Recombinant KAT Enzyme and Process for Its Preparation

The present invention relates to DNA sequences that code for kynurenine aminotransferase.

The enzyme kynurenine aminotransferase (known in the art as KAT) catalyzes the biosynthesis of kynurenic acid (KYNA) from kynurenine (KYN) and is singularly responsible for the regulation of extracellular KYNA concentrations in the brain (J. Neurochem., 57:533-540 (1991)).

KYNA is an effective excitatory amino acid (EAA) receptor antagonist with a particularly high affinity to the glycine modulatory site of the N-methyl-D-aspartate (NMDA) receptor complex (J. Neurochem., 52:1319-1328 (1989)). As a naturally occurring brain metabolite (J. Neurochem., 51:177-180 (1988); and Brain Res., 454:164-169 (1988)), KYNA probably serves as a negative endogenous modulator of cerebral glutamatergic function (Ann. N.Y. Acad. Sci., 648:140-153 (1992)).

EAA receptors and in particular NMDA receptors are known to play a central role in the function of the mammalian brain (Watkins et al, In: The NMDA Receptor, page 242, (1989), Eds., Oxford University Press, Oxford). For example, NMDA receptor activation is essential for cognitive processes, such as, for example, learning and memory (Watkins et al, In: The NMDA Receptor, Eds., pages 137-151, (1989), Oxford University press, Oxford) and for brain development (Trends Pharmacol. Sci., 11:290-296 (1990)).

It follows that a reduction in NMDA receptor function will have detrimental consequences for brain physiology and, consequently, for the entire organism. For example, the decline in the number of NMDA receptors which occurs in the aged brain (Synapse, 6:343-388 (1990)) is likely associated with age-related disorders of cognitive functions.

In the brain, KYNA concentrations and the activity of KYNA's biosynthetic enzyme KAT show a remarkable increase with age (Brain Res., 558:1-5, (1992); and Neurosci. Lett., 94:145-150 (1988)). KAT inhibitors, by providing an increase of the glutamatergic tone at the NMDA receptor, could therefore be particularly useful in situations where NMDA receptor function is insufficient and/or KAT activity and KYNA levels are abnormally enhanced. Hence they could be particularly useful in the treatment of the pathological consequences associated with the aging processes in the brain which are, for example, cognitive disorders including, e.g., attention and memory deficits and vigilance impairments in the elderly.

KAT inhibitors may also be useful in the treatment of perinatal brain disorders which may be related to irregularities in the characteristic region specific pattern of postnatal KAT development (Baran et al, Dev. Brain Res., 74:283-286 (1993)).

In subcellular fractionation studies KAT activity was recovered in the cytosol and in mitochondria (J. Neurochem., supra).

Most nuclear-encoded precursors of mitochondrial proteins contain amino-terminal presequences (Pfanner et al, In: Current Topics in Bioenergetics, 15:177-219 (1987); Lee Ed., New York Academic Press; and Nicholson et al, In: Protein Transfer and Organelle Biogenesis, Das and Robins Eds., New York Academic Press (1988)). These presequences are required for the precursor to enter the mitochondrial matrix, where they are proteolytically removed (Hurt et al, FEBS Lett., 178:306 (1984); Horwich et al, EMBO J., 4:1129 (1985). This cleavage is not essential for completing import but is necessary for further assembly of the newly imported polypeptides into functional complexes (Zwizinski et al, J. Biol. Chem., 258:13340 (1983); Lewin et al, J. Biol. Chem., 258:6750 (1983); Ou et al, J. Biochem., 100:1287 (1986)). Precursor targeting sequences differ considerably in their structures. One of the few common themes is the high content of positively charged amino acids and of hydroxylated amino acids. Presequences may form an amphipathic structure in the form of either .alpha.-helices or .beta.-sheets (von Heijne et al, EMBO J., 5:1335 (1986); Roise et al, EMBO J., 5:1327 (1986); and Vassarotti et al, EMBO J., 6:705 (1987)). Despite the large variability of the sequences of mitochondrial leader peptides, relatively minor alterations of the presequence can prevent cleavage by the processing peptidase (Hurt et al, J. Biol. Chem., 262:1420 (1987)). This suggests that distinct, but up to now undefined, structural elements are required for cleavage. Similarly, the cleavage sites show wide variation among different precursors of a single organism and among precursors of different organisms.

