Drosophila sequences

[0002] The present invention relates to Drosophila genes and methods for their use. The invention provides nucleotide sequences of Drosophila genes, amino acid sequences of the encoded proteins, and derivatives (e.g., fragments) and analogs thereof. The invention further relates to fragments (and derivatives and analogs thereof) of proteins which comprise one or more domains of a Drosophila protein. Antibodies to Drosophila proteins, and derivatives and analogs thereof, are also provided. Also provided herein are vectors and host cells comprising such nucleic acids. Methods of production of a Drosophila protein (e.g., by recombinant means), and derivatives and analogs thereof, are provided. Chimeric polypeptide molecules comprising polypeptides of the invention fused to heterologous polypeptide sequences are provided. Methods to identify the biological function of a Drosophila gene are provided, including various methods for the functional modification (e.g., overexpression, underexpression, mutation, knock-out) of one gene, or of two or more genes simultaneously. Methods to identify a Drosophila gene which modifies the function of, and/or functions in a downstream pathway from, another gene are provided. The invention further provides for use of Drosophila proteins as media additives or pesticides.

[0003] Citation of a reference herein shall not be construed as an admission that such reference is prior art to the present invention.

[0004] G-protein coupled receptors (GPCRs) form an extensive family of transmembrane regulatory proteins that elicit intracellular signals in nearly every physiological system of chordates and invertebrate organisms. As a consequence of relatively small ligand-binding sites and the wide range of physiological events which they regulate, GPCRs have established the precedent of being the largest class of drug targets in humans. As described below, the sequence conservation of GPCRs across vertebrate and invertebrate species suggests that novel receptors identified in invertebrate species could aid in identification of homologues in other species, and the application of the appropriate agonist or antagonist mammalian receptor drugs to invertebrate species could result in the identification of effective pesticide agents. GPCRs can be divided into five broad structural classes, A-E, based on amino acid sequence similarity and sequence motifs. The largest class is class A, which can, in turn, be divided into subgroups according to receptor sequence similarity and ligand characteristics. The categorization of these relationships is illustrated by the following examples:

[0005] Class A (rhodopsin-like) GPCRs include: biogenic amine receptors (e.g. α-adrenergic, β-adrenergic, dopamine, histamine, muscarinic acetylcholine, melatonin, 5-HT, octopamine and tyramine); peptidic ligand receptors (e.g., angiotensin, bombesin, chemokine, endothelin, galanin, hormone protein, F-met-leu-phe, melanocortin, N-formyl peptide, neuropeptide Y, neurokinin, opiate, tachykinin, vasopressin, oxytocin and somatostatin); rhodopsin receptors (e.g., vertebrate rhodopsin, arthropod rhodopsin, and olfactory receptors); prostanoid receptors (e.g., prostaglandin, prostacyclin, and thromboxane); nucleotide receptors (e.g., adenosine and purinoceptors); hormone-releasing GPCRs (e.g., gonadotropin-releasing hormone, thyrotropin-releasing hormone, growth hormone, and secretagogue GPCRs);

[0006] Class B (secretin like) GPCRs include calcitonin, calcitonin releasing factor, calcitonin gene-related peptide, gastrin, cholecystokinin, glucagon, growth hormone-releasing hormone, parathyroid hormone, vasoactive intestinal peptide, PACAP, diuretic hormone and secretin GPCRs;

[0007] Class C (metabotropic glutamate-like) GPCRs include metabotropic glutamate, metabotropic GABA_B, and extracellular calcium-sensing GPCRs;

[0008] Class D includes pheromone GPCRs; and

[0009] Class E includes cAMP-binding GPCRs.

[0010] Among their many functions, extensive study has revealed that GPCRs play a prominent role as receptors for neurotransmitters within the central and peripheral nervous systems, notably illustrated by the biogenic amine ligands such as norepinephrine (NE), octopamine (Oct), dopamine (DA), acetylcholine (ACh) and 5-hydroxytryptamine (5-HT). Several GPCRs for the biogenic amines have been identified in insects by pharmacological and molecular cloning approaches, including two octopamine/tyramine receptors from Drosophila melanogaster(Arakawa et al., 1990, Neuron 4, 343-354; Saudou et al., 1990, EMBO 9, 3611-3617; Han et al., 1990, J. Neurosci. 18, 3650-3658; see also Venter et al, U.S. Pat. Nos. 5,474,898 and 5,344,776) as well from other insect species such as moth, locus, and honey bee (von Nickisch-Rosenegk et al., 1996, Insect Biochem. Mol. Biol. 26: 817-827; Hiripi et al., 1994, Brain Res. 7, 119-126; Roeder et al., 1995, Prog. Brain Res. 106, 249-258; Evans, 1987, J. Exp. Biol. 129:239-250; Ebert et al., 1998, Insect Mol. Biol. 7, 151-162). Two putative Drosophila dopamine receptors, (Sugamori et al., 1995, FEBS Lett. 362, 131-138; Feng et al., 1996, J. Neurosci. 16, 3925-3933), two 5-HT receptors (Saudou et al., 1992, EMBO J. 11, 7-17), and one muscarinic acetylcholine receptor (Shapiro et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86, 9039-9043) have been identified and molecularly cloned, and are shown to be expressed in the nervous system. Glutamate and GABA are also CNS neurotransmitters involved in memory and mediation of pain sensation, and the metabotropic glutamate and GABA GPCRs form a structurally separate class of receptors (Class C). A Drosophila metabotropic glutamate receptor has been cloned and is expressed in the embryonic central nervous system (CNS) (Parmentier et al., 1996, J. Neurosci. 16, 6687-6694).

[0011] Other classes of GPCRs, such as rhodopsins and odorant receptors, are light and chemosensory receptors for the CNS and enable the senses of vision and odor. A number of rhodopsin genes have been identified and sequenced from Drosophila melanogaster, virilis, and simulans(Carulli et al., 1994, J. Mol. Evol. 38, 250-262), honey bee (Bellingham et al., 1997, Eur. J. Biochem. 243, 775-781; Townson et al., 1998, J. Neurosci. 18, 2412-2422), ant and tobacco hornworm (Chase et al., 1997, J. Exp. Biol. 200, 2469-2478; Popp et al., 1996, Invert. Neurosci. 1, 323-329). Related to actions within the nervous system, GPCRs regulate aspects of neuroendocrine secretion such as thyroid releasing hormone (TRH), thyroid stimulating hormone (TSH), growth hormone releasing hormone (GHRH), adrenocorticotropin (ACTH), and water balance via diuretic hormone or vasopressin. Extending to the regulation of cell growth and mammalian reproduction, GPCRs can couple to mitogenic pathways as illustrated by the bombesin and endothelin receptors, and can control ovulation, lactation and birth through the action of follicular stimulating hormone (FSH), luteinizing hormone (LH), and oxytocin.

[0012] Numerous neuropeptides have been identified from insects which perform similar overall roles to some of these mammalian peptides. However, the molecular characterization is incomplete with respect to the insect GPCRs which bind these analogous peptides; several may be homologous to mammalian receptors. A number of diuretic peptides, including an arginine vasopressin-like diuretic hormone, have been identified in locusts (Lehmberg et al., 1991, Biochem. Biophys. Res. Comm. 179, 1036-1041; Thompson et al., 1995, Peptides 16, 95-104; Schoofs et al., 1997, Peptides 18, 145-156; Proux et al., 1987, Biochem. Biophys. Res. Comm. 149, 180-186), while a diuretic hormone GPCR has been cloned from the house cricket and tobacco hornworm (Reagan, 1996, Insect Biochem. Mol. Biol. 26, 1-6; Reagan, 1994, Biol. Chem. 269, 9-12). A Drosophila GPCR with 50% identity to the transmembrane regions of rat TSH, FSH, and LH receptors has been cloned and sequenced (Hauser et al., 1997, J. Biol. Chem. 272, 1002-1010). Within the immune system, GPCRs can influence neutrophil chemotaxis through the action of chemokines, while modulation of digestion via gastric secretion and gut motility is regulated through GPCRs by the peptidic ligands gastrin and cholecystokinin (CCK). Insect GPCRs related to chemokine or CCK receptors have not been previously reported. However, leucosulfakin, proctolin, and FMRFamide peptides, which share sequence identity or functions similar to CCK/gastrin, have been isolated from several insect species (Nachman et al., 1986, Science 234, 71-73; Veenstra, 1989, Neuropeptides 14, 145-149; De Loof and Schoofs, 1990, Comp. Biochem. Physiol. [B] 95, 459-468; Starrat and Brown, 1975, Life Sci. 17, 1253-1256; O'Shea and Adams, 1981, Science 213, 567-569), including Drosophila (Nichols et al., 1988, J. Biol. Chem. 263, 12167-12170). These examples suggest a general structural conservation of certain GPCR subclasses across vertebrate and invertebrate species, and reinforce the notion that GPCRs play essential roles in the signaling and regulation of invertebrate physiology, such as for insects.

[0013] Gamma aminobutyric acid (GABA) is an important inhibitory neurotransmitter in both insects and vertebrates (Kuffler et al., 1965, Neurophysiol. 21, 589-601; Usherwood et al., 1965, Neurophysiol. 28, 497-519). In vertebrates, there are three broad families of GABA receptors found on both pre- and post-synaptic membranes. The GABA_Aand GABA_Cfamilies are ionotropic receptors, i.e., ligand-gated ion channels which mediate fast inhibitory neurotransmission (Hevers et al., 1998, Mol. Neurobiol. 18:35-86; Bormann et al., 1995, Trends Neurosci. 18:515-519). Homologs of these ionotropic receptors are known in insects. For example, the receptor rdl belongs to the GABA_Aclass, and is the target of cyclodiene pesticides such as Dieldrin (ffrench-Constant et al., 1993, Naure 363, 449-451).

[0014] The GABA_Bfamily of vertebrate receptors are entirely distinct from the GABA_Aand GABA_Cclasses in structure and mechanism; they are seven transmembrane domain G-protein coupled receptors (GPCRs) which mediate slow, long-lasting inhibitory effects of GABA via G-mediated effects on the activity of adenylate cyclase, and potassium and calcium channels (for review, see Bowery, 1993, GABA_Breceptor pharmacology, Annu. Rev. Pharmacol. Toxicol. 33, 109-147; Kerr and Ong, 1995, GABA_Breceptors, Pharmacol. Ther. 67, 187-246). Initial cloning of the vertebrate GABA_BR1 receptor (Kaupmann et al., 1997, Nature 386, 239-246) suggested that additional subunits may be required to mediate the full physiologic response to GABA. Subsequent work has identified a second subunit, GABA_BR2, which physically associates with GABA_BR1 to form an unusual heteromeric GPCR that appears to mediate the complete physiologic effects of GABA_Breceptors (Kuner et al., 1999, Science 283, 74-77; Jones et al., 1999, Nature 396, 674-678; White et al., 1999, Nature 396, 679-682; and Kaupmann et al., 1999, Nature 396, 683-687).

[0015] Vertebrate GABA_Breceptors are activated specifically by baclofen and 3-aminopropylphosphonous acid (3-APPA) and are blocked by phaclofen, saclofen and CGP35348 (Bowery, 1993, GABA_Breceptor pharmacology, Annu. Rev. Pharmacol. Toxicol. 33, 109-147). However, baclofen is inactive in many invertebrate preparations, leading investigators to question if this receptor class existed in invertebrates (Sattelle et al., 1988, GABA receptors on the cell body membrane of an identified insect motor neuron, Proc. R. Soc. Lond. B 232, 445-456; Benson, 1989, A novel GABA receptor in the heart of a primitive arthropod, Exp. Biol. 147, 421-438 ). Furthermore, photoaffinity crosslinking studies with the ligand CGP71782, did not reveal the presence of GABA_Breceptors in invertebrates, though receptors from several vertebrate species were identified (Kaupmann et al., 1997, Nature 386, 239).

[0016] The biogenic amines form one of the largest subgroups of neurotransmitters, and regulate numerous physiological processes. (see Goodman and Gilman's: The pharmacological basis of therapeutics, ninth edition, p. 118-130, Hardman and Limbird, eds., McGraw-Hill, New York). One of the most widely characterized biogenic amine ligand and receptor systems are those of the catecholamines. These include the adrenergic system (α-adrenergic and β-adrenergic), which is central to autonomic functions such as sympathetic regulation of arteriole smooth muscle contraction and dilatation, and to regulation of heart contractility and conduction velocity. Epineprine and norepinephrine are the physiological adrenergic ligands; they signal their action through β- and α-adrenergic GPCRs. Another catecholamine is dopamine, which can also influence vascular smooth muscle contractility predominately through the action of receptors in the renal, coronary and mesenteric arteriole beds. In the CNS, dopamine plays a critical role in initiating voluntary motor movement through post-synapatic stimulation of the extrapyramidal motor system. Deficits in this pathway are most notable with the uncontrolled tremors observed in human Parkinson's disease. Octopamine is a related biogenic amine whose role in mammals is not clear, but which plays a significant role in invertebrates as a neurotransmitter and hormone (Evans, 1980, Adv. Insect Physiol. 15, 317-473), and acts similarly through a class of GPCRs closely related to the mammalian adrenergic receptors (Arakawa et al., 1990, Neuron 4, 343-354; Evans et al., 1993, Neurochem. Res. 18, 869-874).

[0017] In mammals, the actions of epinephrine and norepinephrine are mediated through three β-adrenergic receptors (β1, β2 and β3) and six α-adrenergic receptors (α1A, α1B, α1D, α2A, α2B and α2C) (see Kobilka, 1992, Annu. Rev. Neurosci. 15, 87-114; Insel, 1993, Exp. Gerontol. 28, 341-348; Hein et al.,1995, Neuropharmacology 34, 357-366). These seven transmembrane-spanning domain GPCRs are charcterized by a large intracellular loop connecting transmembrane domains five and six; this intracellular loop domain contributes to the interaction with specific heterotrimeric G-proteins which mediate downstream second messenger signaling events (Kobilka et al., 1988, Science 240, 1310-1316).

[0018] The β-adrenergic receptors can be distinguished pharmacologically from the α-adrenergic receptors by the use of subtype-specific agonists and antagonists (see Lefkowitz, 1979, Ann. Intern. Med. 91, 450-458; Frielle et al., 1989, Clin. Chem. 35, 721-725; Ruffolo et al., 1995, J. Med. Chem. 38, 3681-3716; and Kobilka et al., 1988, Science 240, 1310-1316). The intracellular effects of ligand-dependent activation of β-adrenergic receptors result principally from the intracellular increase in cAMP via adenylyl cyclases (see Lefkowitz, 1976, In: Properties of purified cholinergic and adrenergic receptors, pp.69-83; Strosberg, 1995, Obes. Res. 4, 501S-505S). Subtype diversity of α-adrenergic receptors is correlated to the intracellular signaling through multiple but specific effector pathways. These include IP₃and Ca⁺²mobilization, diacylglycerol (α1A-D), activation of adenylyl cyclase, decreased cAMP, increased K⁺conductance, and decreased Ca⁺²conductance (α2A-C) (Kobilka, 1992, Annu. Rev. Neursci. 15:87-114; Hein et al., 1995, Neuropharmacology 34, 357-366).

[0019] Diversity also exists within dopamine GPCR signaling. Five dopamine receptor subtypes (D1-5) have been pharmacologically and molecularly characterized in mammals as being structurally similar to the adrenergic receptors. Subtype-specific agonists and antagonists are available for several of the dopamine receptors, notably for D1-3. The dopamine receptors couple to a similar intracellular signaling pathway as do the adrenergic receptors; D1 receptor elicts the activation of adenylyl cyclase while the D2 receptor is coupled to the decrease of cAMP, reduced Ca⁺²conductance and increased K⁺conductance. Although there have been reports of mammalian octopamine receptors with pharmacological properties distinct from adrenergic and dopamine receptors (Hicks et al., 1979, Brain Res. 157, 402-406), and octopamine exists in mammalian brain (see Axelrod et al., 1977, Nature 265, 501-504), these receptors have not been molecularly identified.

[0020] Catecholamine signaling in invertebrates has, to date, been demonstrated by the existence of dopamine-elicited physiology and GPCRs sharing similarity to mammalian GPCRs. Two dopamine GPCRs have been identified and cloned from Drosophila, (Sugamori et al., 1995, FEBS Lett. 362, 131-138; Feng et al., 1996, J. Neurosci. 16, 3925-3933), and share pharmacological and intracellular signaling characteristics of mammalian D1 and D2 receptors (Sugamori et al., 1995, FEBS Lett. 362, 131-138; Feng et al., 1996, 16, 3925-3933; Yellman et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94, 4131-4136; Reale et al., 1997, J. Neurosci. 17, 6545-6553; Torres et al., 1998, Synapse 29, 148-161). However, the pharmacological profile of the insect D1-like receptor is not totally consistent with the profile exhibited by the mammalian receptor (Sugamori, 1995, FEBS Lett. 362, 131-138). Epinephrine and norepinephrine have been identified in invertebrates and can elict invertebrate biological responses (see Murdock, 1971, Comp. Gen. Pharmacol. 7, 254-274 for review; Watson et al., 1993, J. Pharm. Biomed. Anal. 11-12, 1145-1149; Johnson et al., 1997, J. Comp. Physiol. [B] 167, 89-97; Park et al., 1998, Gen. Comp. Endocrinol. 110, 88-95). However, the physiological receptors which mediate the action of these catecholamines in invertebrates is not clear. The GPCRs most highly related to the adrenergic receptors in invertebrates are the three octopamine receptors identified in multiple insect species (OCT1-3). The insect octopamine receptors are pharmacologically similar to mammalian α-adrenergic receptors (Evans, 1981, J. Physiol. 318, 99-122; Evans, 1987, J. Exp. Biol. 129, 239-250; Venter et al., 1988, Biochem. Pharmacol. 38, 1197-1208; Nathanson, 1993, Pharmacol. Exp. Ther. 265, 509-515; see also Evans et al., 1993, Neurochem Res. 18, 869-874). However, there can be considerable cross-interaction of mammalian dopaminergic and adrenergic receptor agonists and antagonists with the invertebrate octopamine and related tyramine receptors, resulting in difficulties in assigning the specific signaling role for a given invertebrate biogenic amine receptor.

[0021] Accordingly, there exists a need in the art to determine the identity and role of GPCRs in invertebrates, including flies and other insects. Such determinations may lead to the development of powerful and specific pesticides, and further, may enhance understanding of mammalian, including human, physiologic functions of this important superfamily of receptor molecules. This invention provides novel fly GPCRs and methods for their use, as described in detail below.

[0022] Knowledge of the expressed and/or genomic sequences of an organism is a great aid to the use of that organism as a research tool in the study of genes and their function. Drosophila melanogaster is a model system that enables powerful genetic manipulations and studies not available in higher organisms, and thus knowledge of its expressed sequences is highly desired. The present invention also provides such nucleotide and protein sequences of D. melanogaster genes.

[0023] The present invention relates to full-length and partial nucleotide sequences. of D. melanogastergenes, including full-length fly GPCR genes, amino acid sequences of the encoded proteins, and derivatives (e.g., fragments) and analogs thereof. Nucleic acids capable of hybridizing to or complementary to the foregoing nucleotide sequences are also provided. The invention further relates to a method of identifying genes that are modified by, or that participate in signal transduction with, D. melanogasterGPCR genes. The invention still further relates to derivatives and analogs of D. melanogasterGPCR genes and proteins which are functionally active (e.g., “minigenes”), and to D. melanogasterprotein fragments which are capable of displaying one or more known functional activities associated with a full-length (wild-type) GPCR protein. Such functional activities include but are not limited to antigenicity (ability to bind to, or to compete for binding with, an anti-peptide antibody), immunogenicity (ability to generate antibody), and ability to bind to (or to compete for binding with) a GPCR ligand. The invention further relates to a fragment (or a derivative or analog thereof) of a D. melanogasterGPCR protein which comprises one or more domains of the protein, such as a transmembrane domain, a ligand-binding domain, or a cytosolic domain (e.g., the intracellular loop domain between transmembrane domains five and six of the GPCR). Antibodies to D. melanogasterGPCR proteins, and derivatives and analogs thereof, are additionally provided. Methods of production of such proteins, derivatives and analogs, e.g., by recombinant means, are also provided. Methods to identify the biological function of a Drosophila GPCR gene are provided, including various methods for the functional modification (e.g., overexpression, underexpression, mutation, knock-out) of one gene, or of two or more genes simultaneously. Methods to identify a Drosophila gene which modifies the function of, and/or functions in an upstream or downstream pathway from, a D. melanogasterGPCR gene are provided. The invention further provides for use of Drosophila GPCR proteins, derivatives, fragments, or ligands thereof as media additives or pesticides.

[0024] This invention provides a method of detecting the effect of expression of a D. melanogasterGPCR gene which encodes a D. melanogasterGPCR protein comprising an amino acid sequence as set forth in FIG. 1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4), FIG. 3 (SEQ ID NO:6), or FIG. 4 (SEQ ID NO:32,370), on a D. melanogastersignaling pathway, the method comprising: (a) mutating or abnormally expressing a wild-type D. melanogasterGPCR gene that encodes a protein comprising an amino acid sequence as set forth in FIG. 1 (SEQ ID NO:2), FIG. 2 (SEQ ID NO:4), FIG. 3 (SEQ ID NO:6), or FIG. 4 (SEQ ID NO:32,370), in a fly already having a mutation in a D. melanogastersignaling pathway that displays a phenotype-of-interest; and (b) detecting the effect of step (a) on the phenotype-of-interest, so as to detect the effect of expression of the D. melanogasterGPCR gene.

[0025] This invention provides a cell culture medium or medium supplement comprising: (a) a sterile liquid carrier; and (b) a protein encoded by a first nucleic acid which hybridizes under conditions selected from the group consisting of high stringency, moderate stringency and low stringency to a second nucleic acid, which second nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:741. In another embodiment, the nucleotide sequence is selected from the group consisting SEQ ID NO:15,289 through SEQ ID NO:31,635.

[0026] The invention provides a purified Drosophila melanogasterG-protein coupled receptor (“GPCR”) comprising or defined by the amino acid sequence set forth in SEQ ID NO:2, 4, 6 or 32,370, as well as purified derivatives thereof which are able to display one or more functional activities of a Drosophila melanogasterGPCR protein. In particular embodiments, the derivative is able to be bound by an antibody directed against a Drosophila melanogasterGPCR protein, or is a fragment.

[0027] The invention also provides a purified fragment of a Drosophila melanogasterGPCR, which fragment comprises a domain of the GPCR protein selected from the group consisting of the extracellular domain, the intracellular domain, a membrane spanning domain, and the ligand-binding domain. In a particular embodiment, the fragment comprises at least one membrane spanning domain.

[0028] The invention also provides a mature Drosophila melanogasterGPCR protein defined by an amino acid sequence of SEQ ID NO:2, 4, 6 or 32,370 from which the secretory signal peptide sequence has been removed.

[0029] The invention further provides a purified protein comprising at least 25 contiguous amino acids of the sequence set forth in any one of SEQ ID NO:2, 4, 6 or 32,370. In a specific embodiment, such protein is fused to a second protein that is not a GPCR protein. The invention further relates to a chimeric protein comprising a fragment of a Drosophila melanogasterGPCR protein consisting of at least 25 contiguous amino acids of the an amino acid sequence set forth in SEQ ID NO:2, 4, 6 or 32,370 fused to a second protein, in which the second protein is not the GPCR protein.

[0030] Also provided by the invention is an antibody which is capable of binding a Drosophila melanogasterGPCR protein and which does not bind a GPCR protein of another species.

[0031] The invention also provides an isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, 3, 5 or 741 or a coding region thereof. In a specific embodiment the nucleic acid is DNA. The invention further provides an isolated RNA comprising the sequence of SEQ ID NO:1, 3, 5 or 741 wherein T (thymidine) residues are substituted by U (uracil) residues. Nucleic acids comprising a nucleotide sequence complementary to the nucleotide sequence of the foregoing nucleic acids are also provided.

[0032] The invention further provides an isolated nucleic acid comprising at least 50 contiguous nucleotides of SEQ ID NO:1, 3, 5 or 741.

[0033] Recombinant vectors comprising the above-described nucleic acids are also provided, as are recombinant host cells containing such a vector or a recombinant form of the nucleic acid.

[0034] The invention also provides a method for producing a Drosophila melanogasterGPCR protein comprising growing a recombinant cell containing the above-described vectors such that the GPCR protein encoded by said nucleic acid is expressed by the cell, and recovering the expressed GPCR protein. Also provided is the product of such method, said product being purified.

[0035] The invention further relates to a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising a fragment of a GPCR protein, said fragment (i) lacking an intracellular domain and a transmembrane domain, and (ii) exhibiting a functional activity of said GPCR protein; and a pharmaceutically acceptable carrier.

[0036] Another pharmaceutical composition provided by the invention comprises a therapeutically effective amount of an antibody that binds to the extracellular domain of a GPCR protein; and a pharmaceutically acceptable carrier. Alternatively, or additionally, the pharmaceutical composition comprises a therapeutically effective amount of a molecule comprising a nucleic acid encoding a fragment of a GPCR protein and a pharmaceutically acceptable carrier, said fragment (i) lacking an intracellular domain and a transmembrane domain, and (ii) exhibiting a functional activity of said GPCR protein.

[0037] The invention provides a purified Drosophila melanogasterprotein which is encoded by a first nucleic acid that is hybridizable under high, moderate or low stringency conditions to a second nucleic acid, said second nucleic acid defined by the nucleotide sequence as set forth in SEQ ID NO:1, 3, 5 or 741.

[0038] The invention provides an isolated nucleic acid comprising a nucleotide sequence which encodes an amino acid sequence set forth in SEQ ID NO:2, 4, 6 or 32,370.

[0039] The invention provides a non-human transgenic animal which contains a recombinant nucleotide sequence that is inserted into or replaces at least a portion of the genomic sequence corresponding to the nucleotide sequence set forth in SEQ ID NO:1, 3, 5 or 741.

[0040] The invention provides a method for identifying a molecule that binds to a protein, said protein comprising an amino acid sequence depicted in SEQ ID NO:2, 4, 6 or 32,370, comprising contacting one or more candidate molecules with said protein under conditions conducive to binding to said protein; and detecting any binding that occurs of said candidate molecules to said protein.

[0041] The invention provides a method for screening for a molecule that modulates directly or indirectly the formation of a complex of a protein comprising an amino acid sequence depicted in SEQ ID NO:2, 4, 6 or 32,370 and its respective ligand comprising measuring the level of said complex formed under conditions conducive to formation of the complex, and comparing the levels of said complex with the levels of said complex that are formed in the absence of said molecule, wherein a higher or lower level of said complex in the presence of said molecule indicates that the molecule modulates formation of said complex.

[0042] The invention provides a method for screening for a molecule that modulates directly or indirectly the activity of a protein comprising an amino acid sequence depicted in SEQ ID NO:4 comprising measuring the potassium conductance of a cell expressing said protein in the presence of a candidate molecule, and comparing the levels of potassium conductance with the levels of potassium conductance in the absence of said molecule, wherein a higher or lower level of potassium conductance in the presence of said molecule indicates that the molecule modulates the potassium conductance of a cell expressing said protein.

[0043] The invention further provides a purified Drosophila melanogasterchitin synthase comprising or defined by the amino acid sequence set forth in SEQ ID NO:42,135, as well as a purified derivative of the chitin synthase, which is able to display one or more functional activities of a Drosophila melanogasterchitin synthase. In a specific embodiment, the derivative is able to be bound by an antibody directed against a Drosophila melanogasterchitin synthase. In another specific embodiment, the derivative is a fragment. The invention also provides a purified fragment of a Drosophila melanogasterchitin synthase protein, which fragment comprises a domain of the protein selected from the group consisting of the extracellular domain, the intracellular domain, a membrane spanning domain, and the catalytic domain. In a specific embodiment, the fragment comprises at least one membrane spanning domain.

[0044] The invention also provides a mature Drosophila melanogasterchitin synthase protein defined by the amino acid sequence set forth in SEQ ID NO:42,135 from which the secretory signal peptide sequence has been removed. Also provided is a purified protein comprising at least 25 contiguous amino acids of the amino acid sequence set forth in SEQ ID NO:42,135; in a specific embodiment, such protein is fused to a second protein that is not a chitin synthase protein. The invention further relates to a chimeric protein comprising a fragment of a Drosophila melanogasterchitin synthase protein consisting of at least 25 contiguous amino acids of the amino acid sequence set forth in SEQ ID NO:42,135 fused to a second protein, in which the second protein is not the GPCR protein.

[0045] The invention further provides an antibody which is capable of binding a chitin synthase protein as described above, and which does not bind another Drosophila melanogasterchitin synthase protein.

[0046] Also provided is an isolated nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO:10,540 or a coding region thereof. In a specific embodiment, the nucleic is DNA. The invention also relates to an isolated RNA comprising the sequence of SEQ ID NO:10,540 wherein T (thymidine) residues are substituted by U (uracil) residues. The invention further provides an isolated nucleic acid comprising a nucleotide sequence complementary to the nucleotide sequence of one of the above-described nucleic acids. The invention also provides an isolated nucleic acid comprising at least 50 contiguous nucleotides of SEQ ID NO:10,540. A recombinant vector comprising an above-described nucleic acid, and a recombinant host cell containing the vector, are also provided. The invention further relates to a recombinant host cell containing an above-described nucleic acid, said nucleic acid being recombinant. The invention provides a method for producing a Drosophila melanogasterchitin synthase protein comprising growing a recombinant cell containing the above-described vector such that the chitin synthase protein encoded by said nucleic acid is expressed by the cell, and recovering the expressed chitin synthase protein; the purified product of such method is also provided. The invention further provides a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising a fragment of the above-described chitin synthase protein, said fragment comprising the catalytic domain of the chitin synthase protein; and a pharmaceutically acceptable carrier. Also provided is a pharmaceutical composition comprising a therapeutically effective amount of an antibody that binds to the catalytic domain of the above-described chitin synthase protein; and a pharmaceutically acceptable carrier. The invention further provides a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising a nucleic acid encoding a fragment of the above-described chitin synthase protein and a pharmaceutically acceptable carrier, said fragment comprising the catalytic domain of the chitin synthase protein.

[0047] The invention provides a purified Drosophila melanogasterprotein which is encoded by a first nucleic acid that is hybridizable under high, moderate or low stringency conditions to a second nucleic acid, said second nucleic acid defined by the nucleotide sequence set forth in SEQ ID NO:10,540.

[0048] The invention also provides an isolated nucleic acid comprising a nucleotide sequence which encodes the amino acid sequence set forth in SEQ ID NO:42,135.

[0049] The invention also provides a non-human transgenic animal which contains a recombinant nucleotide sequence that is inserted into or replaces at least a portion of the genomic sequence corresponding to the nucleotide sequence set forth in SEQ ID NO:10,540.

[0050] The invention also provides a method for identifying a molecule that binds to a protein, said protein comprising the amino acid sequence set forth in SEQ ID NO:42,135, comprising contacting one or more candidate molecules with said protein under conditions conducive to binding to said protein; and detecting any binding that occurs of said candidate molecules to said protein.

[0051] The invention also provides a method for screening for a molecule that modulates directly or indirectly the activity of a protein comprising the amino acid sequence depicted in SEQ ID NO:42,135 comprising measuring the chitin synthase activity of a cell expressing said protein in the presence of a candidate molecule, and comparing the levels of chitin synthase activity with the levels of chitin synthase activity in the absence of said molecule, wherein a higher or lower level of chitin synthase activity in the presence of said molecule indicates that the molecule modulates the chitin synthase activity of a cell expressing said protein.

[0052] The invention also provides a method for protecting a plant or animal against a pest comprising contacting the plant or animal with a pesticide formulation comprising (3-aminopropyl)methylphosphinic acid, and a carrier.

[0053] The invention also provides a purified protein comprising an amino acid sequence of any one amino acid sequence of SEQ ID NOS:31,636 to 46,852.

[0054] The invention also provides a purified protein comprising an amino acid sequence of any one amino acid sequence of SEQ ID NOS:46,853 to 62,485.

[0055] Also provided is a purified protein comprising an amino acid sequence of at least n contiguous amino acids of any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, n is the number of amino acids listed in the column entitled “100% identity length” in Table 2. In particular embodiments, such purified protein comprises an amino acid sequence of least n+10 contiguous amino acids of any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, n is the number of amino acids listed in the column entitled “100% identity length” in Table 2; or comprises an amino acid sequence of least n+50 contiguous amino acids of any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, n is the number of amino acids listed in the column entitled “100% identity length” in Table 2.

