cell lines containing EIAV gene transfer vectors, BiG-45 cells were co-transfected with an EIAV vector plasmid encoding a β-galactosidase or GFP reporter gene and a plasmid encoding a puromycin selection marker. Clonal cell lines were expanded and tested for vector production following a 24 hour treatment with 10 mM sodium butyrate and 1.5 μg/ml doxycycline. The vector genome plasmids used were pONY8.0 Z, pECG3-CZW and pONY8 G.
[0448] The titres obtained were assessed on D17 or HEK 293T cells and are shown in Table 1.
Table 1. The Titers of Vectors Produced from Stable Packaging Cell Lines Producing EIAV Vectors.
[0449]
| TABLE 1 | ||
|---|---|---|
| Transduction efficiency of VSV-G pseudotyped EIAV vectors produced | ||
| by clonal producer cells derived from BiG-45 cells | ||
| Vector (reporter gene) | Titer‡, TU/ml (Cell line) | |
| pONY8.0Z (lacZ), clone 20 | 8 × 105 (D17) | |
| 3 × 106 (293T) | ||
| G3-CZW (lacZ), clone 9 | 5 × 105 (D17) | |
| pONY8G (GFP), clone 72 | 3 × 105 (D17) | |
| ‡Canine D17 osteosarcoma cells or human HEK 293T cells were analyzed for expression of reporter genes 48 hr after transduction. Titers of vectors containing lacZ (pONY8.0Z and G3-CZW) were determined by counting fixed/X-Gal-stained cells in suspension. Titers of pONY8G were determined by FACS analysis of GFP-expressing cells. TU, transducing units. | ||
[0450] pONY8.0 Z (FIGS. 6 and 7 ) was derived from pONY4.0 Z (W099/32646) by introducing mutations which:
-
- [0451] 1) prevented expression of Tat by an 83 nt deletion in the exon 2 of tat
- [0452] 2) prevented S2 ORF expression by a 5lnt deletion in S2
- [0453] 3) prevented Rev expression by deletion of a single base within exon 1 of rev and
- [0454] 4) prevented expression of the N-terminal portion of gag by insertion of T in ATG start codons, thereby changing the sequence to ATTG from ATG.
[0455] With respect to the wild type EIAV sequence Acc. No. U01 866 these correspond to deletion of nt 5234-5316 inclusive, nt 5346-5396 inclusive and nt 5538. The insertion of T residues was after nt 526 and 543.
[0456] pECG3-CZW (FIGS. 8 and 9 ) was derived from pECG3-CZR by replacement of the DNA fragment corresponding to the EIAV RRE, excised by digestion with NotI and ClaI, with a fragment containing the woodchuck hepatitis virus post-transcriptional regulatory element (WHV PRE) (corresponding to nt 901-1800 of Acc. No. J04514). The fragment containing the WHV PRE was made by PCR using primers containing NotI and ClaI to assist placement into the EIAV vector genome. pECG3-CZ was derived from pEC-LacZ by reduction of the amount of gag sequence as described previously for pECG3-CZR. pONY8G (FIGS. 10 and 11 ) was derived from pONY8.0 Z by exchange of the LacZ reporter gene for the enhanced green fluorescent protein (GFP) gene. This was done by transferring the SacII-KpnI fragment corresponding to the GFP gene and flanking sequences from pONY2.13GFP (WO/9932646) into pONY8.0 Z cut with the same enzymes.
Example 3
Induction of EIAV Gag/Pol Expression by Sodium Butyrate and Doxycycline
[0457] FIG. 12 shows the expression of EIAV gag/pol from a wild type open reading frame in BiG-45 cells and the induction obtained following treatment with sodium butyrate and doxycycline. In these experiments a clonal derivative of BiG-45 cells (clone 8Z.20; 5×106 cells/60-mm dish) expressing pONY8.0 Z was treated with 10 mM sodium butyrate and/or 1.5 μg/ml doxycycline for 24 hr at 37° C.
Results 3
Panel A
[0458] Panel A shows the reverse transcriptase activity appearing in the cell-free supernatant as a measure of reverse transcriptase activity. It shows that sodium butyrate treatment has a significant effect on gag/pol expression, as measured by reverse transcriptase activity appearing in the medium. Also indicated are the fold-induction in reverse-transcriptase activity relative to that observed when no treatments were given. Virion associated reverse transcriptase activity was increased about 30-fold. Doxycycline treatment alone had little effect on reverse transcriptase activity, as expected.
Panel B
[0459] Panel B shows the synergistic effect of sodium butyrate and doxycycline on production of the pONY8.0Z vector from the 8Z.20 cell line. In this experiment cell-free supernatant containing the vector used to obtain the data shown in Panel A was titered on D17 cells. This revealed that without induction, or with sodium butyrate treatment alone, <1 transducing vector particle was produced per ml of medium. Doxycycline treatment resulted in a titer of 1.4×104 transducing units (TU)/ml. However, with both sodium butyrate and doxycycline treatment, a titer of 4.3×105 TU/ml was achieved. This is 31-fold higher than doxycycline treatment alone and greater than 105 higher than with sodium butyrate treatment alone. The synergistic effect between doxycycline and sodium butyrate was a suprising result.
[0460] These results demonstrate that in the uninduced state virtually no vector particles were formed. Therefore the problems associated with self transduction of the producer cell line, leading to an uncontrolled increase in the number of vector genomes present, are effectively eliminated. This is an important feature of the system since it allows production of genetically stable producer cell lines, which is desirable from a manufacturing and regulatory point of view.
Example 4
Maintenance of Virus Production does not Require Sodium Butyrate
[0461] FIG. 13 shows that, once vector production has been induced by treatment with sodium butyrate and doxycycline for 24 hours, sodium butyrate can be removed from the culture medium and vector production can be maintained for at least five days. More specifically, vector production is maintained by doxycycline atone. This feature of the producer system is advantageous because sodium butyrate is a toxic compound causing cell cycle arrest and thus is an important compound to remove from vector preparations.
[0462] In this experiment production of pONY8.0 Z by the 8Z.20 cells was induced by treatment for 24 hours with 10 mM sodium butyrate and 1.5 μg/ml doxycycline. The medium was changed daily and replaced with regular cell growth medium containing only 1.5 μg/ml doxycycline. The results in FIG. 13 indicate that a reasonably steady level of virus production (range 4.3×105 TU/ml to 7.4×105 TU ml) occurred over a five-day period.
Example 5
Expression of EIAV from Codon-optimized ORF
[0463] The sequence of the gag-pol gene of EIAV was altered so that the codon-usage was that of a highly expressed mammalian gene. This process is referred to as codon optimisation. The codon optimised gag-pol was subcloned into the expression vector pCI-neo (Promega) and called pESYNGP (FIGS. 14 and 15). The codon-optimisation process is elaborated in GB Application 0009760.0.
[0464] The expression of Gag/Pol from the codon-optimised gene was assessed with respect to that from various wild type EIAV gag/pol expression constructs by transient transfection of HEK 293T cells (FIG. 16). Transfections were carried out using the calcium phosphate technique, using equal moles of each Gag/Pol expression plasmid together with a plasmid which expressed EIAV Rev either from the wild type sequence or from a codon-optimised version of the gene (pCIneoEREV (FIGS. 17 and 18 ) or pESYNREV (FIGS. 19 and 20), respectively). In transfections in which a Rev expression plasmid was omitted, a similar mass of pCIneo (Promega) was used instead (lanes labelled pCIneo). Cytoplasmic extracts were prepared 48 hours post transfection and 15 μg amounts of protein were fractionated by SDS-PAGE and then transferred to Hybond ECL. The Western blot was probed with a polyclonal antisera from an EIAV-infected horse and then with a secondary antibody, anti-horse, horse-radish peroxidase conjugate. Development of the blot was carried out using the ECL kit (Amersham). Positive controls for the blotting and development procedure, and cytoplasmic extract from untransfected HEK 293T cells are as indicated. The positions of various EIAV proteins are indicated.
[0465] Expression from wild type .gag/pol was achieved from various plasmids. pONY3.2T is a derivative of pONY3.1 (W099/32646)(FIG. 21 ) in which mutations which ablate expression of Tat and 52 have been made. In addition, the EIAV sequence is truncated downstream of the second exon of rev. Specifically, expression of Tat is ablated by an 83 nt deletion in exon 2 of tat which corresponds with respect to the wild type EIAV sequence, Acc. No. U01866, to deletion of nt 5234-5316 inclusive. S2 ORF expression is ablated by a 51 nt deletion, corresponding to nt 5346-5396 of Acc. No. U01866. The EIAV sequence is deleted downstream of a position corresponding to nt 7815 of Acc. No. U01866. These alterations do not alter rev, hence this gene is expressed as for pONY3.1. 3.2 OPTI is a derivative of pONY3.1, and has the same deletions for ablation of Tat and S2 expression as described above. In addition, the first 372 nt of gag have been ‘codon-optimised’ for expression in human cells. The sequence of the wild type and codon-optimised sequences in this region are compared in FIG. 22. Base differences between the sequences are indicated. The region which was codon-optimised represents the region of overlap between the vector genome and wild-type Gag/Pol expression constructs.
