US 6,479,267 B1Grant
FY7 polymerase
Issue Date:2002-11-12
•2 Claims
•51 Drawing Sheets
Abstract
A purified recombinant thermostable DNA polymerase polymerase which exhibits at least about 80% activity at salt concentations of 50 mM and greater, at least about 70% activity at salt concentrations of 25 mM and greater, and having a processivity of about 30 nucleotides per binding event. An isolated nucleic acid that encodes the thermostable DNA polymerase, as well as a recombinant DNA vector comprising the nucleic acid and a recombinant host cell transformed with the vector, are also disclosed. A method of sequencing DNA using the DNA polymerase as well as a kit for sequencing DNA is also disclosed.
Metadata
Assignee
- Amersham Pharmacia Biotech, Inc.
Inventors
- Maria Cuozzo Davis
- Carl W. Fuller
- Lin Huang
- Joseph Anthony Mamone
Application Information
Application Number:US 09/334,818
Filing Date:1999-06-17
Priority Date:1998-06-17
Art Unit:7
Classifications
IPC:
C12N 912C12N 900
Field of Search:
435 6435 912435 911435183435193435194530358530350
Patent Drawings (51 sheets)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to United States Provisional Application Serial No. 60/089,556, filed on Jun. 17, 1998, the entire disclosure of which is incorporated in its herein.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The instant disclosure pertains to thermostable DNA polymerases which exhibit improved robustness and efficiency.
[0005] 2. Background
[0006] DNA polymerases are enzymes which are useful in many recombinant DNA techniques such as nucleic acid amplification by the polymerase chain reaction (“PCR”), self-sustained sequence replication (“3SR”), and high temperature DNA sequencing. Thermostable polymerases are particularly useful. Because heat does not destroy the polymerase activity, there is no need to add additional polymerase after every denaturation step.
[0007] However, many thermostable polymerases have been found to display a 5′ to 3′ exonuclease or structure-dependent single-stranded endonuclease (“SDSSE”) activity which may limit the amount of product produced or contribute to the plateau phenomenon in the normally exponential accumulation of product. Such 5′ to 3′ nuclease activity may contribute to an impaired ability to efficiently generate long PCR products greater than or equal to 10 kb, particularly for G+C rich targets. In DNA sequencing applications and cycle sequencing applications, the presence of 5′ to 3′ nuclease activity may contribute to a reduction in desired band intensities and/or generation of spurious or background bands.
[0008] Additionally, many of the enzymes presently available are sensitive to high salt environments and have low processing ability, that is, the number of nucleotides incorporated per DNA polymerase binding event. Furthermore, addition of dITP to the reaction mixture to address compression problems usually results in reduced activity of the enzyme.
[0009] Thus, a need continues to exist for an improved DNA polymerase having increased tolerance to high salt conditions, efficient utilization of dITP, high productivity, and improved performance on GC-rich templates.
BRIEF SUMMARY OF THE INVENTION
[0010] The instant disclosure teaches a purified recombinant thermostable DNA polymerase comprising the amino acid sequence set forth in FIG. 1, as well as a purified recombinant thermostable DNA polymerase which exhibits at least about 80% activity at salt concentrations of 50 mM and greater. The instant disclosure further teaches a purified recombinant thermostable DNA polymerase which exhibits at least about 70% activity at salt concentrations of 25 mM and greater, and a purified recombinant thermostable DNA polymerase having a processivity of about 30 nucleotides per binding event.
[0011] The instant disclosure also teaches an isolated nucleic acid that encodes a thermostable DNA polymerase, wherein said nucleic acid consists of the nucleotide sequence set forth in FIG. 1, as well as a recombinant DNA vector that comprises the nucleic acid, and a recombinant host cell transformed with the vector.
