US 6,540,996 B1Grant
Compound screening methods
Issue Date:2003-04-01
•19 Claims
•4 Drawing Sheets
Abstract
The invention provides methods of screening for compounds which affect the activity of a physiologically important calcium pump, the sarco/endoplasmic reticulum Ca2+ ATPase (SERCA), using the nematode worm C. elegans.
Metadata
Assignee
- Devgen NV
Inventors
- Richard Zwaal
- José Groenen
- Thierry Bogaert
Application Information
Application Number:US 09/549,872
Filing Date:2000-04-14
Priority Date:1999-04-15
Art Unit:7
Classifications
IPC:
A01N 6300A61K 4800
Field of Search:
435 691800 8800 3424 934
Patent Drawings (4 sheets)
Description
Related Applications
[0002] This application claims priority under Title 35 §119(e) of U.S. Provisional Application No. 60/129,596, filed Apr. 15, 1999, and entitled COMPOUND SCREENING METHODS and foreign priority benefits under Title 35, U.S.C., §119(a)-(d) or §365(a),(b) of foreign patent application nos. GB 9908670.4, filed Apr. 15, 1999, and GB 9912736.7, filed Jun. 1, 1999, the entire contents of which are incorporated herein by reference.
[0003] The invention is concerned with methods for use in the identification of compounds which affect the activity of a physiologically important calcium pump, the sarco/endoplasmic reticulum Ca2+ ATPase (SERCA).
[0004] In most animal cells and plant cells, the normal concentration of free cytosolic Ca2+ is 50 to 100 nM. Since Ca2+ acts as a major intracellular messenger, elevating these levels affects a wide range of cellular processes including contraction, secretion and cell cycling (Dawson, 1990, Essays Biochem. 25:1-37; Evans et al., 1991, J. Exp. Botany 42:285-303). Intracellular Ca2+ stores hold a key position in the intracellular signalling. They allow the rapid establishment of Ca2+ gradients, and accumulate and release Ca2+ in order to control cytosolic Ca2+ levels. Moreover, lumenal Ca2+ intervenes in the regulation of the synthesis, folding and sorting of proteins in the endoplasmic reticulum (Brostrom and Brostrom, 1990, Ann. Rev. Physiol. 52:577-590; Suzuki et al., 1991, J. Cell. Biol. 114:189-205; Wileman et al., 1991, J. Biol. Chem. 266:4500-4507). Furthermore it controls signal-mediated and passive diffusion through the nuclear pore (Greber and Gerace, 1995, J. Cell. Biol. 128:5-14).
[0005] Three genes that code for five different isoforms of the sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) are known in vertebrates, SERCA1a/b, SERCA2a/b and SERCA3. The SERCA isoforms are usually tagged to the endoplasmic reticulum (ER) or ER subdomains like the sarcoplasmic reticulum, although the precise subcellular location is often not known. The SERCA proteins belong to the group of ATP-driven ion-motive ATPases, which also includes, amongst others, the plasma membrane Ca2+-transport ATPases (PMCA), the Na+-K+-ATPases, and the gastric H+-K+-ATPases. The SERCA Ca2+-transport ATPases can be distinguished from their plasma membrane counterparts like PMCA by the specific SERCA inhibitors: thapsigargin, cyclopiazonic acid, and 2,5-di(tert-butyl)-1,4-benzohydroquinone (Thastrup et al., 1990, PNAS 87:2466-2477; Seidler et al., 1989, J. Biol. Chem. 264:17816-17823; Oldershaw and Taylor, 1990, FEBS Lett. 274:214-216). In view of the diverse role of Ca2+ in the cell and the fact that Ca2+ is stored in diverse organelles, the diversity in Ca2+-accumulation pump isoforms is not surprising.
[0006] SERCA1 is only expressed in fast-twitch skeletal muscle fibres. The gene encodes two different isoforms; SERCA1b which is the neonatal isoform and SERCA1a the adult isoform (Brandl et al., 1986, Cell 44:597-607; Brandl et al., 1987, J. Biol. Chem. 262:3768-3774). The difference between the two isoforms is the result of an alternative splice. As a consequence, the neonatal isoform contains a highly charged carboxyl-terminal extension (Korczak et al., 1988, J. Biol. Chem. 263:4813-4819). The reason for this alternative splicing is as yet unknown; the functional significance of this extension is not yet clear. When expressed in COS cells, SERCA1a and SERCA1b exhibit nearly identical maximal Ca2+-turnover rate, Ca2+-affinity and ATP-dependency of Ca2+ transport (Maruyama and MacLennan, 1988, PNAS 85:3314-3318). The human SERCA1 gene is mapped on chromosome 16P12.1 and is about 26 kb long (MacLennan et al., 1987, Somatic Cell Mol. Genet. 13:341-346; Callen et al., 1991, Am. J. Hum. Genet. 49:1372-1377).
[0007] SERCA2 is expressed in muscle and non-muscle cells. The human SERCA2 gene maps to chromosome 12q23-q24.1 (Otsu et al., 1993, Genomics 17:507-509). Partial sequence analysis suggests that the same exon/intron layout is conserved between SERCA1 and SERCA2. mRNA of SERCA2 can be divided in 4 different classes; class 1 encodes SERCA2a and is mainly expressed in muscle, the other classes encode SERCA2b and are mainly expressed in non-muscle tissues. SERCA2b harbors a 49 amino acid extension, which contains a highly hydrophobic stretch. As with SERCA1, no functional difference can be measured between the two SERCA2 isoforms when expressed in COS cells (Campbell, 1991, J. Biol. Chem. 266:16050-16055). However, differences in Ca2+ affinity and turnover rate of the phosphoprotein intermediate have been observed (Lytton et al., 1992, 267:14483-14489; Verboomen et al., 1992, J. Biochem. 286:591-596). Both isoforms are expressed in a tissue-dependent pattern, both qualitatively and quantitatively (Eggermont et al., 1990, J. Biochem. 271:649-653). Cardiac muscle expresses 5- to 20-fold higher levels of SERCA2 than smooth muscle. Slow-twitch skeletal and cardiac muscle only express SERCA2a, while SERCA2b (referred to as the “housekeeping” isoform) is expressed in all non-muscle tissue, and represents about 75% of the Ca2+-transporting ATPase activity in smooth-muscle tissue. Different protein-to-message ratios for SERCA2a and SERCA2b have been observed. Cardiac muscle expresses 70 times more protein and only 7 times more SERCA2a mRNA compared to stomach smooth muscle which expresses SERCA2b (Khan et al., 1990, J. Biochem. 268:415-419).
[0008] SERCA3 is considered to be the non-muscle SERCA isoform. SERCA3 lacks the putative interacting domain for phospholamban, and hence, does not respond to this modulator (Toyofuku et al., 1993, J. Biol. Chem. 268:2809-2815). When expressed in COS cells, SERCA3 shows approximately 5-fold lower activity for Ca2+ and a slightly higher pH optimum (Toyofuku et al., 1992, J. Biol. Chem. 267:14490-14496). In platelets, mast cells and lymphoid cells SERCA3 is co-expressed with SERCA2b (Wuytack et al., 1994, J. Biol. Chem. 269:1410-1416; Wuytack et al., 1995, Bioscience Rep. 15:299-306). Expression has also been observed in some arterial endothelial cells, in early developing rat heart, in some secretory epithelial cells of endodermal origin and in cerebellar Purkinje neurons.
[0009] In slow-twitch skeletal muscle, cardiac muscle and smooth-muscle tissues, SERCA2 activity is modulated by phosphorylation of the regulatory protein phospholamban (PLB) (see Fuji et al., 1991, FEBS Lett. 273:232-234). In cardiac muscle, in vivo phosphorylation of PLB by cAMP- or Ca2+/Calmodulin-dependent protein kinase has a positive effect on the Ca2+ transport (Le Peuch et al., 1997, Biochemistry 18:5150-5157; Tada et al., 1979, J. Biol. Chem. 254: 319-326; Davis et al., 1983, J. Biol. Chem. 258:13587-13591; Wegener et al., 1989, J. Biol. Chem. 264:11468-11474). In order to determine the exact in vivo role of phospholamban, PLB-deficient mice have been generated (Luo et al., 1994, Circ. Res. 75:401-409). A marked effect is observed on Ca2+ uptake, whereas no effect is measured in Vmax. The ablation of the PLB gene in mice is associated with increased myocardial contractility, and a loss of the positive inotropic response to adrenergic stimulation. The precise molecular mechanism underlying the modulation of SERCA by PLB is not apparent. An electrostatic mechanism has been proposed, as a direct interaction between PLB and SERCA, in which the unphosphorylated PLB inhibits the SERCA pump (Kirchberger et al., 1986, Biochemistry 25:5484-5492; Chiesi and Schwaller, 1989, FEBS Lett. 244:241-244; Xu and Kirchberger, 1989, J. Biol. Chem. 264:16644-16651). Alternatively, PLB and the SERCA Ca2+ pump are able to interact and phosphorylation of PLB alters its properties, as confirmed by cross-linking experiments (James et al., 1989, Nature 342:90-92). In some experiments, inhibitory effects of PLB have been observed on co-transfection of PLB and SERCA2a in COS-1 cells (Fuji et al. 1990, FEBS Lett. 273:232-234). Several models have been proposed to explain the regulatory effect of PLB on Ca2+ ATPases. These include the aggregation of SERCA2 around a pentameric form of PLB (Voss et al., 1994, Biophys J. 67:190-196). Another explanation starts from the electrostatic inhibition of Ca2+ binding due to the SERCA-PLB interaction (Toyoftiku et al., 1994, J. Biol. Chem. 269:3088-3094). The interaction between PLB and SERCA2a has been studied in more detail, revealing a putative PLB binding domain that is also present SERCA1 but not in SERCA3. This has been further confirmed by expression studies in COS-1 cells (Toyofuku et al., 1993, J. Biol. Chem., 268:2809-2815). Such a finding is remarkable as SERCA1 and PLB are never co-expressed in vivo.
[0010] Direct phosphorylation of SERCA by Ca2+/CaM kinase II results in a 2-fold higher maximal velocity Xu and Kirchberger, 1989, J. Biol. Chem. 264: 16644-16651. This CaM kinase phosphorylation is specific for SERCA2 and may act synergistically with the phosphorylation of phospholamban.
[0011] Sarcolipin (SLN) is a peptide of 33 amino acids in length that co-purifies with SERCA1. The human gene encoding SLN was mapped to chromosome 11q22-q23. The protein sequence shows some homology to phospholamban, especially in the lumenal part of the protein. In rabbits SLN is highly expressed in fast-twitch skeletal muscle, as is SERCA1 (Odermatt et al., 1997, Genomics 45:741-553). In co-expression studies in HEK-293 T-cells, a decrease of SERCA1 affinity for Ca2+ was observed, but maximal Ca2+ uptake rates were stimulated. Mutational analysis provided evidence for different mechanisms of interaction of both SLN and PLB with the SERCA molecules (Odermatt, et al., 1998, J. Biol. Chem. 273:12360-12369).
[0012] SERCA plays an important role in regulating Ca2+ levels, and hence in pathologies related to abnormal Ca2+ concentrations and regulation. For instance, abnormal cytosolic free Ca2+ levels are involved in different muscle pathologies (Morgan, 1991, N. Engl. J. Med. 325:625-632; Perreault et al., 1993, Circulation 87 Suppl. VII:31-37). Other major pathologies in which SERCA may play a role include cardiac hypertrophy, heart failure, and hypertension (Arai et al., 1994, Circ. Res. 74:555-564; Lompre et al., 1994, J. Mol. Cell. Cardiol. 26:1109-1121).
[0013] Cardiac hypertrophy is an adaptive response of the cardiac muscle to a hemodynamic overload, in which diastolic dysfunction is one of the earliest signs of pathological hypertrophic response. In animal models, where most studies are performed, a highly significant positive correlation has been obtained between end-diastolic cytosolic Ca2+ levels and diastolic relaxation abnormalities. After aortic binding, SERCA2 mRNA and protein levels are decreased, as is the sarcoplasmic reticulum Ca2+ uptake (Komuro et al., 1989, J. Clin Invest. 83:1102-1108; de la Bastie et al., 1990, Circ. Res. 66:554-564). This effect was only found in cases of severe hypertrophy, and was only observed when heart failure occurs. In moderate hypertropy and in cases of compensated hypertrophy no changes in the level of SERCA mRNA were observed (de la Bastie et al, ibid; Feldman et al., 1993, Circ. Res. 73:184-192).
[0014] In humans, most studies report a decrease in SERCA2 mRNA, SERCA2 protein levels and decreased Ca2+ uptake in a failing heart (Arai et al., 1993, Circ. Res. 72:463-469; Hasenfuss et al., 1994, Circ. Res., 75: 434-442). The decreased levels of SERCA2 expression are accompanied by decreased expression of phospholamban, cardiac ryanodine receptor and dihydropyridine receptor (Vatner et al., 1994, Circulation 90:1423-1430; Go et al., 1995, J. Clin. Invest. 95:888-894; Takahashi et al., 1992, J. Clin. Invest. 90:927-935). These human heart failure data are confirmed in different animal models. In a hypertrophic animals, SERCA2 expression levels are decreased; in a dilated strain Ca2+ uptake is decreased with increasing age (Kuo et al., 1992, Biochem Biophys acta 1138:343-349; Whitmer et al., 1988, Circ. Res. 62:81-85). Most striking in both humans and animal models is the strong positive correlation between SERCA2 and phospholamban mRNA levels. Examples in literature that do not confirm these data are most likely the result of various pathogenic mechanisms that can lead to heart failure.
[0015] Blood vessels from hypertensive animals have an increased wall thickness and show altered contractile properties. Several lines of evidence indicate that diminished Ca2+ pump activities might contribute to elevation in cytoplasmic Ca2+ levels in hypertension. However, increased expression of SERCA2 has also been observed. Further study is required to resolve these contradictory results.
[0016] Darier-White disease is an autosomal-dominant skin disorder characterized by loss of adhesion between epidermal cells (acantholysis) and abnormal keratinization. In several patients mutations have been found in SERCA2, demonstrating the role of SERCA and Ca2+-signalling pathway in the regulation of cell-to-cell adhesion and differentiation of the epidermis (Sakuntabhai et al., 1999, Nature Genetics 21:271-277).
[0017] Although little is known about the involvement of SERCA in skeletal muscle disorders, deficiency in the Ca2+-transport ATPase activity has been found in Brodys disease (Benders et al., 1994, J. Clin. Res. 94:741-748). The disorder is characterized by exercise-induced impairment of muscle relaxation. Normal levels of SERCA1 protein were detected, but the SERCA activity was decreased by about 50% in patients suffering from the disease. In other research, SERCA1 in fast-twitch fibers of Brody patients could not be detected immunologically (Danon et al., 1988, Neurology 38:812-815). However, three Brody patients show no defects in their SERCA1 gene, indicating pleiotropic mechanisms underlying Brody disease (Zhang et al., 1995, Genomics 30:415-424).