Interestingly, using the protein algorithm described by Gavel et al (Protein Engineering, 4:33-37 (1990)), a potential mitochondrial transit peptide is predicted either in position 1 to 24 of the deduced protein of cDNA-2 and in position 1 to 44 of the deduced protein of cDNA-3 disclosed in the present invention (see FIGS. 3-4 and Example 3). Recently Perry et al (Mol. Pharm., 43:660-665 (1993)) reported the cloning of a cDNA coding for rat kidney cytosolic cysteine conjugate .beta.-lyase.. When the cDNA was inserted into the expression vector PVS1000 and transfected into COS-1 tissue culture cells, a 7-10 fold increase in cytosolic .beta.-lyase and glutamine transaminase K activities was detected. The deduced amino acid sequence of rat .beta.-lyase is identical to the deduced amino acid sequence of cDNA-1 (rat KAT) except for two residues (see FIG. 2). Moreover the existence of cDNA-2 and cDNA-3 was not reported by Perry et al (Mol. Pharm., supra).

Even more recently Perry et al (FEBS Lett., 360:277-280 (1995)) reported the cloning of a cDNA for human kidney cysteine conjugate beta-lyase whose sequence is identical to the sequence of the human KAT described in the present patent application. Whereas the identity with cysteine conjugate .beta.-lyase and glutamine transaminase K is well documented (Abraham et al, Analytical Biochem., 197:421-427 (1991)), there are no reports indicating identity of kynurenine transaminase with either .beta.-lyase or glutamine transaminase K.

We now report the cloning of mammalian kynurenine aminotransferases.

A first aspect of the present invention relates to isolated DNA sequences encoding a KAT enzyme selected from the group consisting of: (a) isolated DNA sequences which encode rat KAT; (b) an isolated DNA sequence which hybridizes to isolated DNA sequences of (a) above and which encodes a mammalian KAT enzyme; and (c) an isolated DNA sequence differing from the isolated DNA sequences of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a KAT enzyme.

A second aspect of the present invention relates to vectors comprising a cloned DNA sequence as given above.

A third aspect of the present invention are host cells transformed with a vector as given above.

A fourth aspect of the present invention is an oligonucleotide probe capable of selectively hybridizing to a DNA comprising a portion of a gene coding for a KAT enzyme.

A fifth aspect of the present invention is isolated and purified KAT enzyme which is coded for by a DNA sequence selected from the group consisting of: (a) isolated DNA sequences which encode rat KAT; (b) an isolated DNA sequence which hybridizes to an isolated DNA sequence of (a) above and which encodes a mammalian KAT enzyme; and (c) an isolated DNA sequence differing from the isolated DNA sequences of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a KAT enzyme.

FIG. 1 Partial amino acid sequence of rat KAT: N-terminus of mature KAT (SEQ ID NO:14), a CNBr fragment (SEQ ID NO:15), tryptic fragment 112 of KAT (SEQ ID NO:16) and tryptic fragment 130 of KAT (SEQ ID NO:17).

FIGS. 2A-2C nucleotide sequence and deduced amino acid sequence of rat KAT (cDNA-1) (SEQ ID NO:18). The putative pyridoxal phosphate binding site, Ser--Ala--Gly--Lys--Ser--Phe, is underlined. Triplets differing from rat .beta.-lyase cDNA (Perry et al, supra) are boxed.

FIGS. 3A-3D nucleotide sequence and deduced amino acid sequences of rat KAT (cDNA-2) (SEQ ID NO:19). Two proteins can be synthesized: one starting from nucleotide 619 and including a putative mitochondrial targeting peptide, the other beginning at the same ATG starting codon as in the case of cDNA-l. The putative pyridoxal phosphate binding site, Ser--Ala--Gly--Lys--Ser--Phe, is underlined. Triplets differing from rat .beta.-lyase CDNA (Perry et al, supra) are boxed.

FIGS. 4A-4D nucleotide sequence and deduced amino acid sequences of rat KAT (cDNA-3) (SEQ ID NO:5). The sequence of cDNA-3 is identical to that of CDNA-1 except for an insertion of 208 base pairs in the 5'-untranslated region. The insertion creates an additional stretch of 34 amino acids in frame with the cDNA-1 deduced protein sequence. The insertion of these 208 base pairs occurs between nucleotide 237 and 238 of the cDNA-1 sequence.