[0012] The instant disclosure also teaches a method of sequencing DNA comprising the step of generating chain terminated fragments from the DNA template to be sequenced with the DNA polymerase in the presence of at least one chain terminating agent and one or more nucleotide triphosphates, and determining the sequence of said DNA from the sizes of said fragments. The instant disclosure also teaches a kit for sequencing DNA comprising the DNA polymerase.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0013] FIG. 1 depicts the amino acid sequence (SEQ ID No. 2) (and DNA sequence encoding therefor (SEQ ID No. 1)) for the FY7 polymerase.
[0014] FIG. 2 depicts the DNA sequence (SEQ ID No. 3) of M13mp18 DNA sequenced using the FY7 polymerase formulated in Mn conditions, as shown by a print out from an ABI model 377 automated fluorescent DNA sequencing apparatus.
[0015] FIG. 3 depicts the DNA sequence (SEQ ID No. 4) of M13mp18 DNA sequenced using the FY7 polymerase formulated in Mg conditions, as shown by a print out from an ABI model 377 automated fluorescent DNA sequencing apparatus.
[0016] FIG. 4 depicts the percent of maximum polymerase activity for Thermo Sequenase™ enzyme DNA polymerase versus FY7 DNA polymerase under varying KCl concentrations.
[0017] FIG. 5 depicts the effect of high salt concentrations on DNA sequencing ability in radioactively labeled DNA sequencing reactions using Thermo Sequenase™ enzyme DNA polymerase versus FY7 DNA polymerase.
[0018] FIGS. 6-10 (SEQ ID Nos. 5-9, respectively) depict the effect of increasing salt concentration on the performance of Thermo Sequenase. At concentrations as low as 25 mM data quality is affected with the read length being decreased from at least 600 bases to about 450 bases. At 50 mM salt the read length is further decreased to about 350 bases, 75 mM to about 250 bases and at 100 mM the read length is negligible.
[0019] FIGS. 11-15 (SEQ ID Nos. 10-14, respectively) depict the effect of increasing salt concentration on the performance of FY7 DNA polymerase. There is no detrimental effect on performance to at least 75 mM KCl and only a slight decrease in data quality at 100 mM KCl.
[0020] FIG. 16 depicts the processivity measured for Thermo Sequenase DNA polymerase, AmpliTaq FS DNA polymerase, compared with the processivity measured for FY7 DNA polymerase.
[0021] FIG. 17 depicts the improved read length obtained when using FY7 polymerase versus Thermo Sequenase DNA polymerase in radioactively labeled sequencing reactions incorporating the dGTP (Guanosine triphosphate) analog dITP (Inosine triphosphate) at 72° C.
[0022] FIGS. 18-22 (SEQ ID Nos. 15-19, respectively) show the effect of increasing extension step time on the read length and data quality produced by Thermo Sequenase DNA polymerase in fluorescently labeled terminator DNA sequencing reactions
[0023] FIGS. 23-27 (SEQ ID Nos. 20-24, respectively) show the effect of increasing extension step time on the read length and data quality produced by FY7 DNA polymerase in fluorescently labeled terminator DNA sequencing reactions.
DETAILED DESCRIPTION OF THE INVENTION
[0024] A series of polymerase mutants were constructed with the aim of obtaining an improved polymerase for DNA sequencing, by reducing the exonuclease activity found in full length Thermus thermophilusand Thermus aquaticusDNA polymerase I enzymes. Six conserved motifs (Gutman and Minton (1993) Nucleic Acids Research 21, 4406-4407) can be identified in the amino-terminal domain of pol I type polymerases, in which the 5′ to 3′ exonuclease activity has been shown to reside. Further, six carboxylate residues in these conserved regions have been shown in a crystal structure to be located at the active site of the exonuclease domain of Thermus aquaticusDNA pol I (Kim et al., (1995) Nature 376, 612-616). Point mutations were made by site-directed mutagenesis to carboxylates and other residues in three of six conserved motifs in Tth and Taq polymerases as follows: Taq D18A, Taq T140V, Taq D142N/D144N. All of these have the mutation F667Y outside of the exonuclease domain. Tth D18A, Tth T141V, Tth D143N/D145N. All of these have the mutation F669Y outside of the exonuclease domain.