[0018] The underlying mechanism of non-insulin-dependent diabetes mellitus (NIDDM) is still unknown. In islets of Lagerhans from db/db mice (a NIDDM model), glucose-induced initial induction and subsequent oscillations of intracellular Ca2+ concentrations were absent. Further analysis showed that SERCA3 was almost entirely lacking from the db/db islets. These results and thapsigargin experiments implicate SERCA3 in the defective insulin secretion associated with NIDDM (Roe et al., 1994, J. Biol. Chem. 269:18279-28282). A significant reduction of SERCA3 expression was also found in Goto-Kakizaki rats, a non-obese model of NIDDM (Varadi et al., 1996, J. Biochem. 319:521-527) Interactions have been reported between different SERCAs (SERCA1 and SERCA2) and different Insulin Receptor Substrates (IRS-1 and IRS-2). This interaction was dependant on insulin (Algenstaedt et al., 1997, J. Biol. Chem. 272:23696-23702). Inactivation of IRS-2 has recently been shown to resemble certain aspects of type 2 diabetes (Withers et al., 1998, Nature 391:900-904).
[0019] In mammals, there are three genes encoding different SERCA isoforms. In contrast, the nematode worm Caenorhabditis elegans(C. elegans) has only a single homologue of the mammalian SERCA protein, which was identified by the C. elegansgenome-sequencing consortium (see Science issue 282, 1998). The C. elegansSERCA gene is located on chromosome III on a cosmid named K11D9. On a physical level, the gene consists of six exons that span an Open Reading Frame of 3.2 kb, resulting in a predicted protein of 1059 amino acids. The consensus alternative splice site that is present in the C-terminal end of mammalian SERCA genes is present in the worm as well. This leads to a second isoform consisting of 7 exons that span an ORF of 3.0 kb, resulting in a protein of 1004 amino acids. This may indicate a functional conservation of this domain of the protein, e.g. in regulating the activity of the SERCA pump.
[0020] C. elegansis a small roundworm that has a life span of only three days, allowing rapid accumulation of large quantities of individual worms. The cell-lineage is fixed, allowing identification of each cell which has the same position and developmental potential in each individual animal. C. elegansis extremely amenable to genetic approaches and a large collection of mutants have been isolated that are defective in embryonic development, behaviour, morphology, neurobiology etc. There is also a large cosmid collection covering almost the whole C. elegansgenome, which is used to determine the complete genomic sequence of the worm.
[0021] These characteristics of C. elegansmake it the organism of choice for use as a tool in the drug discovery process. In particular, C. elegansmay be used in the development of high throughput live animal compound screens, useful in the development of potential candidate drugs, in which worms are exposed to the compound under test and any resultant phenotypic and/or behavioural changes are recorded. The present inventors have developed a number of C. elegans-based screening methods which may be used to identify compounds which modulate the activity of SERCA, either directly or via the SERCA/PLB interaction. Compounds identified as modulators of SERCA activity using these screening methods may be useful as pharmaceuticals in the treatment of the wide range of diseases with which the SERCA genes have been associated.
[0022] Accordingly, in a first aspect the invention provides a method of identifying compounds which are capable of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises:
[0023] contacting C. eleganswhich exhibit reduced SERCA ATPase activity compared to wild type C. elegansin one or more cell types or tissues with a compound under test; and
[0024] detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity in the one or more cell types or tissues which exhibit reduced SERCA activity in the absence of the compound.
[0025] The method of the invention, which will be hereinafter referred to as the ‘up-regulation assay’ is performed using a C. elegansstrain which exhibits reduced SERCA ATPase activity in one or more cell types or tissues, as compared to the SERCA ATPase activity in wild-type C. elegans.It has been observed that worms which exhibit reduced SERCA activity compared to wild-type worms manifest a variety of phenotypic and behavioural defects. The basis of the up-regulation assay is therefore to take worms which exhibit defects due to reduced SERCA activity, contact these worms with the compound under test and screen for phenotypic, behavioural or biochemical changes indicating a reversion towards wild-type SERCA activity. For example, worms with reduced SERCA activity often show a reduction in the rate of pharynx pumping. In this case, screening for an increase in the rate of pharynx pumping in the presence of a test compound would indicate a reversion towards wild-type SERCA activity due to the ability of the compound to enhance or up-regulate SERCA. For comparison purposes, an example of a C. elegansstrain which exhibits ‘wild-type’ SERCA activity is the N2 strain (this strain can be obtained from CGC, University of Minn., USA). The N2 strain has been particularly well characterised in the literature with respect to properties such as pharynx pumping rate, growth rate and egg laying capacity (see Methods in Cell Biology, Volume 48, Caenorhabditis elegans:Modern biological analysis of an organism, ed. by Henry F. Epstein and Diane C. Shakes, 1995 Academic Press; The nematode Caenorhabditis elegans,ed. by William Wood and the community of C. elegansresearchers., 1988, Cold Spring Harbor Laboratory Press; C. elegansII, ed. by Donald L. Riddle, Thomas Blumenthal, Barbara J. Meyer and James R. Priess, 1997, Cold Spring Harbor Laboratory Press.).
[0026] C. eleganswhich exhibit reduced SERCA activity in one or more cell types or tissues can be obtained in several different ways. In a first embodiment, worms with reduced SERCA activity are obtained by treating a culture of worms with a chemical inhibitor of SERCA such as, for example, thapsigargin. As will be demonstrated in the examples given herein, treatment of C. eleganswith thapsigargin results in recognisable phenotypic and behavioural changes such as paleness, reduced growth, pharynx pumping defects and production of very few progeny which are sick and grow very slowly. Accordingly, reversion of any one of these characteristics towards wild-type can provide an indication of a reversion towards wild-type SERCA activity.
[0027] In another embodiment, worms with reduced SERCA activity can be produced by specifically down-regulating the expression of SERCA in one or more tissues using antisense techniques or double stranded RNA inhibition. This can be achieved by transfection of C. eleganswith a vector that expresses either an antisense C. elegansSERCA RNA or double stranded C. elegansSERCA RNA. Specific down-regulation of SERCA expression in different cell types or tissues of the worms can be achieved by incorporating into the vector an appropriate tissue-specific promoter to drive expression of the antisense RNA or double stranded RNA in the required tissues. SERCA expression will be specifically down-regulated only in those tissues which express the antisense RNA or double stranded RNA. By way of example, the promoter region of the C. elegansSERCA gene itself (see the examples given below) can be used to direct expression of an antisense RNA or double stranded RNA in all the cells and tissues which express SERCA. The C. elegansmyo-2 promoter can be used to direct expression in the pharynx. The C. elegansmyo-3 promoter can be used to direct expression in the body wall muscles. The use of antisense and double stranded RNA inhibition will be further understood with reference to the Examples included herein.
[0028] Alternative RNAi techniques which may be used to inhibit SERCA activity are described in the applicant's co-pending International patent application No. WO 00/01846. These techniques, which are based on delivery of dsRNA to C. elegansby feeding with an appropriate dsRNA or feeding with food organisms which express an appropriate dsRNA, may lead to a more stable RNAi phenotype than results from injection of dsRNA.
[0029] In a still further embodiment, the C. elegansexhibiting reduced SERCA ATPase activity in one or more cell types or tissues may be a mutant strain in which SERCA activity is reduced but not eliminated i.e. a reduction-of-function mutant. The mutation may give rise to reduced SERCA activity through a down-regulation of SERCA expression in one or more cell types or tissues or through a defect in the SERCA protein itself or a defect in regulation of the activity of the SERCA protein.
[0030] A reduction-of-function mutant or a knock-out mutant can be isolated using a classical non-complementation screen, starting with a heterozygote C. elegansstrain carrying a mutant SERCA allele on one chromosome and a recessive marker close to the wild-type SERCA allele on the other chromosome. The worms are subjected to mutagenesis using standard techniques (EMS or UV-TMP are suitable for this purpose) and the progeny is screened by eye for defects, especially in tissues which express SERCA. Since the screening is performed in the F1 generation, mutations will only give rise to a phenotype if the mutation occurs in the SERCA gene (due to non-complementation) or if the mutation is dominant, which does not occur frequently. These two possibilities can be distinguished in subsequent generations. A newly introduced SERCA mutation should be linked to the recessive marker. As a further control, DNA sequencing can be performed to determine the nature of the mutation.
[0031] The step of ‘detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity’ may be performed in several different ways. The method of choice is generally dependent upon the phenotype/behavioural characteristics of the starting worm strain, which is in turn generally dependent upon the nature of the cell types or tissues in which SERCA activity is reduced.
[0032] Inhibition experiments, for example the RNAi experiments and thapsigargin experiments described herein, demonstrate that SERCA is a vital protein for C. elegans.Moreover, reduction of SERCA activity results in a variety of phenotypes that can be used as basis of an assay to isolate compounds that alter the activity of SERCA. The main defects, and hence phenotypes, associated with reduced SERCA activity are related to muscle function e.g pharyngeal muscle, body wall muscle, vulva muscle, anal repressor muscle, and anal sphincter muscle. Screens based on reversion of defects in these muscles to wild-type can be used to identify compounds and genes that alter the activity of SERCA. Moreover, other phenotypes, such as paleness, reduced growth, reduced progeny, protruding vulva and protruding rectum can be used to identify compounds and genes that alter the function of SERCA.
[0033] In one embodiment, particularly suitable for use when the starting worm strain exhibits defects in pharynx pumping due to reduced SERCA activity in the pharynx (as compared to wild-type C. elegans) the up-regulation assay can be based on detection of changes in the pharynx pumping efficiency. If the starting worm strain exhibits a reduced rate of pharynx pumping due to reduced SERCA activity in the pharynx, then an increase in the rate of pharynx pumping in the presence of a test compound can be used as an indicator of a reversion towards wild-type SERCA activity in the pharynx.
[0034] C. elegansfeeds by taking in liquid containing its food (e.g. bacteria). It then spits out the liquid, crushes the food particles and intemalises them into the gut lumen. This process is performed by the muscles of the pharynx. The process of taking up of liquid and subsequently spitting it out, requiring contraction and relaxation of muscles, is called pharyngeal pumping or pharynx pumping.
[0035] Alterations in SERCA activity influence the pharyngeal pumping rate. In particular, inhibition of SERCA using thapsigargin causes a reduction in the rate of pharynx pumping. Measurement of the pumping rate of the C. eleganspharynx is hence a method to determine the activity of SERCA. The pharynx pumping efficiency can be conveniently measured by placing the nematodes in liquid containing a fluorescent marker molecule precursor, such as calcein-AM. Calcein-AM present in the medium is taken up by the nematodes and the AM moiety is cleaved off by the action of esterases present in the C. elegansgut, resulting in the production of the fluorescent molecule calcein. As the quantity of calcein-AM that is delivered in the gut is dependent of the pumping rate of the pharynx, and hence of the activity of SERCA, the fluorescence measured in the gut of the formed calcein is a quantitative and qualitative measurement of the SERCA activity. It would be readily apparent to one skilled in the art that other types of marker molecule precursor which are cleavable by an enzyme present in the gut of C. elegansto generate a detectable marker molecule could be used instead of calcein-AM with equivalent effect.
[0036] In further embodiments, particularly suitable for use when the starting worm strain exhibits reduced SERCA activity in the vulva muscles, the up-regulation assay can be based on detection of changes in the egg laying behaviour of the C. elegansor on detecting changes in the amount of progeny produced by the C. elegans.
[0037] Defects associated with reduced SERCA activity in the vulva muscles include defects in the production and laying of eggs and hence a reduction in the number of progeny produced. Typically, worms with reduced SERCA expression in the vulva are not able to lay their eggs. The eggs thus hatch inside the mother, which then dies. These mothers are easy to recognize under the dissection microscope. As a consequence of the egg laying defect, these worms produce less progeny, and hence the culture as a whole grows much more slowly. Defects associated with reduced SERCA activity have also been observed in the gonad, including the sheath cells and the spermatheca. These defects also result in reduced egg formation and hence a reduced egg laying phenotype.
[0038] One convenient way in which the egg production and egg laying behaviour of the worms can be monitored is by counting the number of resultant offspring produced. A variety of different techniques can be used for this purpose. For example, the offspring can be measured directly using the growth rate assay and/or the movement assay described below. Alternatively, specific antibodies and fluorescent antibodies can be used to detect the offspring. Any specific antibody that only recognizes eggs, or L1 or L2 or L3 or L4 stage worms, will only recognize offspring, such a specific antibody that recognizes an antigen on the L1 surface has been described by Donkin and Politz, W13G 10(2):71. Finally, the number of eggs or offspring in each well can be counted directly using a FANS device. The FANS device is a ‘worm dispenser apparatus’ having properties analogous to flow cytometers such as fluorescence activated cell scanning and sorting devices (FACS) and is commercially available from Union Biometrica, Inc, Somerville, Mass., USA. The FANS device, also designated a nematode flow meter, can be the nematode FACS analogue, described as fluorescence activated nematode scanning and sorting device (FANS). The FANS device enables the measurement of nematode properties, such as size, optical density, fluorescence, and luminescence and the sorting of worms based on these properties.
[0039] In a still further embodiment, particularly suitable for use when the starting worm strain exhibits reduced SERCA activity in the anal sphincter or the anal repressor, the up-regulation assay can be based on detection of a change in the defecation behaviour of the C. elegans.
[0040] A reduction in the SERCA activity in the anal sphincter and/or the anal repressor, for example following treatment with thapsigargin, results in worms which are constipated and also in worms with a protruding rectum. Changes in the defecation rate of the worms can therefore also serve as an indicator of SERCA activity.
[0041] Defecation rate can be measured using an assay similar to that described above for the measurement of pharynx pumping efficiency, but using a marker molecule which is sensitive to pH. A suitable marker is the fluorescent marker BCECF. This marker molecule can be loaded into the C. elegansgut in the form of the precursor BCECF-AM which itself is not fluorescent. If BCECF-AM is added to worms growing in liquid medium the worms will take up the compound which is then cleaved by the esterases present in the C. elegansgut to release BCECF. BCECF fluorescence is sensitive to pH and under the relatively low pH conditions in the gut of C. elegans(pH<6) the compound exhibits no or very low fluorescence. As a result of the defecation process the BCECF is expelled into the medium which has a higher pH than the C. elegansgut and the BCECF is therefore fluorescent. The level of BCECF fluorescence in the medium (measured using a fluorimeter on settings Ex/Em=485/550) is therefore an indicator of the rate of defecation of the nematodes.
[0042] Defecation can also be measured using a method based on the luminescent features of the chelation of terbium by aspirin. The method requires two pre-loading steps, first the wells of a multi-well plate are pre-loaded with aspirin (prior to the addition of the nematode worms) and second, bacteria or other nematode food source particles are pre-loaded with terbium using standard techniques known in the art. C. elegansare then placed in the wells pre-loaded with aspirin and are fed with the bacteria pre-loaded with terbium.