[0056] The invention also provides a purified protein comprising an amino acid sequence having a BLAST score value of at least b when compared to any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, b has a value greater than the BLAST score value listed in the column entitled “BLAST score” in Table 2 for each respective SEQ ID NO, and wherein the BLAST score is determined using the same algorithm as used to calculate the BLAST score value of Table 2. In specific embodiments, for each respective SEQ ID NO, b has a value 3% greater than the BLAST score value listed in the column entitled “BLAST score” in Table 2 for each respective SEQ ID NO; or for each respective SEQ ID NO, b has a value 10% greater than the BLAST score value listed in the column entitled “BLAST score” in Table 2 for each respective SEQ ID NO.

[0057] The invention provides a purified derivative of one of the above-described proteins, which derivative is able to display one or more functional activities of said protein. In a specific embodiment, such derivative is able to be bound by an antibody directed against said protein.

[0058] The invention provides a purified fragment of a protein, said protein defined by an amino acid sequence of any one of SEQ ID NOS:31,636 to 62,485, said fragment comprising one or more domains of the protein as set forth in the column entitled “PFam motifs” or the column entitled “Prosite motifs” for each respective SEQ ID NO in Table 2.

[0059] The invention provides a purified fragment of a protein, said fragment defined by an amino acid sequence of at least n contiguous amino acids of any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, n is the number of amino acids listed in the column entitled “100% identity length” in Table 2. In specific embodiments, the above-described protein or fragment comprises a protein domain as set forth in the corresponding column entitled “PFam motifs” or the column entitled “Prosite motifs” for each respective SEQ ID NO in Table 2.

[0060] The invention provides a purified fragment of a protein, said fragment defined by an amino acid sequence of at least n+50 contiguous amino acids of any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, n is the number of amino acids listed in the column entitled “100% identity length” in Table 2. In specific embodiments, such fragment comprises a protein domain as set forth in the corresponding column entitled “PFam motifs” or the column entitled “Prosite motifs” for each respective SEQ ID NO in Table 2.

[0061] The invention provides a purified fragment of a protein, said protein defined by an amino acid sequence having a BLAST score value of at least b when compared to any one amino acid sequence of SEQ ID NOS:31,636 to 62,485, wherein for each respective SEQ ID NO, b has a value greater than the BLAST score value listed in the column entitled “BLAST score” in Table 2 for each respective SEQ ID NO, said fragment comprising a domain of the protein as set forth in the column entitled “PFam motifs” or the column entitled “Prosite motifs” for each respective SEQ ID NO in Table 2, and wherein the BLAST score is determined using the same algorithm as used to calculate the BLAST score value of Table 2. In a specific embodiment, for each respective SEQ ID NO, b has a value 10% greater than the BLAST score value listed in the column entitled “BLAST score” in Table 2 for each respective SEQ ID NO.

[0062] The invention provides an isolated nucleic acid comprising a nucleotide sequence of any one nucleotide sequence of SEQ ID NOS:7 to 15,288 or a coding region thereof.

[0063] The invention provides an isolated nucleic acid comprising a nucleotide sequence of any one nucleotide sequence of SEQ ID NOS:15,289 to 31,635 or a coding region thereof.

[0064] The invention provides an isolated nucleic acid comprising a nucleotide sequence complementary to any one nucleotide sequence of SEQ ID NOS:7 to 31,635.

[0065] The invention provides an isolated RNA molecule comprising a coding region of any one of SEQ ID NOS:7 to 31,635, wherein T (thymidine) residues are replaced with U (uracil) residues.

[0066] The invention provides an isolated nucleic acid comprising a nucleotide sequence of at least n contiguous nucleotides of any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, n is the number of nucleotides listed in the column entitled “100% identity length” in Table 1. In specific embodiments, such nucleic acid comprises a nucleotide sequence comprising at least n+25 contiguous nucleotides of any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, n is the number of nucleotides listed in the column entitled “100% identity length” in Table 1; or comprises a nucleotide sequence comprising at least n+50 contiguous nucleotides of any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, n is the number of nucleotides listed in the column entitled “100% identity length” in Table 1.

[0067] The invention provides an isolated first nucleic acid capable of hybridizing to a second nucleic acid consisting of any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, under hybridization condition x, wherein for each respective SEQ ID NO, x is the hybridization condition listed in the corresponding column entitled “hybriz. conditions” in Table 1. In a specific embodiment, the first nucleic acid encodes a protein (i) comprising a protein domain of the deduced protein sequence for the respective SEQ ID NO, as set forth in Table 1; or (ii) capable of being bound by an antibody to a protein defined by the deduced protein sequence for the respective SEQ ID NO, as set forth in Table 1.

[0068] The invention provides an isolated nucleic acid comprising a nucleotide sequence having at least z % sequence identity with any contiguous 125 bases of any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, z has a value greater than the value listed in the column entitled “125 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1. In specific embodiments, such nucleic acid comprises a nucleotide sequence having at least z % sequence identity with any contiguous 125 bases of any nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, z has a value 3% greater than the value listed in the column entitled “125 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1; or comprises a nucleotide sequence having at least z % sequence identity with any contiguous 125 bases of any nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, z has a value 10% greater than the value listed in the column entitled “125 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1.

[0069] The invention provides an isolated nucleic acid comprising a nucleotide sequence having at least w % sequence identity with any contiguous 275 bases of any nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence complementary thereto, wherein for each respective SEQ ID NO, w has a value greater than the value listed in the column entitled “275 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1. In specific embodiments, such nucleic acid comprises a nucleotide sequence having at least w % sequence identity with any contiguous 275 bases of any nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence complementary thereto, wherein for each respective SEQ ID NO, w has a value 3% greater than the value listed in the column entitled “275 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1; or comprises a nucleotide sequence having at least w % sequence identity with any contiguous 275 bases of any nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence complementary thereto, wherein for each respective SEQ ID NO, w has a value 10% greater than the value listed in the column entitled “275 bp % identity” in Table 1, and wherein the % sequence identity is determined using the same algorithm as used to calculate the % sequence identity value of Table 1.

[0070] The invention provides an isolated nucleic acid comprising a nucleotide sequence having a BLAST score value of at least b when compared to any one nucleotide sequence of SEQ ID NOS:7 to 31,635, or a nucleotide sequence reverse complementary thereto, wherein for each respective SEQ ID NO, b has a value greater than the BLAST score value listed in the column entitled “BLAST score” in Table 1 for each respective SEQ ID NO, and wherein the BLAST score is determined using the same algorithm as used to calculate the BLAST score value of Table 1. In specific embodiments, for each respective SEQ ID NO, b has a value 3% greater than the BLAST score value listed in the column entitled “BLAST score” in Table 1 for each respective SEQ ID NO; or b has a value 10% greater than the BLAST score value listed in the column entitled “BLAST score” in Table 1 for each respective SEQ ID NO.

[0071] In specific embodiments, the above-described nucleic acids are DNA.

[0072] Isolated nucleic acids comprising a nucleotide sequence encoding an above-described protein are also provided.

[0073] The invention provides an isolated nucleic acid comprising a nucleotide sequence which is at least 65% similar over an at least 20 contiguous nucleotides to any one of the nucleotide sequences of SEQ ID NOS:7-31,635. The invention also provides an isolated nucleic acid comprising a nucleotide sequence which is at least 95% similar over an at least 20 contiguous nucleotides to any one of the nucleotide sequences of SEQ ID NOS:7-31,635. In specific embodiments, such nucleic acid encodes a protein comprising a domain of the protein encoded by any one of SEQ ID NOS:7-31,635 as set forth in the column entitled “PFAM motifs” or the column entitled “Prosite motifs” for each respective SEQ ID NO in Table 2.

[0074] Recombinant vectors comprising the above-described nucleic acids, and recombinant host cell containing such vectors or containing the nucleic acid in recombinant form are also provided. The invention also provides a method for producing a protein comprising growing a recombinant cell containing such a vector such that the protein encoded by said nucleic acid is expressed by the cell, and recovering the expressed protein. The purified product of such method is also provided.

[0075] The invention provides an antibody which is capable of binding an amino acid sequence of any one of SEQ ID NOS:46,853 to 62,485.

[0076] The invention provides a transgenic non-human animal which contains a recombinant nucleotide sequence that is inserted into or replaces at least a portion of the genomic sequence corresponding to the nucleotide sequence set forth in any one of SEQ ID NOS:7 to 31,635.

[0077] The invention provides a computer readable medium having recorded thereon the amino acid sequence of any one of SEQ ID NOS:31,636 to 62,485 or a nucleotide sequence of any one of SEQ ID NOS:7 to 31,635.

[0078] The invention provides a computer readable medium having recorded thereon amino acid sequences comprising SEQ ID NOS:31,636 to 46,852, respectively, or nucleotide sequences comprising SEQ ID NOS:7-15,288, respectively.

[0079] The invention provides a method for identifying a molecule that binds to a protein, said protein comprising an amino acid sequence of any one of SEQ ID NOS:31,636 to 62,485, comprising contacting one or more candidate molecules with said protein under conditions conducive to binding to said protein; and detecting any binding that occurs of said candidate molecules to said protein.

[0080] FIGS. 1A-1H shows the nucleotide sequence (SEQ ID NO:1) of a cDNA and the derived amino acid sequence (SEQ ID NO:2) of a G-protein coupled receptor (GPCR), herein referred to as “GPCR-3”. Locations of possible N-glycosylation sites of GPCR-3 and approximate starting locations of the transmembrane domains are indicated.

[0081] FIGS. 2A-2S shows the nucleotide sequence (SEQ ID NO:3) of a cDNA and the derived amino acid sequence (SEQ ID NO:4) of a GPCR which is a related to the gamma aminobutyric acid type B (GABA_B) family of receptors, and is herein referred to as “GPCR-2” or “GABA_BR-1” or just “GABA_B”. The approximate location of a cleavable signal peptide (indicated by underlining) and the starting location of the transmembrane domains are indicated.

[0082] FIGS. 3A-3L shows the nucleotide sequence (SEQ ID NO:5) of a cDNA and the derived amino acid sequence (SEQ ID NO:6) of a GPCR which is a receptor for melatonin and is herein referred to as “GPCR-1” or “DOPAD2”. The approximate starting locations of the transmembrane domains are indicated.

[0083] FIGS. 4A-4E shows the nucleotide sequence (SEQ ID NO:741) of a cDNA and the derived amino acid sequence (SEQ ID NO:32,370) of a G-protein coupled receptor (GPCR), herein referred to as “GPCR-4”. Locations of possible N-glycosylation sites of GPCR-4 and approximate starting locations of the transmembrane domains are indicated.

[0084] As described herein, the inventors developed a strategy to search for novel genes in the genome of the fruit fly Drosophila melanogasterby making and using an EST database. Further, certain aspects of Drosophila gene function can now be determined as described herein. The results have revealed, inter alia, a number of novel Drosophila G protein coupled receptors (GPCRs). The Drosophila GPCR proteins exhibit significant sequence diversity. These new GPCR genes in Drosophila provide useful tools for probing the function and regulation of their corresponding biological pathways. Systematic genetic analysis of signaling pathways involving GPCR proteins in Drosophila can be expected to lead to the discovery of new drug targets, therapeutic proteins, diagnostics and prognostics useful in the treatment of diseases and other clinical problems associated with the function of GPCRs in humans and other animals. Furthermore, analysis of these same pathways using Drosophila proteins as tools has utility for identification and validation of pesticide targets that are components of signaling pathways in invertebrate pests.

[0085] Use of Drosophila GPCR and other fly genes of the invention as disclosed herein has advantages over manipulation of known components of fly signaling pathways. First, use of GPCR-encoding Drosophila genes provides a superior approach for identifying factors that are upstream of the receptor in the signal transduction pathway. Specifically, the specific ligands that bind to the novel GPCRs of the invention can now be readily identified. Further, the discovery of multiple, different GPCRs provides a rational approach to separate components involved in responses to different, specific environmental or regulatory signals. This is less technically feasible with manipulation of downstream components of the pathway found in target tissues. Still further, the diversity of different GPCRs provides a means to identify potential new hormones and/or signal transduction systems that are structurally different from those that have been characterized to date, in either vertebrates or invertebrates. Yet still further, use of Drosophila as a system for analyzing the function and regulation of GPCR genes has great advantages over approaches in other organisms due to the ability to rapidly carry out large-scale, systematic genetic screens, as well as the ability to screen small molecules directly on whole organisms for possible therapeutic or pesticide use. Particularly, the fruit fly Drosophila is clearly the preferred genetic model organism for dissecting the function of novel proteins, and for validating potential pesticide targets, with respect to other insect pest species.

[0086] The present invention thus relates to proteins encoded by and nucleotide sequences of D. melanogastergenes including GPCR genes. The invention further relates to fragments and other derivatives and analogs of such proteins. Nucleic acids encoding such fragments or derivatives are also within the scope of the invention. Production of the foregoing proteins, e.g., by recombinant methods, is provided. The invention also relates to protein derivatives and analogs which are functionally active, i.e., which are capable of displaying one or more known functional activities associated with a full-length (wild-type) fly protein. Such functional activities may include but are not limited to antigenicity (ability to bind, or to compete for binding, to an anti-peptide antibody), immunogenicity (ability to generate antibody), and ability to bind (or compete for binding) to a ligand for a fly GPCR.

[0087] The invention further relates to fragments (and derivatives and analogs thereof) of a fly GPCR protein which comprise one or more domains of the fly protein.

[0088] Antibodies to a fly GPCR protein, its derivatives and analogs, are additionally provided.

[0089] Methods for genetic analysis of pathways involving GPCRs in Drosophila are provided. Such methods may yield results of importance to human disease. For example, systematic identification of participants in intracellular signaling by fly GPCRs may provide leads to the identification of drug targets, therapeutic proteins, diagnostics, or prognostics useful for treatment or management of resistance in disease.

[0090] In a specific aspect, the present invention further relates to expressed sequence tag (EST) library analysis for the identification of novel genes, especially invertebrate genes such as fly genes, and their encoded proteins. For example, the EST library analysis of the invention has revealed several full-length invertebrate G-protein coupled receptor (GPCR) proteins and the nucleotide sequences encoding them (see FIGS. 1-4). More specifically, the present invention relates to the complete cDNA and genomic sequences for invertebrate y-aminobutyric acid subtype B (GABA_B) receptors, a melatonin receptor, and orphan receptors with similarity to dopaminergic/adrenergic receptors. The complete cDNA sequences were isolated and determined following identification in the Drosophila melanogasterEST library of the invention, which was produced as the initial part of a discovery strategy for genes encoding novel proteins.

[0091] Identification and analysis of other GPCR EST sequences in the database of the invention indicated the presence of 13 additional novel invertebrate receptor homologues. Moreover, the determination of the existence of invertebrate GABA_Breceptors has enabled the discovery that a compound may have selective effects on insects. The compound, SKF97541, is of unremarkable importance in vertebrate GABA_Breceptor pharmacology (see Knight et al., 1996, The pharmacology of adenylyl cyclase modulation by GABA_Breceptors in rat brain slices, Neuropharmacology 35, 703-712; see for review Bowery, 1993, GABA_Breceptor pharmacology, Ann. Rev. Pharmacol. Toxicol. 33, 109-147). However, when the invertebrate GABA_Breceptors of the invention were discovered, the compound was selected for testing for effects on flies and, remarkably, was found to be toxic in vivo. The results set forth herein thus identify a candidate insecticide. Perhaps more importantly, the results demonstrate the feasibility of progression from analysis of the EST database of the invention to identification of novel full-length genes and gene families, further to prediction of gene function, and finally to validation of such prediction with positive experimental results. This powerful approach has tremendous practical benefits, not only for pesticide discovery and development, but also for the many other applications described herein. For example, in addition to pesticides targeted to the specific GABA_B, adrenergic, and melatonin receptors disclosed herein, the present invention further relates to protein expression and drug screening methods for the development of human drugs of therapeutic value.

[0092] The invention further provides a large number of novel Drosophila EST sequences, contigs comprising the EST sequences, deduced protein sequences of the contigs and the novel EST sequences, and derivatives thereof and antibodies thereto, and further methods of use of the foregoing, as described below. Many of the detailed embodiments disclosed herein are discussed with respect to GPCRs, but are also intended to apply to the sequences of Table 1 and Table 2 hereof, and their corresponding genes and proteins.

[0093] The invention is illustrated by way of examples set forth in Section 6 below which disclose, inter alia, the cloning and characterization of several novel D. melanogasterGPCR genes, and numerous other Drosophila nucleotide and protein sequences.

[0094] For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the subsections which follow.

[0095] The invention relates to nucleotide sequences of D. melanogasternucleic acids. In specific embodiments, such nucleic acids comprise a cDNA sequence of a fly GPCR as set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:741, or nucleic acids encoding a fly GPCR protein (e.g., a protein having the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:32,370). As used herein, a gene “corresponding” to a cDNA sequence shall be construed to mean the gene that encodes the RNA from which the cDNA is derived. The invention provides purified or isolated nucleic acids consisting of at least 8 nucleotides (i.e., a hybridizable portion) of an gene sequence; in other embodiments, such nucleic acids consist of at least 25 (continuous) nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides of a sequence, or a full-length coding sequence. In another embodiment, the nucleic acids are smaller than 35, 200, 500, or 5,000 nucleotides in length. Nucleic acids can be single or double stranded. The invention also relates to nucleic acids hybridizable to or complementary to the foregoing sequences or their reverse complements. In specific aspects, nucleic acids are provided which comprise a sequence complementary to at least 10, 25, 50, 100, or 200 nucleotides or the entire coding region of a gene.

[0096] The invention further relates to certain genomic nucleotide sequences of D. melanogaster, GPCR nucleic acids. In specific embodiments, such nucleic acids comprise the genomic GPCR sequences or the coding regions thereof, or nucleic acids encoding a GPCR protein (e.g., a protein having the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:32,370).

[0097] In the above or alternative embodiments, the nucleic acids of the invention consist of a nucleotide sequence of not more than 2, 5, 10, 15, or 20 kilobases.

[0098] In a specific embodiment, a nucleic acid which is hybridizable to a fly GPCR nucleic acid (e.g., having a sequence as set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:741 or to its reverse complement, or to a nucleic acid encoding a GPCR derivative, or to its reverse complement), under conditions of low stringency is provided. By way of example and not limitation, procedures using such conditions of low stringency are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci. U.S.A. 78, 6789-6792). Filters containing DNA are pretreated for 6 h at 40° C. in a solution containing 35% formamide, 5×SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20×10⁶cpm ³²P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 40° C., and then washed for 1.5 h at 55° C. in a solution containing 2×SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60° C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68° C. and re-exposed to film. Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).

[0099] In another specific embodiment, a nucleic acid which is hybridizable to a fly GPCR nucleic acid, or its reverse complement, under conditions of high stringency is provided. By way of example and not limitation, procedures using such conditions of high stringency are as follows. Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65° C. in buffer composed of 6×SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65° C. in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20×10⁶cpm of ³²P-labeled probe. Washing of filters is done at 37° C. for 1 h in a solution containing 2×SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1×SSC at 50° C. for 45 min before autoradiography. Other conditions of high stringency which may be used are well known in the art.

[0100] In another specific embodiment, a nucleic acid which is hybridizable to a fly GPCR nucleic acid, or its reverse complement, under conditions of moderate stringency is provided. Selection of appropriate conditions for such stringencies is well known in the art (see e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; see also, Ausubel et al., eds., in the Current Protocols in Molecular Biology series of laboratory technique manuals, © 1987-1997, Current Protocols, © 1994-1997 John Wiley and Sons, Inc.; see especially, Dyson, 1991, “Immobilization of nucleic acids and hybridization analysis,” In: Essential Molecular Biology: A Practical Approach, Vol. 2, T. A. Brown, ed., pp. 111-156, IRL Press at Oxford University Press, Oxford, UK).

[0101] Nucleic acids encoding derivatives and analogs of fly GPCR proteins, and fly GPCR antisense nucleic acids are additionally provided. As is readily apparent, as used herein, a “nucleic acid encoding a fragment or portion of a GPCR protein” shall be construed as referring to a nucleic acid encoding only the recited fragment or portion of the protein and not the other contiguous portions of the protein as a continuous sequence.

[0102] Fragments of fly GPCR nucleic acids comprising regions conserved between (i.e., with similarity to) other GPCR nucleic acids, of the same or different species, are also provided. Nucleic acids encoding one or more GPCR domains are also provided.

[0103] In one embodiment, after hybridization, stringency conditions for washing are as follows. Each membrane is washed two times each for 30 minutes each at 45° C. in 40 mM sodium phosphate, pH 7.2, 5% SDS, 1 mM EDTA, 0.5% bovine serum albumin, followed by four washes each for 30 minutes in sodium phosphate, pH 7.2, 1 % SDS, 1 mM EDTA, and subsequently each membrane is treated differently as described below for low, medium, or high stringency hybridization conditions. For low stringency hybridization, membranes are not washed further. For medium stringency hybridization, membranes are additionally subjected to four washes each for 30 minutes in 40 mM sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 55° C. For high stringency hybridization, following the washes for low stringency, membranes are additionally subjected to four washes each for 30 minutes in 40 mM sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 55° C., followed by four washes each for 30 minutes in sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 65° C.

[0104] In another specific embodiment of the invention, a nucleic acid is provided which is hybridizable to a Drosophila nucleic acid having a sequence as set forth in any one of SEQ ID NOs:15,289-31,635, or to a reverse complement thereof, under conditions of low, medium or high stringency. Hybridization protocols of differing stringencies are well known in the art. The temperature and salt concentrations at which hybridizations are performed have a direct effect on the results that are obtained. To achieve “stringent” or “high stringency” conditions, a denaturing agent such as formamide is typically used during hybridization. Formamide is typically used at 25% to 50% (v/v) in a buffered diluent comprising 1× to 6×SSC (1×SSC is 150 mM NaCl and 15 mM sodium citrate; SSPE may be substituted for SSC, where 1×SSPE is 150 mM NaCl, 10 mM NaH₂PO₄, and 1.25 mM EDTA, pH7.4). The hybridization temperature is typically about 42° C. High stringency conditions also employ a wash buffer with low ionic strength, such as from about 0.1× to about 0.5×SSC, at relatively high temperature, typically greater than about 55° C. up to about 70° C. Moderately stringent conditions typically use 0% to 25% formamide in 1× to 6×SSC, and use reduced hybridization temperatures, usually in the range of about 27° C. to about 40° C. The wash buffer can have increased ionic strength, e.g. from about 0.6× to about 2×SSC, and is used at reduced temperatures, usually from about 45° C. to about 55° C. To achieve “non-stringent” or “low stringency” hybridization conditions, the hybridization buffer is the same as that used for moderately stringent or high stringency, but does not contain a denaturing agent. A reduced hybridization temperature is used, typically in the range of from about 25° C. to about 30° C. The wash buffer has increased ionic strength, usually from about 2× to about 6×SSC, and the wash temperature is in the range of from about 35° C. to about 47° C.

[0105] As mentioned above, the procedures for nucleic acid hybridizations are well-known in the art (see e.g., Ausubel et al., 1995, Current Protocols In Molecular Biology, Wiley Interscience Publishers; Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York; Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci.U.S.A. 78, 6789-6792; and PCT Publication No. WO 99/01466, each of which is incorporated by reference herein in its entirety). In a specific embodiment of the invention, nucleic acids are provided that are capable of hybridizing to a nucleic acid consisting of a coding sequence encoding a polypeptide of any one of SEQ ID NOs:46,853 to 62,485, or the reverse complement thereof, under the hybridization conditions listed in Table 1 (column 7) for each of SEQ ID NOs:46,853 to 62,485. The “Hybridization Condition #” (column 1 of Table C) for conditions 1 through 10 as listed individually for each novel sequence in column 7 of Table 1, are explained in Table C. Hybridization buffers A through R and wash buffers A through L used for each hybridization condition # from 1 through 10 are listed in column 2 and column 4, respectively, of Table C. The SSC and formamide compositions of hybridization buffers A through R and wash buffers A through L are defined in Table A and Table B, respectively. Thus, for example, if hybridization condition #7 is listed as the preferred hybridization condition for a given SEQ ID NO in Table 1, then the conditions used for finding homologous nucleic acids preferably employ any of hybridization buffers A through M at a hybridization temperature of about 40° C., and any of wash buffers A through E at a wash temperature of approximately 55° C. Hybridization conditions 8 through 10, as listed in Table C and Table 1, are generally considered “high stringency” conditions; hybridization conditions 4 through 7 are generally considered “moderately stringent”, and hybridization conditions 1 through 3 are considered “low- or non-stringent”. Hybridization condition #1 is designed to isolate nucleic acids having at least about 50% sequence identity with the target nucleic acid (with % identity defined as described above). With each subsequent condition, the stringency is such that the isolated nucleic acid has a sequence identity of at least 5% greater than what would be isolated by using the next lower hybridization condition number. Thus, for example, hybridization condition #2 is designed to isolate nucleic acids having at least about 55% sequence identity with the target nucleic acid, and hybridization conditions #9 and #10 are designed to isolate nucleic acids having at least about 90% and 95% sequence identity, respectively, to the target nucleic acid.

[0106] In some situations, where it is desired to isolate more closely homologous nucleic acids, the preferred hybridization condition for isolating a nucleic acid similar to the sequence of a given SEQ ID NO, or its reverse complement, will be at least 1 hybridization condition # greater than the hybridization condition listed in column 7 of Table 1 (applicable for SEQ ID NOs having a hybridization condition that is less than 9 as listed in Table 1). Similarly, if isolation of nucleic acids having even higher sequence similarity is desired, then the preferred hybridization condition will be at least 2 greater than that listed in Table 1 (applicable for SEQ ID NOs having a hybridization condition that is less than 8 as listed in Table 1). Accordingly, the preferred hybridization condition is chosen to be increasingly greater where an increasingly greater level of sequence similarity is desired.

[0107] Preferably, each hybridizing nucleic acid has a length that is at least 30% of the length of the novel nucleic acid sequences described herein (i.e. any one of SEQ ID NOs:15,289-31,635, or a reverse complement thereof) to which it hybridizes. More preferably, a hybridizing nucleic acid has a length that is at least 50%, still more preferably at least 70%, and most preferably at least 90% of the length of the nucleic acid sequence described herein to which it hybridizes.

[0108] In using Table C below, a practitioner of the invention will note that, where a letter is recited for a Hybridization Buffer or a Wash Buffer, it is also permissible to use any Hybridization Buffer or a Wash Buffer having a letter which appears earlier in the alphabet. For example, where Hybridization Buffer R is recited for use in Hybridization Condition #1 in Table C, the user will note that Hybridization Buffers A through Q may also be used. Where Hybridization Buffer G is recited for use in Hybridization Condition #10 in Table C, the user will note that Hybridization Buffers A through F may also be used. Likewise, where Wash Buffer L is recited for use in Hybridization Condition #1 in Table C, the user will note that Wash Buffers A through K may also be used. Where Wash Buffer B is recited for use in Hybridization Condition #10 in Table C, the user will note that Wash Buffers A through B may also be used.

[0109] Specific embodiments for the cloning of a fly gene (e.g. a fly GPCR gene) follow. For expression cloning (a technique well known in the art), an expression library is constructed by any method known in the art. For example, mRNA is isolated, and cDNA is made and ligated into an expression vector (e.g., a bacteriophage derivative) such that it is capable of being expressed by the host cell into which it is then introduced. Various screening assays can then be used to select for the expressed GPCR product. In one embodiment, anti-GPCR antibodies can be used for selection.

[0110] In another embodiment, polymerase chain reaction (PCR) is used to amplify the desired sequence in a genomic or cDNA library, prior to selection. Oligonucleotide primers representing known sequences can be used as primers in PCR. In a preferred aspect, the oligonucleotide primers represent at least part of conserved segments of strong similarity between GPCR genes of different species. The synthetic oligonucleotides may be utilized as primers to amplify sequences from a source (RNA or DNA), preferably a cDNA library, of potential interest. PCR can be carried out, e.g., by use of a Perkin-Elmer Cetus thermal cycler and Taq polymerase (e.g., Gene Amp™). The nucleic acid being amplified can include mRNA or cDNA or genomic DNA from any species. One may synthesize degenerate primers for amplifying homologs from other species in such PCR reactions.

[0111] It is also possible to vary the stringency of hybridization conditions used in priming the PCR reactions to allow for greater or lesser degrees of nucleotide sequence similarity between the known nucleotide sequences and a nucleic acid homolog (or ortholog) being isolated. For cross-species hybridization reactions, low stringency conditions are preferred. For same-species hybridization, moderately stringent conditions are preferred. After successful amplification of a segment of a GPCR homolog, that segment may be cloned and sequenced by standard techniques and utilized as a probe to isolate a complete cDNA or genomic clone. This, in turn, permits the determination of the gene's complete nucleotide sequence, the analysis of its expression, and the production of its protein product for functional analysis, as described below. In this fashion, additional genes encoding proteins and analogs may be identified.

[0112] In another embodiment, the organizational characteristics of fly genes may be used to identify clones containing novel members of a fly gene superfamily (e.g. a fly GPCR superfamily). For example, insulin-like genes in the silkworm insect B. Moriencode the bombyxin proteins and have been demonstrated to be organized in large multi-gene clusters (Kondo et al., 1996, J. Mol. Biol. 259:926-937). Identification and characterization of a genomic region surrounding a known GPCR gene could, therefore, be used to identify additional genes that encode GPCR proteins or analogs which are located within these clusters, using methods generally known in the art such as those described above.

[0113] The above-described methods are not meant to limit the following general description of methods by which clones of genes may be obtained.

[0114] Any eukaryotic cell potentially can serve as the nucleic acid source for molecular cloning of a GPCR gene. The nucleic acid sequences encoding proteins may be isolated from vertebrate, including mammalian, porcine, murine, bovine, feline, avian, equine, canine, and human, as well as additional primate sources; invertebrates, including insects (e.g., Drosophila), nematodes; and plants, etc. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA “library”), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (see e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Vol. I, II, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Glover, ed., 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K.). Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will contain only exon sequences. Whatever the source, the gene should be molecularly cloned into a suitable vector for propagation of the gene.

[0115] In the molecular cloning of the gene from genomic DNA, DNA fragments are generated, some of which will encode the desired gene. The DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNase in the presence of manganese to fragment the DNA, or the DNA can be physically sheared (e.g., by sonication). The linear DNA fragments can then be separated according to size by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis and column chromatography.

[0116] Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired gene may be accomplished in a number of ways. For example, if a portion of a GPCR gene or its specific RNA or a fragment thereof is available and can be purified and labeled, the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe (Benton and Davis, 1977, Science 196:180; Grunstein and Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments with substantial similarity to the probe will hybridize. It is also possible to identify the appropriate fragment by restriction enzyme digestion(s) and comparison of fragment sizes with those expected according to a known restriction map if such is available. Further selection can be carried out on the basis of the properties of the gene.

[0117] Alternatively, the presence of the desired gene may be detected by assays based on the physical, chemical, or immunological properties of its expressed product. For example, cDNA clones, or DNA clones which hybrid-select the proper mRNAs, can be selected and expressed to produce a protein that has, e.g., similar or identical electrophoretic migration, isoelectric focusing behavior, proteolytic digestion maps, hormonal activity, binding activity, or antigenic properties as known for an protein. Using an antibody to a known GPCR protein, other GPCR proteins may be identified by binding of the labeled antibody to expressed putative proteins, e.g., in an ELISA (enzyme-linked immunosorbent assay)-type procedure. Further, using a binding protein specific to a known GPCR protein, other GPCR proteins may be identified by binding to such a protein (see e.g., Clemmons, 1993, Mol. Reprod. Dev. 35:368-374; Loddick et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:1894-1898).

[0118] A GPCR gene can also be identified by mRNA selection using nucleic acid hybridization followed by in vitro translation. In this procedure, fragments are used to isolate complementary mRNAs by hybridization. Such DNA fragments may represent available, purified GPCR DNA of another species (e.g., C. elegans, mouse, human). Immunoprecipitation analysis or functional assays (e.g., aggregation ability in vitro, binding to receptor, etc.) of the in vitro translation products of the isolated products of the isolated mRNAs identifies the mRNA and, therefore, the complementary DNA fragments that contain the desired sequences. In addition, specific mRNAs may be selected by adsorption of polysomes isolated from cells to immobilized antibodies specifically directed against protein. A radiolabeled GPCR cDNA can be synthesized using the selected mRNA (from the adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA may then be used as a probe to identify the GPCR DNA fragments from among other genomic DNA fragments.