FIGS. 5A and 5B cytosolic enzyme activities in transfected COS-1 cells: 5A, glutamine transaminase K activity; 5B, kynurenine transaminase activity. Sense: pSVL-KAT transfected COS-1 cells where cDNA-1 is in the sense orientation. Antisense: PSVL-KAT transfected COS-1 cells were cDNA-1 is in reverse orientation. Each value is the mean of three separate experiments.

FIG. 6 Partial amino acid sequence of human KAT I: tryptic fragments F11 (SEQ ID NO:2); F13 (SEQ ID NO:3); and F14 (SEQ ID NO:4) of the human KAT I.

FIGS. 7A-7C nucleotide sequence and deduced amino acid sequence of human KAT I (SEQ ID NO:1).

Amino acid sequences disclosed herein are presented in the amino to carboxy direction, from left to right. The amino and carboxy groups are not presented in the sequence. Nucleotide sequences are presented herein by single strand only, in the 5' to 3' direction, from left to right. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by three letter code.

The kynurenine aminotransferase enzyme of the present invention includes proteins homologous to, and having essentially the same biological properties as, the protein coded for by the nucleotide sequences herein disclosed. This definition is intended to encompass natural allelic variants of KAT sequence.

Cloned genes of the present invention may code for KAT of any species of origin, but preferably code for enzymes of mammalian origin. Thus, DNA sequences which hybridize to the sequences given in FIGS. 2A-2C (SEQ ID NO:18), 3A-3D (SEQ ID NO:19), 4A-4D (SEQ ID NO:5) and 7A-7C (SEQ ID NO:1) and which code for expression of KAT are also an aspect of this invention. Conditions which will permit other DNA sequences which code for expression of KAT to hybridize to the sequences given in FIGS. 2A-2C (SEQ ID NO:18), 3A-3D (SEQ ID NO:19), 4A-4D (SEQ ID NO:5) and 7A-7C (SEQ ID NO:1) can be determined in a routine manner. Further, DNA sequences which code for polypeptides coded for by the sequences given in FIGS. 2A-2C (SEQ ID NO:18), 3A-3D (SEQ ID NO:19), 4A-4D (SEQ ID NO:5) and 7A-7C (SEQ ID NO:1) or sequences which hybridize thereto and code for a KAT enzyme, but which differ in codon sequence from these due to degeneracy of the genetic code, are also an aspect of this invention. The degeneracy of the genetic code, which allows different nucleic acid sequences to code for the same protein or peptide, is well known in the literature. See, e.g., Toole et al, U.S. Pat. No. 4,757,006 at column 2, Table 1.

DNA which encodes the KAT enzyme may be obtained by a variety of means well known to the expert in the art and disclosed by, for example, Maniatis et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989).

For example, DNA which encodes the KAT enzyme may be obtained by screening of mRNA or genomic DNA with oligonucleotide probes generated from the KAT enzyme gene sequence information provided herein. Probes may be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with known procedures and used in conventional hybridization assays, as described by, for example, Maniatis et al, supra.

KAT gene sequences may alternatively be recovered by use of the polymerase chain reaction (PCR) procedure, with the PCR oligonucleotide primers described herein or with oligonucleotide primers being produced from the KAT enzyme sequences provided herein. See Mullis et al, U.S. Pat. No. 4,683,195; and Mullis, U.S. Pat. No. 4,683,202. The PCR reaction provides a method for selectively increasing the concentration of a particular nucleic acid sequence even when that sequence has not been previously purified and is present only in a single copy in a particular sample. The method can be used to amplify either single- or double-stranded DNA. The essence of the method involves the use of two oligonucleotide probes to serve as primers for the template-dependent, polymerase mediated replication of a desired nucleic acid molecule.

The recombinant DNA molecules of the present invention can be produced through any of a variety of means well known to the expert in the art and disclosed by, for example, Maniatis et al, supra. In order to replicate the KAT enzyme DNA sequences, these must be cloned in an appropriate vector. A vector is a replicable DNA construct. Vectors are used herein either to amplify DNA encoding the KAT enzyme and/or to express DNA which encodes the KAT enzyme. An expression vector is a replicable DNA construct in which a DNA sequence encoding the KAT enzyme is operably linked to suitable control sequences capable of effecting the expression of the KAT enzyme in a suitable host. DNA regions are operably linked when they are functionally related to each other. For example: a promoter is operably linked to a coding sequence if it controls the transcription of the sequence. Amplification vectors do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants.