[0043] The terbium present in the pre-loaded bacteria added to the wells will result in a low level of background luminescence. When the bacteria are eaten by the nematodes the bacterial contents will be digested but the terbium will be defecated back into the medium. The free terbium will then be chelated by the aspirin which was pre-loaded into the wells resulting in measurable luminescence. The luminescence thus observed is therefore an indicator of nematode defecation.
[0044] It has been observed that a reduction in SERCA activity, for example using inhibition by thapsigargin or double stranded RNA inhibition, results in a reduction in the growth rate of a C. elegansculture. Growth rate of the culture as a whole is reduced because the worms produce fewer progeny and also because the few progeny that are produced show poor/delayed growth. Cultures of worms which produce many healthy progeny grow faster than cultures of worms with few and/or sick progeny. Hence measurement of the growth rate of a culture of C. elegansis in indication of the activity of SERCA in the individual worms of the culture.
[0045] Growth rate can be monitored by measuring the number of eggs or the number offspring present in the culture, by measuring the total fluorescence in the culture (this can be autoflourescence, or fluorescence caused by a transgene encoding a flourescent or luminescent protein), but can also be measured using the movement screen described below. Alternatively, the growth rate of a culture of C. eleganscan also be assayed by measuring the turbidity of the culture. In order to perform this ‘turbidity assay’ the worms are grown in liquid culture in the presence of E. colior other suitable bacterial food source. As the culture of worms grows the food source bacteria will be consumed. The greater the number of worms in the culture, the more food source bacteria will be digested. Hence, measurement of the turbidity or optical density of the liquid culture will provide an indirect indication of the number of worms in the culture. By taking sequential measurements over a period of time it is possible to monitor the growth rate of the whole C. elegansculture.
[0046] As an alternative to the above-described methods, the growth rate and amount of progeny can be measured on a plate. Slow growing nematodes, nematodes with vulva defects and nematodes with gonad defects will produce less progeny within a certain time compared to nematodes which do not have these defects. Preferentially, the amount of offspring produced is scored on day five and on day eight. In experiments where the amount of offspring is reduced very drastically due to severe defects in the vulva, gonad or growth rate reduction, the offspring can also be scored at later time intervals.
[0047] In a still further embodiment, the up-regulation assay can be performed by detecting changes in the movement behaviour of C. elegans.As is illustrated by the examples included herein, SERCA is widely expressed in the muscles of C. elegans,including the muscles of the body wall. A reduction of SERCA activity in the body wall muscles gives rise to worms with movement defects. These strains can be used as the basis of an assay in which the worms are contacted with a compound under test and any changes in the movement behaviour of the worms are observed. Compounds which cause the defective movement to revert towards wild-type movement behaviour are scored as compounds capable of enhancing/up-regulating the activity of SERCA.
[0048] Changes in the movement behaviour of the worms can obviously be detected by visual inspection, but as an alternative a number of non-visual approaches for analysing the movement behaviour of worms have been developed which can be performed in a multi-well plate format and are therefore suitable for use in high-throughput screening. Nematode worms that are placed in liquid culture will move in such a way that they maintain a more or less even (or homogeneous) distribution throughout the culture. Nematode worms that are defective in movement will precipitate to the bottom in liquid culture. Due to this characteristic of nematode worms as result of their movement phenotype, it is possible to monitor and detect the difference between nematode worms that move and nematodes that do not move. Advanced multi-well plate readers are able to detect sub-regions of the wells of multi-well plates. By using these plate readers it is possible to take measurements in selected areas of the surface of the wells of the multi-well plates. If the area of measurement is centralized, so that only the middle of the well is measured, a difference in nematode autofluorescence (fluorescence which occurs in the absence of any external marker molecule) can be observed in the wells containing a liquid culture of nematodes that move normally as compared to wells containing a liquid culture of nematodes that are defective for movement. For the wells containing the nematodes that move normally, a low level of autofluorescence will be observed, whilst a high level of autofluorescence can be observed in the wells that contain the nematodes that are defective in movement.
[0049] In an adaptation of the movement assay, autofluorescence measurements can be taken in two areas of the surface of the well, one measurement in the centre of the well, and on measurement on the edge of the well. Comparing the two measurements gives analogous results as in the case if only the centre of the well is measured but the additional measurement of the edge of the well results in an extra control and somewhat more distinct results.
[0050] As an alternative to the above-described embodiments of the up-regulation assay which are all based on the observation of changes in phenotypic and/or behavioural characteristics of the C. elegansas an indicator of SERCA activity, the inventors have developed a method of analysing SERCA activity in a given cell type or tissue which is based upon the use of the marker molecule apoaequorin which is sensitive to changes in intracellular Ca2+.
[0051] Aequorin is a calcium-sensitive bioluminescent protein from the jellyfish Aequorea victoria.Recombinant apoaequorin, which is luminescent in the presence of calcium but not in the absence of calcium, is most useful in determining intracellular calcium concentrations and even calcium concentrations in sub-cellular compartments. Expression vectors suitable for expressing recombinant apoaequorin and, in addition, vectors expressing apoaequorin proteins which are targeted to different sub-cellular compartments, for example the nucleus, the mitochondria or the endoplasmic reticulum are available commercially (see below).
[0052] As SERCA is a endoplasmic reticulum-localized calcium pump, an apoaequorin that is targeted to the endoplasmic reticulum (hereinafter referred to as erAEQ) is particularly useful for developing assays for SERCA activity. Such apoaequorin is available from Molecular probes (Eugene, Oreg., USA). The vector erAEQ/pcDNAI (Molecular Probes) contains an Ig 2b heavy chain gene from mouse, an HA1 epitope and a recombinant apoaequorin in fusion. The mouse gene targets the aequorin to the endoplasmic reticulum, and the aequorin is mutated to make it less sensitive to calcium, as the concentrations of this ion are relatively high in the endoplasmic reticulum. Although apoaequorin is the calcium sensor of choice, it would be apparent to persons skilled in the art that any other calcium sensor localized in the endoplasmic reticulum could be used with equivalent effect
[0053] Plasmid expression vectors which drive expression of the ER-localized apoaequorin in C. eleganscan be easily constructed by cloning nucleic acid encoding erAEQ downstream of a promoter capable of directing gene expression in one or more tissues or cell types of C. elegans,such that the promoter and the erAEQ-encoding sequence are operatively linked. As used herein the term “operatively linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. In a typical cloning procedure, the apoaequorin gene in fusion with the signals to locate the resulting protein to the endoplasmic reticulum was isolated from erAEQ/pcDNAI by EcoRI digestion and cloned into pBlue2SK. The erAEQ was then isolated as an EcoRI/Acc65I fragment by partial digestion and cloned in the vector pGK13 digested with the same enzymes.
[0054] Suitable promoters include the pharynx-specific promoter myo-2, the C. elegansSERCA promoter which directs expression in a wide range of muscle tissues and the body wall muscle-specific promoter myo-3. The vectors can then be used to construct transgenic C. elegansaccording to the standard protocols known to those of ordinary skill in the art. Expression of erAEQ allows for the determination of the calcium levels in the endoplasmic reticulum of various C. eleganscells and tissues, using the protocols of the manufacturer of erAEQ, or minor modifications thereof. Alterations in SERCA activity influence the concentration of calcium in the endoplasmic reticulum as SERCA functions as an endoplasmic reticulum calcium pump. Hence the apoaequorin luminescence measured in the assay is directly related to SERCA activity.
[0055] The basic ‘up-regulation assay’ methodology can also be adapted to perform a genetic screen in order to identify C. eleganswhich carry a mutation having the effect of enhancing or up-regulating the activity of SERCA. Accordingly, the invention also provides a method of identifying C. eleganswhich carry a mutation having the effect of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises:
[0056] subjecting a population of C. eleganswith wild-type SERCA activity to random mutagenesis;
[0057] allowing the mutagenized C. elegansto grow for one or two generations;
[0058] treating the mutagenized C. elegansto reduce the activity of the SERCA ATPase in one or more cell types or tissues; and
[0059] scoring a phenotypic, biochemical or behavioural characteristic of the C. elegansas an indicator of SERCA ATPase activity in the C. elegansin the said one or more cell types or tissues.
[0060] This genetic screen differs from the ‘up-regulation’ assay used to identify compounds in that the C. elegansare subjected to a random mutagenesis step before they are treated to reduce the activity of the SERCA ATPase. The random mutagenesis step can be performed using any of the techniques known in the art. EMS and UV-TMP mutagenesis, both of which are well known in the art (see Methods in Cell biology Vol. 48, 1995, ed. by Epstein and Shakes, Academic press) are preferred. After mutagenesis the worms are grown for one or two generations before they are treated to reduce the activity of SERCA. After one generation, the worms are heterozygous for any mutation, after two generations they may be homozygous or heterozygous for any mutation. Therefore growth for one generation leads to isolation of dominantly acting suppressors, growth for two generations yields both recessively and dominantly acting suppressors.
[0061] The step of treating the C. elegansto reduce the activity of the SERCA ATPase preferably comprises either treating the worms with a chemical inhibitor of SERCA, for example thapsigargin, or specifically down-regulating the expression of SERCA using antisense or double-stranded RNA inhibition.
[0062] When thapsigargin is added to worms in plate or liquid culture few progeny are produced and these don't grow as well as wild-type worms. To perform a genetic screen based on thapsigargin inhibition wild-type worms are first subjected to standard mutagenesis protocols (using EMS or UV/TMP or any other mutagen). F1 or F2 progeny of the mutagenized worms are distributed individually to standard growth medium with bacteria, to which 10 to 50 mM thapsigargin is added. After 4-8 days the cultures are inspected for growth of progeny, either by eye or using the ‘turbidity assay’, as described above. Wild-type C. eleganswith an integrated transgenic array causing general expression of a reporter protein such as GFP can also be used. In this case, cultures are inspected for growth of progeny either by eye or by detecting expression of the reporter protein.
[0063] Thapsigargin causes a short term pharynx pumping defect. Hence, the genetic screen can also be performed by measuring changes in the pharynx pumping efficiency. Wild-type worms are mutagenized and grown on solid media according to standard techniques known in the art. Adults are washed off the plates and put in buffer with calcein-AM and thapsigargin (an assay buffer of 40 mM NaCl, 6 mM KCI, 1 mM CaCl2, 1 mM MgCl2can be used for this purpose). After two hours the worms are viewed under a fluorescence microscope and individual worms that show far brighter gut fluorescence than the other worms are selected, placed individually onto fresh plates and grown for an additional generation. Calcein-AM uptake in the presence of thapsigargin is then re-checked.
[0064] Inhibition of SERCA by antisense or double stranded-RNA inhibition will result in the same phenotypes as described above for the up-regulation assay and hence the same screens can be used to select for mutants that enhance or up-regulate SERCA activity. The precise nature of the screen used depends on the tissue in which the antisense or double stranded SERCA RNA is expressed.
[0065] An analogous genetic screen can also be performed using a reduction-of-function mutant C. elegansstrain which exhibits reduced C. elegansactivity in one or more cell types or tissues. Accordingly, in a further aspect the invention provides a method of identifying C. eleganswhich carry a mutation having the effect of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises the steps of:
[0066] subjecting a population of mutant C. eleganswhich exhibit reduced SERCA activity in one or more cell types or tissues to random mutagenesis;
[0067] allowing the mutagenized C. elegansto grow for one or two generations; and
[0068] scoring a phenotypic, biochemical or behavioural characteristic of the C. elegansas an indicator of SERCA ATPase activity in the C. elegansin the said one or more cell types or tissues.
[0069] A suitable reduction-of-function mutant strain can be isolated as described above.
[0070] The basis of the above-described genetic screens is to screen for mutations that have the effect of enhancing or up-regulating SERCA activity and thus suppress the inhibitory effect of thapsigargin treatment, antisense or double stranded RNA inhibition of SERCA expression or a reduction-of-function mutation. Mutations likely to be identified using the method of the invention include mutations in genes involved in transcription and/or translation of SERCA, mutations that influence Ca2+ cycling between the ER and cytoplasm, mutations that influence Ca2+ buffering and mutations that influence the activity of Ca2+ binding proteins. Once a mutant worm has been identified using a genetic screen it is a matter of routine to identify the mutated gene using techniques commonly used in the art.
[0071] In summary, the up-regulation assay which may be used to identify compounds which enhance the activity and/or expression of SERCA is based on the use of C. elegansworms in which the activity or expression of the C. elegansSERCA protein is reduced. This may be achieved in at least three different ways. First, mutants can be selected that show reduced SERCA activity. Second, wild-type, mutant, or transgenic C. elegansstrains can be treated with compounds that inhibit SERCA activity, such as thapsigargin. Third, RNAi technology can be applied to wild-type, mutant or transgenic C. elegansto reduce the SERCA activity. In each case, screening can be performed to select for compounds that enhance SERCA activity. Such screens may be based on the pharynx pumping rate, egg laying or movement. In a particular example of the up-regulation assay, wild-type, mutant or transgenic strains can be made transgenic for apoaequorin or another calcium marker. These markers may be expressed in the various tissues, such as the pharynx, the body wall muscles, the oviduct, vulva-muscles etc, for which specific promoters are known in the art. Apoaequorin may also be expressed more generally in C. elegans,for instance under the control of the SERCA promoter. The apoaequorin may further be fused to a specific signal peptide translocating the apoaequorin to the endoplasmic reticulum. Selecting compounds that enhance the activity or the expression of SERCA will enhance calcium uptake, and hence increase the bio-luminescence of the apoaequorin located in the lumen of the endoplasmic or sarcoplasmic reticulum.
[0072] In a second aspect the invention provides a method of identifying compounds which modulate the interaction between a sarco/endoplasmic reticulum calcium ATPase and phospholamban, which method comprises:
[0073] exposing transgenic C. eleganswhich contains a first transgene comprising nucleic acid encoding a vertebrate PLB protein and which expresses a SERCA protein to a compound under test; and
[0074] detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegansindicating an increase in the activity of the SERCA protein.
[0075] The vertebrate phospholamban (PLB) protein used in this second method of the invention, hereinafter referred to as the ‘interaction assay’ can be any vertebrate PLB protein. Most preferred are pig PLB (GenBank P07473) or human PLB (GenBank P26678) or a humanized pig PLB (see below). Mutant PLB proteins which exhibit stronger or weaker inhibition of SERCA relative to the wild-type protein may also be used.
[0076] The SERCA protein expressed by the C. elegansmay be a C. elegansSERCA protein, a vertebrate SERCA protein, a fusion between a vertebrate SERCA protein and C. elegansSERCA protein or a mutant SERCA protein, for example a mutant which exhibits greater sensitivity to PLB.
[0077] The vertebrate SERCA protein can be any vertebrate SERCA isoform. Preferred isoforms are pig SERCA2a (GenBank P11606), human SERCA1a (GenBank AAB 53113), human SERCA1b (GenBank AAB 53112), human SERCA2a (GenBank P16614) and human SERCA2b (GenBank P16615). Human and pig SERCA2a are most preferred.