[0466] Reduction of homology within this region would be expected to improve the safety profile of the vector system due to the reduced chances of recombination between the vector genome and the gag/pol transcripts.
[0467] 3.2 OPTI-Ihyg is a derivative of 3.2 OPTI in which the SnaBI-NotI fragment of 3.2 OPTI is transferred to pIRE 1 hygro (Clontech) prepared for ligation by digestion with the same sites. The resulting construct thus contains the intron from pCIneo, not from pIRES1hygro. pEV53B is a derivative of pEV53A (WO 98/51810) in which the EIAV-derived sequence upstream of the Gag initiation codon is reduced to include the major splice donor and surrounding sequences. CAG.GTAAGATG (SEQ ID NO: 20), where the gag initiation codon is shown in bold face.
Results 5
[0468] The results show the Rev-dependence of Gag/Pol expression from pHORSE3.1, which has an EIAV-derived leader sequence starting just downstream of the primer binding site, the wild type gag/pol sequence and then an RRE composed of the two EIAV sequences reported to have RRE activity (see WO99/32646). Expression was enhanced by the same amount when Rev expression was driven by wild type (pCIneoERev) or codon-optimised (pESYNREV) genes. This result confirms the functionality of the codon-optimised Rev expression plasmid.
[0469] In contrast expression of Gag/PoI from pESYNGP was not influenced by the presence of Rev, however it was only slightly lower than from pONY3.1 or pON3.2T. Expression from pESYNGPRRE (see GB Application 0009760.0) (FIGS. 22 and 23), in which the EIAV RRE (see WO 99/32646) is placed downstream of gag/pol, appeared slightly lower than from pESYNGP. The levels of expression from 3.2 OPTI and 3.2OPTI-Ihyg were significantly lower than from pESYNGP or pONY3.1, even in the presence of Rev. This result suggested that there may be determinants of Gag/Pol expression within the first 372 nt of the gag and showed that 3.2 OPTI was unlikely to be useful as a basis for EIAV vector production. Furthermore it demonstrates that codon-optimisation of only certain regions of the whole gag/pol gene may not lead to high levels of Rev-independent expression.
[0470] The ability of pESYNGP to generate viral vectors, when co-transfected with plasmids for the vector genome and envelope was assessed by transient transfection of HEK 293T, as described previously. Briefly, 293T cells were seeded on 6 cm dishes (1.2×106/dish) and 24 hours later they-were transfected by the calcium phosphate procedure. The medium was replaced 12 hours post-transfection and supernatants were harvested 48 hours post-transfection, filtered (0.45 μm filters) and titered by transduction of D17, canine osteosarcoma cells, in the presence of 8 μg/ml Polybrene (Sigma). Cells were seeded at 0.9×105/well in 12 well plates 24 hours prior to use in titration assays. Dilutions of supernatant were made in complete media (DMEM/10% FBS) and 0.5 ml aliquots plated out onto the D17 cells. 4 hours after addition of the vector the media was supplemented with a further 1 ml of media. Transduction was assessed by X-gal staining of cells 48 hours after addition of viral dilutions.
[0471] The vector genomes used for these experiments were pONY4.0 Z (WO 99/32646) and pONY8.0 Z. pONY4.0 Z (WO 99/32646) was derived from pONY2.11Z (WO 99/32646) by replacement of the U3 region in the 5′LTR with the cytomegalovirus immediate early promoter (pCMV). This was carried out in such a way that the first base of the transcript derived from this CMV promoter corresponds to the first base of the R region. This manipulation results in the production of high levels of vector genome in transduced cells, particularly HEK 293T cells, and has been described previously (Soneoka, Y., P. M. Cannon, E. E. Ramsdale, J. C. Griffiths, G. Romano, S. M. Kingsman, and A. J. Kingsman. 1995. Nucleic Acids Res. 23:628-33). pONY4.0 Z expresses all EIAV proteins except for envelope, expression of which is ablated by a deletion of 736 nt between the HindIII sites present in env. pONY8.0 Z was derived from pONY4.0 Z as described above, and is a minimal EIAV vector genome. The results of this analysis are shown graphically in FIG. 24.
Example 6
Lack of Packaging of Codon-optimized Gag/pol ORF Improves the Safety Profile of the Vector System
[0472] The construction and properties of an EIAV gag/pol expression plasmid in which the gene is codon-optimised for expression in human cells are described in Example 5 and GB Patent Application 0009760.0. In summary, the main feature of this expression cassette are 1) that expression of the gag/pol gene is rendered independent of REV/RRE and 2) that the extent of homology between the vector and gag region (in the region corresponding to the packaging signal) is reduced. The latter is predicted to improve the safety of the vector system by reducing the chances of recombination between the vector and gag/pol RNAs. Furthermore, due to the number of alterations in the sequence which result from the codon-optimisation process it is likely that the gag/pol RNA will no longer be packaged into virions. This concept was examined as described below.
[0473] The packaging of mRNA's derived from a wild type gag/pol pEV53B expression cassette, and from the codon-optimised EIAV gag/pol expression cassette, pESYNGP was compared (FIG. 25). In this experiment, medium was collected from B-241 cells, or from 293.101 cells stably transfected with the synthetic EIAV gag/pol expression cassette (pESYNGP). Both cell lines produce vector particles which do not contain vector RNA and do not have envelopes. In some experiments, an EIAV vector genome plasmid (pECG3-CZW) was transfected into the cells to serve as an internal positive control for hybridisation and for the presence of particles capable of packaging RNA.
[0474] Viral particles derived from each of the cell lines were then partially purified from the medium by equilibrium density gradient centrifugation. To do this 10 ml of medium from producer cells, harvested at 24 hours after induction with sodium butyrate, was layered onto a 20-60% (w/w) sucrose gradient in TNE buffer (pH 7.4) and centrifuged for 24 hours at 25,000 rpm and 4° C. in a SW28 rotor. Fractions were collected from the bottom and 10 μl of each fraction assayed for reverse transcriptase activity to locate viral particles. The results of this analysis are shown in Panel A (FIG. 26 ) where the profile of reverse transcriptase activity is shown as a function of gradient fraction. In these figures, the top of the gradient is on the right. It should be noted that the levels of RT activity from the 293.101-derived cell line expressing the codon-optimised gag/pol were significantly lower than from B-241 cells, which expresses the wild type gag/pol gene. To determine the RNA content of the purified virions, aliquots from the top, middle or bottom fractions were pooled (as indicated by the bars labeled T, M and B) and the RNA from each fraction was subjected to slot-blot hybridization analysis. Using a probe specific for a common region of wild type and synthetic gag/pol, encapsidation of RNA was easily detectable in the peak fractions (M) of virions synthesized from the wild type construct, but was not detected from virions synthesized from the synthetic gag-pol construct (Panel B). The positive control for encapsidation was the EIAV G3-CZW vector genome which was readily detected in peak fractions from cells expressing EIAV Gag/Pol from either the wild type or codon-optimised geness.
[0475] This result indicates that the RNA from the codon-optimised gag/pol gene is packaged significantly less efficiently than the wild type. Furthermore the lack of significant homology between the gag/pol and vector components eliminates the possibility of homolgous recombination. The codon-optimisation process therefore improves the safety profile of the system in two distinct ways.
Example 7
Western Blot Analysis of VSV-G Induction
[0476] FIG. 26 shows that efficient inducible expression of VSV-G protein in BiG-45 cells is dependent upon treatment by both sodium butyrate and doxycycline. In these experiments a clonal derivative of BiG-45 cells (clone 8Z.20; 5×106 cells/60-mm dish) producing the pONY8.0 Z vector was treated with 10 mM sodium butyrate and/or 1.5 μg/ml doxycycline for 24 hr at 37° C. Proteins were extracted from the cells and 20 μg protein from each sample was subjected to SDS-PAGE and protein blotting analysis using a monoclonal antibody to VSV-G. It is shown that both sodium butyrate and doxycycline treatment have a synergistic effect on VSV-G expression in these cells. This result further demonstrates that in the system described here full activation of genes under the control of the tetracycline-responsive element is only achieved in the presence of sodium butyrate, however once the system is activated by the dual signal there is no further requirement for sodium butyrate. This is different to the performance of the tetracycline system in other situations and desirable from a manufacturing point of view.
Example 8
Enhancement of EIAV Vector Titer Using the Post-transcriptional Regulatory Element from Woodchuck Hepatitis Virus
[0477] The vectors used to demonstrate the feasibility of an EIAV-based vector system (Olsen J C Gene transfer vectors derived from equine infectious anemia virus. Gene Ther. 1998 Nov ;5(11):1481-7 and WO 98/51810) did not have sequences corresponding to the RRE's present in the env coding region of the wild type virus. Experiments with vector genomes in which the RRE regions were included demonstrated that titres could be enhanced in the presence of Rev. The increased titre is obviously desirable from the perspective of production, however, from the point of view of safety and simplicity it would desirable to remove the RRE/Rev requirement from the system.