DNA sequences encoding the KAT enzyme may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or staggered-ended termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulation are disclosed by Maniatis et al, supra and are well known in the art.

Expression of the cloned sequence occurs when the expression vector is introduced into an appropriate host cell. If a prokaryotic expression vector is employed, then the appropriate host cell would be any prokaryotic cell capable of expressing the cloned sequences, for example E. coli. Similarly, if an eukaryotic expression vector is employed, then the appropriate host cell would be any eukaryotic cell capable of expressing the cloned sequence. A yeast host may be employed, for example S. cerevisiae. Alternatively, insect cells may be used, in which case a baculovirus vector system may be appropriate. Another alternative host is a mammalian cell line, for example COS-1 cells.

The need for control sequences into the expression vector will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. Vectors useful for practicing the present invention include plasmids, viruses (including phages), retroviruses, and integratable DNA fragments (i.e., fragments integratable into the host genome by homologous recombination). The vectors replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.

Expression vectors should contain a promoter which is recognized by the host organism. The promoter sequences of the present invention may be either prokaryotic, eukaryotic or viral. Example of suitable prokaryotic sequences include the P.sub.R and P.sub.L promoters of bacteriophage lambda (Hershey, The Bacteriophage Lambda, Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1973); and Hendrix, Lambda II, Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1980)); the trp, recA, heat shock, and lacZ promoters of E. coli and the SV40 early promoter. (Benoist et al, Nature, 290:304-310 (1981)).

As far as the Shine-Dalgarno sequence is concerned, preferred examples of suitable regulatory sequences are represented by the Shine-Dalgarno of the replicase gene of the phage MS-2 and of the gene cII of bacteriophage lambda. The Shine-Dalgarno sequence may be directly followed by the DNA encoding KAT and result in the expression of the mature KAT protein.

Alternatively, the DNA encoding KAT may be preceded by a DNA sequence encoding a carrier peptide sequence. In this case, a fusion protein is produced in which the N-terminus of KAT is fused to a carrier peptide, which may help to increase the protein expression levels and intracellular stability, and provide simple means of purification. A preferred carrier peptide includes one or more of the IgG binding domains of Staphylococcus protein A. Fusion proteins comprising IgG binding domains of protein A are easily purified to homogeneity by affinity chromatography, e.g., on IgG-coupled Sepharose. A DNA sequence encoding a recognition site for a proteolytic enzyme such as enterokinase, factor X or procollagenase may immediately precede the sequence for KAT to permit cleavage of the fusion protein to obtain the mature KAT protein.

Moreover, a suitable expression vector includes an appropriate marker which allows the screening of the transformed host cells. The transformation of the selected host is carried out using any one of the various techniques well known to the expert in the art and described in Maniatis et al, supra.

One further embodiment of the invention is a prokaryotic host cell transformed with the said expression vector and able to produce, under appropriate culture conditions, the KAT of the invention.

Cultures of cells derived from multicellular organisms are a desirable host for recombinant KAT synthesis. In principal, any eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture, including insect cells. Propagation of such cells in cell culture has become a routine procedure. See Kruse et al, Tissue Culture, Eds., Academic Press (1973). Examples of useful host cell lines are HeLa cells, CHO and COS cell lines. The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate and invertebrate cells are often provided by viral sources. For example, commonly used promoters are derived from Adenovirus 2, polyoma and SV40. See, e.g. U.S. Pat. No. 4,599,308.

An origin of replication may be provided either by construction of the vector to include an exogenous origin or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter may be sufficient.

Rather than using vectors which contain viral origins of replication, one can transform mammalian cells by the method of cotransformation with a selectable marker and the KAT DNA. An example of a suitable marker is dihydrofolate reductase (DHFR) or thymidine kinase. See U.S. Pat. No. 4,399,216.

Cloned genes and vectors of the present invention are useful to transform cells which do not ordinarily express KAT to thereafter express this enzyme. Such cells are useful as intermediates for making recombinant KAT preparations useful for drug screening.

Moreover, genes and vectors of the present invention are useful in gene therapy. For such purposes, adenovirus vectors as well as retroviral vectors as described in Temin et al, U.S. Pat. No. 4,650,764 and Miller, U.S. Pat. No. 4,861,719 may be employed.

Cloned genes of the present invention, and oligonucleotides derived therefrom, are useful for screening for restriction fragment length polymorphism (RFLP) associated with certain disorders.