[0078] Various types of fusion proteins between C. elegansSERCA and vertebrate SERCA proteins which may be used in the method of the invention are described in the accompanying Examples. For example, the fusion might comprise the N-terminal part of C. elegansSERCA and the C-terminal part of a vertebrate SERCA.
[0079] It is essential that a ‘functional’ combination of SERCA and PLB is chosen i.e. that the SERCA protein and the PLB protein are able to interact with each other such that the activity of SERCA can be inhibited by the PLB, mimicking the regulatory interaction occurring in vertebrates.
[0080] In the context of this application the term “transgene” refers to a DNA construct comprising a promoter operatively linked to a protein-encoding DNA fragment. The construct may contain additional DNA sequences in addition to those specified above. The transgene may, for example, form part of a plasmid vector. By the term “operatively linked” it is to be understood that the promoter is positioned to drive transcription of the protein-encoding DNA fragment.
[0081] Methods of preparing transgenic C. elegans,including worms carrying multiple transgenes, are well known in the art and are particularly described by Craig Mello and Andrew Fire, Methods in Cell Biology, Vol 48, Ed. H. F. Epsein and D. C. Shakes, Academic Press, pages 452-480. A typical approach involves the construction of a plasmid-based expression vector in which a protein-encoding DNA of interest is cloned downstream of a promoter having the appropriate tissue or cell-type specificity. The plasmid vector is then introduced into C. elegansof the appropriate genetic background, for example using microinjection. In order to facilitate the selection of transgenic C. elegansa second plasmid carrying a selectable marker may be co-injected with the experimental plasmid.
[0082] The plasmid vector is maintained in cells of the transgenic C. elegansin the form of an extrachromosomal array. Although plasmid vectors are relatively stable as extrachromosomal arrays they can alternatively be stably integrated into the C. elegansgenome using standard technology, for example, using gamma ray-induced integration of extrachromosomal arrays (methods in Cell Biology, Vol 48 page 425-480).
[0083] The DNA fragment encoding the SERCA protein or the PLB protein may be a fragment of genomic DNA or cDNA. Preferably the DNA encoding the vertebrate SERCA protein is operatively linked to the promoter region of a SERCA gene. Most preferably the promoter region of the C. elegansSERCA gene is used. The term ‘promoter region’ as used herein refers to a fragment of the upstream region of a given gene which is capable of directing a pattern of gene expression substantially identical to the natural pattern of expression of the given gene.
[0084] Provided that a functional combination is chosen, wherever the SERCA protein and the vertebrate PLB are co-expressed the two proteins will interact such that PLB inhibits the activity of SERCA. The aim of the interaction assay is to identify compounds which directly or indirectly disrupt the SERCA/PLB interaction, leading to an increase in SERCA activity. The increase in SERCA activity is monitored indirectly, by detecting phenotypic, biochemical or behavioural changes in the C. eleganswhich are indicative of an increase in SERCA activity. Advantageously, the nucleic acid encoding PLB is operatively linked to a tissue-specific promoter. With the use of a promoter of appropriate specificity, the vertebrate PLB can be expressed in all the cells of C. elegans,in a given type of tissue (i.e. all muscles), in a single organ or tissue (for example, the pharynx or the vulva), in a subset of cell types, in a single cell type or even in a single cell.
[0085] By restricting the expression of PLB to certain tissues it is possible to specifically down-regulate SERCA activity in these tissues and thus to influence the phenotype of the resultant transgenic worms. For example, when PLB is expressed in the pharynx, the resultant inhibition of SERCA activity in the pharynx results in a reduction in the rate of pharynx pumping. When PLB is expressed in the vulva muscles, the resultant inhibition of SERCA activity in the vulva results in an egg laying defect.
[0086] Although the interaction assay may be performed using functional combinations of C. elegansSERCA (especially mutant versions thereof, as discussed below) and vertebrate PLB, it is preferred to use functional combinations of vertebrate SERCA and vertebrate PLB. In order to ensure that the interaction assay can be used to identify compounds which specifically modulate the vertebrate SERCA/vertebrate PLB interaction it is preferred to use a transgenic strain which has been modified such that expression of the endogenous C. elegansSERCA protein is abolished or substantially reduced down to background levels. This may be achieved by introducing the transgenes encoding the vertebrate SERCA and PLB into a mutant strain having a knock-out or loss-of-function mutation in the chromosomal C. elegansSERCA gene (e.g. strain ok190 described in the accompanying Examples). A protocol for isolating a suitable knock-out mutant strain is given in the examples included herein. In a variation of this approach, expression of the endogenous C. elegansSERCA gene may be abolished/reduced using RNAi technology, as described hereinbefore. In this case, the genetic background of the transgenic C. elegansmay be wild-type.
[0087] In a further embodiment, a vertebrate-specific interaction assay may be achieved by using transgenic C. elegansexpressing a mutant version of the vertebrate SERCA protein which is resistant to a chemical inhibitor of SERCA activity, such as thapsigargin. The mutation Phe259Val renders C. elegansSERCA resistant to inhibition with thapsigargin. Equivalent mutations may be introduced into transgenes encoding the vertebrate SERCA proteins using standard site-directed mutagenesis. Applying the SERCA inhibitor, e.g. thapsigargin, to transgenic C. eleganswhich express a resistant mutant vertebrate SERCA and a vertebrate PLB will result in inhibition of the endogenous C. elegansSERCA only. Thus, if the inhibitor is added to the interaction assay in addition to the test compound, the screen will be specific for the interaction between the vertebrate SERCA and the vertebrate PLB.
[0088] A particular variant of the interaction assay uses a mutant version of the C. elegansSERCA protein which is more sensitive to vertebrate PLB proteins, such as, for example, a C. elegansSERCA containing the KDDKPV (SEQ ID NO:39) insertion. As illustrated in the accompanying Example 9, introduction of the amino acid sequence KDDKPV (SEQ ID NO:39) into the C. elegansSERCA protein results in a more efficient interaction between the mutant SERCA and vertebrate PLB. Therefore, double transgenic C. elegansstrains containing a first transgene encoding a vertebrate PLB protein and a second transgene encoding a C. elegansSERCA KDDKPV (SEQ ID NO:39) insertion mutant may be used in the interaction assay.
[0089] In order to provide specificity for the mutant SERCA/PLB interaction, it is preferred that the double transgenic is also modified such that expression of the endogenous C. elegansSERCA gene is abolished or substantially reduced. As described above, this may be achieved by using a mutant C. elegansgenetic background having a knock-out or loss-of-function mutation in the chromosomal SERCA gene or by using RNAi technology to inhibit SERCA expression. Alternatively, it is possible to engineer the mutant SERCA so that in addition to the KDDKPV (SEQ ID NO:39) insertion it also carries a firther mutation which renders it resistant to a SERCA inhibitor other than PLB, e.g. the thapsigargin resistance mutation Phe259Val. Addition of the SERCA inhibitor, e.g. thapsigargin, to the assay will result in specific inhibition of the endogenous C. elegansSERCA protein but not the resistant mutant.
[0090] As with the ‘up-regulation assay’ described above, the step of “detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegansindicating an increase in the activity of SERCA” can be performed in several different ways.
[0091] In one embodiment, particularly suitable for use when the transgenic C. elegansexpresses PLB in the pharynx, the method is performed by detecting changes in the pharynx pumping efficiency. The rate of pharynx pumping can be measured using a marker molecule precursor such as calcein-AM, as described above for the up-regulation assay.
[0092] In still further embodiments, particularly suitable for use when the transgenic C. elegansexpresses PLB in the vulva, the method can be performed by detecting changes in the egg laying behaviour of the C. elegansor by detecting changes in the number of progeny produced by the C. elegans.The number of progeny produced by the C. eleganscan, as described above in connection with the up-regulation assay, be directly counted or can be measured indirectly using a growth assay or a turbidity assay.
[0093] In a still further embodiment, again particularly suitable for use when the transgenic C. elegansexpresses PLB in the pharynx, SERCA activity in cells of the C. eleganspharynx can be monitored using apoaequorin luminescence. To achieve this the C. elegansare transfected with a third transgene which comprises nucleic acid encoding an apoaequorin protein, preferably ER-targeted apoaequorin, operatively linked to promoter capable of directing gene expression in the C. eleganspharynx. The construction of suitable expression vectors comprising such a transgene has been described hereinbefore.
[0094] In summary, the basic SERCA-PLB interaction screen to select for compounds that inhibit the interaction between SERCA and PLB is based on the construction of transgenic C. elegansexpressing PLB. The PLB may be of any vertebrate origin, such as human or pig. The PLB may be expressed ubiquitously or in specific tissues, such as the pharynx, the body wall muscles, the oviduct, vulva muscles etc, for which specific promoters are known in the art. Preferred configurations of the interaction assay are summarised below, however, this is not intended to be limiting to the scope of the invention:
[0095] Double transgenic C. elegans,first transgene encoding a vertebrate PLB, second transgene encoding a vertebrate SERCA; expression of endogenous C. elegansSERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild-type genetic background,
[0096] Double transgenic C. elegans,first transgene encoding a vertebrate PLB, second transgene encoding a fusion between C. elegansSERCA and a vertebrate SERCA; expression of endogenous C. elegansSERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild-type genetic background,
[0097] Double transgenic C. elegans,first transgene encoding a vertebrate PLB, second transgene encoding a mutant vertebrate SERCA which is resistant to a SERCA inhibitor other than PLB, e.g. thapsigargin; wild-type genetic background; inhibitor is added to the assay in addition to the compound under test to specifically inhibit endogenous C. elegansSERCA expression,
[0098] Double transgenic C. elegans,first transgene encoding a vertebrate PLB, second transgene encoding a mutant C. elegansSERCA which is more sensitive to inhibition by ivertebrate PLB (e.g. KDDKPV (SEQ ID NO:39) insertion); expression of endogenous C. elegansSERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild-type genetic background,
[0099] Double transgenic C. elegans,first transgene encoding a vertebrate PLB, second transgene encoding a double mutant C. elegansSERCA which is (i) more sensitive to inhibition by vertebrate PLB (e.g. KDDKPV (SEQ ID NO:39) insertion) and (ii) resistant to inhibition by a SERCA inhibitor such as thapsigargin (e.g. Phe259Val); wild-type genetic background; inhibitor is added to the assay in addition to the compound under test to specifically inhibit endogenous C. elegansSERCA expression.
[0100] In a third aspect the invention provides a method of identifying compounds capable of down-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises:
[0101] exposing transgenic C. eleganscontaining a transgene comprising nucleic acid encoding a SERCA protein operatively linked to a promoter capable of directing gene expression to a sample of the compound under test; and
[0102] detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegansindicating a decrease in the activity of the SERCA protein.
[0103] The SERCA protein used in this third aspect of the invention, hereinafter referred to as the ‘down-regulation assay’ can be any SERCA isoform from any species. Preferably the SERCA protein is C. elegansSERCA, pig SERCA2a, or a human SERCA isoform, most preferably human SERCA 2A.
[0104] Preferably the nucleic acid encoding the SERCA protein is operatively linked to a tissue-specific promoter. Most preferably, the tissue-specific promoter is the C. elegansmyo-2 promoter which directs tissue-specific expression in the pharynx.
[0105] In a preferred embodiment the transgenic C. elegansfurther contain a second transgene comprising nucleic acid encoding a reporter protein operatively linked to a promoter which is capable of directing gene expression in one or more cell types or tissues of C. elegans.The reporter protein is preferably an autonomous fluorescent protein, for example, a green fluorescent protein or a blue fluorescent protein or a luminescent protein.
[0106] Transgenic C. elegansover-expressing SERCA are generally observed to be starved and show delayed growth. Compounds which reduce or down-regulate the activity of SERCA will cause a reversion or reduction of this phenotype towards a wild-type phenotype. Accordingly, these worms can be used as a basis of a screen to identify compounds capable of reducing or down-regulating the activity of SERCA, by bringing the worms into contact with the compound under test and then detecting a reversion of the over-expression phenotype reflecting a decrease in the activity of the SERCA transgene.
[0107] The step of “detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegansindicating a decrease in the activity if the SERCA protein” can be performed in several different ways. As mentioned above, transgenic C. eleganswhich overexpress the SERCA protein exhibit delayed growth. Accordingly, it is possible to look for a reversion of the overexpression phenotype by comparing the growth rate of the transgenic C. elegansin the presence and the absence of the compound under test. Compounds which increase the growth rate of the C. elegansculture are scored as compounds which are capable of reducing or down-regulating SERCA activity. Any of the growth assay methods described in connection with the ‘up-regulation’ assay could be used for this purpose.
[0108] Transgenic C. eleganswhich overexpress SERCA also exhibit altered egg laying behaviour and reduced pharynx pumping. Hence, the down-regulation assay can also be performed by detecting changes in the egg laying behaviour or the pharynx pumping efficiency, as described previously.
[0109] In summary, the basic down-regulation assay consists of introducing extra SERCA into C. elegansand screening for a compound that inhibits SERCA activity. The SERCA introduced into C. elegansmay be C. elegansSERCA or a SERCA of any vertebrate origin, such as human or pig. The SERCA protein may be expressed ubiquitously or in specific tissues such as the pharynx, the body wall muscles, the oviduct, the vulva muscles etc, for which appropriate tissue or cell type-specific promoters are known in the art.
[0110] The above-described methodology for the down-regulation assay can be adapted to perform a genetic screen to identify C. eleganscarrying a mutation having the effect of reducing or down-regulating SERCA activity. Thus, in a further aspect the invention provides a method of identifying C. eleganswhich carry a mutation having the effect of reducing or down-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises the steps of:
[0111] providing a transgenic C. elegansstrain containing a first transgene comprising nucleic acid encoding a SERCA protein operatively linked to a promoter capable of directing gene expression in one or more cell types or tissues of C. elegans;
[0112] subjecting a population of the said C. elegansstrain to random mutagenesis;
[0113] allowing the mutagenized C. elegansto grow for one or more generations; and
[0114] scoring a phenotypic, biochemical or behavioural characteristic of the C. elegansas an indicator of SERCA ATPase activity in the C. elegansin the said one or more cell types or tissues.
[0115] The genetic screen is preferably carried out using transgenic C. eleganscontaining an integrated transgene harboring 20-50 ng/μl pGK7 (containing the C. elegansgenomic SERCA gene, including the promoter region, see examples given below) and a general GFP expressing construct. These worms are starved and show general growth delay. The same results are obtained using a vertebrate SERCA, such as the human or pig SERCA.
[0116] Alternatively, the screen can be performed using transgenic nematodes containing an integrated transgene harboring the genomic C. elegansSERCA gene operatively linked to the myo-2 promoter, and a general GFP expressing construct. These worms are also starved and show growth delay.
[0117] The worms are grown and subjected to random mutagenesis according to standard techniques known in the art. The mutagenized worms then are distributed individually to standard growth medium with supplemented with food source bacteria. After 4-8 days the cultures are inspected for growth of progeny, either by eye, by using any of the growth assay techniques mentioned previously in connection with the up-regulation assay, using the turbidity assay or by counting the numbers of progeny produced.