[0478] The present invention demonstrate that the activity of the RRE/Rev system can be replaced by that of the post-transcriptional regulatory element from woodchuck hepatitis virus (WPRE). FIG. 27 shows the results of a comparison of titers obtained with EIAV vector genome plasmids containing the EIAV Rev responsive elements, RRE (RRE1+RRE2) (pECG3-CZR) or the WPRE (pECG3-CZW), or no post-transcriptional regulatory element (pECG3-CZ). The RRE and WPRE increased vector titers 18-fold and 12-fold, respectively, to yield titers greater than 105 TU/ml. Thus the use of the WPRE provides a way of obtaining high-titers without having to use Rev in the vector production system. The use of WPRE as a substitute for Rev/RRE in the production of retroviral vectors has not been disclosed or suggested. The ability of of WPRE to improve vector titre is a surprising and unexpected finding because other researchers such as Zufferey J. Virol (1999), 73(4), 2886-2892 in a document entitled ‘Woodchuck hepatitis virus post-transcriptional regulatory element enhances expression of transgenes delivered by retroviral vectors’ have found that a dilution analysis of the vector stocks on 293T cells showed that the WPRE did not influence the vector titers obtained (data not shown).
Example 9
Construction of a Producer Cell Line for EIAV Vectors
[0479] A producer cell line is created from a packaging cell line by introduction of a system for expression of the vector component of the system. This is achieved either by transfection or transduction. By transfection of a plasmid for the vector genome component, only low numbers of vector genomes are introduced and this may represent a limitation on the titre of vector produced. The producer line 8Z.20 described in Example 2 was created by this route and contains 3 copies of the vector genome, as judged by Southern blot analysis.
[0480] It is more convenient to introduce vector by transduction and furthermore high numbers of genome copies can be achieved by using high mulitplicities of infection. In terms of vector production the critical point is that each of integrated copies of the vector can be transcriptionally active, and therefore contribute to the production of vector genome. For MLV-based vectors very high titres of vector have been obtained using this approach. (Sheridan, P L., et al. Molecular Therapy (2000), 2 (3), 262-275). This approach relies on high levels of transcription from the 5′LTR of the integrated vector therefore will not work for vectors with self-inactivating (SIN) configurations. The SIN configuration is desirable from a safety perspective for both retroviral and lentiviral vectors. For lentiviral vectors the situation is further complicated by the low transcriptional activity of the LTR's in the absence of Tat, and the unacceptability of having this protein expressed by the vector system. A method to overcome these limitations is therefore required.
[0481] One route to overcome the limitations is to arrange for a strong promoter, such as the CMV immediate early promoter, to be present in the 5′LTR following transduction. This promoter gives high level of production in the absence of Tat. However a drawback to this approach is that the titre of such vectors may be reduced relative to vectors which have the normal viral LTR. In addition, it may not be desirable from a safety perspective to have a highly active promoter present within the 3′LTR as it may activate transcription from genes located downstream of the integration site in patient's cells. Another way to overcome the problem is to use a conditional SIN vector such as described previously for an HIV-1-based vector system (Zu, K., et al., Molecular Therapy, (2001), 3(1), 97-104).
[0482] The construction of an EIAV-based conditional SIN vector is described below as is the construction of a packaging cell line based on 293.101 in which expression of the EIAV gag/pol is driven by the codon-optimised EIAV gag/pol ORF and the expression of VSV-G is driven by a tetracycline responsive promoter. It should be noted that the latter system of regulation is different from that for pTOG described in Example 2.
Construction Details
1. Introduction of the Gag/Pol Component.
[0483] The first step in the creation of the packaging cell line for EIAV-based vectors was the introduction of an expression cassette for expression of EIAV Gag/Pol from the codon optimised gene. The plasmid used was derived from pESYNGP (Example 5 and Patent Application GB0009760.0) and was termed pIRES1hyg ESYNGP. In this plasmid EIAV Gag/pol expression is driven by a CMV promoter, and is linked to an ORF for expression of hygromycin phosphotransferase by an EMCV IRES. pIRES1hyg ESYNGP was made as follows. The synthetic EIAV gag/pol gene and flanking sequences was transferred from pESYNGP into pIRES1hygro expression vector (Clontech). First, pESYNGP was digested with EcoRI, and the ends filled in by treatment with T4DNA polymerase and then digested with NotI. pIRES1hygro was prepared for ligation with this fragment by digestion with NsiI, the ends trimmed flush by treatment with T4 DNA polymerase, then digested with NotI. Prior to transfection into 293.101 cells pIRES1hyg ESYNGP was digested with AhdI. Cell lines which stably contained pIRES1hyg ESYNGP, were obtained by transfection, selection of transfectants by hygromycin B treatment and limiting dilution. The levels of Gag/Pol expression from different cell lines so obtained were compared by product enhanced reverse transcriptase (PERT) assay of reverse transcriptase in the supernatants. The cell line with the highest level of gag/pol expression, termed 293.101-ESYNGP, was then used to create a cell line in which expression of VSV-G was under control of the Tet-inducible system.
2. Introduction of the VSV-G Envelope Component
[0484] The VSV-G ORF was introduced into 293.101-ESYNGP cells by transfection of the plasmid, pTKneo-TREHCMV-G, in which expression of the neomycin resistance gene (neo) is driven by the thymidine kinase (TK) promoter. The expression of the VSV-G was from the TREHCMV-G cassette in which the tetracycline responsive element (TRE) promoter motif is placed upstream of the VSV-G sequence obtained from plasmid HCMV-G. The TKneo cassette was located upstream of the TREVSV-G and was orientated in terms of transcription in the same direction. However, a cassette in which it is orientated in the opposite direction could also be used. pTKneo-TREHCMV-G was constructed as follows. The herpes simplex virus TK promoter and intron was obtained by PCR amplification using primers
[0485]
and as template the plasmid, pRL-TK (Promega). The 3′ end of the sequence which was amplified was just upstream of the T7 promoter of pRL-TK. Following digestion with Bg/II and NheI the fragment was ligated into pSL1 1180 (Pharmacia) prepared for ligation by digestion with the same enzymes. The resultant plasmid was termed pSL1 1804-K. The neomycin phosphotransferase gene (neo) was obtained by PCR amplification using as template the pCIneo plasmid (Promega) and the primers
| (SEQ ID NO: 21) | ||
| TK POS | (TACGGAAGATCTAAATGAGTCTTCGGACCT) | |
| and | ||
| (SEQ ID NO: 22) | ||
| TKNEG | (CTCAACGCTAGCGTACTCTAGCCTTAAGAGCTG) | |
and as template the plasmid, pRL-TK (Promega). The 3′ end of the sequence which was amplified was just upstream of the T7 promoter of pRL-TK. Following digestion with Bg/II and NheI the fragment was ligated into pSL1 1180 (Pharmacia) prepared for ligation by digestion with the same enzymes. The resultant plasmid was termed pSL1 1804-K. The neomycin phosphotransferase gene (neo) was obtained by PCR amplification using as template the pCIneo plasmid (Promega) and the primers
[0486]
plasmid contains as a cassette, the TK-promoter/intron upstream of the neo gene. This cassette was excised by digestion with KpnI and Bg/II and ligated into pCI (Promega) prepared for ligation by digestion with the same enzymes. The resultant plasmid was termed pCI-TKneo. This manipulation places the TKneo cassette upstream of a polyadenylation signal.
| (SEQ ID NO: 23) |
| NEO POS |
| (5′-GAATTGGTACCGCCACCATGATTGAACAAGATGGATTGCACGC) |
| and |
| (SEQ ID NO: 24). |
| NEONEG |
| (5′GAATTGGCTAGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCG) |
plasmid contains as a cassette, the TK-promoter/intron upstream of the neo gene. This cassette was excised by digestion with KpnI and Bg/II and ligated into pCI (Promega) prepared for ligation by digestion with the same enzymes. The resultant plasmid was termed pCI-TKneo. This manipulation places the TKneo cassette upstream of a polyadenylation signal.
[0487] A plasmid containing the VSV-G ORF downstream of the TRE was created as follows. The BamHI fragment containing the VSV-G sequence from plasmid HCMV-G was ligated into pTRE2 (Clontech) prepared for ligation by digestion with BamHI. The resultant plasmid was termed pTREHCMV-G and has, from 5′ to 3′, the tetracycline responsive element upstream of a minimal CMV promoter, the VSV-G ORF and polyadenylation signal. Of note is the fact that the VSV-G ORF differs from the published VSV-G (Indiana) (Genbank Acc. No. K01639) sequence by a single aminoacid coding alteration which means that our clone encodes histidine not glutamine at position 96.