[0025] All polymerases were evaluated for exonuclease activity, processivity, strand displacement, salt tolerance, thermostability, and sequencing quality. One FY7 polymerase, Tth D18A, F669Y, is described in further detail below.
EXAMPLES
Methods
[0026] In Vitro Mutagenesis
[0027] PCR was employed to introduce an aspartic acid to alanine amino acid change at codon 18 (D18A) of cloned full length F669Y Tth (plasmid pMR10). Mutagenic Primer 1 (CTGTTCGAACCCAAAGGCCGTGTCCTCCTGGTGGCCGGCCACCAC) (SEQ ID No. 25) spans nucleotides 19-60 of pMR10 including codon 18 and a BstBI restriction site. Oligonucleotide Primer 2 (GAGGCTGCCGAATTCCAGCCTCTC) (SEQ ID No. 26) spans an EcoRI site of pMR10. pMR10 was used as template DNA. The PCR product was digested with BstBI and EcoRI and ligated to two fragments of pMR10: a 5000 bp KpnI/BstBI and a 2057 bp EcoRI/KpnI, creating plasmid pMR12. Cells of E. colistrain DH1λ+ were used for primary transformation, and strain M5248 (λ cI857) was used for protein expression, although any comparable pair of E. colistrains carrying the cI+ and cI857 alleles could be utilized. Alternatively, any rec+ cI+ strain could be induced by chemical agents such as nalidixic acid to produce the polymerase.
[0028] Purification of Polymerase
[0029] M5248 containing plasmid pMR12 was grown in one liter of LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl), preferably 2× LB medium, containing 100 mg/ml ampicillin at 30° C. When the OD600reached 1.0, the culture was induced at 42° C. for 1.5 hours. The cultures were then cooled to <20° C. and the cells harvested by centrifugation in a Sorvall RC-3B centrifuge at 5000 rpm at 4° C. for 15 to 30 minutes. Harvested cells were stored at −80° C.
[0030] The cell pellet was resuspended in 25 ml pre-warmed lysis buffer (50 mM Tris-HCl pH 8.0, 10 mM MgCl2, 16 mM (NH4)2SO4, 1 mM EDTA, 0.1%, preferably 0.2% Tween 20, 0.1%, preferably 0.2% NP40). Preferably, the lysis buffer contains 300 mM NaCl. Resuspended cells were incubated at 75-85° C. for 10-20 minutes, sonicated for 1 minute, and cleared by centrifugation. The cleared lysate was passed through a 300 ml column of diethylaminoethyl cellulose (Whatman DE 52) equilibrated in buffer A (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.1% Tween 20, 0.1% NP40) containing 100 mM, preferably 300 mM NaCl. Fractions were assayed for polymerase activity, and those demonstrating peak polymerase activity were pooled, diluted to 50 mM NaCl with Buffer A, and loaded onto a heparin sepharose column (20 ml) equilibrated with 50 mM NaCl in buffer A. The polymerase was eluted from the column with a linear salt gradient from 50 mM to 700 mM NaCl in buffer A. Fractions were assayed for polymerase activity, and those demonstrating peak activity were pooled and dialyzed against final buffer (20 mM Tris-HCl pH8.5, 50% (v/v) glycerol, 0.1 mM EDTA, 0.5% Tween 20, 0.5% NP40, 1 mM DTT, 100 mM KCl). The purified protein is designated FY7. The amino acid sequence (and DNA sequence encoding therefor) are presented in FIG. 1. ps Bacterial Strains
[0031] E. colistrains: DHIλ+ [gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44, λ+]; M5248 [λ(bio275, cI857, cIII+, N+, λ(H1))].