[0118] The basis of these genetic screens is that mutations having the effect of reducing or down-regulating SERCA activity will suppress the effect of SERCA over-expression. Mutations identified using this screen may include mutations in genes involved in transcription and/or translation of SERCA, mutations that influence Ca2+ cycling between the ER and the cytoplasm, mutations that influence Ca2+ buffering and mutations that influence the activity of Ca2+ binding proteins.
[0119] In the field of human pharmaceuticals, compounds identified as modulators of SERCA activity using the screening methods of the invention may be useful leads in the development of pharmaceuticals for the treatment of the wide range of diseases with which the SERCA genes have been associated, such as cardiac hypertrophy, heart failure, hypertension, NIDDM, Darier-White disease, Brody's disease.
[0120] Outside the pharmaceutical field, compounds identified as modulators of SERCA activity may find important applications as pesticides, particularly insecticides, herbicides or nematocides. Maintaining high calcium concentrations in the ER is important for the proper synthesis of protein, including translation, folding, glycosylation, processing and transport. Treatment of living organisms with chemicals that inhibit the activity of SERCA will hence have a negative effect on the welfare of these organisms. As such, SERCA inhibitors are potential pesticides or can be considered as basic compounds for the development of pesticides such as herbicides, insecticides and nematocides. It has been shown that SERCA function is essential in the intracellular trafficking of the Notch receptor in drosophila (Periz et al., 1999 EMBO J; 5983-5993). This studies and others indicate that SERCA is an interesting target for pesticidal intervention. Accordingly, the screening methods described herein could be applied to screen for pesticides.
[0121] The invention will be further understood with reference to the following experimental Examples together with the accompanying Figures in which:
[0122] FIG. 1 shows a dose-response curve for thapsigargin produced using a liquid culture assay.
[0123] FIG. 2 shows a dose-response curve for thapsigargin produced using a plate assay.
[0124] FIG. 3 illustrates the growth of C. elegansstrain UG530 (strain harboring plasmid pGK28) on different concentrations of thapsigargin. The stage of the progeny was determined 5 days after adults were put on the plates. Since the mothers carry the pGK28 containing plasmid on an extrachromosomal transgene, part of the progeny inherited it and part of the progeny did not. These were differentiated based on a GFP marker also present on this transgene.
[0125] FIG. 4 illustrates the nucleotide sequence of the genomic fragment of C. elegansSERCA bounded by primers SERCA P4 and SERCA P8. Exon IV and exon V are shown in capitals, intron IV in lower case. The fragment deleted in ok190 is underlined.
[0126] All Molecular biology work was performed as described by Sambrook et al. Molecular cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, or using minor modifications of the methods described therein.
[0127] All manipulations of C. elegansworms were performed using techniques described in Methods in Cell Biology, vol 84; Caenorhabditis elegans: modern biological analysis of an organism, ed. Epstein and Shakes, academic press, 1995, or using minor modifications of the methods described therein.
[0128] Transgenic C. elegansstrains were constructed by injection of plasmid DNA into worms using standard techniques known in the art (see Methods in Cell Biology, vol 84 as mentioned above).
Example 1
[0129] Inhibition of Expression of C. elegansSERCA Using RNAi
[0130] 732 bp EcoRI-HindIII fragment from C. elegansSERCA exon 5 (SEQ ID NO: 1) was PCR amplified and cloned into the vector pGEM3 (PROMEGA corporation, Madison, Wis., USA). RNA was in vitro transcribed from both strands using standard procedures. The generated double stranded RNA was injected into C. elegans(see Fire at al., 1998, Nature 391:806-811). This resulted in the following phenotypes: 50% of the progeny of the injected animals were embryonic lethal, while the other 50% were early larval lethal. This indicates that SERCA function is vital for C. elegans.In conclusion, inhibition of the expression of SERCA in all tissues results in embryonic or early larval lethality of the nematode.
[0131] Inhibition of SERCA Using RNAi Feeding Technology
[0132] Although injection of SERCA dsRNA results in a clear phenotype, useful in the development of assays to select for compounds that alter the SERCA activity, or that alter the activity of partners in the SERCA pathway, or that alter the activity proteins involved in calcium metabolism, a more stable RNAi phenotype would be more efficient. Improved RNAi methods which lead to more stable RNAi phenotypes exist and are described, for example in International patent application No. WO 00/01846. More particularly, an RNAi technology has been developed and tested in which dsRNA can be delivered by feeding the nematode dsRNA or by feeding nematodes with DNA.
[0133] pGN4 was constructed by cloning the HindIII-EcoRI fragment of SERCA cloned in vector pGN1 using these same restriction sites. This is the same fragment as was used for in vitro transcription and dsRNA injection, described above.
[0134] HT115(DE3) bacteria (Fire A, Carnegie Institution, Baltimore, Md.) were transfected with pGN4 (and controls with pGN1) and seeded on plates containing IPTG and ampicillin resulting in a high expression of dsRNA by the bacteria. N2 and nuc-1 (e1392) adult nematodes were put on these plates and allowed to lay eggs and the progeny was followed over time. The progeny mostly looked healthy during the larval stages, but the adults (and some of the L4) had a starved appearance (nuc-1 more pronounced then N2). Pumping was irregular and slower then normal, and the growth rate was somewhat reduced. This example indicates that a stable RNAi phenotype useful in assay development and compound screening can be developed using feeding. As described in co-pending application No. WO 00/01846, other possibilities and variants can be used to create a C. elegansSERCA RNAi phenotype. The use of RNAi technology allows the development of screens for compounds that alter SERCA activity or that alter the SERCA pathway, without the construction of a C. elegansSERCA mutant.
[0135] E. coliHT115 has the following characteristics which make it a useful host cell for high level expression of dsRNA: HT115 (DE3): F-mcrA mcrb IN(rrD-rrnE) 1—rnc14::tr10 (DE3 lysogen: lacUV5 promoter-T7 polymerase); host for IPTG inducible T7 polymerase expression; RnaseIII-. Other host strains suitable for expression of dsRNA could be used with equivalent effect.
Example 2
[0136] Overexpression of C. elegansSERCA
[0137] A 11207 bp SpeI-MluI fragment from the cosmid K11D9 (SEQ ID NO:2) was cloned into the vector pUC18 (Messing, J., 1998, Methods in Enzymol. 101: 20), resulting in the plasmid pGK7. This genomic fragment contains the complete SERCA gene with 5631 bp upstream sequences, the complete coding region and 1088 bp downstream sequences. Transfection of C. eleganswith this vector using standard technology resulted in various results. Transfection with high concentrations of DNA (80-200 ng/μl) induced embryonic lethality. At lower concentrations of DNA (20-50 ng/μl) worms were generally sick; also they were constipated, showed a starved appearance, and had pharynx pumping defects. These experiments indicate the importance of fine-tuning the expression level of SERCA in the nematode C. elegans.High levels of overexpression of SERCA is lethal, as is inhibition of expression. Furthermore, intermediate levels of overexpression of SERCA results in defects all over the worm, affecting almost all vital functions.
Example 3
[0138] Expression Pattern of SERCA in C. elegans
[0139] A 5026 bp fragment of the upstream region of the C. elegansSERCA gene, starting 5026 bp upstream of the translation initiation codon and continuing up to and including the A of the ATG initiation codon (SEQ ID NO:3), was cloned into the vector pPD95.79 (described in Fire et al. (1990) Gene, 93: 189-198)in fusion with a GFP fluorescent protein, resulting in vector pGK10. The cloned fragment can be considered as the promoter region of the C. elegansSERCA. The vector was injected into C. elegans,using standard methodology well known to persons skilled in the art, and the expression of the GFP was monitored applying standard fluorescent techniques. GFP expression was observed all over the early embryo of the worm, although expression was faint in some tissues. In a later stage of development, from mid-embryo stage, through larval stage to adult stage, strong GFP expression could be observed in all muscle tissue, including the pharyngeal muscles, the body wall muscles, the anal depressor and the anal sphincter. In adults staining was seen in the vulva muscles, the uterine muscles, the spermatecae and the proximal myoepithelial sheath cells of the gonad.
[0140] A construct containing a smaller promoter fragment, including A of the initiating ATG codon and extending 2915 bp upstream (SEQ ID NO:4), fused to a GFP gene was generated by a PstI deletion of the plasmid pGK10. This plasmid was designated pGK13. Transfection of the nematode with pGK13 resulted in the same pattern of GFP expression as was observed with pGK10.
[0141] Finally, a third construct was made containing a 6612 bp fragment of the C. elegansSERCA gene in the plasmid pPD95.75 (described in Fire et al. (1990) Gene, 93: 189-198). The resultant plasmid was designated pGK12. This 6612 bp fragment contains 5637 bp of upstream sequences an ends in exon 4 of the C. elegansSERCA gene (SEQ ID NO:5). The fragment was cloned as a SalI-BglII fragment isolated from pGK7, and cloned in fusion to GFP. This fragment contains two transmembrane domains of SERCA. Transfection of C. eleganswith this construct resulted in the same pattern of GFP expression as was observed with pGK10 and pGK13, i.e. GFP expression could be localized to the muscle tissues of C. elegans.Detailed analysis of the expression pattern in the muscles showed clearly that the GFP protein was localized to the endoplasmic reticulum and the dense bodies.
[0142] These expression studies clearly demonstrate that the SERCA protein of C. elegansis expressed in all muscle tissue, and that it is localized in the endoplasmic reticulum, indicating that the C. elegansSERCA probably has analogous function to the vertebrate SERCAs.
[0143] In addition to pGK10, pGK12 and pGK13, several further constructs have been used to analyse the pattern of SERCA expression in C. elegans.These are summarised as follows:
[0144] pGK26 contains GFP inserted directly after the CDS of C. elegansSERCA isoform A using overlap PCR, also containing the SERCA downstream region.
[0145] pGK27 contains GFP inserted directly after the CDS of the C. elegansSERCA isoform B using overlap PCR, also containing the SERCA downstream region.
[0146] pGK26 was constructed by the following strategy: Three separate PCR reactions were done to yield three PCR fragments that are joined in consequent overlap PCR. The first fragment is made with the oligonucleotides oGK25 and oGK26 and contains the region upstream of where GFP is inserted. The primer oGK26 is an overlap primer and contains the last 21 nt of SERCA until but not including the stop codon followed by the first 15 nt of GFP. The second fragment contains the complete ORF of GFP including the stop codon. The third fragment is made with oGK27 and oGK28 and contains the region downstream of where GFP is inserted. The primer oGK27 is an overlap primer and contains the last 15 nt of GFP including the stop codon and the first 22 nt of the 3′ UTR. The end result after overlap PCR is a “recombination” of these three fragments in which GFP is inserted exactly after and in-frame with the SERCA coding region such that the fragment encodes a SERCA::GFP fusion protein. This PCR fragment is cloned into pGK7 to replace the normal C-terminus of the gene using unique restriction sites in the SERCA coding region and 3′ UTR (ApaI in the first fragment and PacI in the third fragment).
[0147] pGK27 was constructed the same way, using primers oGK21 and oGK22 instead of oGK25 and oGK26, and primers oGK23 and oGK24 instead of primers oGK27 and oGK28.
[0148] Sequence of Primers
[0149] oGK21: TGGACTCATCTCTGGATGGCTC (SEQ ID NO:17)
[0150] oGK22: CTTCTCCTTTACTCATCAATTCGTTATGTAACTTGTCGG (SEQ ID NO:18)
[0151] oGK23: GAACTATACAAATAGTTGAAGTTCTTCTAACCCCC (SEQ ID NO:19)
[0152] oGK24: GCGTTTATCCTTGATTGGAGCTTC (SEQ ID NO:20)
[0153] oGK25: GAATGGATCGCCGTGTTGAAG (SEQ ID NO:21)
[0154] oGK26: TTCTCCTTTACTCATGTCGCGTTTATCCTTGATTGG (SEQ ID NO:22)
[0155] oGK27: GAACTATACAAATAGAAATGACAGTGCTCCCTCAATC (SEQ ID NO:23)
[0156] oGK28: GTGGGATCCTGGTTTGTTCTGAG (SEQ ID NO:24)
[0157] When the various constructs were injected into wild-type C. elegansthe following expression patterns were observed:
[0158] Expression was observed in all muscle types, such as the body wall muscle, the pharynx, the vulva muscle, the uterine muscles etc, but expression was also observed in the anal depressor, the gut, the gonad sheath cells etc. (see Table 1). This is not unexpected, due to the importance of SERCA in the calcium metabolism of C. elegans,as has also been observed in other organisms. Moreover the various constructs give different expression patterns, indicating complex regulation of SERCA expression as suggested.
[0159] The expression patterns of the constructs, and hence of the endogenous SERCA, indicate that various assays can be developed. These include assays based on body wall muscle function and hence on movement, assays on pharyngeal function and hence on the pumping rate, assays on vulva muscle function and hence on egg laying, assays on anal repressor finction and hence on defecation, assays on the gonad sheath cell, uterine muscle and uterine sheath cell function and hence on egg laying.
| TABLE 1 |
|---|
| expression patterns for SERCA constructs in wild-type |
Example 4
[0160] Expression of Mammalian SERCA in C. elegans
[0161] Further constructs were made in which the pig SERCA2a cDNA was cloned under the regulation of the C. elegansSERCA promoter. Suitable constructs can easily be made by replacing the GFP sequences in pGK10 or pGK13 with the coding region of the pig SERCA2a cDNA. The sequence of the pig SERCA2a cDNA is shown in SEQ ID NO:7. C. eleganswere transfected with plasmid pGK101, harboring the pig SERCA2a cDNA under the control of the worm SERCA promoter derived from pGK 10 by injection of the plasmid at a concentration of 100 ng/μl, resulting in the overexpression of the pig SERCA2a in all C. elegansmuscles. The overexpression of this vertebrate SERCA protein results in embryonic lethality, L1 arrest and growth delay, effects which are quite analogous to the overexpression of C. elegansSERCA.
[0162] The pig SERCA2a was also expressed in C. elegansunder the control of the myo-2 promoter (pGK201), which is specific for induction of expression in the pharyngeal muscles. Overexpression of SERCA2a in the pharyngeal muscles resulted in apparently normal healthy lines, although a slight growth delay was observed. In a pharynx pumping assay, with the fluorescent dye precursor calcein-AM, it was shown that the nematode pumps with a slightly lower efficiency than a wild-type strain.
[0163] Expression in C. elegansof the pig SERCA2a under the regulation of the myo-3 promoter, which directs gene expression in the body wall muscles, resulted in apparently normal, healthy lines, with no apparent movement defects.
Example 5
[0164] Expression of Mammalian Phospholamban (PLB) in C. elegans
[0165] Human, humanized and pig PLB fused and not fused to GFP were expressed under the myo-2 promoter in the pharyngeal muscles. The transfected nematodes appeared sick, showed a reduced growth and a clearly reduced pharynx pumping phenotype. Further generations of offspring seem to be healthier and perform in a pharynx pumping assay as wild-type worms.