[0119] Alternatives to isolating the GPCR genomic DNA include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence or making cDNA to the mRNA which encodes the GPCR protein. For example, RNA for cDNA cloning of the GPCR gene can be isolated from cells which express the gene.

[0120] The identified and isolated gene can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Such vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as PBR322 or pUC plasmid derivatives or the Bluescript vector (Stratagene USA, La Jolla, Calif.). The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified. Alternatively, any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. In an alternative method, the cleaved vector and an gene may be modified by homopolymeric tailing. Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.

[0121] In an alternative method, the desired gene (e.g. a GPCR gene) may be identified and isolated after insertion into a suitable cloning vector in a “shot gun” approach. Enrichment for the desired gene, for example, by size fractionization, can be done before insertion into the cloning vector.

[0122] In an additional embodiment, the desired gene (e.g. a GPCR gene) may be identified and isolated after insertion into a suitable cloning vector using a strategy that combines a “shot gun” approach with a “directed sequencing” approach. Here, the entire DNA sequence of a specific region of the genome, such as a sequence tagged site (STS), can be obtained using clones that molecularly map in and around the region of interest.

[0123] In specific embodiments, transformation of host cells with recombinant DNA molecules that incorporate an isolated GPCR gene, cDNA, or synthesized DNA sequence enables generation of multiple copies of the gene. Thus, the gene may be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA.

[0124] The GPCR sequences provided by the instant invention include those nucleotide sequences encoding substantially the same amino acid sequences as found in native proteins, and those encoded amino acid sequences with functionally equivalent amino acids, as well as those encoding other GPCR derivatives or analogs, as described below for GPCR derivatives and analogs.

[0125] The nucleotide sequence coding for a fly protein (e.g., a GPCR protein) or a functionally-active analog or fragment or other derivative thereof (see Section 5.6), can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The necessary transcriptional and translational signals can also be supplied by the native gene and/or its flanking regions. A variety of host-vector systems may be utilized to express the protein-coding sequence. These include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. In yet another embodiment, a fragment of an protein comprising one or more domains of the protein is expressed.

[0126] Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of a nucleic acid sequence encoding an protein or peptide fragment may be regulated by a second nucleic acid sequence so that the protein or peptide is expressed in a host transformed with the recombinant DNA molecule. For example, expression of an protein may be controlled by any promoter/enhancer element known in the art. A promoter/enhancer may be homologous (i.e. native) or heterologous (i.e. not native). Promoters which may be used to control gene expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), prokaryotic expression vectors such as the P-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the lac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25; Scientific American, 1980, 242:74-94), plant expression vectors comprising the nopaline synthetase promoter region (Herrera-Estrella et al., Nature 303:209-213), the cauliflower mosaic virus 35S RNA promoter (Gardner et al., 1981, Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Herrera-Estrella et al., 1984, Nature 310:115-120), promoter elements from yeast or other fungi such as the Gal4-responsive promoter, the ADH (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); a gene control region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), an immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58), alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al., 1987, Genes and Devel. 1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 314:283-286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus. (Mason et al., 1986, Science 234:1372-1378).

[0127] In a specific embodiment, a vector is used that comprises a promoter operably linked to an gene nucleic acid, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene).

[0128] In a specific embodiment, an expression construct is made by subcloning an coding sequence into the EcoRI restriction site of each of the three pGEX vectors (Glutathione S-Transferase expression vectors; Smith and Johnson, 1988, Gene 7:31-40). This allows for the expression of the protein product from the subclone in the correct reading frame.

[0129] In another specific embodiment, the promoter that is operably linked to the Drosophila GPCR gene is not the native Drosophila GPCR gene promoter (i.e., it is a heterologous promoter).

[0130] Expression vectors containing fly gene inserts can be identified by at least three general approaches: (a) nucleic acid hybridization; (b) presence or absence of “marker” gene functions; and (c) expression of inserted sequences. In the first approach, the presence of a fly gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted fly gene. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain “marker” gene functions (e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of a fly gene in the vector. For example, if a fly GPCR gene is inserted within the marker gene sequence of the vector, recombinants containing the GPCR insert can be identified by the absence of the marker gene function. In the third approach, recombinant expression vectors can be identified by assaying the product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the fly protein in in vitro assay systems, e.g., binding with anti-GPCR protein antibody.

[0131] Once a particular recombinant DNA molecule is identified and isolated, several methods known in the art may be used to propagate it. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. As previously mentioned, expression vectors which can be used include any such vectors known in the art. Specific examples include but are not limited to the following or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda phage); and plasmid and cosmid DNA vectors, to name but a few.

[0132] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers; thus, expression of the genetically engineered protein may be controlled. Furthermore, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, phosphorylation of proteins). Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce a non-glycosylated core protein product. Expression in yeast will produce a glycosylated product. Expression in animal cells can be used to ensure “native” glycosylation of a heterologous protein. Furthermore, different vector/host expression systems may affect processing reactions to different extents.

[0133] In other specific embodiments, the fly protein (e.g., a fly GPCR protein), fragment, analog, or derivative may be expressed as a fusion, or chimeric protein product (comprising the protein, fragment, analog, or derivative joined via a peptide bond to a heterologous protein sequence, e.g., derived from a different protein). A chimeric protein may include fusion of the fly protein, fragment, analog, or derivative to a second protein or at least a portion thereof, wherein a portion is one (but preferably 3, 5, 10, 15, or 20) or more amino acids of said second protein. The second protein, or one or more amino acid portion thereof, may be from a different fly protein or may be from a protein that is not a fly protein. Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer.

[0134] In particular aspects, the invention provides amino acid sequences of fly proteins (e.g., a fly GPCR protein) and fragments and derivatives thereof which comprise an antigenic determinant (i.e., which can be recognized by an antibody) or which are otherwise functionally active, as well as nucleic acid sequences encoding the foregoing. “Functionally active” GPCR material as used herein refers to that material displaying one or more functional activities associated with a full-length (wild-type) protein, e.g., binding to a GPCR ligand (e.g., a hormone), antigenicity (e.g., binding to an anti-GPCR antibody), immunogenicity, etc.

[0135] In specific embodiments, the invention provides fragments of a fly protein (e.g., a fly GPCR protein) consisting of at least 10 amino acids, 20 amino acids, 50 amino acids, or of at least 75 amino acids. In other embodiments, the proteins comprise or consist essentially of a GPCR domain, such as a ligand-binding domain, one or more of the seven transmembrane spanning domains, or a cytosolic domain (e.g., the intracellular loop domain between transmembrane domains five and six of the GPCR), or any combination of the foregoing. Fragments, or proteins comprising fragments, lacking some or all of the foregoing regions of a protein are also provided. Nucleic acids encoding the foregoing are provided. In specific embodiments, the foregoing proteins or fragments are not more than 25, 50 or 100 contiguous amino acids.

[0136] Once a recombinant which expresses the gene sequence is identified, the gene product can be analyzed. This is achieved by assays based on the physical or functional properties of the product, including radioactive labeling of the product followed by analysis by gel electrophoresis, immunoassay, etc.

[0137] Once a fly protein (e.g., a fly GPCR) is identified, it may be isolated and purified by standard methods including chromatography (e.g., ion exchange, affinity, or sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. The functional properties may be evaluated using any suitable assay (see Section 5.7).

[0138] Alternatively, once a fly protein produced by a recombinant is identified, the amino acid sequence of the protein can be deduced from the nucleotide sequence of the chimeric gene contained in the recombinant. As a result, the protein can be synthesized by standard chemical methods known in the art (e.g., see Hunkapiller et al., 1984, Nature 310:105-111).

[0139] In another alternate embodiment, native proteins can be purified from natural sources, by standard methods such as those described above (e.g., immunoaffinity purification).

[0140] In a specific embodiment of the present invention, such proteins (whether produced by recombinant DNA techniques or by chemical synthetic methods or by purification of native proteins) include but are not limited to those containing, as a primary amino acid sequence, all or part of the amino acid sequence substantially as depicted in FIG. 1 through FIG. 4 (SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:741, respectively), as well as fragments and other derivatives, and analogs thereof, including proteins homologous thereto.

[0141] The structure of genes and proteins of the invention, including naturally occuring proteins, can be analyzed by various methods known in the art. Some examples of such methods are described below.

[0142] The cloned DNA or cDNA corresponding to a fly gene (e.g., a fly GPCR gene) can be analyzed by methods including but not limited to Southern hybridization (Southern, 1975, J. Mol. Biol. 98:503-517), Northern hybridization (see e.g., Freeman et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:4094-4098), restriction endonuclease mapping (Maniatis, 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), and DNA sequence analysis. Accordingly, this invention provides nucleic acid probes recognizing a fly gene. For example, polymerase chain reaction (PCR; U.S. Pat. Nos. 4,683,202, 4,683,195 and 4,889,818; Gyllenstein et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7652-7656; Ochman et al., 1988, Genetics 120:621-623; Loh et al., 1989, Science 243:217-220) followed by Southern hybridization with a fly gene-specific probe can allow the detection of an gene in DNA from various cell types. Methods of amplification other than PCR are commonly known and can also be employed. In one embodiment, Southern hybridization can be used to determine the genetic linkage of a fly gene. Northern hybridization analysis can be used to determine the expression of a fly gene. Various cell types, at various states of development or activity can be tested for fly gene expression. The stringency of the hybridization conditions for both Southern and Northern hybridization can be manipulated to ensure detection of nucleic acids with the desired degree of relatedness to the specific fly gene probe used. Modifications of these methods and other methods commonly known in the art can be used.

[0143] Restriction endonuclease mapping can be used to roughly determine the genetic structure of a fly gene. Restriction maps derived by restriction endonuclease cleavage can be confirmed by DNA sequence analysis.

[0144] DNA sequence analysis can be performed by any techniques known in the art, including but not limited to the method of Maxam and Gilbert (1 980, Meth. Enzymol. 65:499-560), the Sanger dideoxy chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74:5463), the use of T7 DNA polymerase (Tabor and Richardson, U.S. Pat. No. 4,795,699), or use of an automated DNA sequenator (e.g., Applied Biosystems, Foster City, Calif.).

[0145] The amino acid sequence of a fly protein (e.g. a fly GPCR) can be derived by deduction from the DNA sequence, or alternatively, by direct sequencing of the protein, e.g., with an automated amino acid sequencer.

[0146] A fly protein sequence can be further characterized by a hydrophilicity analysis (Hopp and Woods, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824). A hydrophilicity profile can be used to identify the hydrophobic and hydrophilic regions of the fly protein and the corresponding regions of the gene sequence which encode such regions.

[0147] Structural prediction analysis (Chou and Fasman, 1974, Biochemistry 13:222) can also be performed to identify regions of a fly protein that form specific secondary structures.

[0148] Manipulation, translation, and secondary structure prediction, open reading frame prediction and plotting, as well as determination of sequence homologies, can also be accomplished using computer software programs available in the art.

[0149] Other methods of structural analysis can also be employed. These include but are not limited to X-ray crystallography (Engstom, 1974, Biochem. Exp. Biol. 11:7-13), nuclear magnetic resonance spectroscopy (Clore and Gonenborn, 1989, CRC Crit. Rev. Biochem. 24:479-564) and computer modeling (Fletterick and Zoller, 1986, Computer Graphics and Molecular Modeling, in Current Communications in Molecular Biology, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

[0150] According to the invention, a fly protein, its fragments or other derivatives, or analogs thereof, may be used as an immunogen to generate antibodies which immunospecifically bind such an immunogen. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. In another embodiment, antibodies to a domain (e.g., a GPCR ligand-binding, transmembrane, or cytosolic domain) of a fly protein are produced. In a specific embodiment, fragments of a fly protein identified as hydrophilic are used as immunogens for antibody production.

[0151] Various procedures known in the art may be used for the production of polyclonal antibodies to a fly protein or derivative or analog. In a particular embodiment, rabbit polyclonal antibodies to an epitope of a fly GPCR protein having the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:32,370 (see also FIGS. 1-4), or a subsequence thereof, can be obtained. For the production of antibody, various host animals can be immunized by injection with the native protein, or a synthetic version, or derivative (e.g., fragment) thereof, including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.

[0152] For preparation of monoclonal antibodies directed to an protein sequence or analog thereof, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein, (Kohler and Milstein 1975, Nature 256:495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology (see e.g., PCT/US90/02545). According to the invention, human antibodies may be used and can be obtained by using human hybridomas (Cole et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96). In fact, according to the invention, techniques developed for the production of “chimeric antibodies” (Morrison et al., 1984, Proc. Natl. Acad. Sci. U.S.A. 81:6851-6855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing the genes from a mouse antibody molecule specific for an protein together with genes from a human antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. In another embodiment, “humanized” antibodies are provided in this invention (see U.S. Pat. No. 5,225,539).

[0153] According to the invention, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce fly protein-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab′ expression libraries (Huse et al., 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for proteins, derivatives, or analogs.

[0154] Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to, the F(ab′)₂fragment which can be produced by pepsin digestion of the antibody molecule, the Fab′ fragments which can be generated by reducing the disulfide bridges of the F(ab′)₂fragment, the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent, and Fv fragments.

[0155] In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art (e.g., enzyme-linked immunosorbent assay or ELISA). For example, to select antibodies which recognize a specific domain of a protein, one may assay generated hybridomas for a product which binds to a fragment containing such domain. For selection of an antibody that specifically binds a first homolog but which does not specifically bind a different homolog, one can select on the basis of positive binding to the first homolog and a lack of binding to the second homolog.

[0156] Antibodies specific to a domain of an protein are also provided. Antibodies specific to an epitope of an protein are also provided.

[0157] The foregoing antibodies can be used in methods known in the art relating to the localization and activity of the protein sequences of the invention, e.g., for imaging these proteins, measuring levels thereof in appropriate physiological samples, in diagnostic methods, etc.

[0158] The invention further relates to fly proteins, derivatives (including but not limited to fragments), analogs, and molecules of fly proteins. As used herein, a molecule defined by a particular SEQ ID NO shall be construed to mean that the sequence of that molecule consists of that SEQ ID NO. A chimeric fly protein having one or more domains from one or more other fly or non-fly proteins is within the scope of the invention. Chimeric proteins are well known in the art (see e.g. Kobilka, 1992, Annu. Rev. Neurosci. 15, 87-114; Insel, 1993, Exp. Gerontol. 28, 341-348; Hein et al.,1995, Neuropharmacology. 34, 357-366 for discussion of and citations to chimeric GPCRs). Nucleic acids encoding fly protein derivatives and protein analogs are also provided. In one embodiment, the fly proteins are encoded by the nucleic acids described in Section 5.1 above. In particular aspects, the proteins, derivatives, or analogs are of fly GPCR proteins encoded by the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:741. In another embodiment, this invention provides one or more fragments (or derivatives or analogs thereof) of a fly chitin synthase 2 protein greater than or equal to 55 contiguous amino acids of SEQ ID NO:42,135.

[0159] Transmembrane domain proteins typically contain a hydrophobic domain near the 5′ end of the expressed protein called a secretory signal peptide. This peptide is necessary for insertion of the protein into a membrane of the cell in which the protein is expressed. As the protein is inserted into a membrane, the secretory signal peptide is removed from the protein by enzymatic action of a signal peptidase resulting in the mature form of the protein. Thus, in one embodiment, the present invention is directed to a mature form of a protein comprising an amino acid sequence of SEQ ID NO:2, 4, 6, 32,370 or 42,135 from which the secretory signal peptide has been removed.

[0160] The production and use of derivatives and analogs related to a fly protein are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type fly protein. As one example, such derivatives or analogs which have the desired immunogenicity or antigenicity can be used in immunoassays, for immunization, for inhibition of GPCR ligand activity, etc. As another example, such derivatives or analogs which have the desired binding activity can be used for binding to a GPCR gene product. As yet another example, such derivatives or analogs which have the desired binding activity can be used for binding to a binding protein specific for a known GPCR protein (see e.g., Clemmons, 1993, Mol. Reprod. Dev. 35:368-374; Loddick et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:1894-1898). Derivatives or analogs that retain, or alternatively lack or inhibit, a desired protein property-of-interest (e.g., binding to a fly protein binding partner), can be used as inducers, or inhibitors, respectively, of such property and its physiological correlates. A specific embodiment relates to a fly GPCR fragment that can be bound by an anti-GPCR antibody. Derivatives or analogs of a fly protein (e.g., a GPCR) can be tested for the desired activity by procedures known in the art, including but not limited to the assays described below.

[0161] In particular, GPCR derivatives can be made by altering GPCR sequences by substitutions, additions (e.g., insertions) or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as a GPCR gene may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of a GPCR gene which is altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a silent change. Likewise, the fly protein derivatives of the invention, including GPCR derivatives, include but are not limited to those containing, as a primary amino acid sequence, all or part of the amino acid sequence of a fly protein including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent alteration. Substitutions for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such substitutions are generally understood to be conservative substitutions.

[0162] In a specific embodiment of the invention, proteins consisting of or comprising a fragment of a fly protein consisting of at least 10 (continuous) amino acids of the protein is provided. In other embodiments, the fragment consists of at least 20 or at least 50 amino acids of the fly protein. In specific embodiments, such fragments are not larger than 35, 100 or 200 amino acids. Derivatives or analogs of proteins include but are not limited to those molecules comprising regions that are substantially homologous to an protein or fragment thereof (e.g., in various embodiments, at least 60% or 70% or 80% or 90% or 95% identity over an amino acid sequence of identical size without any insertions or deletions or when compared to an aligned sequence in which the alignment is done by a computer similarity program known in the art) or whose encoding nucleic acid is capable of hybridizing to a coding gene sequence, under high stringency, moderate stringency, or low stringency conditions.

[0163] Specifically, by way of example computer programs for determining similarity may include but are not limited to TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. U.S.A. 85:2444-2448; Altschul et al., 1990, J. Mol. Biol. 215:403-410; Thompson et al., 1994, Nucleic Acids Res. 22:4673-4680; and Higgins et al., 1996, Methods Enzymol. 266:383-402).

[0164] Specifically, Basic Local Alignment Search Tool (BLAST) (www.ncbi.nlm.nih.gov) (Altschul et al., 1990, J. Mol. Biol. 215:403-410, “The BLAST Algorithm”; Altschul et al., 1997, Nucl. Acids Res. 25:3389-3402) is a heuristic search algorithm tailored to searching for sequence similarity which ascribes significance using the statistical methods of Karlin and Altschul (1990, Proc. Nat'l Acad. Sci. U.S.A., 87:2264-2268; 1993, Proc. Nat'l Acad. Sci. U.S.A. 90:5873-5877). Five specific BLAST programs are used to perform the following tasks: (1) the WU-BLASTP program compares an amino acid query sequence against a protein sequence database; (2) the WU-BLASTN program compares a nucleotide query sequence against a nucleotide sequence database; (3) the BLASTX program compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database; (4) the TBLASTN program compares a protein query sequence against a nucleotide sequence database translated in all six reading frames (both strands); and (5) the TBLASTX program compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

[0165] Smith-Waterman (database: European Bioinformatics Institute wwwz.ebi.ac.uk/bic_sw/) (Smith-Waterman, 1981, J. Mol. Biol. 147:195-197) is a mathematically rigorous algorithm for sequence alignments.

[0166] FASTA (see Pearson et al., 1988, Proc. Nat'l Acad. Sci. U.S.A., 85:2444-2448) is a heuristic approximation to the Smith-Waterman algorithm. For a general discussion of the procedure and benefits of the BLAST, Smith-Waterman and FASTA algorithms see Nicholas et al., 1998, “A Tutorial on Searching Sequence Databases and Sequence Scoring Methods” (www.psc.edu) and references cited therein.

[0167] The derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, a cloned gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual,2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of a modified gene encoding a derivative or analog of an protein, care should be taken to ensure that the modified gene remains within the same translational reading frame as the native protein, uninterrupted by translational stop signals, in the gene region where the desired protein activity is encoded.

[0168] Additionally, a fly nucleic acid sequence (e.g., a GPCR sequence) can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or to form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, chemical mutagenesis, in vitro site-directed mutagenesis (Hutchinson et al., 1978, J. Biol. Chem. 253:6551), use of TAB® linkers (Pharmacia), PCR with primers containing a mutation, etc.

[0169] Manipulations of a fly GPCR polypeptide sequence may also be made at the protein level. Included within the scope of the invention are GPCR protein fragments or other derivatives or analogs which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH₄, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc. In addition, naturally occuring fly proteins are within the scope of the invention.

[0170] In addition, analogs and derivatives of a fly protein can be chemically synthesized. For example, a peptide corresponding to a portion of a GPCR protein which comprises the desired domain, or which mediates the desired activity in vitro, can be synthesized by use of a peptide synthesizer. Furthermore, if desired, non-classical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the sequence. Non-classical amino acids include but are not limited to the D-isomers of the common amino acids, α-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, γ-Abu, ε-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alamine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).

[0171] In a specific embodiment, a GPCR protein derivative is a chimeric or fusion protein comprising a GPCR protein or fragment thereof (preferably consisting of at least a domain or motif of the GPCR protein, or at least 10 amino acids of the protein) joined at its amino- or carboxy-terminus via a peptide bond to an amino acid sequence of a different GPCR protein, fly or non-fly. In specific embodiments, the amino acid sequence of the different GPCR protein is at least 6, 10, 20 or 30 continuous amino acids of the different protein, or a portion of the different protein that is functionally active. In one embodiment, such a chimeric protein is produced by recombinant expression of a nucleic acid encoding the protein (comprising a GPCR-coding sequence joined in-frame to a coding sequence for a different protein). Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer. Chimeric genes comprising portions of a GPCR gene fused to any heterologous protein-encoding sequences may be constructed. A specific embodiment relates to a chimeric protein comprising a fragment of a GPCR protein of at least six amino acids, or a fragment that displays one or more functional activities of the protein.

[0172] In another specific embodiment, the GPCR derivative is a molecule comprising a region of similarity with a GPCR protein. By way of example, in various embodiments, a first protein region can be considered “homologous” to a second protein region when the amino acid sequence of the first region is at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 95% identical, when compared to any sequence in the second region of an equal number of amino acids as the number contained in the first region without any insertions or deletions or when compared to an aligned sequence of the second region that has been aligned by a computer similarity program known in the art. For example, a molecule can comprise one or more regions homologous to a GPCR transmembrane domain or a portion thereof.

[0173] In a specific embodiment, the invention relates to GPCR derivatives and analogs, in particular GPCR fragments and derivatives of such fragments, that comprise, or alternatively consist of, one or more domains of a GPCR protein, including but not limited to a GPCR ligand-binding domain and/or a GPCR transmembrane domain, and/or a cytosolic domain (e.g., the intracellular loop domain between transmembrane domains five and six of the GPCR).

[0174] A specific embodiment relates to molecules comprising specific fragments of a GPCR protein that are those fragments in the respective GPCR proteins of the invention most homologous to specific fragments of a human or mouse protein. A fragment comprising a domain of a GPCR homolog can be identified by protein analysis methods well known in the art.

[0175] In another specific embodiment, a molecule is provided that comprises one or more domains (or functional portion thereof) of a GPCR protein but that also lacks one or more domains (or functional portion thereof) of a GPCR protein. In particular examples, protein derivatives are provided that contain either a GPCR ligand-binding domain, transmembrane domain, or a cytosolic domain (e.g., the intracellular loop domain between transmembrane domains five and six of the GPCR). By way of another example, such a protein may retain such domains separated by a peptide spacer. Such spacer may be the same as or different from a native GPCR linker peptide. In another embodiment, a molecule is provided that comprises one or more domains (or functional portion(s) thereof) of a GPCR protein, and that has one or more mutant (e.g., due to deletion or point mutation) domains of a GPCR protein (e.g., such that the mutant domain has decreased function).

[0176] In other embodiments, derivatives of Drosophila proteins (and their encoding nucleic acids) are provided that display a particular % identity or similarity to the Drosophila protein or are encoded by a nucleic acid that hybridizes to the cDNA encoding the protein, and, optionally, comprises one or more domains of the protein and/or displays the antigenicity of the protein (i.e., can be immunospecifically bound by an antibody to the protein).

[0177] The present invention provides for methods of creating genetically-engineered fruit flies and laboratory-generated mutant fruit flies, as described below.

[0178] In a specific embodiment, genetically-engineered fruit flies are made that harbor one or more deletions or insertions in a fly GPCR gene or genes. In another embodiment, genetically-engineered fruit flies harbor interfering RNAs derived from such genes. In another embodiment, genetically-engineered fruit flies harbor one or more transgenes for mis-expression of wild-type or mutant forms of such genes. The invention provides for laboratory-generated mutant fruit flies which contain deletions, insertions, rearrangements, or point mutations in a fly gene or genes, such as a fly GPCR gene, or combinations thereof.

[0179] The present invention provides a method by which Drosophila strains with laboratory-generated alterations in GPCR genes may be used for the identification of GPCR and/or other genes that participate in particular biochemical and/or genetic pathways. In a specific embodiment, Drosophila strains with laboratory-generated alterations in one or more GPCR genes may be used for the identification of GPCR genes that participate in biochemical and/or genetic pathways that constitute possible pesticide targets, as judged by phenotypes such as non-viability, block of normal development, defective feeding, defective movement, or defective reproduction. That is, development of such a phenotype in a Drosophila containing an alteration in a Drosophila GPCR gene indicates that the gene is a potential pesticide target.

[0180] In another embodiment, Drosophila strains with laboratory-generated alterations relate to therapeutic applications associated with the superfamily hormones, such as metabolic control, growth regulation, differentiation, reproduction, and aging.

[0181] In another embodiment, Drosophila strains with laboratory-generated alterations relate to large-scale genetic modifier screens aimed at systematic identification of components of genetic and/or biochemical pathways that serve as novel drug targets, diagnostics, prognostics, therapeutic proteins, pesticide targets or protein pesticides.

[0182] The invention provides methods for creating and analyzing Drosophila strains having modified expression of genes, as described in the Sections below. In one embodiment, expression modification methods include any method known to one skilled in the art. Specific examples include but are not limited to chemical mutagenesis, transposon mutagenesis, antisense RNA interference, and transgene-mediated mis-expression. In the creation of transgenic animals, it is preferred that heterologous (i.e., non-native) promoters be used to drive transgene expression.

[0183] The present invention provides methods of testing for preexisting mutations in a D. melanogasterGPCR gene. In a specific embodiment, the genomic sequence containing the entire cluster can be used to determine whether an existing mutant Drosophila line corresponds to a mutation in one or more of the GPCR genes. Specifically, but not by limitation, mutations in genes that map to the same genetic region as a GPCR gene cluster are of particular interest. For example, a large number of previously identified mutations have been mapped to certain genetic regions of certain clusters (see FlyBase: a Drosophila database, Flybase consortium, Harvard University). To ascertain whether any of such mutations are in a GPCR gene, a genomic fragment containing a Drosophila gene cluster and potential flanking regulatory regions can be subcloned into any appropriate Drosophila transformation vector, such as the Carnegie series of vectors (Rubin and Spradling, 1983, Nucleic Acids Res. 11:6341-6351), the pCaspeR series of vectors (Thummel et al., 1988, Gene 74:445-456), or the pW8 vector (Klemenz et al., 1987, Nucleic Acids Res. 15:3947-3959) and injected into flies along with an appropriate helper plasmid to supply transposase. Resulting transformants are crossed for complementation testing to an existing panel of Drosophila lines containing mutations that have been mapped to the appropriate genomic region as described above (see Greenspan, 1997, in Fly pushing: The Theory and Practice of Drosophila Genetics, Cold Spring Harbor Press, Plainview, N.Y., pp. 3-46). If a mutant line is discovered to be rescued by such a genomic fragment, as judged by complementation of the mutant phenotype, progressively smaller subclones or clones containing a single gene can be individually tested until the responsible locus is identified.

[0184] Further, the invention herein provides a method for generating loss-of-Function mutations in a D. melanogasterGPCR gene. Mutations can be generated by one of many mutagenesis methods known to investigators skilled in the art (Ashburner, 1989, In Drosophila: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 299-418.; “Fly pushing: The Theory and Practice of Drosophila Genetics”Cold Spring Harbor Press, Plainview, N.Y.). In a specific embodiment, the mutagens that can be used include but are not restricted to: transposons such as the P or hobo elements; chemical mutagens such as ethylmethane sulfonate (EMS), methylmethane sulfonate (MMS), N-ethyl-N-nitrosourea (ENU), triethylmelamine, diepoxyalkanes, ICR-170, or formaldehyde; and irradiation with X-rays, gamma rays, or ultraviolet radiation.

[0185] Mutagenesis by P elements, or marked P elements, is particularly appropriate for isolation of loss-of-Function mutations in Drosophila genes, such as fly GPCR genes, due to the precise molecular mapping of these genes, the small size of these targets, the availability and proximity of preexisting P element insertions for use as a localized transposon source, and the potential to knock out several of these genes by induction of a small deletion of the locus (Hamilton and Zinn, 1994, Methods in Cell Biology 44:81-94; Wolfner and Goldberg, 1994, Methods in Cell Biology 44:33-80; Clark et al., 1994, Proc. Natl. Acad. Sci. U.S.A. 91:719-722; Kaiser, 1990, Bioessays 12:297-301, In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology, Goldstein and Fyrberg, Eds., Academic Press, Inc., San Diego, Calif.). For the purposes of mutagenesis, modified P elements are typically used which contain one or more of the following elements: sequences encoding a dominant visible marker, usually a wild-type white+ or rosy+ eye color gene, to allow detection of animals containing the P element and to screen for transposition events (Rubin and Spradling, 1982, Science 218:348-353; Klemenz et al., 1987, Nucleic Acids Res. 15:3947-3959), bacterial plasmid sequences including a selectable marker such as ampicillin resistance to facilitate cloning of genomic sequences adjacent to the insertion site (Steller and Pirrotta, 1985, EMBO J. 4:167-171) and lacZ sequences fused to a weak general promoter to detect the presence of enhancers with a developmental expression pattern of interest (Bellen et al., 1989, Genes Dev. 3:1288-1300; Bier et al., 1989, Genes Dev. 3:1273-1287; Wilson et al., 1989, Genes Dev. 3:1301-1313). For examples of marked P elements useful for mutagenesis, see “FlyBase—A Drosophila Database”, Nucleic Acids Res. 26:85-88 (see especially http://flybase.bio.indiana.edu).

[0186] A preferred method of transposon mutagenesis employs the “local hopping” method (Tower et al., 1993, Genetics 133:347-359). Briefly, an existing mutant Drosophila line containing a P element inserted into chromosomal bands near a gene-of-interest, such as 93E for GABA_B, or 87D for GPCR-3 or GPCR-4, is crossed to a Drosophila line expressing transposase in order to mobilize the transposon. Transposition of the P element, which contains a marker gene that typically affects eye color, is determined phenotypically on the basis of eye color change in the resulting progeny. Candidate insertion lines are selected for further analysis on the basis of close linkage of the new insertion to the initial insertion site, which can be determined by standard genetic mapping techniques such as high frequency cosegregation of markers. Each new P insertion line can be tested molecularly for transposition of the P element into the gene cluster by assays based on PCR amplification. For each reaction, one PCR primer is used that is homologous to sequences contained within the P element and a second primer is homologous to one of the individual genes, in either the coding region or flanking regions of the gene. Products of the PCR reactions are detected by agarose gel electrophoresis. The sizes of the resulting DNA fragments are used to map the site of P element insertion.

[0187] Alternatively, Southern blotting and restriction mapping using DNA probes derived from genomic DNA or cDNAs of the genes can be used to detect transposition events that rearrange the genomic DNA of the genes. P transposition events that map to the gene cluster can be assessed for phenotypic effects in heterozygous or homozygous mutant Drosophila, as described in detail below.