[0488] pTKneo-TREHCMV-G was made by taking the TKneo-plyadenylation cassette from pCI-TKneo and introducing it into pTREHCMV-G. This was achieved by digestion of pCI-TKneo with PvuI and Bg/II, followed by blunting of the ends by T4 DNA polymerase treatment. This fragment was introduced into pTREHCMV-G prepared for ligation by digestion with AatII, followed by blunting of the ends by treatment with T4 DNA polymerase. A plasmid in which the two cassette were orientated so that transcription was in the same direction was selected and termed pTKneo-TREHCMV-G. Prior to use in transfections the plasmid was modified to remove the ClaI site is located between the polyadenylation signal of neo and the TRE and is useful for linearisation of the plasmid prior to use in transfections carried out for the creation of stable cell lines. This modification was achieved by partial digestion of pTKneo-TREHCMV-G with ClaI, followed by T4 DNA polymerase treatment to blunt the ends of the fragment, and then religation. A plasmid in which the ClaI site immediately downstream of the VSV-G expression cassette was deleted was selected for further work and termed pTKneo-TREHCMV-GClaI.
[0489] Prior to introduction of the pTKneo-TREHCMV-GClaI plasmid into 293.101-ESYNGP cells it was necessary to introduce a plasmid which encodes the tetracycline regulator-VP16 fusion protein. The plasmid used for this purpose was a derivative of pTet-off (Clontech) and pIRESpuro (Clontech) in which the EcoRI to BamHI fragment containing the fusion protein ORF was ligated into pIRESpuro prepared for digestion with the same enzymes. The resulting plasmid, pIRESpuro-Tet-off, has the following order of elements: CMV promoter-fusion protein ORF-intron-IRES-puromycin resistance gene-polyadenylation signal. pIRESpuro-Tet-off was introduced into 293.101-ESYNGP and stably transfected cells were selected by growth in media containing puromycin and then cloned by limiting dilution. 20 cell lines were examined for a suitable level of fusion protein expression following transfection with the test plasmid, pTRE2-luc, supplied by Clontech for this purpose. A cell line which showed a 20-fold induction of luciferase expression following withdrawal of doxycycline was selected as advised in product information by Clontech and was then used for transfection with the pTKneo-TREHCMV-GClaI plasmid prepared by linearisation with ClaI. Following transfection, cells which stably expressed the plasmid were selected by treatment with G418 and then cloned by limiting dilution. The VSV-G expression profile of these cells was then examined under conditions where doxycycline was present (the ‘off’ situation) or absent (the ‘on’ situation). A cell line in which the expression of VSV-G was very low in the presence of doxycycline but induced to the same levels as observed for BiG-45 cells (Example 7) was selected for use as an EIAV packaging cell line and termed, pac293.101EV1.
3. Introduction of the Vector Component into Pac293.101EV1
[0490] An EIAV vector in which the 3′LTR was modified to contain 7 direct repeats of the tetracycline responsive element (TRE) was created as follows. The starting point for construction of the modified LTR was vector pTRE2 (Clontech). The flanking of the TRE in pTRE2 with EIAV LTR sequences was carried out in several stages: In the first a sequence including the 3′PPT and sequences required for integration derived from the 5′ end of the EIAV U3 region were placed to the 5′side of the TRE. In the second, sequences including the EIAV TATA box, R and U5 and further downstream sequences were placed to the 3′-side of the TRE.
Stage 1. Cloning of the U3a Region of the EIAV LTR Upstream of the TRE in pTRE2
[0491] The PCR was used to amplify the U3a region of the EIAV LTR from pONY8.1Z. Pfx polymerase (Gibco BRL) was used together with the primers P1-U3a1 and P2-U3a2 (FIG. 30 ) to incorporate an XhoI restriction endonuclease site at both ends of the resultant 157 bp DNA fragment. This PCR product was digested with XhoI and ligated into similarly digested pTRE2. The resultant clones were analysed using the restriction endonucleases MluI and SphI; those that contained the U3a region in the correct orientation were digested into 2 DNA fragments of 630 bp and 3284 bp. Those clones that contained the U3a region in the incorrect orientation were digested into 2 DNA fragments of 493 bp and 3421 bp. One of the correct clones was selected for the next stage of cloning and was designated pTRE2+U3a. A map of this vector is shown in FIG. 31.
Stage 2. Cloning of the U3b/R/U5 Region of the EIAV LTR Downstream of the TRE in pTRE2+U3a
[0492] The PCR was used to amplify the U3b/R/U5 region of the EIAV LTR from pONY8.1Z. Pfx polymerase (Gibco BRL) was used together with the primers P3-U3bRU51 and P4-U3bRU52 (FIG. 28 ) to incorporate an XmaI restriction endonuclease site at both ends of the resultant 444 bp fragment. The primer U3bRU51 was designed to include the sequence derived from the TRE that would be removed when the TRE was digested with XmaI. This PCR product was digested with XmaI and ligated into similarly digested pTRE2+U3a. The resultant clones were digested with the restriction endonucleases StuI and SphI; those that contained the U3b/R/U5 region in the correct orientation were digested into 2 DNA fragments of 548 bp and 3653 bp. Those that contained the U3b/R/U5 region in the incorrect orientation were digested into 2 DNA fragments of 800 bp and 3401 bp. One of the correct clones was selected for the next stage of cloning and was designated pTRE2+U3a+U3bRU5. A map of this vector is shown in FIG. 32.
Stage 3. Cloning of the TRE-EIAV Hybrid LTR from pTRE2+U3a+U3bRU5 into EIAV Vectors Genome Plasmids
[0493] The transfer of the TRE-EIAV hybrid LTR into EIAV vector genome plasmids is carried out by making use of the SapI sites flanking the hybrid LTR in pTRE2+U3a+U3bRU5 and virtually all EIAV vector genome plasmids. These sites allow directional cloning of the TRE-EIAV hybrid LTR into the EIAV vector genome plasmid. For example, for construction of a pONY8.0 Z derivative , pTRE2+U3a+U3bRU5 is digested with SapI to release an 825 bp fragment, which is then ligated to the 10351 bp fragment released from pONY8.0 Z by digestion with SapI. The sequence of the SapI fragment and some flanking sequences present in pTRE2+U3a+U3bRU5 is shown in FIG. 33.
[0494] Vectors containing LTR's modified by introduction of the TRE can be used to create producer cells lines using procedures similar to those described previously (Sheridan, P L., et al. Molecular Therapy (2000), 2 (3), 262-275). In brief VSV-G pseudotyped vector particles are produced by transient transfection of HEK 293 cells and use to infect, at high multiplicities of infection, pac293.101EV1 packaging cells. Subclones of the transduced population are then screened for production of high titres of vector after induction of vector formation by growth in doxycycline-free media. Thus for clarity, in this embodiment of the present invention, env protein expression, such as VSV-G expression, and vector genome expression are prevented in the presence of a tetracycline modulator, such as doxycycline, (“the “off” situation) and activated in the absence of doxycycline (the “on” situation).
Provision of EIAV Rev Expression
[0495] From experiments in which EIAV vector is made by transient transfection of HEK 293T cells using pESYNGP to supply Gag/Pol, it is known that the titres obtained from vectors which do not express Rev, such as pONY8.0Z and derivatives, are increased when Rev is added to the system. One way to avoid this requirement is to utilise a vector genome which contains a WPRE as described in Example 8. Alternatively Rev can be supplied from a separate expression cassette. Such a cassette may be linked to the vector genome cassette as described previously (PCT/GB 00/03837) or may be an cassette independent of other components of the vector system, for example pESYNREV. One potential difficulty is that continuous expression of Rev at high levels is toxic in cells. Thus there is a requirement for controlled expression of Rev. Expression may be controlled in an ‘off-on’ manner by use of the tetracycline inducible system, however it may be desirable to use a system of regulation which allows a precise level of Rev expression to be achieved. An example of a system that allows the latter is the ecdysone-inducible system through which precise control of the level of expression of a transgene can be obtained. Examples of TRE-mediated and ecdysone-system-mediated regulation of expression of Rev are described below.
Expression of Rev from pTRE-ESYN-TK-blast.
[0496] This plasmid was made using multiple cloning steps as follows. The blasticidin gene was excised from pCEB (Cosset F L, Takeuchi Y, Battini J L, Weiss R A, Collins M K. J Virol. 1995 Decemeber;69(12):7430-6) by digestion with ScaI and NheI and the 654 bp fragment ligated into pSL1180-TK prepared for ligation by digestion with HpaI and SpeI. The resulting plasmid has a thymdine kinase promoter (TK) upstream of the blasticidin gene and is termed pSL1180-TKblast. This is digested with BamHI and EcoRV and the 1573 bp fragment ligated to the 2907 bp fragment derived from pCIneo by digestion with BglII and SmaI. This manipulation introduces a polyadenylation signal downstream of the TK-blast cassette and is a plasmid termed pTKblast-pA. The expression cassette is released from pTKblast-pA by digestion with BamHI, the ends filled in by treatment with T4 DNA polymerase, and then digestion with BclI. The released fragment is then ligated into pTRE REV prepared for ligation by digestion with AatII, followed by filling-in of the ends by treatment with T4 DNA polymerase. The resulting plasmid was termed pTKblast-TRE-ESYNREV. pTRE REV was made by ligation of the 3731 bp fragment released by NheI and SalI digestion of pTRE2 (Clontech) with the 522 bp fragment from pESYNREV produced by digestion with the same enzymes. Cells which were stably transfected with pTKblast-TRE-ESYNREV were selected by treatment with blasticidin.