[0166] Expression of the PLB-GFP fusion protein in the body wall muscles, was done under the regulation of the myo-3 promoter. Expression of the fusion protein could clearly be localized to the endoplasmic reticulum and the dense bodies, but no clear phenotype could be observed.
Example 6
[0167] Construction of a Mutated SERCA C. elegans
[0168] Strategy 1
[0169] The following strategy may be used to isolate a nematode that is mutated in the SERCA gene, using standard selection procedures well known in the art. A population of nematodes are mutagenized, preferentially using UV-TMP, and grown for two generations. The mutagenized worms are distributed per 500 over approximately 1152 plates and grown for an additional two generations. DNA is isolated from a fraction of the worms from each of these plates and used as a template for PCR selection to select for a SERCA gene that has a deletion. From a plate with worms, of which some have been demonstrated to contain a SERCA deletion, new plates are started with fewer worms. Further rounds of PCR selection finally result in the isolation of a heterozygote C. eleganscarrying a mutation in the SERCA gene (see Jansen et al., 1997, Nature Genetics 17:119-121). As the above-mentioned experiments have shown that the expression level of SERCA is important for the survival of the nematode it is possible that this strategy may result only in the isolation of partial knock-out mutations as heterozygote C. eleganscarrying a severe knock-out mutation in the SERCA gene may not viable. In this situation, strategy 1 based on extrachromosomal expression can be used to isolate severe knock-out mutations.
[0170] Strategy 2
[0171] Although primary RNAi experiments indicate that the level of expression the SERCA protein needs to be fine-tuned for the survival of the C. elegansnematode, strains in which the level of SERCA activity is reduced, in particular strains in which SERCA activity is reduced in a single tissue, are probably still viable. Due to the sensitivity of C. elegansto the level of SERCA activity this could result in a recognisable phenotype, such as reduced pharyngeal pumping, vulva muscle defects, and hence egg laying defects, anal repressor and anal sphincter defects, and hence defecation defects, and body wall muscle defects, and hence movement defects. Such strains can be used as the basis of screens to identify compounds capable of enhancing or up-regulating the activity of SERCA.
[0172] The expression levels of SERCA in C. eleganscan be specifically reduced by using antisense technology or double stranded RNA inhibition. The use of antisense technology to specifically reduce expression of a given protein is well known. For the expression of antisense RNA in the worm, the non-coding strand of a fragment of the SERCA gene can be expressed under the control of the SERCA, myo-2 or myo-3 promoter or any other promoter. The expression of the antisense SERCA RNA will result in the inhibition of expression of SERCA.
[0173] Antisense technology can be used to control gene expression through triple-helix formation of antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5′ coding portion or the mature protein sequence, which encodes for the SERCA protein, is used to design an antisense RNA oligonucleotide of from 10 to 50 base pairs in length. The antisense RNA oligonucleotide hybridises to the mRNA in vivo and blocks translation of an mRNA molecule into the protein (Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)). A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple-helix—see Lee et al. Nucl. Acids Res., 6:3073 (1979); Coney et al., Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991), thereby preventing transcription and the production of the protein.
[0174] In order to perform an antisense experiment in C. elegans,an EcoRI-Hind III fragment of SERCA exon 5 was cloned antisense under the control of the myo-2 promoter, the myo-3 promoter, the SERCA promoter or the ceh-24 enhancer and injected into C. elegans.These vectors result in the expression of an antisense SERCA RNA, and hence in inhibition of SERCA activity.
[0175] As an alternative to the antisense approach, the expression of a given gene in a cell can also be specifically reduced by introducing into the cell double stranded RNA corresponding to a region of the transcript transcribed from the gene. Double stranded RNA can be prepared by cloning an appropriate fragment into a plasmid vector containing opposable promoters. A suitable example is the pGEM7 series of vectors from Promega Corporation, Madison, Wis., USA, which contain opposable promoters separated by a multiple cloning site. When the plasmid vector is transformed or transfected into a host cell or organism which expresses the appropriate polymerases, RNA will be transcribed from each of the promoters. As the vector contains two promoters oriented in the opposite sense, complementary sense and antisense transcripts will be transcribed which will combine to form double stranded RNA. The injection of double stranded RNA in C. eleganshas previously been described (Fire et al, Potent and Specific Genetic Interference by Double-Stranded RNA in C. elegans1998, Nature 391 860-811).
Example 7
[0176] Analysis of a C. elegansMutant (Designated ok190)
[0177] A C. elegansstrain mutated in the SERCA gene was kindly provided by R. Barstead (Oklahoma, USA). Heterozygous animals show no defect, but their homozygous progeny die as L1. The lethal phenotype can be rescued by reintroduction of the C. elegansgene by injection of pGK7.
[0178] Using standard PCR protocols the genomic region of ok190 around the deleted area was cloned in the following way:
[0179] A nested PCR was performed on C. elegansgenodneic DNA using the following primer pairs:
[0180] Outer:
[0181] SERCA P2: CGAAGAGCACGAAGATCAGACAG (SEQ ID NO:25)
[0182] SERCA P8: GAGAGGCGGTTGGTTTGGG (SEQ ID NO:26)
[0183] Inner:
[0184] SERCA P4: CCGTTCGTCATCCTTCTCATTC (SEQ ID NO:27)
[0185] SERCA P7: CGACAGATGGACCGACGAGC (SEQ ID NO:28)
[0186] Analysis of the nested PCR product by agarose gel electrophoresis showed that the PCR product in the ok190 strain harbors a deletion of 1.7 kbp. (The wild-type PCR product from SERCA P4-SERCA P7 would be 3.4 kbp but the observed ok190 PCR product was only 1.7 kbp).
[0187] To enable detailed analysis of the deleted region the PCR product was cloned into the pCR-XL-TOPO vector (Invitrogen, The Netherlands). The resulting plasmid was designated pKO4. This cloned fragment was then sequenced reveal ing the exact coordinates of the deleted region. One of the breakpoints of the deletion occurred in the intron between exon IV and exon V, the other in exon V, deleting a total of 1702 bp of which 1690 bp represent coding sequence.
[0188] The nucleotide sequence of the genomic fragment of C. elegansSERCA bounded by primers SERCA P4 and SERCA P8 is shown in FIG. 4 and as SEQ ID NO: 16. Exon IV and exon V are shown in capitals, intron IV in lower case. The fragment deleted in ok190 is underlined.
Example 8
[0189] Construction of a Thapsigargin Resistant SERCA
[0190] A mutated C. elegansSERCA gene which encodes mutant protein resistant to thapsigargin inhibition has been constructed. The mutation is TTC GTC, which results in a Phe258Val substitution. This is analogous to the substitution Phe256Val in hamsters, which was shown to be 40-fold resistant to thapsigargin inhibition (Yu et al., 1999, Arch. Biochem. Biophys. 15:225-232).
[0191] The mutation was introduced in the gene with the QuickChange Site-Directed Mutagenesis Kit (Stratagene, California, USA). PCR was performed on pGK7, according to the instructions supplied by the manufacturer, with the following primers:
[0192] oGK33F256V (CAACAGAAGTTGGACGAAGTCGGAGAGCAACTTTC) (SEQ ID NO:29)
[0193] oGK34F256V (GAAAGTTGCTCTCCGACTTCGTCCAACTTCTGTTG) (SEQ ID NO:30)
[0194] The resulting mutation was screened by EcoRI digestion, as the mutation resulted in the disruption of the EcoRI restriction site. The new vector was sequenced, and the vector was transfected into C. elegans.The resulting vector was designated pGK28.
[0195] Test Sensitivity of Phe259Val SERCA Mutation
[0196] Several C. eleganstransgenic lines where constructed that carry the thapsigargin resistant SERCA mutant by standard injection of pGK28 into the gonad.
[0197] The effect of thapsigargin on worms carrying a pGK28 transgene was measured in the following way: 10 μl of thapsigargin dissolved in DMSO (5, 2.5, 1, 0.5, 0.25, 0.1, and 0.05 mM respectively) was added onto a drop of E. colistrain OP50cs2 in 12-well plates. The wells with compounds were placed at 10 C. overnight, after which 1 to 10 young adults were added to the wells. The pharynx pumping rate and movement behaviour was scored for the ten worms after 10 minutes and after one hour (short term effect). Furthermore the wells were scored for protruding vulva and rectum, production of progeny (few eggs in body) after one day (mid-term-effects), and for progeny after four days (long term effect)
[0198] Cold-sensitive E. colistrain OP50cs2 was deposited on Mar. 25, 1999 in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms in the Belgian Coordinated Collections of Microorganisms (BCCM)/Laboratorium voor Microbiologie-Bacterienverzameling (LMG) bacteria collection, Universiteit Gent, K. L. Ledeganckstraat 35, B-9000, Gent, Belgium under accession number LMG P-18934.
[0199] Conclusions
[0200] The results from this experiment confirmed that the Phe259Val pGK28 lines tested are more resistant to thapsigargin. The clearest indication for resistance was that a large fraction of the GFP-animals (the animals harboring pGK28) grew up to adult or L4 while most non-GFP (not harboring or expressing the mutated SERCA) arrested at L1 and L2 and never grew up further than L3 (see FIG. 3). Furthermore it was observed that nematodes harboring the Phe259Val SERCA mutant had slightly more progeny than wild-type and that the protruding vulva and rectum-phenotype was very often observed in the wild-type nematodes treated with thapsigargin, whereas these phenotypes were not or were only occasionally observed in strain UG530 (strain harboring plasmid pGK28), treated with thapsigargin.
Example 9
[0201] Construction of a C. elegansSERCA Mutant cDNA with a PLB Recognition Site
[0202] Phospholamban is known to interact with the KDDKPV (SEQ ID NO:39) site in mammalian SERCA1 and SERCA2 (Toyofuku et al., J. Biol Chem. 1994, 269:22929-22932). SERCA3 does not contain this sequence and does not bind phospholamban. SERCA3 does bind phospholamban when the KDDKPV sequence (SEQ ID NO:39) is introduced, while SERCA2 can no longer bind phospholamban when this sequence is mutated (Toyofuku et al., J. Biol Chem. 1994, 269:22929-22932). Phospholamban also interacts with transmembrane helix TM6, which is identical in all three mammalian SERCA genes (Asahi et al., J. Biol. Chem. 1999, 274:32855-32862).
[0203] The C. elegansSERCA gene does not contain the KDDKPV sequence (SEQ ID NO:39), but the TM6 domain is identical to mammalian SERCA. A variant of C. elegansSERCA containing the KDDKPV (SEQ ID NO:39) recognition site was constructed using standard site directed mutagenesis technology (QuikChange Site-Directed Mutagenesis Kit of Stratagene). The primers oGK118 and oGK119 and plasmid pGK28 were used to obtain a plasmid designated pGK115 containing thapsigargin-resistant C. elegansSERCA with the KDDKPV (SEQ ID NO:39) site.
[0204] oGK118:GCCAGTCGGAAAGGTTTCCAAGGACGACAAGCCAGTTAACCCAGCTGCTGGAGAATT (SEQ ID NO:31)
[0205] oGK119:AATTCTCCAGCAGCTGGGTTAACTGGCTTGTCGTCCTTGGAAACCTTTCCGACTGGC (SEQ ID NO:32)
[0206] (Nucleotides leading to the mutated SERCA are underlined.)
[0207] Plasmid pGK115 was introduced into C. elegansusing standard techniques. Introduction of this mutant SERCA into C. elegansresults in a more efficient interaction between the C. elegansSERCA (here the mutant) and vertebrate PLB. Introduction of a KDDKPV (SEQ ID NO:39) mutant into a C. elegansstrain which is mutant for SERCA, such as the ok190 strain, results in a strain which is directly useful for performing screens to select for compounds that alter the interaction of SERCA with PLB and hence that alter the activity of SERCA. Since pGK115 also contains the thapsigargin resistance mutation, it can also be expressed in a wild-type C. elegansfor use in screens to select for compounds that alter the interaction of SERCA with PLB and hence that alter the activity of SERCA. In such a screen, thapsigargin should be added to differentiate between activity of the endogeneous SERCA and the introduced double mutant SERCA.
Example 10
[0208] Construction of Fusion Proteins Between C. elegansSERCA and Vertebrate SERCA
[0209] The introduction of vertebrate SERCA in C. elegans,the latter being a SERCA mutant such as ok190 or a wild-type strain where the endogenous SERCA is inhibited for example by RNAi technology, will result in rescue of the mutant phenotypes, but maybe not to the full extent. This could be due, for example, to different kinetic properties of C. elegansand vertebrate SERCA, or to interaction with other partners than phospholamban. Using fusion proteins will overcome this problem. A fusion protein may be constructed that has sufficient properties of the C. elegansSERCA for rescue of the mutant phenotype, and has those vertebrate SERCA properties sufficient in a screen to select for compounds that alter the vertebrate SERCA activity.
[0210] At least four types of fusion proteins are contemplated:
[0211] 1) A fusion protein harboring the N-terminal end of the C. elegansand the C-terminal part of a vertebrate SERCA
[0212] 2) A fusion protein harboring the N-terminal part of a vertebrate SERCA and the C-terminal part of the C. elegansSERCA
[0213] 3) A fusion protein harboring the C- and N-terminal part of the C. elegansSERCA and an internal part of a vertebrate SERCA. This construction can be considered as a variant of the KDDKPV (SEQ ID NO:39) mutation described above.
[0214] 4) A fusion protein harboring the C- and N-terminal part of a vertebrate SERCA and an internal part of the C. elegansSERCA
[0215] Such fusion proteins can easily be constructed using standard molecular techniques.
[0216] A SERCA fusion protein of type 1 has been made in the following way:
[0217] A PCR reaction was performed on plasmid pGK110 (harboring the pig thapsigargin resistant SERCA2A) using primers oGK108 and oGK109.
[0218] oGK108: GACCGTACGAAATTTTCAGGAAAGGAATGCAGAAAATGCC (SEQ ID NO:33)
[0219] oGK109: CCCCGGCCGGCCTTACTCCAGTATTGCAGGTTCCAGG (SEQ ID NO:34)
[0220] The resulting 2701 bp PCR fragment was digested with BsiWI and EagI and cloned in the 10131 bp fragment of pGK8 (containing genomic C. elegansSERCA) cut at the same sites. The resulting vector was designated pGK114.
Example 11
[0221] Construction of Phospholamban Mutants that Show Altered Interaction with SERCA
[0222] The interaction of phospholamban with SERCA has been described very extensively in the literature. Furthermore mutants of PLB have been described that have an enhanced or a diminished interaction with SERCA and hence have a stronger or weaker inhibitory effect on SERCA (Toyofuku et al., J. Biol. Chem 1993, 269:3088-3094; Kimura et al., J. Biol. Chem. 1996, 271:21726-21731; Kimura et al., J. Biol. Chem. 1997, 272:15061-15064; Kimura et al., J. Biol. Chem. 1998, 273:14238-14241).