[0188] In another embodiment, Drosophila lines carrying P insertions in the gene cluster can be used to generate localized deletions in the gene cluster by previously described methods known in the art (Kaiser, 1990, Bioessays 12:297-301; Harnessing the power of Drosophila genetics, In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology, Goldstein and Fryberg, Eds., Academic Press, Inc., San Diego, Calif.; Preston et al., 1996, Genetics 144, 1623-1638). This is particularly useful if no P elements transpositions are found that disrupt a particular gene of interest. In one method, flies containing P elements inserted into the gene cluster are exposed to a further round of transposase to induce excision of the element. Progeny in which the transposon has excised are typically identified by loss of the eye color marker associated with the transposable element. The resulting progeny will include flies with either precise or imprecise excision of the P element, where the imprecise excision events often result in deletion of genomic DNA neighboring the site of P insertion. In another method, male flies containing the P element of interest and heterozygous for genetic markers distal and proximal to the insertion are exposed to transposase. Selection of the appropriate class of recombinant progeny identifies animals with directed deletions or duplications on just one side of the transposon. Progeny from both of these methods can be screened by molecular techniques to identify deletion events that remove flanking genomic sequence. Such methods include, but are not limited to: (a) methods of detecting alterations in the genomic DNA based on PCR amplification with primers flanking the insertion site of the P element; (b) methods based on Southern blotting and restriction mapping using DNA probes derived from the P element, DNA probes derived from flanking genomic sequence in the region of the genes, or DNA probes derived from cDNAs of fly genes such as GPCR genes of the invention. Deletions generated in this manner that remove one or more GPCR loci can be assessed for phenotypic effects in heterozygous and homozygous mutant Drosophila as described below.

[0189] The invention further provides a method for generating loss-of-Function phenotypes using methods based on RNA-mediated interference with gene expression. The function of the Drosophila GPCR genes identified herein may be characterized and/or determined by generating loss-of-Function phenotypes through such RNA-based methods.

[0190] In one embodiment, loss-of-Function phenotypes are generated by antisense RNA methods (Schubiger and Edgar, 1994, Methods in Cell Biology 44:697-713). One form of the antisense RNA method involves the injection of embryos with an antisense RNA that is partially homologous to the gene-of-interest (e.g., a fly GPCR gene). Another form of the antisense RNA method involves expression of an antisense RNA partially homologous to the gene-of-interest by operably joining a portion of the gene-of-interest in the antisense orientation to a powerful promoter that can drive the expression of large quantities of antisense RNA, either generally throughout the animal or in specific tissues. Examples of powerful promoters that can be used in this strategy of antisense RNA include heat shock gene promoters or promoters controlled by potent exogenous transcription factors, such as GAL4 and tTA, described in more detail in the following section. Antisense RNA-generated loss-of-Function phenotypes have been reported previously for several Drosophila genes including cactus, pecanex, and Kruppel (LaBonne et al., 1989, Dev. Biol. 136:1-16; Schuh and Jackle, 1989, Genome 31:422-425; Geisler et al., 1992, Cell 71:613-621).

[0191] In a second embodiment, loss-of-Function phenotypes are generated by co-suppression methods (Bingham, 1997, Cell 90:385-387; Smyth, 1997, Curr. Biol. 7:793-795; Que and Jorgensen, 1998, Dev. Genet. 22:100-109). Co-suppression is a phenomenon of reduced gene expression produced by expression or injection of a sense strand RNA corresponding to a partial segment of the gene-of-interest. Cosuppression effects have been employed extensively in plants to generate loss-of-Function phenotypes, and there is report of cosuppression in Drosophila where reduced expression of the Adh gene was induced from a white-Adh transgene (Pal-Bhadra et al., 1997, Cell 90:479-490).

[0192] In a third embodiment, loss-of-Function phenotypes may be generated by double-stranded RNA interference. This method is based on the interfering properties of double-stranded RNA derived from the coding regions of genes. Termed dsRNAi, this method has proven to be of great utility in genetic studies of the nematode C. elegans(see Fire et al., 1998, Nature 391:806-811) and more recently in Drosophila (see Misquitta et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96, 1451-1456; and Kennerdell et al., 1998, Cell 95, 1017-1026). In a preferred embodiment of this method, complementary sense and antisense RNAs derived from a substantial portion of a gene-of-interest, such as a GPCR gene, are synthesized in vitro. Phagemid DNA templates containing cDNA clones of the gene-of-interest are inserted between opposing promoters for T3 and T7 phage RNA polymerases. Alternatively, one can use PCR products amplified from coding regions of genes, where the primers used for the PCR reactions are modified by the addition of phage T3 and T7 promoters. The resulting sense and antisense RNAs are annealed in an injection buffer, and the double-stranded RNA injected or otherwise introduced into animals. Injected animals and/or their progeny are then inspected for phenotypes-of-interest.

[0193] The invention provides for antisense uses of D. melanogastergenes such as fly GPCR genes. In a specific embodiment, a fly GPCR protein function is inhibited by use of GPCR antisense nucleic acids. The present invention provides for use of nucleic acids of at least six nucleotides that are antisense to a gene or cDNA encoding an protein or a portion thereof. A fly GPCR “antisense” nucleic acid as used herein refers to a nucleic acid capable of hybridizing to a sequence-specific (i.e., non-poly A⁺) portion of a GPCR RNA (preferably mRNA) by virtue of some sequence complementarily. Antisense nucleic acids may also be referred to as inverse (or reverse) complement nucleic acids. The antisense nucleic acid may be complementary to a coding and/or noncoding region of a GPCR mRNA. Such antisense nucleic acids have utility in inhibiting fly GPCR protein function. For example, such antisense nucleic acids may be useful as pesticides to eradicate parasites in plants, or in animals such as dogs, horses, and cattle.

[0194] The antisense nucleic acids of the invention can be oligonucleotides that are double-stranded or single-stranded, RNA or DNA, or a modification or derivative thereof, which can be directly administered to a cell, or which can be produced intracellularly by transcription of exogenous introduced sequences. In a preferred embodiment, the antisense nucleic acids of the invention are double-stranded RNA mentioned previously (see Fire et al., 1998, Nature 391:806-811).

[0195] The antisense nucleic acids of the invention are preferably oligonucleotides (ranging from 6 to about 50 nucleotides). In specific aspects, an oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 200 nucleotides in length. The oligonucleotide can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof (e.g., protein nucleic acid, or PNA), or single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone. The oligonucleotide may include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:648-652; PCT Publication No. WO 88/09810, published Dec. 15, 1988) or the blood-brain barrier (see e.g., PCT Publication No. WO 89/10134, published Apr. 25, 1988), hybridization-triggered cleavage agents (see e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents (see e.g., Zon, 1988, Pharm. Res. 5:539-549).

[0196] In a preferred aspect of the invention, a fly GPCR antisense oligonucleotide is provided as single-stranded DNA. In another preferred aspect, such an oligonucleotide comprises a sequence antisense to the sequence encoding a ligand-binding domain, a transmembrane domain, or a cytoplasmic domain of a fly GPCR protein (e.g., the intracellular loop domain between transmembrane domains five and six of the GPCR). The oligonucleotide may be modified at any position in its structure with substituents generally known in the art.

[0197] An antisense oligonucleotide such as a fly GPCR antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. In another embodiment, the oligonucleotide comprises at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.

[0198] In yet another embodiment, the oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.

[0199] In yet another embodiment, the oligonucleotide is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide may be conjugated to another molecule, e.g., a peptide, a hybridization-triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc.

[0200] Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (Stein et al., 1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.

[0201] In a specific embodiment, a fly GPCR antisense oligonucleotide comprises catalytic RNA, or a ribozyme (see e.g., PCT Publication WO 90/11364, published Oct. 4, 1990; Sarver et al., 1990, Science 247:1222-1225). In another embodiment, the oligonucleotide is a 2′-O-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).

[0202] In an alternative embodiment, a fly GPCR antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector can be introduced in vivo such that it is taken up by a cell, within which cell the vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the fly GPCR antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the fly GPCR antisense RNA can be by any promoter known in the art. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), etc.

[0203] The antisense nucleic acids of the invention comprise a sequence complementary to at least a sequence-specific portion of an RNA transcript of an gene. However, absolute complementarity, although preferred, is not required. A sequence “complementary to at least a portion of an RNA,” as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded GPCR antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with a GPCR RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine, e.g., the melting point of the hybridized complex.

[0204] The current invention provides methods for generating gain-of-Function phenotypes by ectopic expression of fly genes such as GPCR genes. Ectopic expression, including mis-expression or overexpression, of wild type or altered Drosophila GPCR genes in transgenic animals is another useful method for the analysis of gene function (Brand et al., 1994, Methods in Cell Biology 44:635-654, Ectopic expression in Drosophila; Hay et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:5195-5200). Such transgenic Drosophila may be created that contain gene fusions of the coding regions of genes (from either genomic DNA or cDNA) operably joined to a specific promoter and transcriptional enhancer whose regulation has preferably been well characterized, preferably heterologous promoters/enhancers that do not normally drive the expression of the GPCR genes. Examples of promoters/enhancers that can be used to drive such misexpression of GPCR genes include, but are not limited to, the heat shock promoters/enhancers from the hsp70 and hsp83 genes, useful for temperature induced expression; tissue specific promoters/enhancers such as the sevenless promoter/enhancer (Bowtell et al., 1988, Genes Dev. 2:620-634), the eyeless promoter/enhancer (Bowtell et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:6853-6857), and glass-responsive promoters/enhancers (Quiring et al., 1994, Science 265:785-789) useful for expression in the eye; enhancers/promoters derived from the dpp or vetigal genes useful for expression in the wing (Staehling-Hampton et al., 1994, Cell Growth Differ. 5:585-593; Kim et al., 1996, Nature 382:133-138) and binary control systems employing exogenous DNA regulatory elements and exogenous transcriptional activator proteins, useful for testing the misexpression of genes in a wide variety of developmental stage-specific and tissue-specific patterns. Two examples of binary exogenous regulatory systems include the UAS/GAL4 system from yeast (Hay et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:5195-5200; Ellis et al., 1993, Development 119:855-865) and the “Tet system” derived from E. coli, which are described below. It is readily apparent to those skilled in the art that additional binary systems can be used which are based on other sets of exogenous transcriptional activators and cognate DNA regulatory elements in a manner similar to that for the UAS/GAL4 system and the Tet system.

[0205] In a specific embodiment, the UAS/GAL4 system is used. This system is a well-established and powerful method of mis-expression in Drosophila which employs the UAS_Gupstream regulatory sequence for control of promoters by the yeast GAL4 transcriptional activator protein (Brand and Perrimon, 1993, Development 118:401-415). In this approach, transgenic Drosophila, termed “target” lines, are generated where the gene-of-interest (e.g., a fly GPCR gene) to be mis-expressed is operably fused to an appropriate promoter controlled by UASG. Other transgenic Drosophila strains, termed “driver” lines, are generated where the GAL4 coding region is operably fused to promoters/enhancers that direct the expression of the GAL4 activator protein in specific tissues, such as the eye, wing, nervous system, gut, or musculature. The gene-of-interest is not expressed in the so-called target lines for lack of a transcriptional activator to “drive” transcription from the promoter joined to the gene-of-interest. However, when the UAS-target line is crossed with a GAL4 driver line, mis-expression of the gene-of-interest is induced in resulting progeny in a specific pattern that is characteristic for that GAL4 line. The technical simplicity of this approach makes it possible to sample the effects of directed mis-expression of the gene-of-interest in a wide variety of tissues by generating one transgenic target line with the gene-of-interest, and crossing that target line with a panel of pre-existing driver lines. A very large number of specific GAL4 driver lines have been generated previously and are available for use with this system.

[0206] In a second embodiment, a related method of directed mis-expression in Drosophila uses a system adapted from a tetracycline-regulated operon from E. coli, referred to as the “Tet system”. In this case, transgenic Drosophila driver lines are generated where the coding region for a tetracycline-controlled transcriptional activator (tTA) is operably fused to promoters/enhancers that direct the expression of tTA in a tissue-specific and/or developmental stage-specific manner. Also, transgenic Drosophila target lines are generated where the coding region for the gene-of-interest to be mis-expressed (e.g., a fly GPCR gene) is operably fused to a promoter that possesses a tTA-responsive regulatory element. Here again, mis-expression of the gene-of-interest can be induced in progeny from a cross of the target line with any driver line of interest; moreover, the use of the Tet system as a binary control mechanism allows for an additional level of tight control in the resulting progeny of this cross. When Drosophila food is supplemented with a sufficient amount of tetracycline, it completely blocks expression of the gene-of-interest in the resulting progeny. Expression of the gene-of-interest can be induced at will simply by removal of tetracycline from the food. Also, the level of expression of the gene-of-interest can be adjusted by varying the level of tetracycline in the food. Thus, the use of the Tet system as a binary control mechanism for mis-expression has the advantage of providing a means to control the amplitude and timing of mis-expression of the gene-of-interest, in addition to spatial control. Consequently, if a gene-of-interest (e.g., a fly GPCR gene) has lethal or deleterious effects when mis-expressed at an early stage in development, such as the embryonic or larval stages, the function of the gene-of-interest in the adult can still be assessed using the Tet system, by adding tetracycline to the food during early stages of development and removing tetracycline later so as to induce mis-expression only at the adult stage.

[0207] After isolation of flies carrying mutated or mis-expressed genes such as GPCR genes, or inhibitory RNAs, animals are carefully examined for phenotypes-of-interest. For the situations involving deletions, insertions, point mutations, or mis-expression of GPCR genes, fruit flies are generated that are homozygous and heterozygous for the altered genes.

[0208] Examples of specific phenotypes that may be investigated include but are not limited to: altered body shape, altered body size, lethality, sterility, reduced brood size, increased brood size, altered life span, defective locomotion, altered body plan, altered cell size, increased cell division, decreased cell division, altered feeding, slowed development, increased development, altered metabolism, (such as altered glycogen synthesis, storage, or degradation; altered lipid synthesis, storage or degradation; altered levels of carbohydrate in the hemolymph; and altered levels of lipid in the hemolymph), and altered morphogenesis of specific organs and tissues such as gonad, nervous system, fat body, hemocytes, peripheral sensory organs, bristles, imaginal discs, eye, wing, leg, antennae, gut, or musculature. For example, it is of particular interest to identify the ligand or ligands responsible for activating the GPCRs of the invention, or a non-Drosophila homologue thereof.

[0209] Methods for creation and analysis of transgenic Drosophila strains having modified expression of genes are well known to those skilled in the art (Brand et al., 1994, Methods in Cell Biology 44:635-654; Hay et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:5195-5200). cDNAs or genomic regions encoding normal or mutant genes can be operably fused to a desired promoter, as described above, and the promoter-GPCR gene fusion inserted into any appropriate Drosophila transformation vector for the generation of transgenic flies. Typically, such transformation vectors are based on a well-characterized transposable elements, for example the P element (Rubin and Spradling, 1982, Science 218:348-53), the hobo element (Blackman et al., 1989, EMBO J. 8:211-217), mariner element (Lidholm et al., 1993, Genetics 134:859-868), the hermes element (O'Brochta et al., 1996, Genetics 142:907-914), Minos (Loukeris et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92:9485-9489), or the PiggyBac element (Handler et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:7520-7525), where the terminal repeat sequences of the transposon that are required for transposition are incorporated into the transformation vector and arranged such that the terminal repeat sequences flank the transgene of interest (in this case a promoter-gene fusion) as well as a marker gene used to identify transgenic animals. Most often, marker genes are used that affect the eye color of Drosophila, such as derivatives of the Drosophila white or rosy genes; however, in principle, any gene can be used as a marker that causes a reliable and easily scored phenotypic change in transgenic animals, and examples of other marker genes used for transformation include the Adh⁺gene used as a selectable marker for the transformation of Adh⁻strains, Ddc+ gene used to transform Ddc^ts2mutant strains, the lacZ gene of E. coli, and the neomycin^Rgene from the E. colitransposon Tn5. Plasmid constructs for introduction of the desired transgene are coinjected into Drosophila embryos having an appropriate genetic background, along with a helper plasmid that expresses the specific transposase need to mobilized the transgene into the genomic DNA. Animals arising from the injected embryos (G0 adults) are selected, or screened manually, for transgenic mosaic animals based on expression of the marker gene phenotype and are subsequently crossed to generate fully transgenic animals (G1 and subsequent generations) that will stably carry one or more copies of the transgene of interest. Such stable transgenic animals are inspected for mutant phenotypes, such as abnormal development, morphology, metabolism, growth, longevity, reproduction, viability, or behavior, in order to determine a function for the gene created by ectopic expression or overexpression of the gene, or by expression of mutant genes.

[0210] Generation of an overexpression/mis-expression phenotype is likely to result from either activation or inhibition of a receptor-linked signaling pathway. If such an overexpression/mis-expression phenotype is defined for a fly GPCR gene, clonal analysis can then be used to determine whether this phenotype is restricted to cells expressing the gene (i.e., whether the phenotype is cell autonomous or cell non-autonomous). Methods of mitotic recombination of chromosomes in heterozygous flies can be used to generate mitotic clones of genetically homozygous cells that are well known to those skilled in the art, which include the use of X-rays or preferably FLP/FRT mediated recombination (Xu and Harrison, 1994, Methods in Cell Biology 44:655-681; Greenspan, 1979, In Fly Pushing: The Theory and Practice of Drosophila Genetics. Plainview, N.Y., Cold Spring Harbor Laboratory Press, pp. 103-124). These mitotic recombination techniques result in patches of cells, mitotic clones, that contain two or no functional copies of the gene-of-interest. Production of the overexpression/mis-expression phenotype within cells in a clone having no copies of the gene-of-interest indicates that the effect is not cell autonomous, and is therefore likely to be the effect of a secreted molecule, as might be expected for molecules.

[0211] This invention provides screening methodologies useful in the identification of proteins and other compounds which bind to, or otherwise directly interact with, the D. melanogastergenes and proteins of the invention, such as fly GPCR genes and proteins. Screening methodologies are well known in the art (see e.g., PCT International Publication No. WO 96/34099, published Oct. 31, 1996, which is incorporated by reference herein in its entirety). The proteins and compounds include endogenous cellular components which interact with the identified genes and proteins in vivo and which, therefore, may provide new targets for pharmaceutical and therapeutic interventions, as well as recombinant, synthetic, and otherwise exogenous compounds which may have binding capacity and, therefore, may be candidates for pharmaceutical agents. Thus, in one series of embodiments, cell lysates or tissue homogenates may be screened for proteins or other compounds which bind to one of the normal or mutant D. melanogasterGPCR genes and proteins.

[0212] Alternatively, any of a variety of exogenous compounds, both naturally occurring and/or synthetic (e.g., libraries of small molecules or peptides), may be screened for binding capacity.

[0213] As will be apparent to one of ordinary skill in the art, there are numerous other methods of screening individual proteins or other compounds, as well as large libraries of proteins or other compounds (e.g., phage display libraries) to identify molecules which bind to D. melanogasterGPCR proteins. All of these methods comprise the step of mixing a D. melanogasterGPCR protein or. fragment with test compounds, allowing time for any binding to occur, and assaying for any resultant bound complexes. All such methods are enabled by the present disclosure of substantially pure D. melanogasterGPCR proteins, substantially pure functional domain fragments, fusion proteins, antibodies, and methods of making and using the same.

[0214] The present invention further provides methods of identifying or screening for proteins which interact with D. melanogasterGPCR proteins, or derivatives, fragments or analogs thereof. In specific embodiments, the method of identifying a molecule that binds to a ligand comprises (a) contacting the ligand with a plurality of molecules under conditions conducive to binding between the ligand and the molecules; and (b) identifying a molecule within the plurality that binds to the ligand. The ligand or protein in the method can either be a purified or non-purified form. Preferably, the method of identifying or screening is a yeast two-hybrid assay system or a variation thereof, as further described below. In this regard, the yeast two-hybrid method has been used to analyze IGF-1-receptor interactions (see Zhu and Kahn, 1997, Proc. Natl. Acad. Sci. U.S.A. 94:13063-13068). Derivatives (e.g., fragments) and analogs of a protein can also be assayed for binding to a binding partner by any method known in the art, for example, immunoprecipitation with an antibody that binds to the protein in a complex followed by analysis by size fractionation of the immunoprecipitated proteins (e.g., by denaturing or nondenaturing polyacrylamide gel electrophoresis), Western analysis, non-denaturing gel electrophoresis, etc.

[0215] One aspect of the present invention provides methods for assaying and screening fragments, derivatives and analogs of D. melanogasterGPCR proteins for interacting proteins. Derivatives, analogs and fragments of proteins that interact with a D. melanogasterGPCR protein are preferably identified by means of a yeast two hybrid assay system (Fields and Song, 1989, Nature 340:245-246; U.S. Pat. No. 5,283,173). Because the interactions are screened for in yeast, the intermolecular protein interactions detected in this system occur under physiological conditions that mimic the conditions in eukaryotic cells, including vertebrates or invertebrates (Chien et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:9578-9581). This feature facilitates identification of proteins capable of interaction with a D. melanogasterGPCR protein from species other than D. melanogaster.

[0216] Identification of interacting proteins by the improved yeast two-hybrid system is based upon the detection of expression of a reporter gene, the transcription of which is dependent upon the reconstitution of a transcriptional regulator by the interaction of two proteins, each fused to one half of the transcriptional regulator. The “bait” (e.g., D. melanogasterGPCR protein or derivative or analog thereof) and “prey” (proteins to be tested for ability to interact with the bait) proteins are expressed as fusion proteins to a DNA binding domain, and to a transcriptional regulatory domain, respectively, or vice versa. In various specific embodiments, the prey has a complexity of at least about 50, about 100, about 500, about 1,000, about 5,000, about 10,000, or about 50,000; or has a complexity in the range of about 25 to about 100,000, about 100 to about 100,000, about 50,000 to about 100,000, or about 100,000 to about 500,000. For example, the prey population can be one or more nucleic acids encoding mutants of a protein (e.g., as generated by site-directed mutagenesis or another method of making mutations in a nucleotide sequence). Preferably, the prey populations are proteins encoded by DNA, e.g., cDNA or genomic DNA or synthetically-generated DNA. For example, the populations can be expressed from chimeric genes comprising cDNA sequences from an un-characterized sample of a population of cDNA from mRNA.

[0217] One characteristic of the yeast two-hybrid system is that proteins examined in this system are expressed as cytoplasmic proteins, and therefore do not pass through the secretory pathway. The GPCR proteins of the present invention are integral membrane proteins. Other proteins, such as secreted protein hormones of the invention, normally undergo protein processing during trafficking leading to the removal of certain domains such as a pre-domain, a pro-domain, a prepro-domain, and/or a signal peptide. Therefore, expression of precursor forms of Drosophila secreted proteins in the yeast two-hybrid system does not lead to the removal of such domains. However, several methods are incorporated in the present invention to examine derivatives of secreted proteins that mimic processed forms of these proteins. By way of example, but not limitation, in one embodiment, a secreted protein that is examined in the yeast two-hybrid system is expressed as a modified form containing a prepro-peptide but lacking a signal peptide (Zhu and Kahn, 1997, Proc. Natl . Acad. Sci. U.S.A. 94:13063-13068). In another embodiment, an integral membrane protein such a GPCR that is examined in the yeast two-hybrid system is expressed as a modified form containing individual intracellular or extracellular domains of the GPCR. For example, the cytoplasmic loop between TM5 and TM6 is of particular interest for use in a yeast two-hybrid screen.

[0218] In a specific embodiment, recombinant biological libraries expressing random peptides can be used as the source of prey nucleic acids.

[0219] In another embodiment, the invention provides methods of screening for inhibitors or enhancers of the protein interactants identified herein. Briefly, a protein-protein interaction assay can be carried out as described herein, except that it is done in the presence of one or more candidate molecules. An increase or decrease in reporter gene activity relative to that present when the one or more candidate molecules are absent indicates that the candidate molecule has an effect on the interacting pair. In a preferred method, inhibition of the interaction is selected for (i.e., inhibition of the interaction is necessary for the cells to survive), for example, where the interaction activates the URA3 gene, causing yeast to die in medium containing the chemical 5-fluoroorotic acid (Rothstein, 1983, Meth. Enzymol. 101:167-180). The identification of inhibitors of such interactions can also be accomplished, for example, but not by way of limitation, using competitive inhibitor assays, as described above.

[0220] In general, proteins of the bait and prey populations are provided as fusion (chimeric) proteins (preferably by recombinant expression of a chimeric coding sequence) comprising each protein contiguous to a pre-selected sequence. For one population, the pre-selected sequence is a DNA binding domain. The DNA binding domain can be any DNA binding domain, as long as it specifically recognizes a DNA sequence within a promoter. For example, the DNA binding domain is of a transcriptional activator or inhibitor. For the other population, the pre-selected sequence is an activator or inhibitor domain of a transcriptional activator or inhibitor, respectively. The regulatory domain alone (not as a fusion to a protein sequence) and the DNA-binding domain alone (not as a fusion to a protein sequence) preferably do not detectably interact (so as to avoid false positives in the assay). The assay system further includes a reporter gene operably linked to a promoter that contains a binding site for the DNA binding domain of the transcriptional activator (or inhibitor).

[0221] Accordingly, in the present method of the invention, binding of a D. melanogasterGPCR fusion protein to a prey fusion protein leads to reconstitution of a transcriptional activator (or inhibitor) which activates (or inhibits) expression of the reporter gene. The activation (or inhibition) of transcription of the reporter gene occurs intracellularly, e.g., in prokaryotic or eukaryotic cells, preferably in cell culture.

[0222] The promoter that is operably linked to the reporter gene nucleotide sequence can be a native or non-native promoter of the nucleotide sequence, and the DNA binding site(s) that are recognized by the DNA binding domain portion of the fusion protein can be native to the promoter (if the promoter normally contains such binding site(s)) or non-native to the promoter. Thus, for example, one or more tandem copies (e.g., four or five copies) of the appropriate DNA binding site can be introduced upstream of the TATA box in the desired promoter (e.g., in the area of about position −100 to about −400). In a preferred aspect, four or five tandem copies of the 17 bp UAS (GAL4 DNA binding site) are introduced upstream of the TATA box in the desired promoter, which is upstream of the desired coding sequence for a selectable or detectable marker. In a preferred embodiment, the GAL1-10 promoter is operably fused to the desired nucleotide sequence; the GAL1-10 promoter already contains four binding sites for GAL4.

[0223] Alternatively, the transcriptional activation binding site of the desired gene(s) can be deleted and replaced with GAL4 binding sites (Bartel et al., 1993, BioTechniques 14:920-924; Chasman et al., 1989, Mol. Cell. Biol. 9:4746-4749). The reporter gene preferably contains the sequence encoding a detectable or selectable marker, the expression of which is regulated by the transcriptional activator, such that the marker is either turned on or off in the cell in response to the presence of a specific interaction. Preferably, the assay is carried out in the absence of background levels of the transcriptional activator (e.g., in a cell that is mutant or otherwise lacking in the transcriptional activator).

[0224] In one embodiment, more than one reporter gene is used to detect transcriptional activation, e.g., one reporter gene encoding a detectable marker and one or more reporter genes encoding different selectable markers. The detectable marker can be any molecule that can give rise to a detectable signal, e.g., a fluorescent protein or a protein that can be readily visualized or that is recognizable by a specific antibody. The selectable marker can be any protein molecule that confers the ability to grow under conditions that do not support the growth of cells not expressing the selectable marker, e.g., the selectable marker is an enzyme that provides an essential nutrient and the cell in which the interaction assay occurs is deficient in the enzyme and the selection medium lacks such nutrient. The reporter gene can either be under the control of the native promoter that naturally contains a binding site for the DNA binding protein, or under the control of a heterologous or synthetic promoter.

[0225] The activation domain and DNA binding domain used in the assay can be from a wide variety of transcriptional activator proteins, as long as these transcriptional activators have separable binding and transcriptional activation domains. For example, the GAL4 protein of S. cerevisiae(Ma et al., 1987, Cell 48:847-853), the GCN4 protein of S. cerevisiae(Hope and Struhl, 1986, Cell 46:885-894), the ARDI protein of S. cerevisiae(Thukral et al., 1989, Mol. Cell. Biol. 9:2360-2369), and the human estrogen receptor (Kumar et al., 1987, Cell 51:941-951), have separable DNA binding and activation domains. The DNA binding domain and activation domain that are employed in the fusion proteins need not be from the same transcriptional activator. In a specific embodiment, a GAL4 or LEXA DNA binding domain is employed. In another specific embodiment, a GAL4 or herpes simplex virus VP 16 (Triezenberg et al., 1988, Genes Dev. 2:730-742) activation domain is employed. In a specific embodiment, amino acids 1-147 of GAL4 (Ma et al., 1987, Cell 48:847-853; Ptashne et al., 1990, Nature 346:329-331) is the DNA binding domain, and amino acids 411-455 of VP16 (Triezenberg et al., 1988, Genes Dev. 2:730-742; Cress et al., 1991, Science 251:87-90) comprise the activation domain.

[0226] In a preferred embodiment, the yeast transcription factor GAL4 is reconstituted by protein-protein interaction and the host strain is mutant for GAL4. In another embodiment, the DNA-binding domain is Ace1N and/or the activation domain is Ace1, the DNA binding and activation domains of the Ace1 protein, respectively. Ace1 is a yeast protein that activates transcription from the CUP1 operon in the presence of divalent copper. CUP1 encodes metallothionein, which chelates copper, and the expression of CUP1 protein allows growth in the presence of copper, which is otherwise toxic to the host cells. The reporter gene can also be a CUP1-lacZ fusion that expresses the enzyme beta-galactosidase (detectable by routine chromogenic assay) upon binding of a reconstituted Ace1N transcriptional activator (see Chaudhuri et al., 1995, FEBS Lett. 357:221-226). In another specific embodiment, the DNA binding domain of the human estrogen receptor is used, with a reporter gene driven by one or three estrogen receptor response elements (Le Douarin et al., 1995, Nucl. Acids. Res. 23:876-878).

[0227] The DNA binding domain and the transcriptional activator/inhibitor domain each preferably has a nuclear localization signal (see Ylikomi et al., 1992, EMBO J. 11:3681-3694; Dingwall and Laskey, 1991, TIBS 16:479-481) functional in the cell in which the fusion proteins are to be expressed.

[0228] To facilitate isolation of the encoded proteins, the fusion constructs can further contain sequences encoding affinity tags such as glutathione-S-transferase or maltose-binding protein or an epitope of an available antibody, for affinity purification (e.g., binding to glutathione, maltose, or a particular antibody specific for the epitope, respectively) (Allen et al., 1995, TIBS 20:511-516). In another embodiment, the fusion constructs further comprise bacterial promoter sequences for recombinant production of the fusion protein in bacterial cells.

[0229] The host cell in which the interaction assay occurs can be any cell, prokaryotic or eukaryotic, in which transcription of the reporter gene can occur and be detected, including, but not limited to, mammalian (e.g., monkey, mouse, rat, human, bovine), chicken, bacterial, or insect cells, and is preferably a yeast cell. Expression constructs encoding and capable of expressing the binding domain fusion proteins, the transcriptional activation domain fusion proteins, and the reporter gene product(s) are provided within the host cell, by mating of cells containing the expression constructs, or by cell fusion, transformation, electroporation, microinjection, etc. In a specific embodiment in which the assay is carried out in mammalian cells (e.g., hamster cells, HeLa cells), the DNA binding domain is the GAL4 DNA binding domain, the activation domain is the herpes simplex virus VP16 transcriptional activation domain, and the reporter gene contains the desired coding sequence operably linked to a minimal promoter element from the adenovirus E1B gene driven by several GAL4 DNA binding sites (see Fearon et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:7958-7962). The host cell used should not express an endogenous transcription factor that binds to the same DNA site as that recognized by the DNA binding domain fusion population. Also, preferably, the host cell is mutant or otherwise lacking in an endogenous, functional form of the reporter gene(s) used in the assay. Various vectors and host strains for expression of the two fusion protein populations in yeast are known and can be used (see e.g., U.S. Pat. No. 5,1468,614; Bartel et al., 1993, “Using the two-hybrid system to detect protein-protein interactions” In Cellular Interactions in Development, Hartley, ed., Practical Approach Series xviii, IRL Press at Oxford University Press, New York, N.Y., pp. 153-179; Fields and Stemglanz, 1994, Trends In Genetics 10:286-292). By way of example but not limitation, yeast strains or derivative strains made therefrom, which can be used are N105, N106, N1051, N1061, and YULH. Other exemplary strains that can be used in the assay of the invention also include, but are not limited to, the following:

[0230] Y190: MATa, ura3-52, his3-200, lys2-801, ade2-101, trpl-901, leu2-3,112, gal4α, gal80α, cyh^r2, LYS2::GALl_UAS-HIS3_TATAHIS3, URA3::GALl_UAS-GALl_TATA-lacZ; Harper et al., 1993, Cell 75:805-816, available from Clontech, Palo Alto, Calif. Y190 contains HIS3 and lacZ reporter genes driven by GAL4 binding sites.