[0497] Thus, in this embodiment of the present invention Rev protein expression is prevented in the presence of a tetracycline modulator, such as doxycycline, (“the “off” situation) and activated in the absence of doxycycline (the “on” situation).
Regulated Expression of EIAV Rev Using the Ecdysone Inducible System.
[0498] It may be necessary to optimise the level of Rev expression in the producer cell line for each vector genome. This could be achieved using a regulatable system, for example the Ecdysone regulatable system (Invitrogen, and WO 97/38117 and WO 99/58155) with which expression can be varied in a dose-dependent manner by treatment of the cell line with the ecdysone analogues, ponasterone A or Muristerone A.
Example 10
Use of Insulator Elements to Improve the Performance of LTR's in Producer Cells
[0499] The level of transcription from the LTR of an integrated retrovirus is determined by the chromosomal environment. Therefore the performance of a particular integrated conditional SIN vector will also be influenced similarly. The levels of LTR driven transcription can be improved and made more uniform across a collection of integrated copies of a vector by flanking the vector genome with insulator elements, such as the chicken β-globin insulator (Emery D W, Yannaki E, Tubb J, Stamatoyannopoulos G. Proc Natl Acad Sci U S A 2000 Aug 1;97(16):9150-5; Rivella S, Callegari J A, May C, Tan C W, Sadelain M. J Virol. 2000 May;74(10):4679-87). These observations suggest that inclusion of an insulator sequence in the conditional SIN vectors described above would result in an improved level of transcription and hence production of higher titres of virus. An additional benefit is that the transcriptional activity from LTR's flanked in this manner will be maintained for an increased period relative to that from LTR's not protected from the effects of the local chromosomal environment, thereby extending the productive lifetime of the producer cell line.
[0500] The cHS4 element from the chicken beta-globin locus (Genbank: Accession Number U78775) was obtained from plamsid pJC 13.1(Chung J H, Whiteley M, Felsenfeld Cell. 1993 Aug 13;74(3):505-14) as an XbaI fragment and prepared for ligation by filling-in the ends by treatment with T4 DNA polymerase. This fragment was ligated into pTRE2+U3a+U3bRU5 prepared for ligation by partial digestion with XhoI, followed by treament with T4 DNA polymerase. The products of ligation and transformation were screened for the presence of the cHS4 element located in either orientation and located between the 5′EIAV U3 sequence and the TRE multimer. For clarity the order of components in the LTR is thus 5′end of the EIAV U3—cHS4—TRE multimer—EIAV TATA box-EIAV R-U5: The cHS4/TRE hybrid LTR's, with the cHS4 in the plus or minus orientations, were then transferred to vector genomes by carrying out 3-way ligations with vector genome fragment prepared by SapI ligation and the two SapI fragments representing the 5′ and 3′ ends of the hybrid LTR.
Example 11
[0501] It can be advantageous from the point of view of production of vectors at large scale to utilize a cell that can be propagated in suspension culture. Technologies for handling of cells in suspension and for separation of substances secreted into the growth media of such cells are well established. A number of cell lines are available for the generation of of producer cell lines. These include cells derived from leukemias (e.g. HL-60) and cells derived from lymphomas (e.g. CEM, WIL2, Namalwa, JM-1, IM-9). A longer list of human and non-human cells lines is available from the ATCC (American Type Culture Collection, http:\\www.atcc.org). Preferably the cell line would be human. For example CEM cells can form the basis of an EIAV-vector producer cell using the approach outlined in Example 9.
[0502] All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described mode's for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
Claims
1. A packaging cell comprising:
(i) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a tetracycline responsive element (TRE);
(ii) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator; and
(iii) a third NS encoding a retrovirus nucleocapsid protein;
such that the expression of the first NS is regulatable by tetracycline and an initial stimulus with sodium butyrate or a functional analogues thereof.
2. A packaging cell according to claim 1 wherein the first NS encodes a vesicular stomatitis virus (VSV)-G protein or a mutant, variant, homologue or fragment thereof.
5. A producer cell comprising:
(i) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; wherein the promoter is operably linked to at least one copy of a TRE;
(ii) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator;
(iii) a third NS encoding a retrovirus nucleocapsid protein; and
(iv) a fourth NS comprising a retroviral sequence to be packaged in a retroviral particle;
such that the retroviral vector particle titre obtainable from the producer cell is regulatable by tetracycline and an initial stimulus with sodium butyrate or functional analogues thereof.
6. A producer cell according to claim 5 wherein the first NS encodes a VSV-G protein or a mutant, variant, homologue or fragment thereof.
11. A virus producer cell comprising:
(i) a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a TRE;
(ii) a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator; and
(iii) a third NS comprising a viral sequence sufficient to produce viral vector particles from the cell;
such that the viral vector particle titre obtainable from the producer cell is regulatable by tetracycline and an initial stimulus with sodium butyrate or functional analogues thereof.
12. A producer cell according to claim 11 wherein the viral sequence comprises at least one NOI.
14. A method for producing a retroviral vector wherein the method comprises:
(i) selecting a host cell for retroviral vector production;
(ii) introducing into the host cell:
a first nucleotide sequence (NS) encoding a toxic viral envelope protein operably linked to a promoter; and wherein the promoter is operably linked to at least one copy of a TRE;
a second NS wherein the second NS comprises a sequence encoding a tetracycline modulator;
a third NS encoding a retrovirus nucleocapsid protein;
a fourth NS comprising a retroviral sequence to be packaged in a retroviral particle; and
(iii) incubating the host cell in a culture medium comprising tetracycline and an initial stimulus with sodium butyrate or functional analogues thereof such that sufficient retroviral vector transducing particles are producible from the host cell.
15. A method according to claim 14 wherein the toxic viral envelope protein is VSV-G or a mutant, variant, homologue or fragment thereof.
21. A method according to claim 20 wherein the polynucleotide response element is the Rev response element (RRE).
22. A method according to claim 20 wherein the polynucleotide response element is a woodchuck hepatitis virus post-transcriptional regulatory element (WHY PRE).
24. A method according to claim 23 wherein the minimal vector genome is a lentiviral vector genome.
25. A method according to claim 24 wherein the lentiviral vector genome is an EIAV vector.
28. A retroviral vector according to claim 27 wherein the target site is a cell.
29. A cell transduced with a retroviral vector according to claim 28.
32. A method for producing a retroviral gene delivery system comprising incubating the producer cell of claim 5 in a culture medium comprising tetracycline and sodium butyrate or functional analogues thereof in a sufficient amount and for a sufficient time such that an effective amount of a retroviral vector is produced.
33. A method for producing a viral gene delivery system comprising incubating the cell of claim 12 in a culture medium comprising tetracycline or a sodium butyrate or functional analogues thereof in a sufficient amount and for a sufficient time such that an effective amount of a viral vector is produced.
35. A retroviral delivery system or a viral delivery system according to claim 34 wherein the target site is a cell.
36. A cell transduced with a retroviral delivery system or a viral delivery system according to claim 35.
38. A method for delivering an NOI to a target site, said method comprising introducing into the target site the viral delivery system according to claim 33.
39. A stable temperature regulated producer cell line according to claim 11 wherein the producer cell line produces sufficient amounts of a viral vector.