Oligonucleotides of the present invention are useful as diagnostic tools for probing KAT gene expression in various tissues. For example, tissue can be probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiography techniques to investigate native expression of this enzyme or pathological conditions relating thereto.

Genetically modified (transfected) cells have been successfully used for cerebral implantation. Cells transfected with the KAT gene can be useful for delivering kynurenic acid (or any other KAT product; see below) to the brain. This may prove to be an attractive means to circumvent the blood-brain barrier for kynurenic acid through peripheral administration of kynurenine (or any appropriate substrate of KAT; see below).

Transfected cells expressing large quantities of KAT are also useful for the production of neuroactive kynurenic analogs. For example, KAT is capable of forming the potent NMDA receptor antagonist and neuroprotectant 7-chlorokynurenic acid from its bioprecursor L-4-chlorokynurenine (J. Med. Chem., 37:334-336 (1994)).

The present invention is explained in greater detail in the following examples. These examples are intended to be illustrative of the present invention, and should not be constructed as limiting thereof.

Protein Purification

Rat KAT was prepared essentially as described by Okuno et al, Brain Res., 534:37-44 (1990). The enzyme eluted from a Sephacryl S-200 column was separated by HPLC on a reverse-phase column (SC18, 250.times.4.6 mm, Japan Spectro. Co. Ltd). Elution was performed with a gradient of solvent A (70% vol/vol) acetonitrile in 0.1% trifluoroacetic acid (TFA)) and solvent B (0.1% TFA) applied for 40 min at a flow rate of 1 ml/min.

Trypsin and CNBr Digestion and Fragment Purification

500 pmoles of HPLC-purified rat KAT sample were digested by trypsin as described (Hugli, In: Techniques In Protein Chemistry, Eds., Academic Press, Inc., pages 377-391 (1989)) and by CNBr. These samples were subjected to reverse-phase HPLC after digestion and the resulting peaks collected.

Amino Acid Sequence Analysis

Sequence analysis was performed essentially as described (Fabbrini et al, FEBS Lett., 286:91-94 (1991)). FIG. 1 shows the partial amino acid sequence of rat KAT: N-terminus of mature KAT, (SEQ ID NO:14) a CNBr fragment (SEQ ID NO:15), tryptic fragment 112 of KAT (SEQ ID NO:16) and tryptic fragment 130 of KAT (SEQ ID NO:17).

RNA extraction

Total RNA from rat kidney was extracted from small quantities of tissue according to the instruction of RNAzol.TM. method (RNAzol-Cinna/Biotex Lab., Tex., U.S.A.).

First Strand cDNA Synthesis

First strand CDNA was synthesized from 3 mg of total RNA using 2 mg oligo polydT (18 pb), 4 ml of dNTP (2.5 mM), 8 ml of AMV buffer (TrisHCl pH8.8 250 mM/ KCl 200 mM/MgCl.sub.2 50 mM/ DTT 20 mM) in a final volume of 38.75 ml. The solution was boiled for 3 min at 65.degree. C. and then placed on ice for 10 min; 0.75 ml of RNAsin (40 .mu./ml Promega) and 0.5 ml of AMV Reverse transcriptase (25 .mu./ml Boehringer Mannheim,GmbH, Germany) were added to the cold solution. The reaction was carried on at 42.degree. C. for 2 h.

Design and Synthesis of Degenerated Oligonucleotides

Since the relative position of tryptic fragments 112 and 130 along the rat KAT primary structure was unknown, four degenerated oligonucleotides each 26 bp, were designed and synthesized using a DNA/RNA synthesizer (380B Applied Biosystems). The product of the reactions was purified on Sephadex G50 (Nap 25 Column, Pharmacia).

The sense orientation oligonucleotide, OligoA: (AAYYTNTGYCARCARCAYGAYGTNGT) (SEQ ID NO:20), and the anti-sense orientation oligonucleotide, OligoC: (ACNACRTCRTGYTGYTGRCANARRTT) (SEQ ID NO:21), were based on the peptide sequence Asn--Leu--Cys--Gln--Gln--His--Asp--Val--Val (residues 7-15 of fragment 130 (SEQ ID NO:17)). The sense orientation oligonucleotide, OligoB: (ACNGANARRTTYTGRTCXATNCCRTC) (SEQ ID NO:22), and the corresponding anti-sense oligonucleotide, OligoD: (GAYGGNATZGAYCARAAYYTNTCNGT) (SEQ ID NO:23), were based on the peptide sequence Asp--Gly--Ile--Asp--Gln--Asn--Leu--Ser--Val (residues 3-11 of fragment 112 (SEQ ID NO:16)) (N=T/C/A/G; Z=T/C/A; R=A/G; Y=T/C; X=T/G/A).