[0231] CG-1945: MATa, ura3-52, his3-200, lys2-801, ade2-101, trpl-901, leu2-3,112, gal4-542, gal80-538, cyh^r2, LYS2::GALl_UAS-HIS3_TATAHIS3, URA3::GALl_{UAS17mers(x3)}-CYC1_TATA-lacZ, available from Clontech, Palo Alto, Calif. CG-1945 contains HIS3 and lacZ reporter genes driven by GAL4 binding sites.

[0232] Y187: MAT-α, ura3-52, his3-200, ade2-101, trp1-901, leu2-3,112, gal4α, gal80α, URA3::GAL1_UAS-GAL1_TATA-lacZ, available from Clontech, Palo Alto, Calif. Y187 contains a lacZ reporter gene driven by GAL4 binding sites.

[0233] SFY526: MATa, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3,112, gal4-542, gal80-538, can^r, URA3::GAL1-lacZ, available from Clontech, Palo Alto, Calif. SFY526 contains HIS3 and lacZ reporter genes driven by GAL4 binding sites.

[0234] HF7c: MATa, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3,112, gal4-542, gal80-538, LYS2::GAL1-HIS3, URA3::GAL1_{USA17MERS(x3)}-CYC1-lacZ, available from Clontech, Palo Alto, Calif. HF7c contains HIS3 and lacZ reporter genes driven by GAL4 binding sites.

[0235] YRG-2: MATa, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3,112, gal4-542, gal80-538, LYS2::GAL1_UAS-GAL1_TATA-HIS3, URA3::GAL1_{UAS17mers(x3)}-CYC1-lacZ, available from Stratagene, La Jolla, Calif. YRG-2 contains HIS3 and lacZ reporter genes driven by GAL4 binding sites.

[0236] Many other strains commonly known and available in the art can be used.

[0237] If not already lacking in endogenous reporter gene activity, cells mutant in the reporter gene may be selected by known methods, or the cells can be made mutant in the target reporter gene by known gene-disruption methods prior to introducing the reporter gene (Rothstein, 1983, Meth. Enzymol. 101:202-211).

[0238] In a specific embodiment, plasmids encoding the different fusion protein populations can be introduced simultaneously into a single host cell (e.g., a haploid yeast cell) containing one or more reporter genes, by co-transformation, to conduct the assay for protein-protein interactions. Or, preferably, the two fusion protein populations are introduced into a single cell either by mating (e.g., for yeast cells) or cell fusions (e.g., of mammalian cells). In a mating type assay, conjugation of haploid yeast cells of opposite mating type that have been transformed with a binding domain fusion expression construct (preferably a plasmid) and an activation (or inhibitor) domain fusion expression construct (preferably a plasmid), respectively, will deliver both constructs into the same diploid cell. The mating type of a yeast strain may be manipulated by transformation with the HO gene (Herskowitz and Jensen, 1991, Meth. Enzymol. 194:132-146).

[0239] In a preferred embodiment, a yeast interaction mating assay is employed using two different types of host cells, strain-type a and alpha of the yeast Saccharomyces cerevisiae. The host cell preferably contains at least two reporter genes, each with one or more binding sites for the DNA-binding domain (e.g., of a transcriptional activator). The activator domain and DNA binding domain are each parts of chimeric proteins formed from the two respective populations of proteins. One strain of host cells, for example the a strain, contains fusions of the library of nucleotide sequences with the DNA-binding domain of a transcriptional activator, such as GAL4. The hybrid proteins expressed in this set of host cells are capable of recognizing the DNA-binding site in the promoter or enhancer region in the reporter gene construct. The second set of yeast host cells, for example, the alpha strain, contains nucleotide sequences encoding fusions of a library of DNA sequences fused to the activation domain of a transcriptional activator.

[0240] In a preferred embodiment, the fusion protein constructs are introduced into the host cell as a set of plasmids. These plasmids are preferably capable of autonomous replication in a host yeast cell and preferably can also be propagated in E. coli. The plasmid contains a promoter directing the transcription of the DNA binding or activation domain fusion genes, and a transcriptional termination signal. The plasmid also preferably contains a selectable marker gene, permitting selection of cells containing the plasmid. The plasmid can be single-copy or multi-copy. Single-copy yeast plasmids that have the yeast centromere may also be used to express the activation and DNA binding domain fusions (Elledge et al., 1988, Gene 70:303-312).

[0241] In another embodiment, the fusion constructs are introduced directly into the yeast chromosome via homologous recombination. The homologous recombination for these purposes is mediated through yeast sequences that are not essential for vegetative growth of yeast, e.g., the MER2, MER1, ZIPI, REC102, or ME14 gene.

[0242] Bacteriophage vectors can also be used to express the DNA binding domain and/or activation domain fusion proteins. Libraries can generally be prepared faster and more easily from bacteriophage vectors than from plasmid vectors.

[0243] In a specific embodiment, the present invention provides a method of detecting one or more protein-protein interactions comprising: (a) recombinantly expressing a D. melanogasterGPCR protein or a derivative or analog thereof in a first population of yeast cells being of a first mating type and comprising a first fusion protein containing the D. melanogasterGPCR sequence and a DNA binding domain, wherein said first population of yeast cells contains a first nucleotide sequence operably linked to a promoter driven by one or more DNA binding sites recognized by said DNA binding domain such that an interaction of said first fusion protein with a second fusion protein, said second fusion protein comprising a transcriptional activation domain, results in increased transcription of said first nucleotide sequence; (b) recombinantly expressing in a second population of yeast cells of a second mating type different from said first mating type, a plurality of said second fusion proteins, each second fusion protein comprising a sequence of a fragment, derivative or analog of a protein and an activation domain of a transcriptional activator, in which the activation domain is the same in each said second fusion protein; (c) mating said first population of yeast cells with said second population of yeast cells to form a third population of diploid yeast cells, wherein said third population of diploid yeast cells contains a second nucleotide sequence operably linked to a promoter driven by a DNA binding site recognized by said DNA binding domain such that an interaction of a first fusion protein with a second fusion protein results in increased transcription of said second nucleotide sequence, in which the first and second nucleotide sequences can be the same or different; and (d) detecting said increased transcription of said first and/or second nucleotide sequence, thereby detecting an interaction between a first fusion protein and a second fusion protein. In a preferred aspect, between step (a) and (b), a step is carried out of negatively selecting to eliminate those yeast cells in said first population which said increased transcription of said first nucleotide sequence occurs in the absence of said second fusion protein (see e.g. PCT International Publication No. WO97/47763, published Dec. 18, 1997, which is incorporated by reference herein in its entirety).

[0244] In a preferred embodiment, the bait D. melanogasterGPCR cytoplasmic domain sequence and the prey library of chimeric genes are combined by mating the two yeast strains on solid media, such that the resulting diploids contain both kinds of chimeric genes, i.e., the DNA-binding domain fusion and the activation domain fusion.

[0245] Preferred reporter genes include the URA3, HIS3 and/or the lacZ genes (see e.g., Rose and Botstein, 1983, Meth. Enzymol. 101:167-180) operably linked to GAL4 DNA-binding domain recognition elements. Other reporter genes include but are not limited to, Green Fluorescent Protein (GFP) (Cubitt et al., 1995, Trends Biochem. Sci. 20:448-455), luciferase, LEU2, LYS2, ADE2, TRP1, CAN1, CYH2, GUS, CUP1 or chloramphenicol acetyl transferase (CAT). Expression of the reporter genes can be detected by techniques known in the art (see e.g. PCT International Publication No. WO97/47763, published Dec. 18, 1997, which is incorporated by reference herein in its entirety).

[0246] In a specific embodiment, transcription of the reporter gene is detected by a linked replication assay. For example, as described by Vasavada et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:10686-10690, expression of SV40 large T antigen is under the control of the E1B promoter responsive to GAL4 binding sites. The replication of a plasmid containing the SV40 origin of replication, indicates a protein-protein interaction. Alternatively, a polyoma virus replicon can be used (Vasavada et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:10686-90).

[0247] In another embodiment, the expression of reporter genes that encode proteins can be detected by immunoassay, i.e., by detecting the immunospecific binding of an antibody to such protein, which antibody can be labeled, or incubated with a labeled binding partner to the antibody, to yield a detectable signal. Alam and Cook disclose non-limiting examples of detectable marker genes that can be operably linked to a transcriptional regulatory region responsive to a reconstituted transcriptional activator, and thus used as reporter genes (Alam and Cook, 1990, Anal. Biochem. 188:245-254).

[0248] The activation of reporter genes like URA3 or HIS3 enables the cells to grow in the absence of uracil or histidine, respectively, and hence serves as a selectable marker. Thus, after mating, the cells exhibiting protein-protein interactions are selected by the ability to grow in media lacking a nutritional component, such as uracil or histidine (see Le Douarin et al., 1995, Nucl. Acids Res. 23:876-878; Durfee et al., 1993, Genes Dev. 7:555-569; Pierrat et al., 1992, Gene 119:237-245; Wolcott et al., 1966, Biochem. Biophys. Acta 122:532-534). In other embodiments of the present invention, the activities of the reporter genes like GFP or lacZ are monitored by measuring a detectable signal (e.g., fluorescent or chromogenic, respectively) that results from the activation of these reporter genes. LacZ transcription, for example, can be monitored by incubation in the presence of a substrate, such as X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside), of its encoded enzyme, β-galactosidase.

[0249] In a preferred embodiment of the present invention, false positives arising from transcriptional activation by the DNA binding domain fusion proteins in the absence of a transcriptional activator domain fusion protein are prevented or reduced by negative selection prior to exposure to the activation domain fusion population (see e.g. PCT International Publication No. WO97/47763, published Dec. 18, 1997, which is incorporated by reference herein in its entirety). By way of example, if such cell contains URA3 as a reporter gene, negative selection is carried out by incubating the cell in the presence of 5-fluoroorotic acid (5-FOA, which kills URA+ cells (Rothstein, 1983, Meth. Enzymol. 101:167-180). Hence, the metabolism of 5-FOA will lead to cell death of self-activating DNA-binding domain hybrids.

[0250] In a preferred aspect, negative selection involving a selectable marker as a reporter gene can be combined with the use of a toxic or growth inhibitory agent to allow a higher rate of processing than other methods. Negative selection can also be carried out on the activation domain fusion population prior to interaction with the DNA binding domain fusion population, by similar methods, either alone or in addition to negative selection of the DNA binding fusion population. Negative selection can be carried out on the recovered protein-protein complex by known methods (see e.g., Bartel et al., 1993, BioTechniques 14:920-924; PCT International Publication No. WO97/47763, published Dec. 18, 1997).

[0251] In a preferred embodiment of the invention, DNA sequences encoding pairs of interacting proteins are isolated by a method wherein either the DNA-binding domain hybrids or the activation domain hybrids are amplified, in separate respective reactions. Preferably, the amplification is carried out by polymerase chain reaction (PCR) (see U.S. Pat. Nos. 4,683,202; 4,683,195; and 4,889,818; Gyllenstein et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7652-7656; Ochman et al., 1988, Genetics 120:621-623; Loh et al., 1989, Science 243:217-220; Innis et al., 1990, PCR Protocols, Academic Press, Inc., San Diego, Calif.) using pairs of oligonucleotide primers specific for either the DNA-binding domain hybrids or the activation domain hybrids. Other amplification methods known in the art can be used, including but not limited to ligase chain reaction (see EP 320,308), use of Qβ replicase, or methods listed in Kricka et al., 1995, Molecular Probing, Blotting, and Sequencing, Academic Press, New York, Chapter 1 and Table IX.

[0252] The plasmids encoding the DNA-binding domain hybrid and the activation domain hybrid proteins can also be isolated and cloned by any of the methods well known in the art. For example, but not by way of limitation, if a shuttle (yeast to E. coli) vector is used to express the fusion proteins, the genes can be recovered by transforming the yeast DNA into E. coliand recovering the plasmids from E. coli(see e.g., Hoffman et al., 1987, Gene 57:267-272). Alternatively, the yeast vector can be isolated, and the insert encoding the fusion protein subcloned into a bacterial expression vector, for growth of the plasmid in E. coli.

[0253] The present invention provides biochemical assays using fly proteins of the invention. In one embodiment, Drosophila proteins such as GPCR proteins are useful for biochemical assays aimed at the identification and characterization of the ligand(s) which bind under physiologic conditions, or the identification of ligands for new GPCR receptors or other proteins that are discovered. The cDNAs encoding the GPCR proteins can be individually subcloned into any of a large variety of eukaryotic expression vectors permitting expression in insect and mammalian cells, described above. The resulting genetically engineered cell lines expressing GPCR proteins can be assayed for production and processing of the mature GPCR proteins, for example, with antibodies to Drosophila GPCR proteins and Western blotting assays or ELISA assays. For assays of specific receptor binding and functional activation of receptor proteins, one can employ genetically engineered cells over-expressing fly GPCRs. Such engineered cells may exhibit characteristics providing clues to determining specific GPCR functions. Further, partially-purified culture medium or extracts, or highly-purified Drosophila or other proteins can also be screened for functional activity when exposed to such engineered cells.

[0254] Specific protein binding of Drosophila GPCR proteins to Drosophila GPCR ligands can be assayed, for example, by following the procedures of Yamaguchi et al. (Yamaguchi et al., 1995, Biochemistry 34:4962-4968). Chinese hamster ovary cells, COS cells, or any other suitable cell line, can be transiently transfected or stably transformed with expression constructs that direct the production of a Drosophila GPCR. Direct binding of a Drosophila GPCR ligand to such recombinant receptor-expressing cells can be measured using, e.g., a labeled Drosophila ligand population. The label is typically a chemical or protein moiety covalently attached to the ligand population which permits the experimental monitoring and quantitation of any labeled ligand that binds to the Drosophila GPCR protein.

[0255] More specifically, a label attached to a ligand population to be screened for binding to a fly GPCR can be a radioactive substituent such as a ¹²⁵I-moiety or a ³²P-phosphate moiety, a fluorescent moiety, or a label which allows for indirect methods of detection such as a biotin-moiety for binding by avidin or streptavidin, an epitope-tag such as a Myc-tag or FLAG-tag, or a protein fusion domain which allows for direct or indirect enzymatic detection such as an alkaline phosphatase-fusion or Fc-fusion domain. Such labeled ligands can be used to test for direct and specific binding to fly GPCR-expressing cells by incubating the labeled proteins with the GPCR-expressing cells in serum-free medium, washing the cells with ice-cold phosphate-buffered saline to remove unbound protein, lysing the cells in buffer with an appropriate detergent, and measuring label in the lysates to determine the amount of bound protein. Alternatively, in place of whole cells, membrane fractions obtained from GPCR-expressing cells may also be used. Also, instead of a direct binding assay, a competition binding assay may be used. The specificity and affinity of binding of Drosophila GPCR proteins can be judged by comparison with other superfamily proteins tested in the same assay, for example, vertebrate GPCRs.

[0256] The invention described herein provides methods wherein Drosophila GPCR proteins are used for the identification of novel GPCR ligands, other than Drosophila ligands, using biochemical methods well known to those skilled in the art for detecting specific protein-protein interactions (see e.g., Current Protocols In Protein Science, 1998, Coligan et al., eds., John Wiley & Sons, Inc., Somerset, N.J.). In particular, it is likely that some Drosophila GPCRs interact with ligand types that have not yet been identified in vertebrates, or with ligand types that are specific to invertebrates. The identification of either novel vertebrate ligand types or invertebrate-specific ligand types is of great interest with respect to human therapeutic applications, or pesticide applications, respectively. Assuming some Drosophila GPCRs do not exhibit specific protein binding to any known ligand in the binding assays described above, then the novel cognate ligands for these GPCRs can be investigated and identified as follows.

[0257] Labeled ligand populations can be used for binding assays in situ to identify ligands binding to fly GPCR receptors, for example, as described elsewhere (Gorczyca et al., 1993, J. Neurosci. 13:3692-3704; see also Formosa et al., 1991, Methods Enzymol. 208:24-45; Formosa et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2442-2446). Further, specific binding proteins can be identified by cross-linking radioactively-labeled or epitope-tagged GPCRs to specific binding proteins in lysates, followed by electrophoresis to identify and isolate the cross-linked protein species (Ransone, 1995, Methods Enzymol. 254:491-497). Still further, molecular cloning methods can be used to identify novel GPCR interacting proteins, e.g., by expression cloning using Drosophila cDNA expression libraries transfected into mammalian cells, expression cloning of specific binding proteins using Drosophila cDNA libraries expressed in E. coli(Cheng and Flanagan, 1994, Cell 79:157-168), and yeast two-hybrid methods (as described above) using a Drosophila GPCR fusion (such as a cytosolic domain fusion) as “bait” for screening activation-domain fusion libraries derived from Drosophila cDNA (Young and Davis, 1983, Science 222:778-782; Young and Davis, 1983, Proc. Natl. Acad. Sci. U.S.A. 80:1194-1198; Sikela and Hahn, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:3038-3042; Takemoto et al., 1997, DNA Cell Biol. 16:797-799).

[0258] Ligands that bind to domains of novel fly proteins of the invention identified herein, such as GPCR cytosolic domains (e.g., the intracellular loop domain between transmembrane domains five and six of a GPCR), transmembrane domains or ligand-binding domains, may also be identified, e.g., from screening of a cDNA expression library, synthetic combinatorial chemistry library, or a phage-displayed random peptide library. Such random peptide libraries have been extensively described elsewhere (see e.g., Kay et al., 1992, Gene 128, 59-65). A brief description of the preparation of a phage-displayed random peptide library follows. One such library is referred to as a TSAR library, for Totally Synthetic Affinity Reagent library. By cloning degenerate oligonucleotides of fixed length into bacteriophage vectors, recombinant libraries of random peptides can be generated which are expressed at the amino-terminus of the pill protein on the surface of M13 viral particles. From three to five copies of the pIII-fusion peptide is expressed on the surface of each particle. Phage display of such random peptides offers at least three conveniences: first, the expressed peptides are on the surface of the viral particles and accessible for interactions; second, the recombinant viral particles are stable (e.g., they can be frozen and/or exposed to pH extremes); and third, the viruses can be easily amplified. Consequently, such libraries can be screened by isolating viral particles that bind to targets, such as fly GPCRs. The isolates can be grown up overnight, and the displayed peptide sequence responsible for binding can be quickly deduced by DNA sequencing. Libraries such as these have approximately >10⁸different recombinants, and nucleotide sequencing of the inserts suggests that the expressed peptides are indeed random in amino acid sequence.

[0259] Accordingly, in another embodiment, this invention provides a method of identifying a compound (e.g., peptide) having a region that binds to a fly domain comprising: (a) providing a (preferably immobilized) target molecule comprising the fly domain; (b) incubating the target molecule with one or more candidate compounds (e.g., an aliquot taken from a random peptide library); (c) removing unbound compounds from the target molecule; and (d) recovering the compound bound to the target molecule. Optionally, the structure of the compound is then determined (e.g., by sequencing).

[0260] The functional activity of fly proteins, such as GPCRs or derivatives or analogs, can be assayed by various methods known to one skilled in the art.

[0261] For example, in one embodiment, where one is assaying for the ability to bind to or compete with a wild-type GPCR protein for binding to an anti-GPCR antibody, various immunoassays known in the art can be used, including but not limited to competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In another embodiment, antibody binding is detected by detecting a label on the primary antibody. In yet another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are well known in the art for detecting binding in an immunoassay and are within the scope of the present invention. In another embodiment, where a GPCR-binding protein is identified, the binding can be assayed, e.g., by any means known in the art. In another embodiment, physiological correlates of protein binding to its substrates and/or receptors (e.g., signal transduction) can be assayed. Here, for example, downstream activation of various physiologic effectors by GPCRs of the invention may be assayed in vitro. Examples of such effectors include but are not limited to adenylyl cyclase and phospholipase C. Other examples are provided below.

[0262] In another embodiment, genetic studies can be done to determine the phenotypic effect of a GPCR gene mutant that is a derivative or analog of a wild-type GPCR gene. Other such methods will be readily apparent to the skilled artisan and are within the scope of the invention.

[0263] Other functional assays of Drosophila GPCR proteins that go beyond ligand or interactor binding can be investigated using recombinant GPCR-expressing cells. Assayable functional activities may include but are not limited to stimulation of cell proliferation, stimulation of overall tyrosine kinase activity (as determined by immunoblotting cell extracts with an anti-phosphotyrosine antibody), stimulation of phosphorylation of specific substrate proteins such as ion channels or transcription factors (using, e.g., ³²P-labeling and immunoprecipitation with antibodies that specifically recognize a substrate protein), and stimulation of other enzymatic activities linked to a signaling pathway of interest, including assays of the following activities: GTPase, adenylyl cyclase, potassium ion conductance, calcium ion conductance, and/or phospholipase C.

[0264] This invention provides animal models which may be used in the identification and characterization of D. melanogasterprotein signaling pathways, and/or phenotypes associated with the mutation or abnormal expression of a D. melanogasterprotein. In a specific embodiment, the protein is a GPCR. Methods of producing such animal models using novel genes and proteins are well known in the art (see e.g., PCT International Publication No. WO 96/34099, published Oct. 31, 1996, which is incorporated by reference herein in its entirety). Such models include but are not limited to the following embodiments.

[0265] First, animals are provided in which a normal D. melanogasterGPCR gene has been recombinantly introduced into the genome of the animal as an additional gene, under the regulation of either an exogenous or an endogenous promoter element, and as either a minigene or a large genomic fragment. Animals are also provided in which a normal gene has been recombinantly substituted for one or both copies of the animal's homologous gene by homologous recombination or gene targeting.

[0266] Second, animals are provided in which a mutant D. melanogasterGPCR gene has been recombinantly introduced into the genome of the animal as an additional gene, under the regulation of either an exogenous or an endogenous promoter element, and as either a minigene or a large genomic fragment. Animals are also provided in which a mutant gene has been recombinantly substituted for one or both copies of the animal's homologous gene by homologous recombination or gene targeting.

[0267] Third, animals are provided in which a mutant version of one of that animal's own genes (bearing, for example, a specific mutation corresponding to, or similar to, a pathogenic mutation of a GPCR gene from another species) has been recombinantly introduced into the genome of the animal as an additional gene, under the regulation of either an exogenous or an endogenous promoter element, and as either a minigene or a large genomic fragment.

[0268] Finally, equivalents of transgenic animals, including animals with mutated or inactivated genes, may be produced using chemical or x-ray mutagenesis. Using the isolated nucleic acids disclosed or otherwise enabled herein, one of ordinary skill may more rapidly screen the resulting offspring by, for example, direct sequencing, restriction fragment length polymorphism (RFLP) analysis, PCR, or hybridization analysis to detect mutants, or Southern blotting to demonstrate loss of an allele.

[0269] Such animal models may be used to identify a D. melanogasterGPCR protein signaling pathway by various methods. In one embodiment, this invention provides a method of identifying a D. melanogasterGPCR signaling pathway comprising: (a) disrupting a D. melanogasterGPCR gene; and (b) identifying the effect of the gene disrupted in step (a) in an assay selected from the group consisting of a developmental assay, an energy metabolism assay, a growth rate assay, and a reproductive capacity assay. Further specific assays may be performed to test for lethality, sterility, reduced brood size, increased brood size, altered life span, defective locomotion, altered body shape, altered body plan, altered body size, altered bristles, altered body weight, altered cell size, increased cell division, decreased cell division, altered feeding, slowed development, increased development, decreased metabolism (including but not limited to alterations in glycogen synthesis, storage, and/or degradation, alterations in lipid synthesis, storage and/or degradation, alterations in levels of carbohydrate in hemolymph, alterations in levels of lipid in hemolymph), alterations in morphogenesis (including but not limited to organs or tissues of the gonad, nervous system, fat body, hemacytes, peripheral sensory organs, imaginal discs, eye, wing, leg, antennae, bristle, gut or musculature). Such assays are well known in the art. In one embodiment, results of an assay may be compared to known mutant phenotypes to determine the signaling pathway involved. In another embodiment, a GPCR gene is disrupted using chemical mutagenesis. In another embodiment, a GPCR gene is disrupted using transposon mutagenesis. In a further embodiment, a GPCR gene is disrupted by radiation mutagenesis. Further, other novel fly genes identified using the methods and database of the invention may be subjected to such analysis.

[0270] Further, this invention provides a method of identifying a phenotype associated with mutation or abnormal expression of a D. melanogasterGPCR protein comprising identifying the effect of a mutated or abnormally expressed D. melanogasterGPCR gene in a D. melanogasteranimal. In one embodiment, the effect is determined by an assay as set forth above.

[0271] In yet another embodiment, a GPCR gene is mutated or abnormally expressed using a technique selected from the group consisting of chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, antisense and double-stranded RNA interference. Abnormal (i.e., ectopic) expression can be overexpression, underexpression (e.g., due to inactivation), expression at a developmental time different from wild-type animals, or expression in a cell type different from in wild-type animals.

[0272] Yet another approach that may be used to probe the biological function of the genes identified herein is by using tests for genetic interactions with other genes that may participate in the same, related, interacting, or modifying genetic or biochemical pathways. In particular, since it is evident that there are multiple GPCR genes in the Drosophila genome, this raises the possibility of functional redundancy of one or more genes. Consequently, it is of interest to investigate the phenotypes of fruit flies containing mutations that eliminate the function of more than one GPCR gene. Such strains carrying mutations in multiple genes can be generated by cross breeding animals carrying the individual mutations, followed by selection of recombinant progeny that carry the desired multiple mutations.

[0273] One specific question is whether genetic analysis of interactions of GPCR genes with other well-characterized Drosophila genes and pathways identifies any novel interactions. Thus, double mutant fruit flies may be constructed that carry mutations in a GPCR gene and any other gene-of-interest.

[0274] It is of particular interest to test the interaction of the GPCR genes with other genes implicated in G-protein signaling, especially those that exhibit similarity to signaling components in vertebrates. For example, fruit flies carrying mutations in GPCR genes and a mutation in such genes as adenylyl cyclase, phospholipase C, or potassium channels would be of use in investigating the involvement of different GPCR genes in the signaling pathway where these genes participate. The database FlyBase (1998, “FlyBase—A Drosophila Database”, Nucl. Acids Res. 26:85-88; see also flybase.bio.indiana.edu) can be consulted for a listing known fly genes that participate in G-protein coupled receptor pathways. Similarly, transgenic animals mis-expressing GPCR genes which further carry mutations in known GPCR signal transduction genes are of interest. Other genetic interactions may be tested based on the actual phenotypes observed for alterations of the GPCR genes alone.

[0275] The initial characterization of phenotypes created by mutations in single or multiple GPCR genes is expected to lead to the identification of Drosophila strains that exhibit mutant phenotypes suitable for large scale genetic modifier screens aimed at discovering other components of the same pathway. The procedures involved in typical genetic modifier screens to define other components of a genetic/biochemical pathway are well known to those skilled in the art and have been described elsewhere (Wolfner and Goldberg, 1994, Methods in Cell Biology 44:33-80; Karim et al., 1996, Genetics 143:315-329). Such genetic modifier screens are based on the identification of mutations in other genes that modify an initial mutant phenotype, by isolating either suppressor mutations that return the mutant phenotype toward normal, or enhancer mutations that make the initial mutant phenotype more severe.

[0276] Genetic modifier screens can follow a variety of strategies, depending on the nature of the sensitizing mutation and the specific pathway affected. Most commonly, a dominant mutation is used as the sensitizer and females carrying this mutation are crossed to wild type males exposed to an effective mutagen, such as EMS, MMS, ENU, triethylamine, diepoxyalkanes, ICR-170, formaldehyde, X-rays, gamma rays, or ultraviolet radiation. The progeny are scored for rare mutations that result in an enhanced or suppressed version of the original mutant phenotype, indicating the presence of a second site modifier mutation. Any new mutations identified as modifiers (i.e. suppressors or enhancers) are candidates for genes that participate in the same pathway. Some sensitizer mutations allow both enhancer and suppressor mutations to be identified by alterations in a dispensable tissue, such as the eye. Others, such as inducible dominant lethals, only permit the recovery of suppressor mutations. The mutagenized animals are crossed to animals of the opposite sex that also carrying the mutant allele to be modified, and the resulting progeny are scored for rare events that result in a suppressed or enhanced version of the original mutant phenotype. In the case where the mutant allele being modified is genetically dominant, as is commonly the situation for ectopically expressed genes, wild type males are mutagenized and crossed to females carrying the mutant allele to be modified. Any new mutations identified as modifiers (i.e., suppressors or enhancers) are candidates for genes that participate in the same phenotype-generating pathway.

[0277] In a pilot-scale genetic modifier screen, 10,000 or fewer mutagenized progeny are inspected; in a moderate size screen, 10,000 to 50,000 mutagenized progeny are inspected; and in a large scale screen, over 50,000 mutagenized progeny are inspected. Progeny exhibiting either enhancement or suppression of the original phenotype are immediately crossed to adults containing balancer chromosomes and used as founders of a stable genetic line. In addition, progeny of the founder adult are retested under the original screening conditions to ensure stability and reproducibility of the phenotype. Additional secondary screens may be employed, as appropriate, to confirm the suitability of each new modifier mutant line for further analysis. For example, newly identified modifier mutations can be tested directly for interaction with other genes of interest known to be involved or implicated in signaling pathways of interest (e.g., hedgehog, patched, smoothened, frizzled, wingless, dunce, rutabaga, amnesiac, mutations in modifier genes obtained from different genetic screens of a signaling pathway of interest), using methods described above. Also, the new modifier mutations can be tested for interactions with genes in other pathways thought to be unrelated or distantly related, such as genes in the Notch signaling pathway. New modifier mutations that exhibit specific genetic interactions with other genes implicated in signaling, but not interactions with genes in unrelated pathways, are of particular interest. Additionally, strains can be generated that carry the new modifier mutations of interest in the absence of the original gene mutation (i.e. a strain wild type for the mutant allele being suppressed or enhanced) to determine whether the new modifier mutation exhibits an intrinsic phenotype, independent of the mutation in a GPCR gene or other novel gene of the invention, which might provide further clues as to the normal function of the new modifier gene.

[0278] Each newly-identified modifier mutation can be crossed to other modifier mutations identified in the same screen to place them into complementation groups, which typically correspond to individual genes (see Greenspan, 1997, In Fly Pushing: The Theory and Practice of Drosophila Genetics, Plainview, N.Y., Cold Spring Harbor Laboratory Press, pp. 23-46). Two modifier mutations are said to fall within the same complementation group if animals carrying both mutations in trans exhibit essentially the same phenotype as animals that are homozygous for each mutation individually.

[0279] Although the genetic modifier screens described above are quite powerful and sensitive, some genes that participate in a GPCR pathway may be missed in this approach, particularly if there is functional redundancy of those genes. This is because the vast majority of the mutations generated in the standard mutagenesis methods described above will be loss-of-Function mutations, whereas gain-of-Function mutations that could reveal genes with functional redundancy will be relatively rare. Another method of genetic screening in Drosophila has been developed that focuses specifically on systematic gain-of-Function genetic screens (Rorth, et al., 1998, Development 125:1049-1057). This method is based on a modular mis-expression system utilizing components of the GAL4/UAS system (which were defined above). In this case, a modified P element, termed an EP element, is genetically engineered to contain a GAL4-responsive UAS element and promoter, and this engineered transposon is used to randomly tag genes by insertional mutagenesis (similar to the method of P mutagenesis described above). Thousands of transgenic Drosophila strains, termed EP lines, can thus be generated each containing a specific UAS-tagged gene. This approach takes advantage of a well-recognized insertional preference of P elements, where it has been found that P elements have a strong tendency to insert at the 5′-ends of genes. Consequently, many of the genes that have been tagged by insertion of EP elements become operably fused to a GAL4-regulated promoter, and increased expression or mis-expression of the randomly tagged gene can be induced by crossing in a GAL4 driver gene (similar that described above).

[0280] Thus, systematic gain-of-Function genetic screens for modifiers of phenotypes induced by mutation or mis-expression of a GPCR gene can be performed as follows. A large battery of thousands of Drosophila EP lines can be crossed into a genetic background containing a mutant or mis-expressed GPCR gene, and further containing an appropriate GAL4 driver transgene. The progeny of this cross can be inspected for enhancement or suppression of the original phenotype induced by mutation/mis-expression of the GPCR gene. Progeny that exhibit an enhanced or suppressed phenotype can be crossed further to verify the reproducibility and specificity of this genetic interaction with the GPCR gene. EP insertions that demonstrate a specific genetic interaction with a mutant or mis-expressed GPCR gene, have therefore physically tagged a new gene that genetically interacts with the . The new modifier gene can be identified and sequenced using PCR or hybridization screening methods that allow the isolation of the genomic DNA adjacent to the position of the EP element insertion.