Patent Citations (29)
| Patent | Date | Inventor | Cited By |
|---|---|---|---|
| EP445625(A1) | 1991-02-01 | Applicant | |
| WO91/00047(A1) | 1991-01-01 | Applicant | |
| WO92/05266(A2) | 1992-04-01 | Applicant | |
| WO94/29438(A1) | 1994-12-01 | Applicant | |
| WO94/29440(A1) | 1994-12-01 | Applicant | |
| WO95/21927(A2) | 1995-08-01 | Applicant | |
| WO95/30018(A2) | 1995-11-01 | Applicant | |
| WO96/09400(A1) | 1996-03-01 | Applicant | |
| WO96/35454(A1) | 1996-11-01 | Applicant | |
| WO97/17457(A2) | 1997-05-01 | Applicant | |
| WO97/27310(A1) | 1997-07-01 | Applicant | |
| WO97/38117(A1) | 1997-10-01 | Applicant | |
| WO98/05635(A1) | 1998-02-01 | Applicant | |
| WO98/05754(A2) | 1998-02-01 | Applicant | |
| WO98/05759(A1) | 1998-02-01 | Applicant | |
| WO98/07859(A2) | 1998-02-01 | Applicant | |
| WO98/09985(A2) | 1998-03-01 | Applicant | |
| WO98/17815(A1) | 1998-04-01 | Applicant | |
| WO98/51810(A1) | 1998-11-01 | Applicant | |
| WO99/15683(A1) | 1999-04-01 | Applicant | |
| WO99/32646(A1) | 1999-07-01 | Applicant | |
| WO99/41397(A1) | 1999-08-01 | Applicant | |
| WO99/58155(A1) | 1999-11-01 | Applicant | |
| WO99/61639(A2) | 1999-12-01 | Applicant | |
| WO/29428(A2) | 2000-05-01 | Applicant | |
| WO/31200(A1) | 2000-06-01 | Applicant | |
| WO/52188(A1) | 2000-09-01 | Applicant | |
| WO1/25466(A1) | 2001-04-01 | Applicant | |
| WO1/79518(A2) | 2001-10-01 | Applicant |
Non-Patent Literature (123)
- Abe et al., “In Vitro Cell-Free Conversion of Noninfectious Moloney Retrovirus Particles to an Infectious Form by the Addition of the Vesicular Stomatitis Virus Surrogate Envelope G Protein,” Journal of Virology, 72(8):6356-6361, Aug. 1998, American Society for Microbiology.Applicant
- Akkina et al., “High-Efficiency Gene Transfer into CD34+ Cells with a Human Immunodeficiency Virus Type 1-Based Retroviral Vector Pseudotyped with Vesicular Stomatitis Virus Envelope Glycoprotein G,” Journal of Virology, 70(4):2581-2585, Apr. 1996, American Society for Microbiology.Applicant
- Arai et al., “A New System for Stringent, High-Titer Vesicular Stomatitis Virus G Protein-Pseudotyped Retrovirus Vector Induction by Introduction of Cre Recombinase into Stable Prepacking Cell Lines,” Journal of Virology, 72(2):1115-1121, Feb. 1998, American Society for Microbiology.Applicant
- Attenello & Lee, “Regulation of a Hybrid Gene by Glucose and Temperature in Hamster Fibroblasts,” Science, 226:187-190, Oct. 1984.Applicant
- Benmansour et al., “Antigenicity of Rabies Virus Glycoprotein,” Journal of Virology, 65(8):4198-4203, Aug. 1991, American Society for Microbiology.Applicant
- Binns et al., “Companion of a Conserved Region in Fowlpox Virus and Vaccinia Virus Genomes and the Translocation of the Fowlpox Virus Thymidine Kinase Gene,” J. gen. Virol., 69:1275-1283, 1988, SGM, Great Britain.Applicant
- Borrelli et al., “Targeting of an inducible toxic phenotype in animal cells,” Proc. Natl. Acad. Sci. USA, 85:7572-7576, Oct. 1988.Applicant
- Boyle et al., “Fowlpox Virus Thymideine Kinase: Nucleotide Sequence and Relationships to Other Thymidine Kinases,” Virology, 156:355-365, 1987, Academic Press, Inc.Applicant
- Burger et al., “Stable expression of rabies virus glycoprotein in Chinese hamster ovary cells,” Journal of General Virology, 72:359-367, 1991, SGM, Great Britain.Applicant
- Burns et al., “Vesicular stomatitis virus G glycoprotein pseudotypes retroviral vectors: Concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells,” Proc. Natl. Acad. Sci. USA, 90:8033-8037, Sep. 1993.Applicant
- Chen et al., “Generation of packaging cell lines for pseudotyped retroviral vectors of the G protein of vesicular stomatitis virus by using a modified tetracycline inducible system,” Proc. Natl. Acad. Sci. USA, 93:10057-10062, Sep. 1996.Applicant
- Chen et al., “Sensitization of Human Breast Cancer Cells to Cyclophosphamide and Ifosfamide by Transfer of a Liver Cytochrome P450 Gene,” Cancer Research, 56:1331-1340, 1996.Applicant
- Chung et al., “A 5′ Element of the Chicken β-Globin Domain Serves as an Insulator in Human Erythroid Cells and Protects against Effect in Drosophila,” Cell, 74:505-514, Aug. 1993, Cell Press.Applicant
- Coffin et al., “Retroviruses,” p. 449, JM Coffin et al., eds., Cold Spring Harbour Laboratory Press, 1997.Applicant
- Coffin et al., “Retroviruses,” pp. 758-763, JM Coffin et al., eds., Cold Spring Harbor Laboratory Press, 1997.Applicant
- Coll, “Synthetic peptides from the heptad repeats of the glycoproteins of rabies, vesicular stomatitis and fish rhabdoviruses bind phosphatidylserine,” Archives of Virology, 142:2089-2097, 1997, Springer-Verlag, Austria.Applicant
- Coll, “The glycoprotein G of rhabdoviruses,” Archives of Virology, 140:827-851, 1995, Springer-Verlag, Austria.Applicant
- Cosset et al., “High-Titer Packaging Cells Producing Recombinant Retroviruses Resistant to Human Serum,” Journal of Virology, 69(12):7430-7436, Dec. 1995, American Society for Microbiology.Applicant
- Cosson, “Direct interaction between the envelope and matrix proteins of HIV-1,” The EMBO Journal, 15(21):5783-5788, 1996, Oxford University Press.Applicant
- Coulon et al., “An Avirulent Mutant of Rabies Virus Is Unable to Infect Motoneurons In Vivo and In Vitro,” Journal of Virology, 72(3):273-278, Jan. 1998, American Society for Microbiology.Applicant
- Coulon et al., “Invasion of the Peripheral Nervous Systems of Adult Mice by the CVS Strain of Rabies Virus and Its Avirulent Derivative AvO1,” Journal of Virology, 63(8):3550-3554, Aug. 1989, American Society for Microbiology.Applicant
- Dachs et al., “Targeting gene expression to hypoxic tumor cells,” Nature Medicine, 3(5):515-520, May 1997.Applicant
- Dietzschold et al., “Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus,” Proc. Natl. Acad. Sci. USA, 80:70-74, Jan. 1983.Applicant
- Dietzschold et al., “Isolation and Purification of a Polymeric Form of the Glycoprotein of Rabies Virus,” J. gen. Virol., 40:131-139, Great Britain.Applicant
- Dietzschold et al., “Structure and Function of Rabies Virus Glycoprotein,” Develop. Biol. Standard, 40:45-55, 1978, S. Karger, Basel.Applicant
- Dietzschold, “Oligosaccharides of the Glycoprotein of Rabies Virus,” Journal of Virology, 23(2):286-293, Aug. 1977, American Society for Microbiology, USA.Applicant
- Dorfman et al., “Role of the Matrix Protein in the Virion Association of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein,” Journal of Virology, 63(3):1689-1696, Mar. 1994, American Society for Microbiology.Applicant
- Dougherty & Temin, “A promoterless retroviral vector indicates that there are sequences in U3 required for 3′ RNA processing,” Proc. Natl. Acad. Sci. USA, 84:1197-1201, Mar. 1987.Applicant
- Einfeld, “Maturation and Assembly of Retroviral Glycoproteins,” pp. 133-176.Applicant
- Emerman & Temin, “Genes with Promoters in Retrovirus Vectors Can Be Independently Suppressed by an Epigenetic Mechanism,” Cell, 39:459-467, Dec. 1984 (Part 2), MIT.Applicant
- Emery et al., “A chromatin insulator protects retrovirus vectors from chromosomal position effects,” PNAS, 97(16):9150-9155, Aug. 2000.Applicant
- EMI et al., “Pseudotype Formation of Murine Leukemia Virus with the G Protein Vesicular Stomatitis Virus,” Journal of Virology, 65(3):1202-1207, Mar. 1991, American Society for Microbiology.Applicant
- Esposito & Knight, “Nucleotide Sequence of the Thymidine Kinase Gene Region of Monkeypox and Variola Viruses,” Virology, 135:561-567, 1984, Academic Press, Inc.Applicant
- Firth et al., “Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: Similarities with the erythropoietin 3′ enhancer,” Proc. Natl. Acad. Sci. USA, 91:6496-6500, Jul. 1994.Applicant
- Friedlos et al., “Mustard Prodrugs for Activation by Escherichia coli Nitroreductase in Gene-Directed Enzyme Prodrug Therapy,” J. Med. Chem., 40:1270-1275, 1997, American Chemical Society.Applicant
- Fries et al., “Human safety immunogenicity of a canarypox-rabies glycoprotein recombinant vaccine: an alternative poxvirus vector system,” Vaccine, 14(5):428-434, 1996, Elsevier Science Ltd., Great Britain.Applicant