[0032] PCR
[0033] Plasmid DNA from E. coliDHIλ+ (pMR10) was prepared by SDS alkaline lysis method (Sambrook et al., Molecular Cloning 2ndEd. Cold Spring Harbor Press, 1989). Reaction conditions were as follows: 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin, 1 uM each primer, 2.5U Taq polymerase, per 100 μl reaction. Cycling conditions were 94° C. 2 minutes, then 35 cycles of 94° C. 30s, 55° C. 30s, 72° C. 3 minutes followed by 72° C. for 7 minutes.
Example 1
Formulation of the Enzyme in Mn Conditions
[0034] In the following “pre-mix” protocol, all the reagents are contained in two solutions; reagent mix A and reagent mix B.
[0035] Reagent Mix A
[0036] The following reagents were combined to make 10 ml of reagent mix A:
[0037] 2.5 ml 1 M HEPPS N-(2-hydroxyethyl) piperazine-N′-(3-propanesulfonic acid), pH 8.0
[0038] 500 μl 1 M tartaric acid, pH 8.0
[0039] 50,000 units FY7 DNA polymerase
[0040] 1 unit Thermoplasma acidophiluminorganic pyrophosphatase
[0041] 100 μl 100 mM dATP
[0042] 100 μl 100 mM dTTP
[0043] 100 μl 100 mM dCTP
[0044] 500 μl 100 mM dITP
[0045] 9.375 μl 100 μM C-7-propargylamino-4-rhodamine-6-G-ddATP
[0046] 90 μl 100 μM C-5-propargylamino-4-rhodamine-X-ddCTP
[0047] 6.75 μl 100 μM C-7-propargylamino-4-rhodamine-110-ddGTP
[0048] 165 μl 100 μM C-5-propargylamino-4-tetramethylrhodamine-ddUTP
[0049] 10 μl 50 mM EDTA
[0050] 1 ml glycerol
[0051] The volume was made up to 10,000 μl with deionized H2O.
[0052] Reagent Mix B
[0053] The following reagents were combined to make 10 ml of reagent mix B:
[0054] 10 μl 1M MES 2-(N-morpholino)ethanesulfonic acid, pH 6.0
[0055] 200 μl 1M MgCl2
[0056] 75 μl 1M MnSO4
[0057] The volume was made up to 10,000 μl with deionized H2O.
Example 2
Use of the Formulation From Example 1
[0058] Two (2) μl reagent mix A, 2 μl reagent mix B, 200 ng M13mp18 DNA, 5 pmole of primer (M13-40 Forward 5′-GTTTTCCCAGTCACGACGTTGTA) (SEQ ID No. 27), and deionized water to a total volume of 20 μl were mixed together and subjected to 25 cycles of (95° C. 30 seconds, 60° C. 1 minute) in a thermal cycler. After cycling, 4 μl of a solution which contained 1.5 M sodium acetate, 250 mM EDTA was added. The solution was mixed and 4 volumes (100 μl) of ethanol added. The DNA was precipitated by incubation on ice for 15-20 minutes followed by centrifugation. The supernatant was removed and the pellet was washed with 70% ethanol, dried and resuspended in 4 μl of formamide containing loading dye. The resuspended DNA was then run on an automated fluorescent DNA sequencing apparatus (ABI model 377 instrument). The print out from the machine of the DNA sequence is shown as FIG. 2.
Example 3
Formulation of the Enzyme in Mg Conditions
[0059] In the following “pre-mix” protocol, all the reagents are contained in one solution.