[0281] This invention provides assays for detecting changes in the expression of the D. melanogastergenes and proteins. Assays for changes in gene expression are well known in the art (see e.g., PCT Publication No. WO 96/34099, published Oct. 31, 1996, which is incorporated by reference herein in its entirety). Such assays may be performed in vitro using transformed cell lines, immortalized cell lines, or recombinant cell lines, or in vivo using animal models.

[0282] In a specific embodiment, expression of a GPCR gene or protein is assayed. In particular, the assays may detect the presence of increased or decreased expression of a D. melanogasterGPCR gene or protein on the basis of increased or decreased mRNA expression (using, e.g., nucleic acid probes), increased or decreased levels of related protein products (using, e.g., the antibodies disclosed herein), or increased or decreased levels of expression of a marker gene (e.g., β-galactosidase or luciferase) operably linked to a 5′ regulatory region in a recombinant construct.

[0283] In yet another series of embodiments, various expression analysis techniques may be used to identify genes which are differentially expressed between two conditions, such as a cell line or animal expressing a normal D. melanogasterGPCR gene compared to another cell line or animal expressing a mutant D. melanogasterGPCR gene. Such techniques comprise any expression analysis technique known to one skilled in the art, including but not limited to differential display, serial analysis of gene expression (SAGE), nucleic acid array technology, subtractive hybridization, proteome analysis and mass-spectrometry of two-dimensional protein gels. In a specific embodiment, nucleic acid array technology (i.e., gene chips) may be used to determine a global (i.e., genome-wide) gene expression pattern in a normal D. melanogasteranimal for comparison with an animal having a mutation in one or more D. melanogastergenes.

[0284] To elaborate further, the various methods of gene expression profiling mentioned above can be used to identify other genes (or proteins) that may have a functional relation to (e.g., may participate in a signaling pathway with) a D. melanogasterGPCR gene. Gene identification of such other genes is made by detecting changes in their expression levels following mutation, i.e., insertion, deletion or substitution in, or overexpression, underexpression, mis-expression or knock-out, of a D. melanogasterGPCR gene, as described herein. Expression profiling methods thus provide a powerful approach for analyzing the effects of mutation in a D. melanogastergene.

[0285] Methods of gene expression profiling are well-known in the art, as exemplified by the following references describing subtractive hybridization (Wang and Brown, 1991, Proc. Natl. Acad. Sci. U.S.A. 88:11505-11509), differential display (Liang and Pardee, 1992, Science 257:967-971), SAGE (Velculescu et al., 1995, Science 270:484-487), proteome analysis (Humphery-Smith et al., 1997, Electrophoresis 18:1217-1242; Dainese et al., 1997, Electrophoresis 18:432-442), and hybridization-based methods employing nucleic acid arrays (Heller et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:2150-2155; Lashkari et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:13057-13062; Wodicka et al., 1997, Nature Biotechnol. 15:1259-1267).

[0286] This invention provides methods for using gene regulatory DNA elements to identify tissues, cells, genes and factors that specifically control GPCR protein production. In one embodiment, regulatory DNA elements, such as enhancers/promoters, from Drosophila GPCR genes are useful for identifying and manipulating specific cells and tissues that synthesize a GPCR protein. Such cells and tissues are of considerable interest since they are likely to have an important regulatory function within the animal in sensing and controlling various aspects of cellular signaling. Analyzing components that are specific to cell signaling is likely to lead to an understanding of how to manipulate these regulatory processes, either for therapeutic applications or pesticide applications, as well as an understanding of how to diagnose dysfunction in these processes. Regulatory DNA elements derived from GPCR genes provide a means to mark and manipulate such cells, and further, identify regulatory genes and proteins, as described below.

[0287] In a specific embodiment, gene fusions with GPCR gene regulatory elements can be made. For compact genes that have relatively few and small intervening sequences, it is typical that the regulatory elements that control spatial and temporal expression patterns are found in the DNA immediately upstream of the coding region, often extending to the nearest neighboring gene. Regulatory regions can be used to construct gene fusions where the regulatory DNAs are operably fused to a coding region for a reporter protein whose expression is easily detected, and these constructs may be introduced as transgenes into Drosophila. An entire regulatory DNA region can be used, or the regulatory region can be divided into smaller segments to identify sub-elements that might be specific for controlling expression a given cell type or stage of development. Examples of reporter proteins that can be used for construction of these gene fusions include but are not limited to E. colibeta-galactosidase or green fluorescent protein (GFP), whose products can be detected readily in situ and which are useful for histological studies (O'Kane,and Gehring, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:9123-9127; Chalfie et al., 1994, Science 263:802-805) and sorting of specific cells that express proteins (Cumberledge and Krasnow, 1994, Methods in Cell Biology 44:143-159); the cre or FLP recombinase proteins that can be used to control the presence and expression of other genes in the same cells through site-specific recombination (Golic and Lindquist, 1989, Cell 59:499-509; White et al., 1996, Science 271:805-807); toxic proteins such as the reaper, and cell death proteins which are useful to specifically ablate cells that normally express certain proteins in order to assess the physiological function of certain tissues (see Kingston, 1998, In Current Protocols in Molecular Biology. Ausubel et al., John Wiley & Sons, Inc. sections 12.0.3-12.10) or any other protein where it is desired to examine the function this particular protein specifically in cells that synthesize and secrete proteins (as described in the mis-expression analysis above).

[0288] Alternatively, a binary reporter system can be used, similar to that described above, where a GPCR regulatory element is operably fused to the coding region of an exogenous transcriptional activator protein, such as the GAL4 or tTA activators described above, to create a GPCR regulatory element “driver gene”. For the other half of the binary system the exogenous activator controls a separate “target gene” containing a coding region of a reporter protein operably fused to a cognate regulatory element for the exogenous activator protein, such as UASG or a tTA-response element, respectively. An advantage of a binary system is that a single driver gene construct can be used to activate transcription from preconstructed target genes encoding different reporter proteins, each with its own uses as delineated above.

[0289] The regulatory element-reporter gene fusions described in the preceding paragraph are also useful for tests of genetic interactions, where the objective is to identify those genes that have a specific role in controlling the expression of GPCR genes, or promoting the growth and differentiation of the tissues that expresses a GPCR protein. Transgenic Drosophila carrying a GPCR regulatory element-reporter gene fusion can be crossed with another Drosophila strain carrying a mutation-of-interest and the resulting progeny examined. For example, the mutation-or-interest might be a modifier mutation arising from a genetic modifier screen as described in a preceding section. If no change of expression of the reporter gene in the resulting progeny is observed, this is indicative of a lack of involvement of the gene altered by the mutation-of-interest in controlling protein expression; by contrast, if a significant increase, decrease, loss, or mis-expression of the reporter protein in the resulting progeny is observed, this is indicative of a regulatory role for the gene altered by the mutation-of-interest in cells expressing the protein.

[0290] In yet another embodiment, GPCR gene regulatory DNA elements are used in protein-DNA binding assays to identify gene regulatory proteins that control the expression of GPCR genes. Such gene regulatory proteins can be detected using a variety of methods that probe specific protein-DNA interactions well known to those skilled in the art (see e.g., Kingston, 1998, In Current Protocols in Molecular Biology, Ausubel et al, John Wiley & Sons, Inc., sections 12.0.3-12.10) including in vivo footprinting assays based on protection of DNA sequences from chemical and enzymatic modification within living or permeabilized cells, in vitro footprinting assays based on protection of DNA sequences from chemical or enzymatic modification using protein extracts nitrocellulose filter-binding assays and gel electrophoresis mobility shift assays using radioactively labeled regulatory DNA elements mixed with protein extracts. In particular, it is of interest to identify those DNA binding proteins whose presence or absence is specific to GPCR protein expressing tissue, as judged by comparison of the DNA-binding assays described above using cells/extracts from a GPCR gene-expressing tissue versus other cells/extracts from tissues that do not express a certain GPCR gene or genes. For example, a DNA-binding activity that is specifically present in cells that normally express a GPCR protein might function as a transcriptional activator of the GPCR gene; conversely, a DNA-binding activity that is specifically absent in cells that normally express a GPCR protein might function as a transcriptional repressor of the GPCR gene. Having identified candidate GPCR gene regulatory proteins using the above DNA-binding assays, these regulatory proteins can themselves be purified using a combination of conventional and DNA-affinity purification techniques. In this case, the DNA-affinity resins/beads are generated by covalent attachment to the resin of a small synthetic double stranded oligonucleotide corresponding to the recognition site of the DNA binding activity, or a small DNA fragment corresponding to the recognition site of the DNA binding activity, or a DNA segment containing tandemly iterated versions of the recognition site of the DNA binding activity. Alternatively, molecular cloning strategies can be used to identify proteins that specifically bind GPCR gene regulatory DNA elements. For example, a Drosophila cDNA library in an E. coliexpression vector, such as the lambda-gt11 vector, can be screened for Drosophila cDNAs that encode GPCR gene regulatory element DNA-binding activity by probing the library with a labeled DNA fragment, or synthetic oligonucleotide, derived from the gene regulatory DNA, preferably using a DNA region where specific protein binding has already been demonstrated with a protein-DNA binding assay described above (Singh et al., 1989, Biotechniques 7:252-261). Similarly, the yeast “one-hybrid” system can be used as another molecular cloning strategy (Li and Herskowitz, 1993, Science 262:1870-1874; Luo et al., 1996, Biotechniques 20:564-568; Vidal et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 93:10315-10320). In this case, the gene regulatory DNA element is operably fused as an upstream activating sequence (UAS) to one, or typically more, yeast reporter genes such as the lacZ gene, the URA3 gene, the LEU2 gene, the HIS3 gene, or the LYS2 gene, and the reporter gene fusion construct(s) inserted into an appropriate yeast host strain. It is expected that in the engineered yeast host strain the reporter genes will not be transcriptionally active, for lack of a transcriptional activator protein to bind the UAS derived from the Drosophila GPCR gene regulatory DNA. The engineered yeast host strain can be transformed with a library of Drosophila cDNAs inserted in a yeast activation domain fusion protein expression vector, e.g. pGAD, where the coding regions of the Drosophila cDNA inserts are fused to a functional yeast activation domain coding segment, such as those derived from the GAL4 or VPI6 activators. Transformed yeast cells that acquire Drosophila cDNAs that encode proteins that bind the Drosophila GPCR gene regulatory element can be identified based on the concerted activation the reporter genes, either by genetic selection for prototrophy (e.g. LEU2, HIS3, or LYS2 reporters) or by screening with chromogenic substrates (lacZ reporter) by methods known in the art.

[0291] The present invention provides for the use of Drosophila GPCRs or fragments or derivatives thereof or ligands thereto as media additives. Such additives may modify growth, differentiation and/or maintenance of cells in culture. As signaling proteins, GPCRs may be useful to provide one or more of these functions.

[0292] Examples of known culture media that are commonly used to maintain Drosophila and other insect cell lines include Schneider's medium (Schneider, 1964, J. Exp. Zool. 156:91-103), D-22 (Echalier and Ohanessian, 1970, In Vitro 6:162-172), M3 (Shields and Sang, 1977, Drosophila Information Service 52:161), and commercially-available media such as HyQ-CCM3 (HyClone Laboratories, Inc., Logan, Utah), Sf-900 II (Life Technologies, Inc., Rockville, Md.), Grace's insect medium (Life Technologies, Inc., Rockville, Md.), IPL-41 insect medium (Life Technologies, Inc., Rockville, Md.), TC-100 insect medium (Life Technologies, Inc., Rockville, Md.), Ex-Cell 401 (JRH Biosciences, Lenexa, Kans.), and TMN-FH (PharMingen, San Diego, Calif.). However, not all insect cells can be propagated effectively in these available media. Furthermore, it is difficult and time consuming to wean cells onto serum-free media for large-scale protein production. Accordingly, a need exists for novel media additive capable of modifying growth, differentiation and/or maintenance of cells in culture.

[0293] In a specific embodiment, a fly GPCR protein or fragment (or ligand thereto) is used to facilitate the in vitro cultivation of Drosophila or other insect cells. Insect cell lines are widely used for basic research in cell and molecular biology. Also, Drosophila and other insect cell lines have application as a preferred system for developing cell-based assays for insecticide targets, particularly those that might be amenable to high-throughput screening methods (see U.S. Pat. Nos. 5,767,261; 5,487,986; 5,641,652; 5,593,862; 5,593,864; 5,550,049; 5,514,578).

[0294] In another embodiment, the Drosophila GPCR proteins are employed for the in vitro cultivation of Drosophila and other insect cell lines used as host cells for the economical production of recombinant proteins on laboratory, pilot, or commercial scales (Johansen et al., 1989, Genes Dev. 3:882-889; Culp et al., 1991, Biotechnology 9:173-177; Kirkpatrick et al., 1995, J. Biol. Chem. 270:19800-19805; Griffiths and Page, 1997, Methods Mol. Biol. 75:427-40; McCarroll and King, 1997, Curr. Opin. Biotechnol. 8:590-594; Merrington et al., 1997, Mol. Biotechnol. 8:283-297; Possee, 1997, Curr. Opin. Biotechnol. 8:569-572). Further, the Drosophila and other insect cell lines can be used as hosts for the large-scale growth in vitro of viruses or bacteria that can be used as commercial insect control agents (Zhou et al., 1998, Proc. R. Soc. Lond. B. Biol. Sci. 265:509-515; Miltenburger, 1980, Dev. Biol. Stand. 46:295-300; Miltenburger and Reimann, 1980, Dev. Biol. Stand. 46:217-22; Shuler, et al., 1990, Ann. N.Y. Acad. Sci. 589:399-422).

[0295] In another embodiment of the invention, Drosophila genes may be used in controlling agriculturally important pest species. For example, the GPCR proteins disclosed herein, or analogs or derivatives thereof or ligands thereof or interactors thereto, may have activity in modifying the growth, feeding and/or reproduction of crop-damaging invertebrate pest species including insects, arachnids and acarids, molluscs, nematodes and other helminths. Such pest species include urban pests (e.g., cockroaches), agricultural crop pests (e.g., Colorado potato beetle, European corn borer), human and animal pests (e.g., mosquitoes, fleas, ticks, biting flies, parasitic nematodes, chiggers, mites), hygenic and esthetic pests (e.g., ants, clothes moths, flour beetles), home and garden pests (e.g., cockroaches, fleas, spiders), and pests posing a threat to the integrity of man-made structures including houses and marine piers (e.g., wood-boring pests such as termites, and marine pests such as snails and barnicles). In general, effective pesticides exert a disabling activity on the target pest, such as lethality, sterility, paralysis, blocked development, or cessation of feeding. Such pests may include but are not limited to egg, larval, juvenile and adult forms of dipterans (flies, mosquitos), lepidopterans (moths, caterpillars), coleopterans (beetles), hymenopterans (ants, wasps), homopterans (aphids, leafhoppers), hemipterans (lice), siphonapterans (fleas), isopterans (termites), blattarians (roaches), orthopterans (grasshoppers, locusts), arachnids (spiders, scorpions), and acarids (mites, ticks).

[0296] Tests for such activities can be carried out by any method known in the art. Pesticides comprising the nucleic acids of Drosophila GPCRs may be prepared in a suitable vector for delivery to a plant or animal. Such vectors include but are not limited to Agrobacterium tumefaciensTi plasmid-based vectors for the generation of transgenic plants (Horsch et al., 1984, Science 233:496-489; Fraley et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:4803) or recombinant cauliflower mosaic virus for the incoulation of plant cells or plants (Hohn et al., 1982, In Molecular Biology of Plant Tumors, Academic Press, New York, pp 549-560; Howell, U.S. Pat. No. 4,407,956); retrovirus-based vectors for the introduction of genes into vertebrate animals (Burns et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90:8033-8037); and vectors based on transposable elements such a P (Rubin and Spradling, 1982, Science 218:348-353), minos (Loukeris et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92:9485-9489), Hermes (O'Brochta et al., 1996, Genetics 142: 907-914), mariner (Coates et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:3748-3751), or PiggyBac (Handler et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:7520-7525) for.the introduction of genes into insects. For example, transgenic insects can be generated using a transgene comprising a GPCR gene operably fused to an appropriate inducible promoter. For example, a tTA-responsive promoter may be used (see above) in order to direct expression of the protein at an appropriate time in the life cycle of the insect. In this way, one may test efficacy as an insecticide in, for example, the larval phase of the life cycle (i.e., when feeding does the greatest damage to crops).

[0297] Further, recombinant or synthetic GPCR proteins, analogs, fragments, derivatives, ligands or interactors can be assayed for insecticidal activity by injection of solutions of proteins into the hemolymph of insect larvae (Blackburn et al., 1998, Appl. Environ. Microbiol. 64:3036-3041; Bowen and Ensign, 1998, Appl. Environ. Microbiol. 64:3029-3035). Still further, transgenic plants that express proteins can be tested for activity against insect pests (Estruch et al., 1997, Nat. Biotechnol. 15:137-141).

[0298] In a preferred embodiment, GPCR and other fly genes can be tested as insect control agents in the form of recombinant viruses that direct the expression of an gene in the target pest. Suitable recombinant virus systems for expression of proteins in infected insect cells include but are not limited to recombinant Semliki Forest virus (DiCiommo and Bremner, 1998, J. Biol. Chem. 273:18060-18066), recombinant sindbis virus (Higgs et al., 1995, Insect Mol. Biol. 4:97-103; Seabaugh et al., 1998, Virology 243:99-112), recombinant pantropic retrovirus (Matsubara et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 93:6181-6185; Jordan et al., 1998, Insect Mol. Biol. 7:215-222), and most preferably recombinant baculovirus. Use of recombinant baculoviruses as a means to engineer expression of toxic proteins in insects, and as insect control agents, is well known in the art. This approach has a number of specific advantages including host specificity, environmental safety, the availability of easily manipulable vector systems, and the potential use of the recombinant virus directly as a pesticide without the need for purification or formulation of the protein (Cory and Bishop, 1997, Mol. Biotechnol. 7:303-313; U.S. Pat. Nos. 5,470,735; 5,352,451; 5,770,192; 5,759,809; 5,665,349; 5,554,592). Thus, recombinant baculoviruses that direct the expression of GPCR or other identified genes can be used for both testing the pesticidal activity of proteins under controlled laboratory conditions, and as insect control agents in the field. One disadvantage of wild type baculoviruses as insect control agents can be the amount of time between application of the virus and death of the target insect, typically one to two weeks. During this period, the insect larvae continue to feed and damage crops. Consequently, there is a need to develop improved baculovirus-derived insect control agents which result in a rapid cessation of feeding of infected target insects.

[0299] Mutational anaylsis of GPCR genes may also be used in connection with the control of agriculturally-important pests. In this regard, mutational analysis of genes encoding GPCRs in Drosophila provides a rational approach to determine the precise biological function of this class of proteins in invertebrates. Further, mutational analysis provides a means to validate potential pesticide targets that are constituents of these signaling pathways.

[0300] Drosophila GPCR genes, proteins, derivatives, fragments, analogs, and ligands and interactors thereof may be formulated with any carrier suitable for agricultural use, such as water, organic solvents and/or inorganic solvents. The pesticide composition may be in the form of a solid or liquid composition and may be prepared by fundamental formulation processes including but not limited to dissolving, mixing, milling, granulating, and dispersing.

[0301] The present invention encompasses compositions containing a Drosophila GPCR protein or gene in a mixture with agriculturally acceptable excipients known in the art, including but not limited to vehicles, carriers, binders, UV blockers, adhesives, hemecants, thickeners, dispersing agents, preservatives and insect attractants. Thus the compositions of the invention may, for example, be formulated as a solid comprising the active agent and a finely divided solid carrier. Alternatively, the active agent may be contained in liquid compositions including dispersions, emulsions and suspensions thereof. Any suitable final formulation may be used, including for example, granules, powder, bait pellets (a solid composition containing the active agent and an insect attractant or food substance), microcapsules, water dispersible granules, emulsions and emulsified concentrates.

[0302] Examples of adjuvant or carriers suitable for use with the present invention include but are not limited to water, organic solvent, inorganic solvent, talc, pyrophyllite, synthetic fine silica, attapugus clay, kieselguhr chalk, diatomaceous earth, lime, calcium carbonate, bontonite, fuller's earth, cottonseed hulls, wheat flour, soybean flour, pumice, tripoli, wood flour, walnut shell flour, redwood flour, and lignin.

[0303] The compositions of the present invention may also include conventional insecticidal agents and/or may be applied in conjunction with conventional insecticidal agents.

[0304] As described herein, the oligonucleotides comprising all or a portion of the nucleotide sequences having SEQ ID NOs listed in Table 1 can be used for a wide variety of purposes, e.g., mapping, double-stranded RNAi interference (described above), cloning of full-length genes, and in microarrays representing all or a portion (preferably, a majority) of the genes of Drosophila. A microarray, further described in section 5.17 below, is preferably used to detect or measure expression of the RNAs (or cDNAs derived therefrom) that hybridize to the oligonucleotides.

[0305] Drosophila ESTs and sequence contigs derived from ESTs are useful as molecular markers to relate individual genes and proteins to the physical and genetic map of the genome of Drosophila melanogaster, and are particularly useful for assembly of a transcript map of the entire genome. Such transcript maps are important tools for rapidly identifying, mapping and characterizing mutant genes that arise from large scale genetic screens, such as those described herein. Drosophila ESTs can be connected to the physical map of the genome using a variety of methods known in the art. Individual ESTs can be mapped to specific cytogenetic locations by in situ hybridization of EST-derived DNA probes to Drosophila polytene chromosomes (Pardue, 1994, Meth. Cell Biol. 44: 333-351). Also, individual ESTs can be assigned to specific genomic locations by mapping each EST with respect to arrayed libraries of large insert genomic clones, such as cosmid, P1, BAC or YAC libraries, where the genomic clones have been assembled into contigs and have themselves been mapped to cytogenetic locations on polytene chromosomes (Kimmerly et al., 1996, Genome Research 6: 414-430; Rubin, 1996, Genome Research 6: 71-79). Mapping ESTs with respect to arrayed large-insert genomic libraries can be carried out using the EST DNA as a hybridization probe with filters containing spotted clones from the arrayed genomic library. Alternatively, the EST sequences can be used to design PCR primers for mapping to large-insert genomic clones using a so-called STS content approach (Kimmerly et al., 1996, Genome Research 6: 414-430). Because EST sequences are expected to be reasonably uniformly distributed throughout the euchromatic regions of the genome, these sequences also have utility for the identification of single nucleotide polymorphisms (SNPs) which can be employed as molecular markers for moderate and high resolution genetic mapping of genes (WO 98/38846). Specific SNP alleles in different Drosophila stocks, which can be used as markers for genetic mapping, can be identified using any of several different methods including direct DNA sequencing, denaturing gradient gel electrophoresis (Erlich, ed., 1992, PCR Technology, Principles and Applications for DNA Amplification, W H Freeman and Co., New York, Chapter 7), single-stranded conformation polymorphism analysis (Orita et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86, 1766-1770), and denaturing high pressure liquid chromatography.

[0306] Drosophila ESTs and sequence contigs derived from ESTs are useful as tools for retrieval of full-length protein coding sequences, and for proteomics analysis.

[0307] Full-length Cloning

[0308] Full length cloning of genes based on the EST information can be accomplished using at least two different methods: (a) Rapid Amplification of cDNA Ends (RACE); and/or (b) hybridization of a nucleic acid comprising an EST to a library of full-length cDNA clones. RACE is a rapid, PCR-based technique for obtaining full-length cDNA clones when a partial cDNA sequence is available (Frohman et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002; Zhang et al., 1997, Meth. Mol. Biol. 69:61-87). First, PCR is used to amplify partial cDNAs from the the region between a single point in an mRNA transcript and its 3′ or 5′ end. For this procedure, a short internal stretch of sequence (such as an EST) must already be known from the mRNA of interest. From this sequence, gene-specific primers are chosen that are oriented in the direction of the missing sequence. Extension of the partial cDNAs from the unknown end of the message back to the known region is achieved using primers that anneal to the preexisting poly A⁺ tail at the 3′ end, or to an appended homopolymer oligonucleotide tail at the 5′ end.

[0309] In one RACE variation, total RNA is first purified from cells of interest. Oligo-dT primers are then used to isolate the poly A⁺mRNA from total RNA. This step enhances successful isolation of 3′RACE products. An RNA anchor oligo may also be attached to the 5′ end of the mRNA. This step permits successful isolation of 5′ RACE products. First and second strand cDNAs are then synthesized from mRNA, and RACE PCR reactions are carried out. Full-length cDNAs can then be generated by end-to-end amplification using 5′ and 3′ gene-specific primers, or by ligating the two fragments using a unique restriction site in the overlapping CDNA sequence. The resulting product can then be cloned and sequenced. In another RACE variation, first and second-strand cDNAs are synthesized from mRNA, and adaptors are ligated to the 5′ end of the double-stranded cDNA population.

[0310] Another method of obtaining full-length cDNA clones from partial cDNA sequences such as ESTs is by hybridization of the partial cDNA clones, or PCR products amplified therefrom, to a library of full-length cDNA clones. (see e.g., Ausubel et al., 1999, In: Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). Briefly, the library is first plated onto nutrient agar plates at a high enough density to allow separation of individual clones. Nitrocellulose or nylon membranes the exact size of the plate are then placed over the clones, marked, and then lifted. In this way, an accurate replica representation of the clones on a plate is made on the membrane which contacted the plate. The DNA from clone replicas on each membrane is denatured and fixed. Specific clones are then identified by hybridization to a labeled nucleic acid, such as an EST, representing the cDNA of interest. Positive clones are identified and isolated by aligning the original nutrient agar plate with the resulting autoradiograph from the hybridization to the labeled EST. Labeling of EST cDNA for hybridization can be accomplished by a variety of methods well known in the art. A preferred method is the Rediprime labeling system, available from Amersham (Amersham Pharmacia Biotech, U.S.A.). This system is based on random labeling and uses radioactive dCTP. Unincorporated nucleotides can be removed using, e.g., Clontech spin columns as per manufacturer's suggestions. Hybridizations may be carried out in a solution containing 5×SSC, 0.5%SDS, 5×Denhardt's and 0.2 mg/ml sonicated fish sperm DNA, at 65° C. Washes are carried out at 65° C. with a solution containing 0.1×SSC and 0.1%SDS, three times, for 20 minutes each.

[0311] Proteomics

[0312] The EST sequences of the invention provide novel sequences useful in proteomics analysis. Genome sequencing efforts provide a wealth of data on DNA and RNA sequences. Proteomics, the study of all the proteins of an organism, aims to supplement the gene sequence data with information on how the gene sequences predict their respective protein sequences, what proteins are made where, in what amounts, and under what conditions. Proteomics further aims to show how protein cascades inside cells change as a result of specific diseases, thereby identifying novel prospective drug targets. Proteomics still further aims to validate particular drug leads against identified prospective targets by providing information on how lead compounds interact with and affect proteome cascades (e.g., signal transduction pathways).

[0313] From a technological standpoint, the essence of proteomics analysis is protein characterization. As such, the oldest technique known for accomplishing this task is protein sequencing using Edman Degradation (Edman, 1950, Acta Chem. Scand. 4, 282-283; Wasinger et al., 1995, Electrophoresis 16, 1090-1094). Mass spectrometry (MS) methods have also been developed as alternatives to Edman sequencing. With this approach, proteins and peptides are first digested, either chemically or enzymatically, to produce a unique degradation pattern that can then be analyzed by MS (Henzel et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90, 5011-5015). Another essential and heavily-used technique for charaterization of protein expression patterns is 2-dimensional gel electrophoresis (2-DE). At high resolution, this powerful technique produces gels containing up to 10,000 distinct protein and peptide spots (Klose et al., 1995, Electrophoresis 16, 1034-1059).

[0314] Analysis of 2-DE and MS data is an integral part of the proteomics approach. Currently, 2-DE gel patterns are scanned into a computer and analyzed using algorithms that quantitate the different gel patterns that arise when a proteome complement of a cell is obtained under normal or altered states (Taylor et al., 1982, Clin. Chem. 28, 861-866). Computer algorithms are also used to analyze data from peptide mass fingerprints. One method relies on comparing the actual MS spectrum of a test sample to a database of predicted spectra (Yates et al., 1993, Anal. Biochem. 214, 397-408; Yates, 1998, J. Mass Spec. 33, 1-19).

[0315] As mentioned above, the oligonucleotides comprising all or a portion of the nucleotide sequences having SEQ ID NOs listed in Table 1 can be used in microarrays representing all or a portion (preferably, a majority) of the genes of Drosophila. A microarray, as stated above, is preferably used to detect or measure expression of the RNAs (or cDNAs derived therefrom) that hybridize to the oligonucleotides. In one embodiment, a microarray is used to detect or measure the expression of genes which function in any given pathway-of-interest (such as a GPCR pathway). In another embodiment, a microarray is used to detect or measure the expression of genes which function in a GPCR pathway (e.g., a fly GABA_Bpathway or a fly melatonin receptor pathway) or another pathway (e.g., a fly chitin synthase 2 pathway or a fly sphingomyelinase pathway).

[0316] The present invention further relates to methods for using proteins and nucleotide sequences of a Drosophila pathway gene as a drug target. The invention still further relates to pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a fragment or other derivative or analog of such fly pathway proteins (e.g., a protein encoded by a gene in a GPCR-pathway) which may be used, e.g., as a pesticide target.

[0317] In one embodiment, expressed sequence tags (ESTs), or contigs comprising EST sequence, may be used to construct a microarray. For example, any number of EST cDNAs of interest, or fragments thereof, may be attached to a solid support to construct a microarray.

[0318] In a preferred embodiment, a microarray is constructed using DNA fragments of from 10 to 300, of from 15 to 150, of from 20 to 75, or of from 25 to 50 nucleotides in length.

[0319] In a preferred embodiment of the invention, an initial step in identifying expression of a gene or gene family, or quantitating same, is by the construction of a DNA microarray from any number of novel ESTs of the invention (SEQ ID NOs:15,289-31,635) or from any number of the contigs of the invention (SEQ ID NOs:7-15,288). In another preferred embodiment, a microarray of the invention comprises a surface with an ordered array of binding (e.g., hybridization) sites for products ranging from 2 to 20,000, from 5 to 15,000, from 10 to 10,000, from 20 to 5,000, from 50 to 2,500, from 100 to 1,000, or from 200 to 500 of the genes in the genome of Drosophila. In yet another embodiment, the microarray comprises at least a portion of at least 17 contiguous nucleotides of one or more novel ESTs of the invention (i.e., SEQ ID NOs:15,289-31,635). In another embodiment, a microarray is an array of less than 6.25 cm²in size. Microarrays may be employed, e.g., for analyzing the transcriptional status of a cell, i.e., as a measure of the genes in a genome that are and are not expressed, and if expressed, to what extent.

[0320] Microarrays can be made in a number of ways well known in the art, of which several are described below. However produced, microarrays share certain characteristics. The arrays are reproducible, allowing multiple copies of a given array to be produced and compared with one another. Preferably, the microarrays are small, usually smaller than 5 cm²and they are made from materials that are stable under binding (e.g., nucleic acid hybridization) conditions. Preferably, a given binding site or unique set of binding sites in the microarray will specifically bind (e.g., hybridize) to the product of a single gene in a cell (e.g., to a specific mRNA, or to a specific cDNA derived therefrom). However, in general, other related or similar sequences will cross hybridize to a given binding site. Although there may be more than one physical binding site per specific RNA or DNA, for the sake of clarity, the discussion below will assume that there is a single, completely complementary binding site.

[0321] The microarrays of the present invention include one or more test binding sites, each of which has a polynucleotide sequence that is complementary to a subsequence of RNA or DNA to be detected. Each binding site preferably has a different nucleic acid sequence. The position of each binding site on the solid surface is preferably known. In one embodiment, the microarray is a high density array, preferably having a density greater than about 60 different binding sites per cm². In another embodiment, the microarray is an array (i.e., a matrix) in which each position represents a discrete binding site for a product encoded by a gene (i.e., an mRNA or a cDNA derived therefrom), and in which binding sites are present for products of most or almost all of the genes in the organism's genome. For example, the binding site can be a DNA or DNA analogue to which a particular RNA can specifically hybridize. The DNA or DNA analogue can be, e.g., a synthetic oligomer, a full-length cDNA, a less-than-full-length cDNA, or a gene fragment. In a specific embodiment, a DNA microarray, or chip, is a microscopic array of DNA fragments or synthetic oligonucleotides, disposed in a defined pattern on a solid support, wherein they are amenable to analysis by standard hybridization methods (Schena, BioEssays18, 427, 1996, which is incorporated herein by reference in its entirety).