Polymerase Chain Reaction Condition

The first strand CDNA was divided in two aliquots and amplified by PCR as described below. The two oligonucleotide mixtures PCR1: oligoA and oligoD and PCR2: OligoB and OligoC were used as primers in the PCR reactions. 70 ng of template CDNA were combined with 10 mg of each set of primers, 10 ml of 10.times. Taq polymerase buffer (500 mM KCl/100 mM Tris--HCl, pH 8.3), 8 ml of 25 mM MgCl.sub.2, 8 ml of a dNTP solution (2.5 mM dNTP) and 0.5 ml (2.5 units) of Taq DNA polymerase (Perkin Elmer Cetus). The volume was brought to 100 ml with H.sub.2 O and the mixture was overlayed with mineral oil to prevent evaporation. The tube was heated to 94.degree. C. for 3 min, denaturation was carried out for 3 minutes at 94.degree. C., annealing for 2 min at 60.degree. C. and polymerization for 2 min and 30 seconds at 72.degree. C. The cycle was repeated 30 times.

A specific amplification product was observed only with PCR1. The product of the amplification was a DNA molecule of about 550 bp. The PCR1-amplification product was re-amplified using a new set of oligos, basically with the same sequence of oligoA and oligoc with SalI linkers and 5'-extra nucleotides. OligoE: (GCTAGTCGACACNACRTCRTGYTGYTGRCANARRTT) (SEQ ID NO:24) complementary to nucleotides coding for peptide 130 (SEQ ID NO:17) and OligoF: (GATCGTCGACGAYGGNATZGAYCARAAYYTNTCNGT) (SEQ ID NO:25) corresponding to nucleotides coding for peptide 112 (SEQ ID NO:16).

After PCR amplification, the resulting DNA fragment was digested overnight with the restriction enzyme SalI and ligated into the SalI site of the cloning plasmid pUC18 (Yanisch-Perron et al, Gene, 33:103-119 (1985)). The recombinant plasmid was extracted according to the instruction of the Qiagen Plasmid Maxi Protocol, precipitated with PEG, and denatured with NaOH 2 N.

Sequencing was carried out with universal and forward primers and subsequently with a series of synthetic oligonucleotide primers according to the dideoxy chain termination method (Sanger et al, Proc. Natl. Acad. Sci. USA, 74:5463-5467 (1977)) using Sequenase (United States Biochemicals Corp., Cleveland, Ohio).

Both strands of the insert were sequenced revealing an open reading frame of 196 amino acids. Part of the two rat KAT peptides that were sequenced are encoded by the corresponding 588 bp open reading frame. This open reading frame is used as probe in the cDNA library screening described in Example 3.

About 500,000 recombinant phages of .lambda.gt11 rat kidney CDNA library (Clontec Laboratories, USA) were plated on a lawn of E. coli Y1090 cells. After an overnight growth at 37.degree. C. the recombinant phages were transferred to duplicate nitrocellulose filters; their DNA was then denatured, neutralized and baked under vacuum at 80.degree. C. for 2 h. Prehybridization was carried out at 60.degree. C. for 4 h in 6.times.SSC, 5.times. Denhardt's, 1% SDS, 200 .mu.g/ml salmon sperm DNA. The filters were then hybridized overnight at 60.degree. C. in the same mixture with the addition of about 1.5.times.10.sup.6 cpm/ml of labeled probe (see Example 2).

The probe was labeled with (.sup.32 p) dCTP by Multiprime DNA labeling system (Amersham), purified on Nick Column (Pharmacia) and added to the hybridizing solution.

The filters were washed at 60.degree. C. twice in 2.times.SSC, 0.1% SDS and once in 1.times.SSC, 1% SDS. Filters were exposed to Kodak X-AR film (Eastman Kodak Company, Rochester, N.Y., USA) with intensifying screen at -80.degree. C.

Positive phage plaques were isolated and screened again twice in order to isolate single clones.