[0060] Sequencing Premix
[0061] The following reagents were combined to make 800 μl of Sequencing premix 200 μl of 500 mM Tris-HCl pH 9.5, 20 mM MgCl2
[0062] 100 μl 40 units/μl FY7 DNA polymerase, 0.0008 units/μl Thermoplasma acidophiluminorganic pyrophosphatase
[0063] 100 μl 10 mM dITP, 2 mM dATP, 2 mM dTTP, 2 mM dCTP
[0064] 100 μl 0.125 μM C-7-propargylamino-4-rhodamine-6-G-ddATP
[0065] 100 μl 1.2 μM C-5-propargylamino-4-rhodamine-X-ddCTP
[0066] 100 μl 0.09 μM C-7-propargylamino-4-rhodamine-110-ddGTP
[0067] 100 μl 2.2 μM C-5-propargylamino-4-tetramethylrhodamine-ddUTP
Example 4
Use of the Formulation From Example 3
[0068] Four (4) μl of sequencing premix, 200 ng M13mp18 DNA, 5 pmole of primer (M13-40 Forward 5′-GTTTTCCCAGTCACGACGTTGTA) (SEQ ID No. 27), and deionized water to a total volume of 20 μl were mixed together and subjected to 25 cycles of (95° C. 30 seconds, 60° C. 2 minutes) in a thermal cycler. After cycling, 7 μl of 7.5 M ammonium acetate was added. The solution was mixed and 4 volumes (100 μl) of ethanol added. The DNA was precipitated by incubation on ice for 15-20 minutes followed by centrifugation. The supernatant was removed and the pellet was washed with 70% ethanol, dried and resuspended in 4 μl of formamide containing loading dye. The resuspended DNA was then run on an automated fluorescent DNA sequencing apparatus (ABI model 377 instrument). The print out from the machine of the DNA sequence is shown as FIG. 3.
Example 5
Polymerase Activity Versus Salt Concentration (KCl) for Thermo Sequenase™ Enzyme and FY7 Enzyme
[0069] The percent of maximum polymerase activity was measured for Thermo Sequenase™ enzyme DNA polymerase and FY7 DNA polymerase under varying KCl concentrations. The results are depicted in FIG. 4. The data indicate that FY7 has a much higher salt optimum as well as broader range of tolerance for salt in the reaction mixture than Thermo Sequenase™. The salt concentration which gives 50% activity is five-fold higher for FY7 than for Thermo Sequenase.
[0070] The effect of high salt concentrations on DNA sequencing ability in radioactively labeled DNA sequencing reactions was also examined. The results are presented in FIG. 5. At KCl concentrations of 50 mM or higher Thermo Sequenase™ polymerase performance degrades to levels at which usable data cannot be extracted. FY7 DNA polymerase, however, is able to give quite good sequencing data at concentrations of KCl of 100 mM.
Example 6
Fluorescent Sequencing Salt Tolerance
[0071] These experiments examined the effect of the above-demonstrated polymerase activity in high salt concentrations on DNA sequencing ability in fluorescently labeled terminator DNA sequencing reactions. The results are presented in FIGS. 6-15.
[0072] FIGS. 6-10 show the effect of increasing salt concentration on the performance of Thermo Sequenase. At concentrations as low as 25 mM data quality is affected with the read length being decreased from at least 600 bases to about 450 bases. At 50 mM salt the read length is further decreased to about 350 bases, 75 mM to about 250 bases and at 100 mM the read length is negligible.
[0073] FIGS. 11-15 show the effect of increasing salt concentration on the performance of FY7 DNA polymerase. There is no detrimental effect on performance to at least 75 mM KCl and only a slight decrease in data quality at 100 mM KCl.
[0074] As it is recognized that some types of DNA preparations may be contaminated with salt (which is detrimental to DNA sequencing data quality), the use of FY7 DNA polymerase allows for a more robust sequencing reaction over a broader range of template conditions.
Example 7
Polymerase Processivity
[0075] The processivity (number of nucleotides incorporated per DNA polymerase binding event) has been measured, for different DNA sequencing polymerases. The results are presented in FIG. 16. Thermo Sequenase DNA polymerase has a processivity of only ˜4 nucleotides per binding event. AmpliTaq FS DNA polymerase has a processivity of ˜15 nucleotides per binding event. FY7 DNA polymerase has a processivity more than seven-fold greater than Thermo Sequenase DNA polymerase and ˜two-fold greater than AmpliTaq FS DNA polymerase at ˜30 nucleotides per binding event.