- Gaudin et al., “Biological Function of the Low-pH, Fusion-Inactive Conformation of Rabies Virus Glycoprotein (G): G Is transported in a Fusion-Inactive State-Like Conformation,” Journal of Virology, 69(9):5528-5534, Sep. 1995, American Society for Microbiology.Applicant
- Gaudin et al., “Rabies Virus Glycoprotein is a Trimer,” Virology, 187:627-632, 1992, Academic Press, Inc.Applicant
- Gazit et al., “Use of the Stress-inducible grp78/BiP Promoter in Targeting High Level Gene Expression in Fibrosarcoma in Vivo,” Cancer Research, 55:1660-1663, Apr. 1995.Applicant
- Gentz et al., “Bioassay for trans-activation using purified human immunodeficiency virus tat-encoded protein: Trans-activation requires mRNA synthesis,” Proc. Natl. Acad. Sci. USA, 86:821-824, Feb. 1989.Applicant
- Gershon & Black, “The Nucleotide Sequence around the Capripoxvirus Thymidine Kinase Gene Reveals a Gene Shared Specifically with Leporipoxvirus,” J. gen. Virol., 70:525-533, 1989, SGM, Great Britain.Applicant
- Gossen & Bujard, “Tight control of gene expression in mammalian cells by tetracycline-responsive promoters,” Proc. Natl. Acad. Sci. USA, 89:5547-5551, Jun. 1992.Applicant
- Hanham et al., “Evidence from the Anti-Idiotypic Network that the Acetylcholine Receptor Is a Rabies Virus Receptor,” Journal of Virology, 67(1):530-542, Jan. 1993, American Society for Microbiology.Applicant
- Hawley et al., “Handicapped retroviral vectors efficiently transduce foreign genes into hematopoietic stem cells,” Proc. Natl. Acad. Sci. USA, 84:2406-2410, Apr. 1987.Applicant
- Herman & Coffin, “Efficient Packaging of Readthrough RNA in ALV: Implications for Oncogene Transduction,” Science, 236:845-848, May 1987.Applicant
- Hong et al., “Adenovirus type 5 fiber knob binds to MHC class I α2 domain at the surface of human epithelial and B lymphoblastoid cells,” The EMBO Journal, 16(9):2294-2306, 1997, Oxford University Press.Applicant
- Hruby et al., “Fine structure analysis and nucleotide sequence of the vaccinia virus thymidine kinase gene,” Proc. Natl. Acad. Sci. USA, 80:3411-3415, Jun. 1983.Applicant
- Hunter, “Macromolecular interactions in the assembly of HIV and other retroviruses,” seminars in Virology, 5:71-83, 1994.Applicant
- Inoue et al., “The Human Preproendothelin-1 Gene,” The Journal of Biological Chemistry, 264(25):14954-14959, Sep. 5, 1989, The American Society for Biochemistry and Molecular Biology, Inc., USA.Applicant
- Januszeski et al., “Functional Analysis of the Cytoplasmic Tail of Moloney Murine Leukemia Virus Envelope Protein,” Journal of Virology, 71(5):3613-3619, May 1997, American Society for Microbiology.Applicant
- Johnson et al., “Effect of Host Modification and Age on Airway Epithelial Gene Transfer Meidated by a Murine Leukemia Virus-Derived Vector,” Journal of Virology, 72(11):8861-8872, Nov. 1998, American Society for Microbiology.Applicant
- Jolly et al., “Elements in the long terminal repeat of murine retroviruses enhance stable transformation by thymidine kinase gene,” Nucleic Acids Research, 11(6):1855-1872, 1983, IRL Press Limited, Oxford, England.Applicant
- Kafri et al., “A Packaging Cell Line for Lentivirus Vectors,” Journal of Virology, 73(1):576-584, Jan. 1999. American Society for Microbiology.Applicant
- Karreman et al., “On the use of double FLP recognition targets (FRTs) in the LTR of retroviruses for the construction of high producer cell lines,” Nucleic Acids Research, 24(9):1616-1624, 1996, Oxford University Press.Applicant
- Kerr et al., “Antibody-penicillin-V-amidase conjugates kill antigen-positive tumor cells when combined with doxorubicin phenoxyacetamide,” Cancer Immunol. Immunother, 31:202-206, 1990, Springer-Verlag.Applicant
- Kestler et al., “cis Requirements for the Efficient Production of Recombinant DNA Vectors Based on Autonomous Parvoviruses,” Human Gene Therapy, 10:1619-1632, Jul. 1, 1999, Mary Ann Liebert, Inc.Applicant
- Kilpatrick & Rouhandeh, “Cloning and Physical Mapping of the Yaba Monkey Tumor Virus DNA,” Virology, 143:399-406, 1985, Academic Press, Inc.Applicant
- Klages et al., “A Stable System for the High-Titer Production of Multiply Attenuated Lentiviral Vectors,” Molecular Therapy, 2(2):170-176, Aug. 2000, The American Society of Gene Therapy.Applicant
- Krässlich & Welker, “Intracellular Transport of Retroviral Capsid Components,” Curr. Top. Microbiol. Immunol., 214:133-176, 1996.Applicant
- Kroll et al., “A Multifunctional Prokaryotic Protein Expression System: Overproduction, Affinity Purification, and Selective Detection,” DNA And Cell Biology, 12(5):441-453, 1993, Mary Ann Liebert, Inc. Publishers.Applicant
- Ku{hacek over (c)}era et al., “Pathways of the Early Propagation of Virulent and Avirulent Rabies Strains from the Eye to the Brain,” Journal of Virology, 55(1):158-162, Jul. 1985, American Society for Microbiology.Applicant
- Lefkowitz et al., “Complementation of Vesicular Stomatitis Virus Glycoprotein G Mutant with Wild-Type Protein Expressed from either a Bovine Papilloma Virus or a Vaccinia Virus Vector System,” Virology, 178:373-383, 1990, Academic Press, Inc.Applicant
- Lewis & Emerman, “Passage through Mitosis is Required for Oncoretroviruses but Not for the Human Immunodeficiency Virus,” Journal of Virology, 68(1):510-516, Jan. 1994, American Society for Microbiology.Applicant
- Lewis et al., “Human immunodeficiency virus infection of cells arrested in the cell cycle,” The EMBO Journal, 11(8):3053-3058, 1992, Oxford University Press.Applicant
- Lindemann et al., “Efficient Pseudotyping of Murine Leukemia Virus Particles with Chimeric Human Foamy Virus Envelope Proteins,” Journal of Virology, 71(6):4815-4820, Jun. 1997, American Society for Microbiology.Applicant
- Luo et al., “A virus-neutralizing epitope on the glycoprotein of rabies virus that contain Trp251 is a linear epitope,” Virus Research, 51:35-41, 1997, Elsevier Science B.V.Applicant
- Luo et al., “Antigenic and Functional Analyses of Glycoprotein of Rabies Virus Using Monoclonal Antibodies,” Microbiol. Immunol., 42(3):187-193, 1988.Applicant
- Lytvyn et al., “Comparison of the thymidine kinase genes from three entomopoxviruses,” Journal of General Virology, 73:3235-3240, 1992, SGM, Great Britain.Applicant
- Madan & Curtin, “A 24-base-pair sequence 3′ to the human erythropoietin gene contains a hypoxia-responsive transcriptional enhancer,” Proc. Natl. Acad. Sci. USA, 90:3928-3932, May 1993.Applicant
- Mammano et al., “Truncation of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Allows Efficient Pseudotyping of Moloney Murine Leukemia Virus Particles and Gene Transfer into CD4+ Cells,” Journal of Virology, Apr. 1997, American Society for Microbiology.Applicant
- Mann et al., “Construction of a Retrovirus Packagin Mutant and its Use to Produce Helper-Free Defective Retrovirus,” Cell, 33:153-159, May 1983, MIT.Applicant
- Martarano et al., “Equine Infectious Anemia Virus trans-Regulatory Protein Rev Controls Viral mRNA Stability, Accumulation, and Alternative Splicing,” Journal of Virology, 68(5):3102-3111, May 1994, American Society for Microbiology.Applicant
- Mebatsion et al., “A CXCR4/CD4 Pseudotye Rhabdovirus That Selectively Infects HIV-1 Envelope Protein-Expressing Cells,” Cell, 90:841-847, Sep. 1997, Cell Press.Applicant
- Meyer et al., “Mapping of deletions in the genome of the highly attenuated vaccina virus MVA and their influence on virulence,” Journal of General Virology, 72:1031-1038, 1991, SGM, Great Britain.Applicant
- Miletic et al., “Retroviral Vectors Pseudotyped with Lymphocytic Choriomeningitis Virus,” Journal of Virology, 73(7):6114-6116, Jul. 1999, American Society for Microbiology.Applicant
- Mitchell et al., “Vectors for the Inducible Overexpression of Glutathione S-Transferase Fusion Proteins in Yeast,” Yeast, 9:715-723, 1993.Applicant
- Morimoto et al., “Syncytium Formation Is Induced in the Murine Neuroblastoma Cell Culture Which Produce Pathogenic Type G Proteins of the Rabies Virus,” Virology, 189:203-216, 1992, Academic Press.Applicant
- Moss, “Vaccinia Virus: A Tool for Research and Vaccine Development,” Science, 252:1662-1667, Jun. 1991.Applicant