[0322] In another specific embodiment, the DNA in a microarray is derived from genomic or cDNA libraries, from fully-sequenced clones, or from partially or fully sequenced cDNAs known as expressed sequence tags (ESTs). In a preferred embodiment, the DNA in a microarray is derived from one or more novel fly ESTs of the invention (SEQ ID NOs:15,289-31,365) or contigs comprising novel EST sequence (SEQ ID NOs:7-15,288). Methods for obtaining such DNA molecules are generally known in the art (see e.g., Ausbel et al., eds., 1994, Current Protocols in Molecular Biology, New York). In another embodiment, oligonucleotides may be synthesized by conventional methods, such as phosphoramidite-based synthesis. Oligonucleotides for microarrays may range in length from 10 to 300 bases, but are preferably from about 20 to about 50 bases in length, and most preferably about 25 bases in length (i.e. 25 mers). In a further embodiment, where the particular base in a given sequence is unknown or is polymorphic, a universal base, such as inosine or 5-nitroindole, may be substituted. Additionally, it is possible to vary the charge on the phosphate backbone of the oligonucleotide, for example, by thiolation or methylation, or even to use a peptide rather than a phosphate backbone (i.e., as for peptide nucleic acid or PNA).

[0323] Although in a preferred embodiment the microarray contains binding sites for products of almost all genes in the fly genome, such comprehensiveness is not necessarily required. A microarray may have binding sites corresponding to at least about 1% or less of the genes in the genome (e.g., as for a chip for detection of a family of related genes). Further, where most of the genome is to be represented on a chip, a microarray may have binding sites corresponding to about 50%, about 75%, about 90%, or about 99% of the genes in the genome. Preferably, the microarray has binding sites for genes relevant to the action of a drug of interest or for a collection of genes that participate in a biological pathway of interest. The number of genes in a genome can be estimated from the number of mRNAs expressed by the organism, or by extrapolation from a well characterized portion of the genome.

[0324] As noted above, the “binding site” to which a particular polynucleotide molecule specifically hybridizes according to the invention is usually a complementary polynucleotide sequence. In one embodiment, the binding sites of the microarray are DNA or DNA “mimics” (e.g., derivatives and analogues such as PNA) corresponding to at least a portion of two or more genes in an organism's genome. In another embodiment, the binding sites of the microarray are complementary RNA or RNA mimics.

[0325] DNA mimics are polymers composed of subunits capable of specific, Watson-Crick-like hybridization with DNA, or of specific hybridization with RNA. The nucleic acids can be modified at the base moiety, at the sugar moiety, or at the phosphate backbone. Exemplary DNA mimics include, e.g., phosphorothioates and PNA.

[0326] DNA can be obtain, e.g., by PCR amplification of gene segments from genomic DNA, cDNA, or other cloned sequences. PCR primers are preferably chosen based on known sequences of the genes or cDNA that result in amplification of unique fragments (e.g, fragments that do not share more than 10 bases of contiguous identical sequence with any other fragment on the microarray). Computer programs that are well known in the art are useful in the design of primer with the required specificity and optimal amplification properties, such as Oligo version 5.0 (National Biosciences). PCR methods are well known in the art, and are described, for example, in Innis et al., eds., 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., San Diego. It will be apparent to one skilled in the art that controlled robotic systems are useful for isolating and amplifying nucleic acids.

[0327] Another means for generating the polynucleotide binding sites of the microarray is by synthesis of synthetic polynucleotides or oligonucleotides, e.g., using N-phosphonate or phosphoramidite chemistries (Froehler et al., 1986, Nucl. Acid Res.14, 5399-5407; McBrid et al., 1983, Tetrahedron Lett.,246-248). Synthetic sequences are typically between about 15 and about 500 bases in length, more typically between about 20 and about 60 bases. In another embodiment, synthetic nucleic acids may include non-natural bases, such as inosine. Another example of a suitable nucleic acid analogue is peptide nucleic acid (see e.g., Eghohn et al., 1993, Nature363:566-568; U.S. Pat. No. 5,539,083).

[0328] In alternative embodiments, the hybridization sites (i.e., the binding sites) are made from plasmid or phage clones of genes, cDNAs (e.g., expressed sequence tags), or inserts or fragments derived therefrom (Nguyen et al., 1995, Genomics29:207-209).

[0329] Solid supports on which binding sites of microarrays may be immobilized are well-known in the art and include filter materials, such as nitrocellulose, cellulose acetate, nylon, and polyester, among others, as well as non-porous materials, such as glass, plastic (e.g., polypropylene), polyacrylamide, and silicon. In general, non-porous supports, and glass in particular, are preferred. The solid support may also be treated in such a way as to enhance binding of oligonucleotides thereto, or to reduce non-specific binding of unwanted substances thereto. For example, it is often desirable to treat a glass support with polylysine or silane to facilitate attachment of binding sites such as oligonucleotides to the glass. A preferred method for attaching binding sites such as nucleic acids to a surface is by printing on glass plates, as is described generally by Schena et al., 1995, Science270:467-470. This method is especially useful for preparing microarrays of cDNA (See also, DeRisi et al., 1996, Nature Genetics14:457-460; Shalon et al., 1996, Genome Res.6:689-645; and Schena et al., 1995, Proc. Natl. Acad. Sci. U.S.A.93:10539-11286).

[0330] Methods of immobilizing binding sites on the solid support may include direct touch, micropipetting (Yershov et al., 1996, Genetics93: 4913), or the use of controlled electric fields to direct a given oligonucleotide to a specific spot in the array (U.S. Pat. No. 5,605,662 issued to Heller et al.). In a specific embodiment, DNA is typically immobilized at a density of from 100 to 10,000 oligonucleotides per cm²and preferably at a density of about 1000 oligonucleotides per cm².

[0331] In a preferred embodiment, binding sites (e.g., oligonucleotides) are synthesized directly on said support (Maskos et al., 1993, Nucl. Acids Res. 21, 2267; Fodor et al., 1991, Science281, 767; Blanchard et al., 1996, Biosens. Bioelectron. 11, 687). Among methods of synthesizing oligonucleotides directly on a solid support, particularly preferred method are photolithography (see e.g., Fodor, supra., and McGall et al.,1996, Proc. Natl. Acad. Sci. U.S.A.93: 13,555) and most preferred, piezoelectric printing (see e.g., Blanchard, supra).

[0332] A second preferred method for making microarrays is by making high-density oligonucleotide arrays. Techniques are known for producing arrays containing thousands of oligonucleotides complementary to defined sequences, at defined locations on a surface using photolithographic techniques for synthesis in situ (see, Fodor et al., 1991, Science251:767-773; Pease et al., 1994, Proc. Natl. Acad. Sci. U.S.A.91:5022-5026; Lockhart et al., 1996, Nature Biotechnology14:1675; U.S. Pat. Nos. 5,578,832, 5,556,752 and 5,510,270) or other methods for rapid synthesis and deposition of defined oligonucleotides (Blanchard et al., Biosensors& Bioelectronics11:687-690). When these methods are used, oligonucleotides (e.g., 20-mers) of known sequence are synthesized directly on a surface such as a derivatized glass slides. Usually, the array produced is redundant, with several oligonucleotide molecules per RNA.

[0333] Other methods for making microarrays, e.g., by masking (Maskos and Southern, 1992, Nuc. Acids. Res.20:1679-1684), may also be used. In principle, any type of array, for example, dot blots on a nylon hybridization membrane (see Sambrook et al., supra) could be used. However, as will be recognized by those skilled in the art, very small arrays will frequently be preferred because, e.g., hybridization volumes will be smaller. 5.17.4. Hybridizing Target Polynucleotides to a Microarray

[0334] As described, supra, the polynucleotide molecules which may be analyzed by the present invention may be from any source, including naturally-occurring nucleic acid molecules, as well as synthetic nucleic acid molecules. In a preferred embodiment, the polynucleotide molecules analyzed by the invention comprise RNA, including, but not limited to, total cellular RNA, poly A⁺ RNA, fractions thereof, or RNA transcribed from cDNA. In a specific embodiment, cellular RNA or DNAs from two cell populations (e.g., RNA of Drosophila untreated or treated with a specific drug) are analyzed by incubating both populations of RNAs with the microarray. In a specific embodiment, Drosophila are treated with an agent known or suspected to alter a pathway of interest. In yet another specific embodiment, Drosophila containing a deletion mutation is used to identify gene function. Methods for preparing total and poly A⁺ RNA are well known in the art, and are described generally, e.g., in Sambrook et al., supra. In one embodiment, RNA is extracted from cells of the various types of interest in this invention using guanidinium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al., 1979, Biochemistry18:5294-5299). Poly A⁺ RNA is selected by selection with oligo-dT cellulose. Cells of interest include, but are by no means limited to, wild-type cells, drug-exposed wild-type cells, modified cells, diseased cells, and, in a particular embodiment, cancer cells.

[0335] In one embodiment, RNA can be fragmented by methods known in the art, e.g., by incubation with ZnCl₂, to generate fragments of RNA prior to analysis using a microarray. In another embodiment, isolated mRNA can be converted to antisense RNA synthesized by in vitro transcription of double-stranded cDNA in the presence of labeled dNTPs (Lockhart et al., 1996, Nature Biotechnology14:1675).

[0336] Nucleic acid hybridization and wash conditions are chosen for microarrays so that the polynucleotide molecules to be analyzed “specifically bind” or “specifically hybridize” to the complementary polynucleotide sequences of the array, preferably to a specific array site, wherein its complementary DNA is located.

[0337] Arrays containing double-stranded DNA situated thereon are preferably subjected to denaturing conditions to render the DNA single-stranded prior to contacting with the target polynucleotide molecules. Arrays containing single-stranded binding site DNA (e.g., synthetic oligodeoxyribonucleic acids) may need to be denatured prior to contacting with the target polynucleotide molecules, e.g., to remove hairpins or dimers which form due to self complementary sequences.

[0338] Optimal hybridization conditions will depend on the length (e.g., oligomer versus polynucleotide greater than 200 bases) and type (e.g., RNA or DNA) of binding site and target nucleic acids. General parameters for specific (i.e., stringent) hybridization conditions are described in Sambrook et al. (supra), and in Ausubel et al., 1987, Current Protocols in Molecular Biology,Greene Publishing and Wiley-Interscience, New York. When the CDNA microarrays of Schena et al. are used, typical hybridization conditions are hybridization in 5×SSC plus 0.2% SDS at 65° C. for four hours, followed by washes at 25° C. in high stringency wash buffer (0.1×SSC plus 0.2% SDS) (Shena et al., 1996, Proc. Natl. Acad. Sci. U.S.A.93:10614). Useful hybridization conditions are also provided, e.g., in Tijessen, 1993, Hybridization With Nucleic Acid Probes,Elsevier Science Publishers B.V.; and in Kricka, 1992, Nonisotopic DNA Probe Techniques,Academic Press, San Diego.

[0339] In a another specific embodiment, use of a nucleic acid which is hybridizable to a fly GPCR nucleic acid (e.g., having a sequence or subsequence of at least 17 nucleotides as set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:741, or to its reverse complement) under conditions of low, moderate, or high stringency is provided. By way of example and not limitation, procedures using conditions of low stringency are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci. U.S.A. 78, 6789-6792). Arrays containing DNA are pretreated for 6 h at 40° C. in a solution containing 35% formamide, 5×SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20×10⁶cpm ³²P-labeled probe is used. Arrays are incubated in hybridization mixture for 18-20 h at 40° C., and then washed for 1.5 h at 55° C. in a solution containing 2×SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60° C. Arrays are blotted dry and visualized. If necessary, arrays are washed for a third time at 65-68° C. and re-visualized. Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).

[0340] In another specific embodiment, use of a nucleic acid which is hybridizable to a GPCR nucleic acid, or its reverse complement, under conditions of high stringency is provided. By way of example and not limitation, procedures using such conditions of high stringency are as follows. Prehybridization of arrays containing DNA is carried out for 8 h to overnight at 65° C. in buffer composed of 6×SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Arrays are hybridized for 48 h at 65° C. in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20×10⁶cpm of ³²P-labeled probe. Washing of arrays is done at 37° C. for 1 h in a solution containing 2×SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1×SSC at 50° C. for 45 min before autoradiography. Other conditions of high stringency which may be used are well known in the art.

[0341] In another embodiment, after hybridization, stringency conditions are as follows. Each array is washed two times each for 30 minutes each at 45° C. in 40 mM sodium phosphate, pH 7,2, 5% SDS, 1 mM EDTA, 0.5% bovine serum albumin, followed by four washes each for 30 minutes in sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA, and subsequently each array is treated differently as described below for low, medium, or high stringency hybridization conditions. For low stringency hybridization, arrays are not washed further. For medium stringency hybridization, membranes are additionally subjected to four washes each for 30 minutes in 40 mM sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 55° C. For high stringency hybridization, following the washes for low stringency, membranes are additionally subjected to four washes each for 30 minutes in 40 mM sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 55° C., followed by four washes each for 30 minutes in sodium phosphate, pH 7.2, 1% SDS, 1 mM EDTA at 65° C.

[0342] Use of nucleic acids encoding derivatives and analogs of proteins in a signal transduction pathway of interest (e.g., a GPCR pathway) are additionally provided.

[0343] It will be appreciated that when cDNA complementary to the mRNA of a cell is made and hybridized to a microarray under suitable hybridization conditions, the level of hybridization to the site in the array corresponding to any particular gene will reflect the prevalence in the cell of mRNA transcribed from that gene. For example, when detectably labeled (e.g., with a fluorophore) cDNA complementary to the total cellular mRNA is hybridized to a microarray, the site on the array corresponding to a gene (i.e., capable of specifically binding the product of the gene) that is not transcribed in the cell will have little or no signal (e.g., fluorescent signal), and a gene for which the encoded mRNA is prevalent will have a relatively strong signal.

[0344] In preferred embodiments, cDNAs from two different cells or organisms (e.g. untreated and drug treated flies or fly parts) are hybridized to the binding sites of the microarray. In the case of drug responses, one cell is exposed to a drug and another cell of the same type is not exposed to the drug. The cDNA derived from each of the two cell types are differently labeled so that they can be distinguished. In one embodiment, for example, cDNA from a cell treated with a drug is synthesized using a fluorescein-labeled dNTP, and cDNA from a second cell, not drug-exposed, is synthesized using a rhodamine-labeled dNTP. When the two cDNAs are mixed and hybridized to the microarray, the relative intensity of signal from each cDNA set is determined for each site on the array, and any relative difference in abundance of a particular mRNA is thereby detected.

[0345] In the example described above, the cDNA from the drug-treated cell will fluoresce green when the fluorophore is stimulated, and the cDNA from the untreated cell will fluoresce red. As a result, when the drug treatment has no effect, either directly or indirectly, on the relative abundance of a particular mRNA in a cell, the mRNA will be equally prevalent in both cells, and, upon reverse transcription, red-labeled and green-labeled cDNA will be equally prevalent. When hybridized to the microarray, the binding site(s) for that species of RNA will emit wavelength characteristic of both fluorophores. In contrast, when the drug-exposed cell is treated with a drug that, directly or indirectly, increases the prevalence of the mRNA in the cell, the ratio of green to red fluorescence will increase. When the drug decreases the mRNA prevalence, the ratio will decrease.

[0346] The use of a two-color fluorescence labeling and detection scheme to define alterations in gene expression has been described (see e.g., Shena et al., 1995, Science270, 467-470).

[0347] When fluorescently labeled probes are used, the fluorescence emissions at each site of a transcript array can be, preferably, detected by scanning confocal laser microscopy (see e.g., Fodor et al., 1993, Nature 364:555). In a specific embodiment, where the sample to be hybridized is a cDNA, labeling is accomplished by incorporating fluoresecently-labeled deoxynucleotide triphosphates (dNTPs), during in vitro reverse transcription. Fluorescently-labeled dNTPs are commercially available from sources such as Amersham and Perkin Elmer Cetus. Alternatively, cDNAs are labeled indirectly by incorporating biotinylated nucleotides during cDNA synthesis, followed by the addition of fluorescently-labeled avidin or streptavidin. Biotinylated dNTPS are available from Enzo (Farmingdale, N.Y.) and Boehringer Mannheim (Indianapolis, Ind.), while fluorescently labeled avidin and streptavidin are available from Becton Dickinson (Mountain View, Calif.) and Molecular Probes (Eugene, Oreg.). Methods of reverse transcription and labeling are well-known in the art and are described for example, in Ausbel et al., eds., 1994, Current Protocols in Molecular Biology, New York; DeRisi, 1997, Science 278:680; and Schena et al.,1996, Proc. Natl. Acad Sci. U.S.A. 93:10614.

[0348] Alternatively, a laser can be used that allows simultaneous specimen illumination at wavelengths specific to the two fluorophores and emissions from the two fluorophores can be analyzed simultaneously (see Shalon et al., 1996, Genome Res. 6:639-645).

[0349] In one embodiment, where the sample to be hybridized is mRNA, labeling is accomplished by incorporating fluoresecently-labeled ribonucleotides or biotinylated ribonucleotides during in vitro transcription, as described in Lockhart, D. J. et al., 1996, Nature Biotech. 14:1675.

[0350] Although it is preferred to use fluorescent labels, other labels may also be employed, such as radioisotopes, enzymes, and luminescent substances. Such methods are well-known in the art; (see e.g., Zhao et al.,1997, Gene 156:207).

[0351] To probe a DNA microarray, the labeled samples are first hybridized to the microarray such as under hybridization conditions as set forth above. After washing to remove unbound sample, the microarray is excited with specific wavelengths of light and scanned to detect fluorescence. Typically, two samples, each labeled with a different fluor, are hybridized simultaneously to permit differential expression measurements. When neither sample hybridizes to a given spot in the array, no fluorescence is detected. When only one sample hybridizes to a given spot, the color of the resulting fluorescence will correspond to that of the fluor used to label the hybridizing sample (e.g., green when the sample was labeled with fluorescein, or red when the sample was labeled with rhodamine). When both samples hybridize to the same spot, a combined color signal is produced (e.g., yellow if the samples were labeled with fluorescein and rhodamine). Then, by applying routine computer methods of pattern recognition and data analysis, it is possible to quantify differences in gene expression between the samples.

[0352] Signals are recorded and, in a preferred embodiment, analyzed by computer.

[0353] Any method known in the art may be used to search the database of the invention containing at least a portion of the sequences of the SEQ ID NOs set forth in Table 1 and Table 2. However, database searches of the invention are preferably executed on an automated system (e.g., a computer system). Accordingly, this invention provides a computer system comprising: (a) a computer-readable medium having computer-readable program code embodied thereon (e.g., all of or a portion of the FlyTag™ contig database, SEQ ID NOs:7-15,288, either alone or together with the sequences of the other SEQ ID NOs of the invention, on permanent or removable storage media such as a CD-ROM or floppy disk) useful for effecting one or more database searches or methods of the invention; and (b) a computer and associated software capable of searching the database.

[0354] For example, when searching the Drosophila sequence database of the invention (i.e. FlyTag™) for nucleotide or predicted protein sequences related to a known query sequence (e.g., a vertebrate dopamine receptor), one typically uses a computer program, such as the BLAST suite of programs, to carry out the query. This section describes exemplary computer systems, as well as methods and programs for operating such computer systems, which may be used to perform methods of the invention.

[0355] In certain embodiments, a search algorithm used to search the database of the invention may be programmed using mathematical software packages which allow symbolic entry of equations and high-level specification of processing, including the specific algorithms to be used. Such software packages are preferred since they free a user of the need to procedurally program individual equations or algorithms. Exemplary mathematical software packages which may be used include Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram Research (Champaign, Ill.), or S-Plus from Math Soft (Cambridge, Mass.). Alternative computer systems and software for implementing analytical search methods of the database of the invention will be readily apparent to one of skill in the art.

[0356] The following examples are provided merely as illustrative of various aspects of the invention and shall not be construed to limit the invention in any way.

[0357] Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated.

[0358] Preparation of cDNA Library

[0359] Tissue from mixed-stage embryos (0-20 hour), imaginal disks, and adult fly heads were collected and total RNA was prepared. Mitochondrial rRNA was removed from the total RNA by hybridization with biotinylated rRNA-specific oligonucleotides, and the resulting RNA was selected for polyadenylated mRNA. The resulting material was then used to construct a random-primed library. First strand cDNA synthesis was primed using a six nucleotide random primer. The first strand cDNA was then tailed with terminal transferase to add approximately 15 dGTP molecules. The second strand was synthesized using a primer which contained a NotI site followed by a 13 nucleotide C tail to hybridize to the G-tailed first strand cDNA. The double stranded cDNA was ligated with BstXI adaptors and digested with NotI. The cDNA was then sized on an agarose gel and the cDNA greater than 700 bp was purified. The cDNA was then ligated with NotI, BstXI-digested pCDNA-sk⁺ vector (a derivative of pBluescript) and transformed into bacterial cells (XL1blue). The final complexity of the library was 6×10⁶independent clones.

[0360] The cDNA library was normalized using a modification of the method described by Bonaldo and others (Bonaldo et al., 1996, Genome Research 6:791-806). Biotinylated driver was prepared from the cDNA by PCR amplification of the inserts and allowed to hybridize with single stranded plasmids of the same library. The resulting double stranded forms were removed using streptavidin magnetic beads, and the remaining single stranded plasmids were converted to double stranded molecules using Sequenase (United States Biochemical); the plasmid DNA was stored at −20° C. prior to transformation. Aliquots of the normalized plasmid library were transformed into bacteria (XL1blue or DH10B) and plated at moderate density. The colonies were picked and transferred using a Qbot robot into 384-well master plates containing bacterial growth media. The clones were allowed to grow for 24 hours at 37° C., then the master plates were frozen at −80° C. for storage. The total number of colonies picked for sequencing from the normalized library was 230,000. The master plates were used to inoculate media for growth and preparation of DNA for use as template in sequencing reactions. The sequencing reactions were primarily carried out with a primer that initiated at the 5′ end of the cDNA inserts. However, a minor percentage of the clones were also sequenced from the 3′ end. Clones were selected for 3′ end sequencing based on either further biological interest or the selection of clones that could extend assemblies of contigs (see below). Sequencing reactions were carried out on ABI377s (Applied Biosystems) and used either ABI FS, dirhodamine or BigDye chemistires.

[0361] Analysis of sequences were done as follows: the traces generated by the automated sequencers were base-called using the program Phred (Gordon, 1998, Genome Res. 8:195-202), which also assigned quality values to each base. The resulting sequences were trimmed for quality bases using the quality scores; vector sequences were also removed. Each sequence was compared to all other known fly expressed sequence tag (EST) sequences using the specific BLAST program and parameters described in the explanation of Tables provided in section 6 below, and a filter to identify regions of near 100% identity. Sequences with potential overlap were then assembled into contigs using the program Phrap. The resulting assemblies were then compared to existing public databases, and similarity to known proteins was then used to direct translation of the consensus sequence. Where no BLAST similarity was available, the statistically most likely translation based on codon and hexanucleotide preference was used. The Pfam and Prosite collections of protein domains were used to identify motifs in the resulting translations.

[0362] In one embodiment, a mentioned above, the invention relates to novel GPCR nucleotide and deduced protein sequences. The novel sequences were initially identified by computer comparison of ESTs from cDNA libraries of Drosophila with known sequence databases. The sequences were then analyzed for a variety of uses, including as protein targets for the screening of novel pesticide drugs. For several of the GPCR ESTs identified herein, the complete cDNA sequence was also determined and confirmed by the predicted cDNA sequence of a genomic-derived gene sequence. Four unique Drosophila full-length gene sequences which were determined represent four GPCRs within three structural subclasses, i.e. metabotropic γ-aminobutyric acid subtype B receptors (GABA_B), a melatonin-like receptor, and an orphan receptor having greatest similarity to dopamine/adrenergic/octopamine receptors of the class A biogenic amine GPCR subgroup.

[0363] Accordingly, in one embodiment, the present invention relates to a product, a composition, or a method of use comprising a Drosophila GPCR cDNA and/or the protein encoded thereby which is highly related to vertebrate GABA_BGPCRs. In this regard, it has recently been demonstrated by several groups that functional GABA_Breceptors exist as heterodimers of similar but distinct gene products. This is consistent with the finding here of at least three independent GABA_Breceptors in Drosophila. Thus, the active unit for successful drug screening for pesticide drugs or therapeutics for human disease may contain combinations of at least two of the GABA_Breceptor subunits of the invention.

[0364] In an attempt to discover members of the catecholamine/β-adrenergic receptor family in invertebrates, a sequence related to vertebrate β-adrenergic receptors has been identified from the Drosophila EST library of the invention, and the complete cDNA has been isolated. Although sequence analysis of the predicted protein suggests that it is not a clear member of either the dopamine receptor or adrenergic receptor subfamilies, it is nevertheless found to be most related to these two GPCR subgroups.

[0365] A summary of information follows which relates to GPCR-1, GPCR-2 and GPCR-3 predicted ligand-binding domains, signal sequence locations, and transmembrane domain locations.

[0366] GPCR-1 (Predicted DOPAD2 or Melatonin Receptor)

[0367] The ligand-binding domain for members of this family of receptors is part of the solvent-accessible surface of transmembrane (TM) domains 3, 5 and 7. The transmembrane domains of GPCR-1 are located at approximately amino acid residues 35-51, 74-90, 122-138, 153-169, 202-218, 315-331 and 350-366 (see SEQ ID NO:6 and FIG. 3).

[0368] GPCR-2 (Predicted GABA_BR-1)

[0369] The ligand-binding domain of this class of GPCRs resides in the N-terminal region of the protein, minus the signal peptide. The signal peptide is located at approximately amino acid residues 1-23 of SEQ ID NO:4. The transmembrane domains are located at approximately amino acid residues 278-294, 452-468, 488-504, 563-579, 621-637, 664-680 and 685-701 (see SEQ ID NO:4 and FIG. 2).

[0370] GPCR-3

[0371] The ligand-binding domain for this receptor is predicted to reside in parts of TM3, TM5 and TM7. The transmembrane domains are located at approximately amino acid residues 151-167, 180-196, 224-240, 261-277, 312-328, 1049-1065 and 1076-1092 (see SEQ ID NO:2 and FIG. 1).

[0372] A re-sequenced EST clone, CK01.91B.D9, was used as primary starting material for isolation of the complete cDNA sequence for GPCR-3 and for the isolation of a P1 genomic clone encoding the GPCR-3 gene. The genomic clone was analyzed to determine the intron/exon structure of the GPCR-3 gene.

[0373] Isolation of a P1 Clone

[0374] The insert from clone CK01.91B.D9 was radioactively labeled and used as a probe to screen a Drosophila P1 library filter (Genome Systems, Inc.). The following clones showed positive hybridization signals: DS02125, DS04390, DS03124, DS04877, DS00309, DS06179, DS00214, DS06380, and DS03327.

[0375] Four of these clones, i.e. DS02125, DS04390, DS00214, and DS06179, mapped to a region of contig GstD1 spanning cytogenetic bands 87C2 to 87D13, and were chosen for further characterization. Each clone was streaked onto LB/Kanamycin plates and grown overnight at 37° C. The presence of EST sequences in single isolates from the streaks was confirmed by PCR using the following EST-specific primer pairs: ADR-FWD2/ADR-REV2; ADR-FWD3/ADR-REV; and ADR-FWD3/ADR-REV2. DS04390 mapped to the largest genomic region and was chosen for genomic sequencing.

[0376] Rapid Amplification of cDNA Ends (RACE)

[0377] The following components were used to carry out RACE for isolation of full-length GPCR-3. Poly A⁺ mRNA from Canton S strain Drosophila embryos (Clontech, lot#7070254) was used as a template and turned into RACE-ready cDNA using Clontech's Marathon cDNA amplification kit (cat#K1802-1), according to manufacturer's instructions. The resultant cDNA was diluted 1:100 and used as template for RACE reactions.

[0378] 3′ and 5′ RACE reactions were performed by PCR, using manufacturer's suggestions under the following conditions. Primers were used at a final concentration of 0.2 μM.

[0379] Primary 3′ RACE:

[0380] Reaction A: Template: RACE-ready cDNA; Primers: ADR-REV2/AP1.

[0381] Reaction B: Template: RACE-ready cDNA; Primers: ADR-REV/AP1.

[0382] Nested 3′ RACE:

[0383] Reaction C: Template: Reaction A product; Primers: ADRR-REV/AP2.

[0384] Reaction D: Template: Reaction B product; Primers: ADR3′4/AP2.

[0385] All products were resolved on 1.5% agarose gels in kilobase (kb). Bands of approximately 1.4 kb and 1.8 kb were excised from reaction C; bands of approximately 0.9 kb, 1.2 kb, and 1.9 kb were excised form reaction D.

[0386] Primary 5′ RACE:

[0387] Template: RACE-ready cDNA; Primers: ADRR-FWD2/AP1.

[0388] Nested 5′ RACE:

[0389] Template: Primary 5′ RACE product; Primers: ADR-REV/AP2.

[0390] Nested 5′ RACE product was run on a 1.5% gel and the approximately 1.2 kb and 1.4 kb bands excised. All excised bands from 3′ and 5′ RACE reactions were gel-purified (Geneclean II kit, BIO 101) and cloned (PCR II-TOPO kit, Invitrogen), each according to manufacturer's instructions. Colonies were tested by PCR for presence of EST CK01.9B.D9 sequences. DNA was extracted from clones with positive PCR results (Zhou, 1990, Biotechniques 8, 172-173), digested to confirm presence of inserts, and sequenced. Sequences obtained were compared with the genomic sequence from P1 clone DS04390 and EST clone CK01.91B.D9 (Sequencher, Gene Codes Corporation). Primers were then designed using the RACE products to produce full-length CDNA clones by PCR. PCR reactions were carried out according to manufacturer's protocols (Boehringer Mannheim) using the following components.

[0391] Reaction A: Template: RACE-ready cDNA; Primers: cDNA.O.F./cDNA.I.R.

[0392] Reaction B: Template: RACE-ready cDNA; Primers: cDNA.I.F./cDNA.I.R.

[0393] Reactions were run on a gel and bands of 1.6 kb and 3.5 kb were excised from each reaction, gel-purified, and cloned (PCR II-TOPO kit, Invitrogen). DNA from positive clones was next run on gels, and clones of appropriate size (5.5 and 7.4 kb) were sequenced using several primers as follows: M13 Forward, M13 Reverse, 1350F, 1350R, 2050F, 2050R, 2500F, 2500R, 27REV, 28FWD, 1500R, 400F, 400R, ADR3′4, ADRR-REV, ADRR-FWD2, ADR5′2. All sequencing reactions were analyzed to assemble the contiguous, full-length nucleotide sequence of GPCR-3, the translation of which represents a functional 7-transmembrane domain protein.

[0394] The cloning of GPCR-3 (cDNA SEQ ID NO:1) just described was carried out using the following PCR primer sequences.