[0223] Introduction of a PLB mutant with an altered inhibition of SERCA in C. eleganscan improve the basic screen to select for compounds that alter the interaction of PLB and SERCA in such a way that the parameters of the screen can be fine-tuned exactly as is most useful, allowing screening for more specific compounds directed to the PLB SERCA interaction.
[0224] PLB mutations can easily be made using standard site directed mutagenesis techniques as described above, and as known in the art.
[0225] One phospholamban mutant of particular interest is Ser16Ala. In intact beating hearts or isolated cardiac myocytes, serine16 becomes phosphorylated by cAMP-dependent protein kinase upon stimulation with isoproterenol. This leads to increased cardiac relaxation due to decreased inhibition. A phospholamban mutant for this phosphorylation site thus lacks cAMP-dependent protein kinase-mediated regulation (Simmerman et al., J. Biol. Chem. 1986,261:13333-13341; Wegener et al., J. Biol. Chem. 1989, 264:11468-11474; Kuschel et al., Am. J. Physiol. 1999, 276:H1625-H1633).
Example 12
[0226] Cloning of Pig PLB, Construction of Humanized Pig PLB
[0227] Pig PLB cDNA was cloned from pGEM7PigPLB (Wuytack, personal gift) by PCR amplification using the primer combinations listed below. PCR amplification was performed using standard procedures (PCR, A practical approach, ed. by M. J. McPherson, P. Quirke and G. R. Taylor, 1993, Oxford University Press.
[0228] Summary of Primer Combinations
[0229] oGK51-oGK55: pg PLB, including stop codon
[0230] oGK51-oGK56: pig PLB, excluding stop codon (open ended)
[0231] oGK52-oGK55: humanized pig PLB, including stop codon
[0232] oGK52-oGK56: humanized pig PLB, excluding stop codon (open ended)
[0233] oGK51 and oGK52 contain an XbaI site for cloning
[0234] oGK55 and oGK56 contain an Asp718 site for cloning
[0235] oGK52 contains T-to-G point mutation compared to pig PLB cDNA so as to introduce a D-to-E amino acid substitution at position 2 of PLB. Since this is the only difference between the human and pg PLB proteins, the resultant polypeptide is the same as the human PLB sequence (NB the point mutated cDNA does not have the same sequence as the human PLB cDNA but encodes a protein having identical amino acid sequence to human PLB, hence it is referred to as a humanized pig PLB cDNA).
[0236] Sequences of the Primers are as Follows
[0237] oGK51: GCTCTAGATGGATAAAGTCCAATACCTCAC (SEQ ID NO:35)
[0238] oGK52: GCTCTAGATGGAGAAAGTCCAATACCTCAC (SEQ ID NO:36)
[0239] oGK55: GGGGTACCTCAGAGAAGCATCACGATGATG (SEQ ID NO:37)
[0240] oGK56: GGGGTACCATGAGAAGCATCACGATGATGCAAATC (SEQ ID NO:38)
[0241] pGK202 was constructed by cloning the oGK51-oGK55 PCR fragment digested with XbaI and Asp718 into pPd96.48 digested with the same enzymes. The vector expresses pig PLB under the control of the myo-2 promoter.
[0242] pGK204 was constructed by cloning the oGK51-oGK56 PCR fragment digested with XbaI and Asp718 into pGK203 digested with the same enzymes. The vector expresses the pig PLB fused to GFP under the control of the myo-2 promoter.
[0243] pGK205 was constructed by cloning the oGK52-oGK55 PCR fragment digested with XbaI and Asp718 into pPD96.48 digested with the same enzymes. The vector expresses the humanized pig PLB under the control of the myo-2 promoter.
[0244] pGK206 was constructed by cloning the oGK52-oGK56 PCR fragment digested with XbaI and Asp718 into pGK203 digested with the same enzymes. The vector expresses the humanized pig PLB fused to GFP under the control of the myo-2 promoter.
[0245] pGK302 was constructed by cloning the oGK51-oGK55 PCR fragment digested with XbaI and Asp718 into pPD96.52 digested with the same enzymes. The vector expresses the pig PLB under the control of the myo-3 promoter.
[0246] pGK304 was constructed by cloning the oGK51-oGK56 PCR fragment digested with XbaI and Asp718 into pGK303 digested with NheI-Asp718. The vector expresses the pig PLB fused to GFP under the control of the myo-3 promoter.
[0247] pGK305 was constructed by cloning the oGK52-oGK55 PCR fragment digested with XbaI and Asp718 intointo pPD96.52 digested with NheI-Asp718. The vector expresses the humanized pig PLB under the control of the myo-3 promoter.
[0248] pGK306 was constructed by cloning the oGK52-oGK56 PCR fragment digested with XbaI and Asp718 into pGK303 digested with NheI-Asp718. The resulting vector expresses the humanized pig PLB fused to GFP under the regulation of the myo-3 promoter.
Example 13
[0249] Inhibition of SERCA by Compounds
[0250] Several compounds are known to inhibit the function of SERCA, such as cyclopiazonic acid, cyproheptadine, thapsigargin, 2,5-di (tert-butyl)-1,4-benzohydroquinone, 2,4-benzoquinone, and vanadate. Other compounds are known to activate the activity of SERCA, such as diethylether, gingerol, and 1-(3,4-dimethoxyphenyl)-3-dodecanone. Still other compounds have a dual activity, they stimulate SERCA at low concentrations, but inhibit at high concentrations, such as phenothiazines, and pentobarbital.
[0251] Using two kinds of assays, the optimal concentration of compounds that inhibit the activity SERCA has been determined. The first assay is designated the drop or plate assay in which the nematodes are fed E. colistrains pre-loaded with the compound. In a second assay, the compound is administrated to the worm in liquid culture.
[0252] Plate Assay
[0253] A standard plate drop assay is performed according to the following protocol. 4 ml NGM agar (see “The nematode C. elegans” Ed. by William B. Wood and the Community of C. elegansResearchers, CSHL Press, 1988, pg589) is into 3 cm plates and seeded with approximately 5 μl of an E. coliovernight culture and grown preferably for one week at room temperature. Approximately 10 μl of test compound dissolved in DMSO or other suitable solvent is pipetted onto the bacterial lawn so that the lawn is covered completely. After overnight soaking in or compound, one C. elegans(L4 stage) per plate is put onto the bacterial lawn. Plates are incubated at 21° C. and checked after some hours. Plates are checked again after 4 days for phenotypes of the F1 progeny (control shows all stages up to gravid hermaphrodites).
[0254] Thapsigargin at various concentrations (5 μM, 2.5 μM and 1.25 μM) causes the nematode to stop pharynx pumping within 10 min. Within an hour the worms restart pumping, although at a low level. The worms are pale and thin and have a slow and irregular movement, with an increased amplitude. No plate drop response is observed, and the worms show poor backing, reduced pumping and strong constipation. The worms have a defective gonad with only very few eggs, and a protruding vulva. Some worms also have a protruding rectum. Progeny reaches L2 stage only after four days, and the brood size is very small. Lower concentrations of thapsigargin (0.5 μM, 0.25 μM, 0.125 μM) still cause reduced brood size.
[0255] 2,5-di-tert butylhydroquinone at a concentration of 500 μM resulted in pale, starved, thin worms with slow movement, defective gonad, constipated and reduced brood size.
[0256] Cyclopiazonic acid at a concentration of 500 μM resulted in nematodes that lay still or move slowly after one hour. The worms showed strong avoidance and after 24 hours they look starved, pale and thin, with only a few eggs in the body, a defective gonad, and reduced brood size. A delayed growth of the F1 generation was observed.
[0257] Thapsigargicin at 500 μM, 125 μM, 31 μM, 10 μM, 5 μM resulted in nematodes with similar phenotypes to those described above for thapsigargin at 5 μM, 2.5 μM, 1.25 μM. Lower concentrations of thapsigargicin (3 μM and 1.5 μM) caused a slightly reduced brood size.
[0258] Thapsigargin-epoxide did not result in a clear observable effect, even at the highest concentration tested (1 mM drop, 5 μM end concentration).
[0259] 1,4-benzoquinone did not result in a clear observable effect, even at the highest concentration tested (100 mM drop, 500 μM end concentration).
[0260] Liquid
[0261] Thapsigargin at 100, 50 and 20 μM resulted in small worms which show slow and loopy movement. They had a protruding vulva, and no progeny (or no progeny that grows up) were observed. At lower concentrations of 10 μM and 5 μM a reduced number of progeny and delayed growth could be observed.
[0262] 2,5-di-tert butylhydroquinone at a concentration of 1 mM resulted in progeny exhibiting delayed growth and the worms be observed to be thinner than ‘normal’ worms.
[0263] Cyclopiazonic acid at a concentration of 1 mM resulted in pale, thin worms with a slow movement and a very strongly reduced brood size. At lower concentrations of 0.5 mM, growth delay was observed.
[0264] Thapsigargicin at 1000 μM, 250 μM, 62.5 μM and 16 μM concentrations resulted in small worms with slow and loopy movement, a protruding vulva, and no progeny (or no progeny that grows up) were observed. At lower concentrations of 10 μM, delayed growth and reduced progeny were observed.
[0265] The effect of thapsigargin on progeny of wild-type strains was tested with the liquid assay: On an average of 12 worms, the number of progeny for the different concentrations is summarized in FIG. 1.
[0266] The effect of thapsigargin was also tested on progeny of wild-type strains using the plate assay: On an average of 12 worms the number of progeny at different concentrations is summarized in FIG. 2.
[0267] The effect of thapsigargin on the production of progeny was determined for a number of different C. elegansstrains. The numbers of progeny produced following thapsigargin treatment was counted for an average of 15 animals, the results are summarised as follows:
[0268] unc-31:
[0269] control: 132
[0270] 0.5 mM: 35
[0271] 1 mM: 5,6
[0272] srf-3:
[0273] control: 50
[0274] 1 mM: 18,3
[0275] The effect of thapsigargin on pharynx pumping behaviour was also determined. In wild-type worms, all animals stopped pumping after 10 minutes. In mutant strain unc-31 at a concentration of 1 mM thapsigargin, all worms stopped pumping after 10 minutes, some start again after half an hour, but pumping is only one third of normal speed.
[0276] In summary, the above experiments demonstrate that inhibition of C. elegansSERCA activity using thapsigargin or other chemical inhibitors of SERCA results in worms with recognisable phenotypic characteristics, including paleness, reduced growth, reduced rate of pharynx pumping and reduced numbers of progeny.
Example 14
[0277] Screening for Antagonists of a Compound (Thapsigargin)
[0278] The compound thapsigargin is known to inhibit the activity of SERCA. The SERCA protein pumps calcium into the sarco/endoplasmic reticulum and provides the cell with an internal storage of calcium. The internal storage of calcium is important for muscle activity. In C. elegans,inhibiting SERCA activity by applying thapsigargin to the worm results in a decrease in the pharynx pumping rate. Another feature observed by the action of thapsigargin on the nematode worm C. elegansis decreased movement, which is a result of the inhibition of SERCA activity of the body wall muscles.
[0279] A pharynx pumping screen has been developed to screen for chemical substances that suppress the activity of thapsigargin on SERCA. In this screen the pumping rate of the pharynx is measured indirectly by adding a marker molecule precursor such as calcein-AM to the medium and measuring the formation of marker dye in the C. elegansgut. Calcein-AM is cleaved by esterases present in the C. elegansgut to release calcein, which is a fluorescent molecule. The pumping rate of the pharynx will determine how much medium will enter the gut of the worm, and hence how much calcein-AM will enter the gut of the worm. Therefore by measuring the accumulation of calcein in the nematode gut, detectable by fluorescence, it is possible to determine the pumping rate of the pharynx.
[0280] A standard pharynx pumping screen may be carried out as follows.
[0281] 1) Dispense substantially equal numbers of C. elegansnematodes into the wells of multi-well assay plates. A ‘worm dispenser’ apparatus, e.g. the device commercially available from Union Biometrica, Inc, Somerville, Mass., USA which has properties analogous to flow cytometers, such as fluorescence activated cell scanning and sorting devices (FACS), may be used for this purpose. Typically, 40+/−5 worms are added to each well of the microtiter plate.
[0282] 2) Thapsigargin is added to the worms at an inhibitory concentration and calcein-AM is added at a concentration of 5-10 M.
[0283] 3) The chemical substances to be selected are added. Control wells are also set up containing thapsigargin alone with no second chemical substance. The chemical substances are typically made up in DMSO. Any other solvent can be used for this purpose, but most selected chemical substances appear to be soluble in DMSO. The chemical substance is added in the wells at various concentrations. but preferentially a concentration between 3 to 30 μM is chosen as this gives the clearest results. It possible to screen for dosage effects by varying the concentration of the chemical substance from less than 1 μM up to 100 μM.
[0284] The concentration of the DMSO should not be too high and preferentially should not exceed 1%, more preferentially the concentration of the DMSO should not exceed 0.5% and even more preferentially, the concentration of the DMSO is lower than 0.3%.
[0285] 4) Fluorescence intensity is measured using a multi-well plate reader (e.g. Victor2, Wallac Oy, Finland) with following settings: Ex/Em=485/530.
[0286] Wells harboring a chemical substance where the measured fluorescence is higher than in the control wells containing no chemical substance are scored. These wells harbor a chemical substance that is an antagonist of the thapsigargin activity, as the inhibitory activity of thapsigargin is suppressed. Chemical substances thus identified may inhibit directly the activity of thapsigargin, or stimulate the activity of SERCA, or have an enhancer activity on the SERCA pathway, and hence on the calcium biology of the organism.
[0287] Chemical substances selected in this screen as antagonists of thapsigargin are considered as potential therapeutics, or as hits for the further development of therapeutics in the disease areas which are the cause of a malfunction of the calcium biology of the organism. Examples of disease areas for which these therapeutics are useful are cardiac hypertrophy, cardiac failure, arterial hypertension, Type 2 diabetes and Brody disease.
[0288] In the example given above, thapsigargin is used as an example of a compound having a defined phenotypic effect on C. elegansas a result of inhibition of SERCA activity. It will be appreciated that other SERCA inhibitors which have an inhibitory activity on the pharynx pumping rate may be used in analogous screens with equivalent effect.
Example 15
[0289] Screening for Chemical Substances in Transgenic, Mutant and Humanized Animals (SERCA-PLB)
[0290] An increase of the internal storage of calcium is general considered to be important for the strength of muscle contraction, and consequently an improvement or increase of this muscle contraction can be realized by enhancing SERCA activity. Chemical substances that enhance SERCA activity or inhibit the SERCA-PLB interaction are considered as potential therapeutics, or as hits for the further development of therapeutics in the disease areas which are the cause of a malfunction of the calcium biology of the cell or organism. Examples of disease areas where an increase of SERCA activity may be beneficial are cardiac hypertrophy, cardiac failure, arterial hypertension, Type 2 diabetes and Brody disease.