- Mullen et al., “Tumors Expressing the Cytosine Deaminase Suicide Gene Can Be Eliminated in Vivo with 5-Fluorocytosine and Induce Protective Immunity to Wild Type Tumor,” Cancer Research, 54:1503-1506, Mar. 1994.Applicant
- Nature Biotechnology, 14:556, May 1996.Applicant
- Olsen & Sechelski, “Use of Sodium Butyrate to Enhance Production of Retroviral Vectors Expressing CFTR cDNA,” Human Gene Therapy, 6:1195-1202, Sep. 1995, Mary Ann Liebert, Inc.Applicant
- Olsen et al., “882. An Inducible First Generation Stable Packaging Cell Line for Equine Levinthal Vectors,” Molecular Therapy, vol. 1, No. 5, May 2000, Part 2 of 2 parts.Applicant
- Olsen, “Gene transfer vectors derived from equine infectious anemia virus,” Gene Therapy, 5:1481-1487, 1998, Stockton Press, United Kingdom.Applicant
- Ory et al., “A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes,” Proc. Natl. Acad. Sci. USA, 93:11400-11406, Oct. 1996.Applicant
- Otvos et al., “Glycosylation of synthetic T helper cell epitopic peptides and their antigenic potency and conformation in a sugar location-specific manner,” Biochimica et Biophysica Acta, 1224:68-76, 1994.Applicant
- Pear et al., “Production of high-titer helper-free retroviruses by transient transfection,” Proc. Natl. Acad. Sci. USA, 90:8392-8396, Sep. 1993.Applicant
- Peshavaria & Day, “Molecular structure of the human muscle-specific enolase gene (ENO3),” Biochem. J., 275:427-433, Great Britain.Applicant
- Porath, “Immobilized Metal Ion Affinity Chromatography,” Protein Expression and Purification, 3(4):263-281, 1992, Academic Press, Inc.Applicant
- Rice et al., “Synthesis and Processing of the Transmembrane Envelope Protein of Equine Infectious Anemia Virus,” Journal of Virology, 64(8):3770-3778, Aug. 1990, American Society for Microbiology.Applicant
- Rivella et al., “The cHS4 Insulator Increases the Probability of Retroviral Expression at Random Chromosomal Integration Sites,” Journal of Virology, 74(10):4679-4687, American Society for Microbiology.Applicant
- Roitt et al., “Immunology,” 4th Edition, p. 14.7, Mosby.Applicant
- Rose et al., “Homology Between the Glycoproteins of Vesicular Stomatitis Virus and Rabies Virus,” Journal of Virology, 43(1):361-364, Jul. 1982.Applicant
- Schnitzlein et al., “A rapid method for identifying the thymidine kinase genes of avipoxviruses,” Journal of Virological Methods, 29:341-352, 1988, Elsevier Science Publishers B.V. (Biomedical Division).Applicant
- Seganti et al., “Susceptibility of Mammalian, Avian, Fish, and Mosquito Cell Lines to Rabies Virus Infection,” Acta virol., 34:155-163, 1990.Applicant
- Seif et al., “Rabies Virulence: Effect on Pathogenicity and Sequence Characterization of Rabies Virus Mutations Affecting Antigenic Sit III of the Glycoprotein,” Journal of Virology, 53(3):926-934, Mar. 1985, American Society for Microbiology.Applicant
- Semenza & Wang, “A Nuclear Factor Induced by Hypoxia via De Novo Protein Synthesis Binds to the Human Erythropoietin Gene Enhancer at a Site Required for Transcriptional Activation,” Molecular and Cellular Biology, 12(12):5447-5454, Dec. 1992, American Society for Microbiology.Applicant
- Senter et al., “Anti-tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate,” Proc. Natl. Acad. Sci. USA, 85:4842-4846, Jul. 1998.Applicant
- Sheridan et al., “Generation of Retroviral Packaging and Producer Cell Lines for Large-Scale Vector Production and Clinical Application: Improved Safety and High Titer,” Molecular Therapy, 2(3):262-275, Sep. 2000, The American Society of Gene Therapy.Applicant
- Smith & Moss, “Infectious poxvirus vectors have capacity for at least 25 000 base pairs of foreign DNA,” Gene, 25:21-28, 1983, Elsevier Science Publishers.Applicant
- Soneoka et al., “A transient three-plasmid expression system for the production of high titer retroviral vectors,” Nucleic Acids Research, 23(4):628-633, 1995, Oxford University Press.Applicant
- Takenaka et al., “Rat Pyruvate Kinase M Gene,” The Journal of Biological Chemistry, 264(4):2363-2367, Feb. 1989, The American Society for Biochemistry and Molecular Biology, Inc., USA.Applicant
- Thoulouze et al., “The Neural Cell Adhesion Molecule is a Receptor for Rabies Virus,” Journal of Virology, 72(9):7181-1790, Sep. 1998, American Society for Microbiology.Applicant
- Tomko et al., “HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses,” Proc. Natl. Acad. Sci. USA, 94:3352-3356, Apr. 1997.Applicant
- Tuchiya et al., “Characterization of rabies virus glycoprotein expressed by recombinant baculovirus,” Virus Research, 25:1-13, 1992, Elsevier Science Publishers, B.V.Applicant
- Tuffereau et al., “Low-affinity nerve-growth factor receptor (P75NTR) can serve as a receptor for rabies virus,” The EMBO Journal, 17(24):7250-7259, 1998, Oxford University Press.Applicant
- Tuffereau et al.,“Neuronal Cell Surface Molecules Mediate Specific Binding to Rabies Virus Glycoprotein Expressed by a Recombinant Baculovirus on the Surfaces of Lepidopteran Cells,” Journal of Virology, 72(2):1085-1091, Feb. 1998, American Society for Microbiology.Applicant
- Upton & McFadden, “Identification and Nucleotide Sequences of the Thymidine Kinase Gene of Shope Fibroma Virus,” Journal of Virology, 60(3):920-927, Dec. 1986, American Society for Microbiology.Applicant
- Vanin et al., “Development of High-Titer Retroviral Producer Cell Lines by Using Cre-Mediated Recombination,” Journal of Virology, 71(10):7820-7826, Oct. 1997, American Society for Microbiology.Applicant
- Wang & Semenza, “General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia,” Proc. Natl. Acad. Sci. USA, 90:4304-4308, May 1993.Applicant
- Weir & Moss, “Nucleoside Sequence of the Vaccinia Virus Thymidine Kinase Gene of the Nature of Spontaneous Frameshift Mutations,” Journal of Virology, 46(2):530-537, May 1993, American Society for Microbiology.Applicant
- Whitt et al., “Membrane Fusion Activity, Oligomerization and Assembly of the Rabies Virus Glycoprotein,” Virology, 185:681-688, 1991, Academic Press, Inc.Applicant
- Wickham et al., “Integrin ανβ5 Selectivity Promotes Adenovirus Mediated Cell Membrane Permeabilization,” The Journal of Cell Biology, 127:257-265, 1994, The Rockefeller University Press.Applicant
- Wickham et al., “Integrins ανβ3 and ανβ5 Promote Adenovirus Internalization but Not Virus Attachment,” Cell, 73:309-319, Apr. 1993, Cell Press.Applicant
- Wilcox et al., “Integrin αIIb promoter-targeted expression of gene products in megakaryocytes derived from retrovirus-transduced human hematopoietic cells,” Proc. Natl. Acad. Sci. USA, 96:9654-9659, Aug. 1999.Applicant
- Wolff & Trubetskoy, “The Cambrian period of nonviral gene delivery,” Nature Biotechnology, 16:421-422, May 1998.Applicant
- Xu et al., “Generation of a Stable Cell Line Producing High-Titer Self-Inactivating Lentiviral Vectors,” Molecular Therapy, 3(1):97-104, Jan. 2001, The American Society for Gene Therapy.Applicant
- Yang et al.,“Inducible, High-Level Production of Infectious Murine Leukemia Retroviral Vector Particles Pseudotyped with Vesicular Stomatitis Virus G Envelope Protein,” Human Gene Therapy, 6:1203-1213, Sep. 1995, Mary Ann Liebert, Inc.Applicant
- Yee et al., “A general method for the generation of high-titer, pantropic retroviral vectors: Highly efficient infection of primary hepatocytes,” Proc. Natl. Acad. Sci. USA, 91:9564-9568, Sep. 1994.Applicant
- Yoshida et al., “VSV-G-Pseudotyped Retroviral Packaging through Adenovirus-Mediated Inducible Gene Expression,” Biochemical and Biophysical Research Communications, 232:379-382, 1997, Academic Press.Applicant
- Yu et al., “Self-activating retroviral vectors designed for transfer of whole genes into mammalian cells,” Proc. Natl. Acad. Sci. USA, 83:3194-3198, May 1986.Applicant
- Zufferey et al., “Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors,” Journal of Virology, 73(4):2886-2892, American Society for Microbiology.Applicant
- http://hiv-web.lanl.gov/content/index, Nov. 25, 2002.Applicant
- http://www.ncbi.nlm.mih.gov/, Nov. 25, 2002.Applicant