Example 8
Polymerase Extension with dITP at 72° C.
[0076] The series examined improved read length obtained when using FY7 polymerase versus Thermo Sequenase DNA polymerase in radioactively labeled sequencing reactions incorporating the dGTP (Guanosine triphosphate) analog dITP (Inosine triphosphate) at 72° C. The results are presented in FIG. 17. FY7 is able to incorporate >50-100 more nucleotides under standard 33P[α-dATP] sequencing conditions than Thermo Sequenase.
Example 9
Effect of Extension Step Time on Length of Read
[0077] These series of experiments examined the effect of increasing extension step time of the read length and data quality of Thermo Sequenase and FY7 DNA polymerases in fluorescently labeled terminator DNA sequencing reactions. The results are presented in FIGS. 18-27.
[0078] FIGS. 18-22 show the effect of increasing extension step time on the read length and data quality produced by Thermo Sequenase DNA polymerase. This data shows that a minimum of a two minutes extension step is required by Thermo Sequenase in order to achieve a quality read of at least 600 bases. Signal strength generally increases to a maximum at a four minute extension (the time specified in the commercial product utilizing this enzyme and method).
[0079] FIGS. 23-27 show the effect of increasing extension step time on the read length and data quality produced by FY7 DNA polymerase. This data shows that a minimum of a 30 second extension step is required by FY7 in order to achieve a quality read of at least 600 bases. Signal strengths plateau at about one minute extension time. The FY7 DNA polymerase can produce data of equivalent quality to Thermo Sequenase in one-quarter to one-half the time of extension reaction.
[0080] Although the above examples describe various embodiments of the invention in detail, many variations will be apparent to those of ordinary skill in the art. Accordingly, the above examples are intended for illustration purposes and should not be used in any way to restrict the scope of the appended claims.
Claims
What is claimed is:
1. A purified recombinant thermostable DNA polymerase comprising the amino acid sequence set forth in FIG. 1 (SEQ ID No. 2).
2. A kit for sequencing DNA comprising the DNA polymerase of claim 1.
Patent Citations (14)
| Patent | Date | Inventor | Cited By |
|---|---|---|---|
| US5192674(A) | 1993-03-01 | Oshima et al. | Examiner |
| US5593840(A) | 1997-01-01 | Bhatnagar et al. | Applicant |
| US5610066(A) | 1997-03-01 | Fuller et al. | Applicant |
| US5618711(A) | 1997-04-01 | Gelfand et al. | Applicant |
| US5633138(A) | 1997-05-01 | Davis et al. | Applicant |
| US5744312(A) | 1998-04-01 | Mamone et al. | Applicant |
| US5789224(A) | 1998-08-01 | Gelfand et al. | Applicant |
| US5795762(A) | 1998-08-01 | Abramson et al. | Applicant |
| US5804375(A) | 1998-09-01 | Gelfand et al. | Applicant |
| US5885813(A) | 1999-03-01 | Davis et al. | Applicant |
| US5948614(A) | 1999-09-01 | Chatterjee | Examiner |
| EP745676 | 1996-12-01 | Applicant | |
| WO91/09950 | 1991-07-01 | Applicant | |
| WO98/01562 | 1998-01-01 | Applicant |
Non-Patent Literature (3)
- Takagi et al. Characterization of DNA Polymerase from Pyrococcus sp. Strain KOD1 and its Application to PCR, Applied and Enviromental Microbiology 63(11): 4504-4510, Nov. 1997.Applicant
- Gutman, Pablo and Minton, Kenneth; Conserved Sites in the 5′-3′ Exonuclease Domain of Escherichia coli DNA Polymerase; Nucleic Acids Research, 1993, vol. 21, No. 18, pp. 4406-4407.Applicant
- Reeve, Michael and Fuller, Carl; A Novel Thermostable Polymerase for DNA Sequencing; Nature, vol. 376, Aug. 31, 1995, pp. 796-797.Applicant