[0395] adr3′3 GATCTGAATGCCACATCCGCCCG  (SEQ ID NO:62,486)

[0396] adr5′1 AGCCCAGAAAGATGGGCGTGAAGG  (SEQ ID NO:62,487)

[0397] adr5′2 TGGTCCGGATGCAGGGAAATCTCC  (SEQ ID NO:62,488)

[0398] adrR-Rev TTTCCCTGCATCCGGACCAGTGC  (SEQ ID NO:62,489)

[0399] adr3′4 GAGCTATCTGCATCCCAGTGACTG  (SEQ ID NO:62,490)

[0400] adrR-Fwd2 CAGTCACTGGGATGCAGATAGCTC  (SEQ ID NO:62,491)

[0401] adr-Rev2 TACACGACGGAGGAGCACCTG  (SEQ ID NO:62,492)

[0402] adr-Fwd3 GCCCATGTGGACGCTGTTAAGG  (SEQ ID NO:62,493)

[0403] 7B.Fwd TAATCCAAAGTTCTAGAATTCAGC  (SEQ ID NO:62,494)

[0404] 7C.Rev CAGCGTGTTCGAGGATATCGTGG  (SEQ ID NO:62,495)

[0405] 28.Fwd CTGAAGCGCCTGATAGAGGACAAC  (SEQ ID NO:62,496)

[0406] 27.Rev CGGCCTTGTGTTCGGCCTTCC  (SEQ ID NO:62,497)

[0407] 39.Fwd TGAAGCTAAGCAATACTCGATGTG  (SEQ ID NO:62,498)

[0408] 4D.Rev CATAACGTCAGCTACACAATTCTC  (SEQ ID NO:62,499)

[0409] 36.Rev CATTTGACAACATTTCACTTGAAG  (SEQ ID NO:62,500)

[0410] AdRcDNA.F GGAGCAACTTGAATGAGCTGCGAC  (SEQ ID NO:62,501)

[0411] AdR400F TAACCAGGCGGAGCTGGAGGAGAG  (SEQ ID NO:62,502)

[0412] AdR400R CTCTCCTCCAGCTCCGCCTGGTTA  (SEQ ID NO:62,503)

[0413] AdR1350F ATGTCCCGATGTGCTCGTGGTGG  (SEQ ID NO:62,504)

[0414] AdR1350R CCACCACGAGCACATCGGGACAT  (SEQ ID NO:62,505)

[0415] 5.1500R GTTGCGGGCCATTGGGATGAGAAT  (SEQ ID NO:62,506)

[0416] 5.2050F CAGCTACAACGGATGCGGTGGCGG  (SEQ ID NO:62,507)

[0417] 5.2050R CCGCCACCGCATCCGTTGTAGCTG  (SEQ ID NO:62,508)

[0418] 5.2500F CCGCCGGCCATTTCCGTGCCGAAC  (SEQ ID NO:62,509)

[0419] 5.2500R GTTCGGCACGGAAATGGCCGGCGG  (SEQ ID NO:62,510)

[0420] shrt.O.R GAACTTTGGATTAATGTGTATTTT  (SEQ ID NO:62,511)

[0421] shrt.I.R TTCATTTTGAACATCTTTGAAATG  (SEQ ID NO:62,512)

[0422] cDNA.I.R ACGAGGGTGGACGAAGCAGGAATG  (SEQ ID NO:62,513)

[0423] cDNA.O.F AGCATTGGCGGAGCAACTTGAATG  (SEQ ID NO:62,514)

[0424] cDNA.I.F ACTCAATTGGGCTGCGAAATCGAC  (SEQ ID NO:62,515)

[0425] M13 Forward GTTTTCCCAGTCACGA  (SEQ ID NO:62,516)

[0426] M13 Reverse CAGGAAACAGCTATGAC  (SEQ ID NO:62,517)

[0427] The RACE primers used were those included with the Clontech Marathon kit referred to as AP1 and AP2.

[0428] The cytogenetic location of the GPCR-3 gene, like the GPCR-4 gene, is 87D.

[0429] Cloning of GPCR-2 (cDNA SEQ ID NO:3)

[0430] Two completely sequenced ESTs (CK01.119B.H9 and CK01.59A.E6) from the cDNA library described in Section 6.1 and one partially sequenced Berkeley Drosophila Genome Project EST (BDGP EST HL01578) were found to form a sequence contig with highest predicted protein sequence similarity to rat GABA_BR1. The complete sequence of HL01578 was subsequently obtained by several rounds of “primer walking,” i.e. sequencing and analysis followed by design of new primers for additional sequencing reactions into undetermined regions. The clone HL01578 was shown to contain a poly A⁺ tail, indicating it was a full-length cDNA at the 3′ end. However, comparison of the predicted protein coding regions between rat and fly sequences suggested the fly contig was incomplete at the 5′ end. Consistent with this analysis, the fly open reading frame (ORF) was “open” at the 5′ end (i.e., it did not contain an initiating methionine).

[0431] To facilitate determination of the missing 5′ sequence, four drosophila P1 genomic DNA clones were identified by probing a filter of arrayed clones (Genome Systems) with a ³²P-labeled probe consisting of a 1.6 kb XhoI fragment of HL01578. The probe was prepared using a RediPrime kit (Amersham) according to the manufacturer's instructions. The filter was pre-hybridized at 65° C. overnight in 30 ml of hybridization buffer (5×SSPE, 5×Denhardt's solution, 0.5% SDS, and 0.1 mg/ml herring sperm DNA). The following day, thirty million cpm of probe was added and the hybridization continued overnight. On the third day, the filter was washed twice for 10 minutes each with wash solution (0.1×SSC and 0.1% SDS) at 65° C. and exposed to film overnight at −70° C. with an intensifying screen. Four positive clones were recovered from frozen stocks by decoding the arrayed filter according to the manufacturer's instructions. Four additional clones were picked from frozen stocks based on their inclusion in the same genomic contig on the Berkeley Drosophila Genome Project internet site.

[0432] Together, these eight clones were retested by PCR amplification using primers derived from the cDNA sequence obtained above. PCR conditions were as follows: 35 cycles of 95° C. for thirty seconds, 60° C. for thirty seconds, and 72° C. for 120 seconds in a reaction containing the bacterial clone in 1×reaction buffer (Boehringer Mannheim Biochemical, BMB), 200 μM dNTPs, 1 μM primers, and 1 U of Expand thermostable polymerase (BMB). The 5′ primer “GABA_B⁺240” ATTTTCCTGGGTCTCGATACC (nucleotides 1552-1572 of SEQ ID NO:3) and 3′ primer “GABA_B-710” AATATGCTTGGAATCGTTCAG (nucleotides 2005-2025 of SEQ ID NO:3) yielded a product of approximately 550 nucleotides (nt). Four clones tested positive by this assay, and one clone (DS01103) was sequenced.

[0433] Twenty (20) kb of genomic sequence around the GABA_BR1 gene from P1 clone DS01103 was obtained, as well as a BLAST analysis of this region, and a predicted GABA_BR1 gene sequence determined. The comparison of this sequence to the Drosophila EST database identified a previously unrecognized EST (exs|297454|) which overlapped the predicted 5′ UTR and initiating methionine.

[0434] To produce a full-length physical clone and a complete predicted peptide sequence, the putative GABA_BR1 ORF was PCR amplified in two separate pieces from a cDNA template. These two pieces were then joined together by PCR using primers in the 5′ and 3′ untranslated regions (UTRs) of the sequence. The resulting product (˜4 kb) was subcloned into pcDNA 3.1 (−) myc-his A (Invitrogen). The inserts were re-sequenced in their entirety to verify correct sequence and assembly, and a predicted full-length peptide sequence was inferred.

[0435] The cytogenetic location of the GPCR-2 gene is 93F.

[0436] Fly EST clone CK01.44B.E6 from the library described herein was chosen based on display of a high predicted amino acid sequence similarity to the human dopamine D2 receptor. Complete sequencing of this EST clone revealed an insert of approximately 576 nucleotides. Comparison of the predicted open reading frame (ORF) to vertebrate proteins suggested the EST clone was missing both 3′ and 5′ coding sequences.

[0437] Using the cDNA sequence of CK01.44B.E6, nested oligonucleotide primers were designed for both 3′ and 5′ RACE reactions and used to PCR amplify Drosophila cDNA prepared from embryo, larval, or adult RNA, or to amplify random-primed or oligo dT-primed embryonic cDNA libraries. For the 5′ RACE reactions, the primers were as follows:

[0438] “dopa-30” AGGCAAGGGATGACGAAGGCGGTG (the portion of SEQ ID NO:5 encoding residues 1352-1375 of SEQ ID NO:6);

[0439] “dopa-70” CCAGAAGATCTTGGCATAGCAGGC (the portion of SEQ ID NO:5 encoding residues 1384-1409 of SEQ ID NO:6);

[0440] “dopa-90” CAAGCGCTGCTCCGACTTGTGGAC (the portion of SEQ ID NO:5 encoding residues 1413-1436 of SEQ ID NO:6);

[0441] and

[0442] “dopa-470” AATACAAGCCGACAGGTAGAGCAG (the portion of SEQ ID NO:5 encoding residues 1788-1811 of SEQ ID NO:6).

[0443] The initial reaction products obtained for 5′ RACE were obtained only with “dopa-30” primers and were cloning artifacts. When subcloned and sequenced, these products were found to encode tropomyosin-related sequences. Conditions were varied to obtain products of ˜1500 nucleotides from all 4 primer combinations. Final reaction conditions were: 1×reaction buffer and 2 U “Advantage” thermostable polymerase (ClonTech), 200 μM dNTPs (Pharmacia), 50 ng of dT-primed LD embryonic cDNA library, and 0.2 μM primers. The PCR cycling conditions were 35 cycles of 94° C. for 30 seconds and 68° C. for 180 seconds. The products were excised from an agarose gel, pooled, ligated into pCRIII (Invitrogen), and sequenced by primer walking. The sequence of these products overlapped the existing contig exactly and were found to extend the ORF to include a putative initiating methionine preceded by stop codons in all 3 frames and about 700 nucleotides of 5′ untranslated region (UTR).

[0444] The initial reaction products for 3′ RACE appeared very promising: three different gene-specific primers yielded appropriately sized fragments (each about 300 nucleotides) with two different anchor primers. Reaction conditions were as above; PCR cycling conditions were 35 cycles of 94° C. for 15 seconds and 68° C. for 30 seconds. The primers used were:

[0445] “dopa+450” CTATATCCTGCTCTACCTGTCGGC (the portion of SEQ ID NO:5 encoding residues 1781-1804 of SEQ ID NO:6);

[0446] “dopa+510” AGTACCGCAAGGCCTACAAGACGG (the portion of SEQ ID NO:5 encoding residues 1843-1866 of SEQ ID NO:6);

[0447] and

[0448] “dopa+550” CTTCTGCTGCCCTTCGGGAAGACC (the portion of SEQ ID NO:5 encoding residues 1890-1913 of SEQ ID NO:6).

[0449] The product generated by amplification with “dopa+510” and the M13 reverse anchor primer was excised from an agarose gel, purified using QiaQuick (Qiagen), ligated into pCRII T/A vector (Invitrogen), and sequenced using forward and reverse primers. The sequence obtained contiged perfectly with existing data, extending the ORF 230 nucleotides to the 3′ without hitting a stop codon. Thus, three additional primers were designed for an additional round of 3′ RACE:

[0450] “dopa+680” GGAGCAGGGACGGCAACGGGAACG (the portion of SEQ ID NO:5 encoding residues 2017-2040 of SEQ ID NO:6);

[0451] “dopa+730” ACCCCACCGGAGGTCCAACAAGCC (the portion of SEQ ID NO:5 encoding residues 2062-2085 of SEQ ID NO:6);

[0452] and

[0453] “dopa+760” AGATGGTGTCGCGGGGACCGGACC (the portion of SEQ ID NO:5 encoding residues 2096-2119 of SEQ ID NO:6).

[0454] Using these primers with the reaction conditions above and 35 cycles of 94° C. for 30 seconds and 70° C. for 120 seconds, reaction products of ˜1.6 kb were obtained. The product obtained using “dopa+680” and an M13 anchor primer was excised from an agarose gel, ligated into pCR2.1 (Invitrogen), and sequenced through several rounds of primer walking. This sequence was found to extend the ORF further to the 3′ to include a stop codon, 3′ untranslated sequences, and a poly A⁺ tail, thus indicating the clone was complete at the 3′ end. BLAST analysis of the completed predicted protein sequence indicated that the clone is most closely related to the human melatonin R1α protein.

[0455] Cloning of GPCR-4 (cDNA, SEQ ID NO:741; Predicted Protein SEQ ID NO:32,370)

[0456] The GPCR-4 sequence was assembled from a computational gene prediction performed on a P1 clone of genomic DNA originally isolated and sequenced for determining the structure of GPCR-3. GPCR-4 was predicted by BLAST similarity to other GPCRs of the invention. The genomic sequence is not presented herein.

[0457] The cytogenetic location of the GPCR-4 gene, like the GPCR-3 gene, is 87D.

[0458] In a similar manner, the fly EST database of the invention has been analyzed to discover several other full-length genes that are either strong candidates for use as pesticide targets or are of interest for other reasons. Some of these full-length genes are briefly described below.

[0459] The complete CDNA nucleotide sequence of chitin synthase 2 is set forth in SEQ ID NO:10,540, and the complete amino sequence is set forth in SEQ ID NO:42,135. This gene represents a strong pesticide target gene candidate due to the importance of chitin in the construction of the exoskeleton of insect pests. The catalytic domain of chitin synthase 2 is from amino residues 440 to 935 of SEQ ID NO:42,135. In one embodiment, this invention provides one or more fragments (or derivatives or analogs thereof) of a fly chitin synthase 2 protein greater than or equal to 55 contiguous amino acids of SEQ ID NO:42,135.

[0460] The complete cDNA nucleotide sequence of an alpha subunit of a fly nicotinic acetylcholine receptor (nAChR) is set forth in SEQ ID NO:13,473, and the complete amino sequence is set forth in SEQ ID NO:45,044. This gene represents a strong pesticide target gene candidate due to the importance of the nAChR in nervous system function of insect pests.

[0461] The complete cDNA nucleotide sequence of a fly sphingomyelinase (SMase) is set forth in SEQ ID NO:10,989, and the complete amino sequence is set forth in SEQ ID NO:42,580. This gene is of general interest due to the ubiquitous importance of lipid second messengers such as ceramide, and may also represent a pesticide target gene candidate. Methods for investigation of lipid second messengers have recently been reviewed (see Rubin and Laychock, eds., 1998, Lipid Second Messengers, In: Methods In Life Sciences: Methods In Signal Transduction Series, Eichberg, series ed., CRC Press, Boca Raton, pp. 1-176; see also, www.crcpress.com) and many volumes are available describing the SMase signal transduction pathway (see e.g., Bell, Hannun and Merrill, eds., 1993, Sphingolipids, Part A: Functions and breakdown products, Advances in Lipid Research 25, Academic Press, Inc., San Diego, pp. 1-327).

[0462] The complete cDNA nucleotide sequence of a fly homolog of the mouse Tubby gene has been identified and is set forth in SEQ ID NO:13,498, and the complete amino sequence is set forth in SEQ ID NO:45,069. This gene is of interest for understanding the regulation of metabolism and weight gain.

[0463] GABA_BReceptor Agonist SKF97541 Has Dramatic Effects on Drosophila

[0464] A number of GABA_Breceptor agonists known to act on vertebrate receptors (e.g., baclofen) were tested for activity in Drosophila and gave negative results, suggesting that the insect receptors of the invention display novel pharmacology compared to vertebrate receptors. Indeed, one agonist of little importance in vertebrates, SKF97541, i.e. (3-aminopropyl)methylphosphinic acid, had dramatic effects in flies, as described below.

[0465] For adult fly assays, a 20 mg ml⁻¹stock solution of SKF97541 (Tocris) in DMSO was diluted in water to the desired concentration. 30 μl aliquots of the stock were mixed with 120 μl of acetone and then used to coat the inside of scintillation vials. Control scintillation vials were coated with an equivalent amount of DMSO in acetone. Next, 12 male and 12 female w, iso 2, iso 3 (stock A5001) Drosophila melanogasterwere put into the prepared scintillation vials. The top of each vial was immediately plugged with a cotton ball soaked in 1% sucrose solution. The time to reach severe paralysis of 100% of the flies was observed and recorded. Additionally, flies were left in the vials overnight, and the extent of toxic effects at given concentrations was observed and recorded the following morning. Severe paralysis was defined as inability to walk on a vial wall, staggering, falling onto the back, remaining on the bottom of a vial for a prolonged period, or death. In this assay, SKF97541 had obvious effects at concentrations equal or greater than 0.9 μg/cm²per coated vial. Shortly after exposure to SKF97541, flies become unable to fly or walk up the sides of a vial without falling onto the back. With prolonged exposure, flies remained at the bottom of a vial, eventually dying after overnight treatment.

[0466] Embryonic and larval assays of SKF97541 were also performed. The acute effects on larvae were assayed as follows. First, 40 μl of the desired concentration of SKF97541 in DMSO, or DMSO alone as a control, was applied to the surface of apple juice agar plates (surface area 18.25 cm²) and allowed to dry. A spot of yeast paste was applied to the center of the plate, and 25 embryos, 1^st, 2^ndor 3^rdinstar larvae were added to each plate. Plates were observed after two hours and after overnight incubation, and larval behavior and mobility were recorded. “Immobile” larvae were defined as larvae unable to move towards food.

[0467] Exposure to SKF97541 caused mobility and feeding defects in 1^stand 2^ndinstar larvae at concentrations greater than 1.6 μg/cm². Concentrations greater than 5.4 μg/cm²caused defects in 1^st, 2^ndand 3^rdinstars. Immobile larvae were able to recoil normally when touched with a brush on the head, body or tail, but were unable to crawl towards food, instead displaying a “lurching on the spot” phenotype.

[0468] Chronic effects of SKF97541 exposure were assayed as follows. Five female and two male Drosophila (A5001) were allowed to lay eggs for two days at 25° C. in vials containing approximately 8 ml of standard cornmeal-agar-molasses fly medium (surface area 5 cm²). Flies were removed and 40 μl of defined concentrations of SKF97541 in DMSO, or DMSO alone, was applied to the food surface bearing the zero to 48 hr old embryos and larvae. The solution was allowed to soak into the surface, the vial was re-plugged with cotton wool, and fly development was allowed to proceed at 25° C. The vials containing developing larvae were observed and the effects on development were recorded compared to controls. The dramatic effects, described in detail in the next paragraph, were observed with decreasing penetrance when SKF97541 was applied at 100, 20 or 4 μg/cm², respectively, to vials of 48 hr egg lays.

[0469] After three days, corpses of 1^stinstar larvae were visible in treated vials. Thin, 2^ndinstar larvae were visible on the surface of the food displaying lurching mobility defects. After four days, the control vials contained 3^rdinstar larvae burrowing into the food. By contrast, larvae in the treated vials appeared to be developmentally delayed; there were many thin larvae and no larvae burrowing in the food. Even larvae of normal size for 3^rdinstars in the treated vials remained on the surface, lurching and sluggish. A few 2^nd/3^rdinstar corpses were visible on the food surface at day four. After five days, wandering 3^rdinstar larvae and pupae were visible on the walls of control vials. By contrast, treated vials did not have larvae on their walls, although some pupae were forming on the surface of the food. At eight days of treatment, adults were enclosing in control vials, but none emerged in the treated vials. Some pupae in the treated vials were visible on the surface of the food, but not on the walls of the vial. After ten days of treatment, some adults eventually enclosed from the pupae on the surface of the food of treated vials; all were female, and were two days developmentally delayed compared to controls.

[0470] GABA_BReceptor GPCR-2 RNA in situ Hybridization on Embryos

[0471] An RNA GPCR-2 probe was synthesized from The Berkeley Drosophila Genome Project (BDGP) clone HL01578. This clone, which contains a 2.4 kb fragment corresponding to a portion of the GABA_Breceptor sequence, was used as a transcription template for T7 RNA polymerase. Antisense DIG-labeled RNA probes were synthesized using the Boehringer Mannheim Dig RNA Labeling Kit and T7 RNA polymerase according to the in situ hybridization protocol of BDGP genome project methods page. The in situ hybridization results indicate that GABA_B(GPCR-2) is expressed in Drosophila embryos throughout the central nervous system in stages 11 through 17.

[0472] Column 1 of Table 1 provides the SEQ ID NOs for the nucleotide sequences of all contiguous sequence assemblies generated from novel Drosophila ESTs and publically-available sequences (SEQ ID NOs:7-15,288) (“Contig SEQ ID NO”). Column 2 of Table 1 provides the SEQ ID NOs for the nucleotide sequences of all novel portions of each contig listed in column 1 (SEQ ID NOs:15,289-31,365) (“novel DNA SEQ ID NOs”). This latter sequence information was generated by first building contigs using the EST library of the invention and public sequence information, and next eliminating all portions of each contig sequence contained within public databases using the BLAST algorithms defined below. Column 3 of Table 1 provides percentage identity values of each nucleotide sequence of column 2 with respect to the closest public sequence over a window size of 125 base pairs using the specific percent identity algorithm described below (“125 bp % identity”). In cases where the closest known sequence in the BLAST search exhibited less than 50% identity to the sequence of column 2, 50% is reported as a default floor value in column 3. In cases where the sequence in column 2 is less than 125 base pairs, the length of the window in base pairs used to determine the % identity is given in parentheses in column 3. Column 4 of Table 1 provides percentage identity values of each nucleotide sequence of column 2 with respect to the closest public sequence over a window size of 275 base pairs using the specific percent identity algorithm defined below (“275 bp % identity”). In cases where the closest known sequence in the BLAST search exhibited less than 50% identity to the sequence of column 2, 50% is reported as a default floor value in column 4. In cases where the sequence in column 2 is less than 275 base pairs, the length of the window in base pairs used to determine the % identity is given in parentheses in column 4. Column 5 of Table 1 provides the length of the longest contiguous stretch of nucleotides, plus one, which is 100% identical between any known sequence and the sequence of column 2 (“100% identity length”). This value thus can be thought of as a measure of the smallest novel or unique contiguous fragment of the sequence of column 2. Column 6 of Table 1 provides the BLAST score, computed using the specific algorithm defined below, of the closest public sequence compared to the sequence of column 2 (“Blast score”). Higher BLAST scores reflect greater similarity between the sequence of column 2 and the closest public sequence. Column 7 of Table 1 provides a condition as set forth in Table C for use in hybridization reactions to isolate sequences which are more related to the sequence of column 2 than is the nearest public sequence (“hybridiz conditions”). For each hybridization condition set forth in Table C, Table A sets forth hybridization buffer conditions and Table B sets forth wash buffer conditions. Column 8 of Table 1 provides the protein translations of the predicted coding regions of each nucleotide sequence in column 2 (SEQ ID NOs:46,853-62,485) (“encoded polypep. SEQ ID NO”). They are therefore believed to represent novel polypeptide sequences of the invention.

[0473] A public sequence database was assembled and used for all BLAST comparisons and was a combination of GenBank and the Berkeley Drosophila Genome Project database (BDGP) as they existed on or about Feb. 15, 1999.

[0474] Nucleic acids comprising or defined by any one of the SEQ ID NOs of Table 1, coding regions thereof, and derivatives, recombinant cells, transgenics, methods of production, etc., comprising or using same, as set forth in the subsections of section 5 herein are also provided.

[0475] “Percent (%) sequence identity” with respect to the amino acid sequences and nucleotide sequences disclosed in Table 1 and Table 2 was calculated as the percentage of amino residues (or nucleotides) in a candidate sequence that are identical with the amino acid residues (or nucleotides) in the sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and, for amino acid sequences, not considering any conservative substitutions as part of the sequence identity. “Percent (%) nucleotide sequence identity over a specified window size “W” with respect to the sequences disclosed herein was calculated as the percentage of nucleotide residues in any window of W base pairs (e.g., the window of 125 or 275 base pairs set forth in columns 3 and 4, respectively, of Table 1) in the candidate sequence that are identical with the nucleotides in the disclosed sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. A percent nucleic acid sequence identity value is determined by the number of matching identical residues divided by the window size W for which the percent identity is reported.

[0476] Unless otherwise indicated, the % identity values used in Table 1 and Table 2 mean those values that were generated by WU-BLAST-2a19, WU-BLASTP program (for % amino acid sequence identity) and WU-BLASTN program (for % nucleic acid sequence identity) (Altschul et al., 1997, Meth. Enzymol. 215, 403-410; http://blast.wustl.edu/blast/README.html). WU-BLAST-2a19 uses several search parameters, all of which were set to the default values. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. Values may be adjusted to increase sensitivity. A % sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the “longer” sequence in the aligned region. The “longer” sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-BLAST-2a19 to maximize the alignment score are ignored).

[0477] “Percent (%) amino acid sequence similarity” with respect to amino acid sequences was determined by doing the same calculation as for determining % amino acid sequence identity described above, but including conservative amino acid substitutions in additional to identical amino acids in the computation. Conservative amino acids are those that do not significantly affect the folding or activity of the protein. Conservative aromatic amino acids that may be substituted for each other are phenylalanine, tryptophan, and tyrosine. Conservative hydrophobic amino acids that may be substituted for each other are leucine, isoleucine and valine. Conservative polar amino acids that may be substituted for each other are glutamine and asparagine. Conservative basic amino acids that may be substituted for each other are arginine, lysine and histidine. Conservative acidic amino acids that may be substituted for each other are aspartic acid and glutamic acid. Finally, conservative small amino acids that may be substituted for each other are alanine, serine, threonine, methionine, and glycine.

[0478] For each contig nucleotide sequence (SEQ ID NOs:7-15,288) listed in Table 2 (column 1), the corresponding SEQ ID NO of the amino acid sequence of any predicted polypeptide encoded thereby is also disclosed (column 2). For each of these amino acid sequences (SEQ ID NOs:31,636 to 46,852), BLAST, PFam, and Prosite information is further provided, as appropriate. Accordingly, the invention provides proteins comprising or defined by any one of these amino acid sequences, as well as derivatives thereof, antibodies thereto, nucleic acids encoding them, etc., as set forth in the subsections of section 5 hereinabove. Mature proteins in which precursor sequences (e.g., secretory signal peptide sequences) have also been removed are also provided.

[0479] The cell in Table 2 designated “Blast Description” (column 3 and sub-columns therein) discloses the top two database hits obtained using BLAST. BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases. The scores assigned by WU-BLASTP in a protein search have a well-defined statistical interpretation designed to identify related proteins. WU-BLASTP uses a heuristic algorithm which seeks local as opposed to global alignments and is therefore able to detect relationships among sequences which share only isolated regions of similarity (Altschul et al., 1990, Id.; Altschul et al., 1997, Nucl. Acids Res. 25, 3389-3402). For each BLAST hit, a BLAST score is provided at the left margin of the “Blast Description” cell. The score was computed using the same WU-BLASTP program set to the same parameters as described above for ascertaining % amino acid sequence identity. Next to the BLAST score is a GenBank identifier number, followed by the description line in GenBank.

[0480] For each contig SEQ ID NO listed in Table 2 (column 1), one or more predicted protein subsequences are reported which were predicted to be novel from the BLAST search results (“Polypeptide subsequence SEQ ID NO”). For each Polypeptide subsequence SEQ ID NO listed, the associated parameters from the BLAST search are also reported (“100% identity length”) (“100% similarity length”) (“Blast score”). The values listed for 100% identity length, 100% similarity length, and Blast score were generated for these amino acid sequences in an analogous manner to the computations explained in Table 1 for nucleotide sequences.

[0481] In the “PFam motifs” cell (column 4), a PFam motif number may be provided, along with the beginning and ending amino acid residue numbers of the portion of the sequence where the PFam motif is located. A description for each PFam motif number is provided in Table 3. The PFam value was obtained by using PFam database version 3.2 (created by Sean Eddy et al., Washington University, St. Louis, Mo.). Using the HMMER software, version 2.0, PFam was searched using the “hmmpfam” program, version 2.1. All PFam search hits with an E score less than or equal to 0.5 were reported. PFam is described by Bateman et al. (1999, Nucl. Acids Res. 27, 260-262). The HMMER software is described by Eddy (1996, Curr. Opin. Struct. Biol. 6, 361-365; see also http://hmmer.wustl.edu). Briefly, PFam is a large collection of multiple sequence alignments of protein domains or conserved protein regions which represent evolutionarily conserved structure having implications for a protein's function. The HMMER software uses hidden Markov models (HMMs) (described by Durbin et al., 1998, Biological sequence analysis: probabilistic models of proteins and nucleic acids, Cambridge University Press) to find new members of a domain family.

[0482] In the “Prosite motifs” cell (column5), a Prosite motif number may be provided along with the beginning and ending amino acid residue numbers of the portion of the sequence where the Prosite motif is located. A description for each Prosite motif number is provided in Table 4. Prosite is described in Hoffmann et al. (1999, Nucl. Acids Res. 27, 215-219). Briefly, Prosite is a database of protein families and domains. It is based on the observation that, while there is a huge number of different proteins, most of them can be grouped, on the basis of similarities in their sequences, into a limited number of families. Proteins or protein domains belonging to a particular family generally share functional attributes and are derived from a common ancestor. It is apparent, when studying protein sequence families, that some regions have been better conserved than others during evolution. These regions are generally important for the function of a protein and/or for the maintenance of its three-dimensional structure. By analyzing the constant and variable properties of such groups of similar sequences, it is possible to derive a signature for a protein family or domain which distinguishes its members from all other unrelated proteins. Prosite contains signatures specific for about one thousand protein families or domains. Each Prosite signature is documented to provide background information on the structure and function of these proteins (available at http://expasy.hcuge.ch/sprot/prosite.html).

[0483] In one aspect of the present invention, a protein (including peptides and polypeptides) is provided having an amino acid sequence with a BLAST score of at least X compared with any one of SEQ ID NOs:46,853 to 62,485, wherein for each of these sequences, X is greater than the value shown in the “Blast score” cell of Table 2. Preferably the value of X is at least 1%, 2%, 5% or 10%, more preferably 20%, 30%, 40% or 50% greater than the value shown in the “Blast score” cell. In addition to having a BLAST score of at least X compared with one of the sequences of SEQ ID NOs:46,853 to 62,485, preferably the amino acid sequence of the protein includes the amino acid sequence of the PFam and/or Prosite motif, if any, listed in Table 2 for that sequence (i.e. one of SEQ ID NOs:46,853 to 62,485) or another example of that motif type. In an another embodiment, in addition to having a BLAST score of at least X with one of the sequences of SEQ ID NOs:46,853 to 62,485, preferably the protein has a biological activity of a GenBank protein, if any, listed in the “Blast description” cell for the related ‘parent’ protein (i.e. the protein defined by the sequence of any one of SEQ ID NOs:31,636-46,852 to which the protein motif subsequence of any one of SEQ ID NOs:46,853 to 62,485 is related). Alternatively, and/or additionally, the related protein displays the antigenicity of the protein defined by any one of SEQ ID NOs:46,853 to 62,485.

[0484] Another aspect of the invention is directed to a protein having an amino acid sequence of at least 60% sequence identity, at least 70% sequence identity, preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and most preferably at least 95% sequence identity when compared with any one of SEQ ID NOs:46,853 to 62,485. In addition to sharing sequence identity with any one of SEQ ID NOs:46,853 to 62,485, preferably, the amino acid sequence of the protein includes the amino acid sequences of the PFam and/or Prosite motif, if any, listed in Table 2 for the sequence (i.e. one of SEQ ID NOs:46,853 to 62,485). or another example of that motif type. In an another embodiment, in addition to having an amino acid sequence sharing the above-mentioned sequence identity with any one of SEQ ID NOs:46,853 to 62,485, preferably the protein additionally has the biological activity of a Genbank protein, if any, listed in the “Blast description” cell for the related ‘parent’ protein, and/or has the antigenicity of the protein defined by any one of SEQ ID NOs:46,853 to 62,485.

[0485] Yet another aspect of the invention is directed to a polypeptide having an amino acid sequence of at least 60% sequence similarity, at least 70% sequence similarity, preferably at least 80% sequence similarity, more preferably at least 90% sequence similarity, and most preferably at least 95% sequence similarity when compared with any one of SEQ ID NOs:46,853 to 62,485. In addition to sharing sequence similarity with any one of SEQ ID NOs:46,853 to 62,485, preferably, the amino acid sequence of the protein includes the amino acid sequences of the PFam and/or Prosite motif, if any, listed in Table 2 for the sequence (i.e. one of SEQ ID NOs:46,853 to 62,485). or another example of that motif type. In an another embodiment, in addition to having an amino acid sequence sharing the above-mentioned sequence similarity with any one of SEQ ID NOs:46,853 to 62,485, preferably the protein additionally has the biological activity of a Genbank protein, if any, listed in the “Blast description” cell for the related ‘parent’ protein, and/or has the antigenicity of the protein defined by any one of SEQ ID NOs:46,853 to 62,485.

[0486] For each PFam entry listed in column one of Table 3 (“ID No.”) and each Prosite entry listed in column one of Table 4 (“ID No.”), a brief, one-line description obtained from the respective Pfam and Prosite databases is provided in column 2 of each of these tables (“Description”). This information further describes the motifs identified in Table 2 in the “PFam motifs” and “Prosite motifs” cells of Table 2 (columns 4 and 5, respectively).

[0487] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings and Sequence Listing containing, inter alia, an extensive fly EST database. Such modifications are intended to fall within the scope of the appended claims. The various references cited herein may include patent applications, patents, and other publications; the disclosure of each reference cited is hereby incorporated herein by reference in its entirety.