[0291] The different SERCA genes and isoforms which are associated with different types of diseases; SERCA2 and PLB are associated with cardiovascular diseases, SERCA1 and sarcolipin are associated with skeletal-muscle diseases, and three SERCA genes have been associated with non-insulin-dependent diabetes mellitus.
[0292] In order to perform screens to identify chemical substances which modulate the activity of SERCA pathways SERCA genes and PLB have been expressed in C. elegans.The expression of these genes can be regulated under the control of several specific promoters with the following activities:
[0293] a) The C. elegansmyo-2 promoter which promotes expression in the pharynx
[0294] b) The C. elegansSERCA promoter which promotes expression in the C. elegansmuscles, including the pharynx, the vulva muscles and the body wall muscles.
[0295] The following transgenics were constructed:
[0296] a) pig and/or human SERCA under the SERCA and/or myo-2 promoter.
[0297] b) pig and/or human SERCA under the SERCA and/or myo-2 promoter in a C. elegansmutated for the C. elegansSERCA (Knock-outs and selected mutants).
[0298] c) pig and/or human PLB under the SERCA and/or the myo-2 promoter.
[0299] d) pig and/or human PLB under the SERCA and/or the myo-2 promoter in a C. elegansmutated for the C. elegansSERCA (Knock-out and selected mutants).
[0300] e) pig and/or human PLB-GFP fusion under the SERCA and/or the myo-2 promoter.
[0301] f) pig and/or human PLB-GFP fusion under the SERCA and/or the myo-2 promoter in a C. elegansmutated for the C. elegansSERCA (Knock-outs and selected mutants).
[0302] g) pig and/or human SERCA under the SERCA promoter and pig and/or human PLB under the myo-2 promoter.
[0303] h) pig and/or human SERCA under the SERCA promoter and pig and/or human PLB under the myo-2 promoter in a C. elegansmutated for the C. elegans,SERCA (Knock-out and selected mutants).
[0304] i) pig and/or human SERCA under the SERCA promoter and pig and/or human PLB-GFP under the myo-2 promoter.
[0305] j) pig and/or human SERCA under the SERCA promoter and pig and/or human PLB-GFP under the myo-2 promoter in a C. elegansmutated for the C. elegansSERCA (Knock-out and selected mutants).
[0306] Some of these constructed transgenic and mutant worms show a clear change in pharynx pumping rate as can be measured by the fluorescence of calcein in the gut using the calcein-AM pharynx pumping assay. Some of these strains were considered to be useful for further screen development. To perform the pharynx pumping assay, the transgenic and mutant animals were placed in the wells of multi-well plates. Calcein-AM and chemical substances under test were then added. The fluorescence of the calcein formed in the gut was measured in a multi-well plate reader set to measure fluorescence. Chemical substances that altered the properties of the pharynx pumping rate, and hence altered the function and activity of the SERCA pathway were selected for further analysis, and can be considered as potential compounds for therapeutic use, or as hits for the further development of therapeutics.
[0307] A analogous experiment can be performed with the SERCA1 gene and its regulator Sarcolipin (SLN), to detect chemical substances that alter their activity and/or regulation.
Example 16
[0308] Construction of Plasmids
[0309] The ‘pPD’ series of vectors were all obtained from the laboratory of Andrew Fire, see Fire A, Harrison S. W., and Dixon D. A modular set of LacZ fusion vectors for studying gene expression in Caenorhabditis elegans.1990. Gene 93:189-198. The sequences of these vectors are freely available at ftp://stein.cshl.org/pub/elegans_vector/).
[0310] pGK301 was constructed by cloning a 3181 bp fragment of pERIIIA (F. Wuytack, personal communication) into pPD96.52 digested with the same restriction enzymes. pGK301 expresses the SERCA2a cDNA under the regulation of the myo-3 promoter.
[0311] pGK201 was constructed by cloning a 480009 bp NheI/SpeI fragment of pGK301 in pPD96.48 digested with the same enzymes. The vector expresses pig SERCA2a under the regulation of the moy-2 promoter.
[0312] pGK101 was constructed by cloning a 4828 bp NheI/ApaI fragment of pGK201 into plasmid pDW2600 digested with the same enzymes. The vector expresses the pig SERCA2a cDNA under the regulation of the worm SERCA promoter.
[0313] pDW2600 was constructed by cloning a 5046 bp SphI-SmaI fragment of pGK10 in pPD49.26.
[0314] pGK203 was constructed by cloning the AccI/SpeI fragment of pPD95.79 into pPD96.48 digested with the same enzymes. This vector contains the myo-2 promoter, GFP and unc-54 3′UTR.
[0315] pGK303 was constructed by cloning the Asp718-ApaI fragment of pPD95.79 into pPD96.52 digested with the same enzymes. This vector contains the myo-2 promoter, GFP and unc-54 3′UTR.
[0316] List of Genbank Accession Numbers for SERCA and PLB cDNA Sequences
[0317] pig SERCA2a GenBank P11606
[0318] human SERCA1a GenBank AAB 53113
[0319] human SERCA1b GenBank AAB 53112
[0320] human SERCA2a GenBank P16614
[0321] human SERCA2b GenBank P16615
[0322] human SERCA3 GenBank Q93084
[0323] pig PLB GenBank P07473
[0324] human PLB GenBank P26678
[0325] Sequence Listing
[0326] SEQ ID NO:1 is the nucleic acid sequence of a 732 bp EcoRI-HindII fragment of C. elegansSERCA exon 5. This fragment was cloned into pGEM3 for use in RNA inhibition experiments.
[0327] SEQ ID NO:2 is the nucleic acid sequence of a 11207 bp SpeI-MluI fragment of cosmid K11D9. This fragment contains the complete C. elegansSERCA gene with 5631 bp of upstream sequence, the entire coding region and 1088 bp of downstream sequence. The fragment was cloned into pUC18 to give plasmid pGK7.
[0328] SEQ ID NO:3 is the nucleic acid sequence of a 5026 bp fragment of the upstream region of C. elegansSERCA, up to and including A of the initiating ATG. This fragment was cloned into pPD95.79, in fusion with GFP, to give plasmid pGK10.
[0329] SEQ ID NO:4 is the nucleic acid sequence of a 2915 bp fragment of the upstream region of C. elegansSERCA, as found in plasmid pGK13.
[0330] SEQ ID NO:5 is the nucleic acid sequence of a 6612 bp fragment of the C. elegansSERCA gene containing 5637 bp of upstream sequence and ending in exon 4, as cloned in pPD95.75, resulting in pGK12.
[0331] SEQ ID NO:6 is the nucleic acid sequence of the long isoform of the C. elegansSERCA cDNA.
[0332] SEQ ID NO:7 is the nucleic acid sequence of the pig SERCA2a cDNA.
[0333] SEQ ID NO:8 is the nucleic acid sequence of the human SERCA2a cDNA.
[0334] SEQ ID NO:9 is the nucleic acid sequence of the pig phospholamban cDNA.
[0335] SEQ ID NO:10 is the nucleic acid sequence of the C. elegansmyo-2 promoter.
[0336] SEQ ID NO:11 is the nucleic acid sequence of the C. elegansmyo-3 promoter.
[0337] SEQ ID NO:12 is the nucleic acid sequence of the C. elegansvulval muscle enhancer. This is an enhancer element from ceh-24 that directs gene expression in the vulval muscles (Harfe and Fire, 1998, Developmental 125: 421-429)
[0338] SEQ ID NO:13 is the nucleic acid sequence of humanized pig PLB cDNA.
[0339] SEQ ID NO:14 is the amino acid sequence of pig PLB.
[0340] SEQ ID NO:15 is the amino acid sequence of human PLB and humanized pig PLB.
[0341] SEQ ID NO:16 is the nucleotide sequence of a genomic fragment of C. elegansSERCA covered by primers SERCA P4 and SERCA P8.
[0342] SEQ ID Nos: 17-38 are primers used in the accompanying Examples.
[0343] SEQ ID NO:39 is an amino acid sequence insertion of a mutant C. elegansSERCA ATPase
[0344] All references disclosed herein are incorporated by reference in their entirety.
Claims
What is claimed is:
1. A method of identifying compounds which enhance or up-regulate the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises:
contacting C. eleganswhich exhibit reduced SERCA ATPase activity compared to wild type C. elegansin one or more cell types or tissues with a compound under test; and
detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity in the one or more cell types or tissues which exhibit reduced SERCA activity in the absence of the compound.
2. A method as claimed in claim 1 wherein the C. eleganshave been treated with a SERCA inhibitor to reduce the activity of SERCA in one or more cell types or tissues prior to contact with the compound under test.
3. A method as claimed in claim 2 wherein the SERCA inhibitor is thapsigargin.
4. A method as claimed in claim 1 wherein the C. eleganshave been treated with antisense or double-stranded RNA to specifically reduce the expression of SERCA in one or more cell types or tissues prior to contact with the compound under test.
5. A method as claimed in claim 1 wherein the C. elegansis a mutant C. eleganswhich exhibits reduced SERCA calcium ATPase activity in one or more cell types or tissues.
6. A method as claimed in claim 5 wherein the C. elegansis a mutant C. eleganswhich exhibits reduced expression of SERCA in one or more cell types or tissues.
7. A method as claimed in any one of claims 1 to 6 wherein the C. elegansexhibit reduced SERCA activity in the muscles of the pharynx, as compared to wild type C. elegansand the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises detecting a change in the pharynx pumping efficiency of the C. elegansin the presence of the compound under test.
8. A method as claimed in claim 7 wherein the C. elegansfurther contain a transgene comprising a promoter which directs gene expression in the muscles of the C. eleganspharynx operatively linked to nucleic acid encoding an apoaequorin protein.
9. A method as claimed in claim 8 wherein the promoter is the C. elegansmyo-2 promoter or the C. elegansSERCA promoter.
10. A method as claimed in claim 8 wherein the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises comparing the level of apoaequorin luminescence in the absence of the compound under test and the level of apoaequorin luminescence in the presence of the compound under test.
12. A method as claimed in claim 11 wherein the step of detecting a phenotypic, biochemical or behavioural change indicating a reversion towards wild type SERCA activity comprises detecting a change in the egg laying behaviour of the C. elegansin the presence of the compound under test.
13. A method as claimed in claim 11 wherein the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises detecting a change in the amount of progeny produced by the C. elegans.
14. A method as claimed in claim 11 wherein the C. elegansfurther contain a transgene comprising a promoter which directs gene expression in the muscles of the C. elegansvulva operatively linked to nucleic acid encoding an apoaequorin protein.
15. A method as claimed in claim 14 wherein the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises comparing the level of apoaequorin luminescence in the absence of the compound under test and the level of apoaequorin luminescence in the presence of the compound under test.
16. A method as claimed in any one of claims 1 to 6 wherein the C. elegansexhibit reduced SERCA activity in the anal repressor and/or the anal sphincter and the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises detecting a change in the defecation behaviour of the C. elegansin the presence of the compound under test.
17. A method as claimed in any one of claims 1 to 6 wherein the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises comparing the growth rate of the C. elegansin the absence of the compound under test and the growth rate of the C. elegansin the presence of the compound under test.
18. A method as claimed in any one of claims 1 to 6 wherein the step of detecting a phenotypic, biochemical or behavioural change in the C. elegansindicating a reversion towards wild type SERCA activity comprises comparing the turbidity of the C. elegansin culture in the absence of the compound under test and the turbidity of the C. elegansin culture in the presence of the compound under test.
Patent Citations (6)
| Patent | Date | Inventor | Cited By |
|---|---|---|---|
| US6010848(A) | 2000-01-01 | Delvecchio et al. | Examiner |
| WO90/09096 | 1990-08-01 | Applicant | |
| WO96/38555 | 1996-12-01 | Applicant | |
| WO98/53856 | 1998-05-01 | Examiner | |
| WO98/53856 | 1998-12-01 | Applicant | |
| WO99/02652 | 1999-01-01 | Applicant |
Non-Patent Literature (15)
- JH Cho et al.,Gene, “Two isoforms of sarco/endoplasmic reticulum calcium ATPase (SERCA) are essential in Caenorhabditis elegans,” 2000, 261, pp. 211-219.Applicant
- Y Sagara et al., Journal of Biological Chemistry, “Characterization of the Inhibition of Intracellular Ca2+ Transport ATPases by Thapsigargin,” 1992, vol. 267,No. 18, pp. 12606-12613.Applicant
- PA Sharp, Genes & Development, “RNAi and double-strand RNA,” 1999, 13:139-141.Applicant
- AS Kraev, Locus Bank, Accession No. CAA09985, 1998.Applicant
- Arai, Masashi et al., “Alterations in Sarcoplasmic Reticulum Gene Expression in Human Heart Failure,” Circulation Research (1993) vol. 72, No. 2, pp. 463-469.Applicant
- Arai, Masashi, “Function and Regulation of Sarcoplasmic Reticulum Ca2+-ATPase,” Jpn. Heart J. (2000), vol. 41, No. 1, pp. 1-13.Applicant
- Del Monte, Federica et al., “Restoration of Contractile Function in Isolated Cardiomyocytes from Failing Human Hearts by Gene Transfer of SERCA1a,” Circulation (1999), 100:2308-2311.Applicant
- Kiriazis, Helen et al., “Genetically Engineered Models with Alterations in Cardiac Membrane Calcium-Handling Proteins,” Annu. Rev. Physiol. (2000), 62:321-51.Applicant
- MacLennan, David et al., “Minireview: The Mechanism of Ca2+-ATPases,” J. Biol. Chem. (1997), 272:28815-28818.Applicant
- Miyamoto, Michael et al., “Adenoviral Gene Transfer of SERCA2a Improves Left-Ventricular Function in Aortic-Banded Rats in Transition to Heart Failure,” PNAS (2000), vol. 97, No. 2, pp. 793-798.Applicant
- Moller, Jesper et al., “Structural Organization, Ion Transport, and Energy Transduction of P-Type ATPases,” Biochimica et Biophysica Acta (1996) 1286, pp. 1-51.Applicant
- Odermatt, Alex et al., “Mutations in the Gene-Encoding SERCA1, the Fast-twitch Skeletal Muscle Sarcoplasmic Reticulum Ca2+ ATPase, are Associated with Brody Disease,” Nature Genetics (1996) 14(2):191-4.Applicant
- Sakuntabhai, Anavaj et al., “Mutations in ATP2A2, Encoding a Ca2+ Pump, Cause Darier Disease,” Nature Genetics (1999) vol. 21, pp. 271-277.Applicant
- Schmidt, U et al., “Restoration of Diastolic Function in Senescent Rat Hearts Through Adenoviral Gene Transfer of Sarcoplasmic Reticulum Ca2+-ATPase,” Circulation (2000), 101:790-796.Applicant
- Alexander Kraev et al., “Identification and Functional Expression of the Plasma Membrane Calcium ATPase Gene Family From Caenorhabditis elegans,” J. Biol. Chem. (1999), vol. 274, No. 7, pp. 4254-4258.Applicant