Recombinant Phage DNA Extraction and Sequencing Methods

About 50,000 phages of each positive clone were plated on a lawn of E. coli Y1090 cells. After an overnight growth at 37.degree. C., phages were resuspended in SM buffer (100 mM NaCl/8 mM MgSO.sub.4 /50 mM Tris--HCl, pH 7.5/gelatin 0.001%) and chloroform 0.3%; the suspension was treated with 1 mg of RNAse and 1 mg of DNAse. Phage DNA was precipitated with PEG 10%/1 M NaCl, extracted with phenol and phenol:chloroform:iso-amyl alcohol and precipitated with PEG again.

The phage DNA was digested with EcoRI and the insert was ligated to the EcoRI site of pUC18.

The recombinant plasmid was extracted according to the instruction of Qiagen Plasmid Maxi Protocol; precipitated with PEG and denatured with 2 N NaOH.

Sequencing was carried out with universal and forward primers and subsequently with a series of synthetic oligonucleotide primers according to dideoxy chain termination method (Sanger et al, supra) using Sequenase (United States Biochemicals Corp., Cleveland, Ohio).

Three positive clones were isolated, cDNA-1, cDNA-2 and cDNA-3. Both strands of the three cDNAs were sequenced (see FIGS. 2A-2C, 3A-3D and 4A-4D).

cDNA-1 encodes a deduced protein of 423 amino acid residues, cDNA-2 encodes a deduced protein of 437 amino acid residues and cDNA-3 encodes a deduced protein of 457 amino acid residues.

The three deduced proteins differ only in their N-terminus. Moreover, the cDNA-2 and cDNA-3 clones are not homogeneous, since an alternative 5' sequence introduces an upstream ATG starting codon.

As already said, the longer proteins deduced from the cDNA-2 and cDNA-3 clones present a putative mitochondrial transit peptide in position 1 to 24 (cDNA-2) and in position 1 to 44 (cDNA-3) which is only partially present in the 423 amino acid protein.

A .lambda. ZapII human brain CDNA library (Stratagene) was screened with a probe representing the N-terminal part of the cDNA-1, encompassing a sequence from amino acid residue 11 to 197 and encoding rat kidney KAT. About 1,350,000 recombinant phages were plated on a lawn of E. coli XL1 blue cells and screening was performed as described in the Example 3.

Positive phage plaques were isolated and screened again twice in order to isolate single clones.

Recombinant Phage DNA Extraction and Sequencing Methods

E. coli XL1 blue cells were coinfected with about 10.sup.5 phage particles corresponding to the positive clone selected and 1 .mu.l of EX Assist helper phage (10.sup.6 pfu/ml). The mixture was incubated at 37.degree. C. for 15 min and later incubated with 3 ml of LB for 3 h. Cells were spun down and the supernatant was heated 70.degree. C. for 15 min. SORL cells at OD600=1 were mixed with the supernatant containing the phagemid pBluescript and incubated for 15 min at 37.degree. C. and plated on LB-ampicillin plates (50 .mu.g/ml). Single clones were incubated overnight in LB-ampicillin and DNA was extracted according to the instruction of the Qiagen Plasmid Maxi Protocol, then precipitated with PEG and denaturaed with NaOH 2 N. Sequencing was carried out with universal and forward primer and subsequently with a series of synthetic oligonucleotide primers according to the dideoxy chain termination method (Sanger et al, supra) using Sequenase (United States Biochemicals Corp., Cleveland, Ohio).

Unfortunately none of the positive clones contained a full length sequence. Therefore, in order to isolate the 5' missing sequence, a RACE protocol was performed.

5' PCR Race

0.5 .mu.g of polyA+RNA from human brain was reverse transcribed with a primer (5'-CAGGGCCTGGAAGGCTGTGA-3') (SEQ ID NO:6) located at the N-terminal part of the longest cDNA clone isolated from the human brain cDNA library. Reaction was carried out as described in Example 2. 20 .mu.l of the product was precipitated and resuspended in a mixture containing DATP 0.2 mM, buffer tailing (0.1 M potassium cacodylate pH 6.8, 1 mM CoCl.sub.2, 100 mM DTT, 100 .mu.g/ml BSA) and 15 U TdT enzyme (Gibco BRL). After incubation at 37.degree. C. for 10 min, water was added to a final reaction volume of 250 .mu.l. CDNA was mixed with 25 pmol of oligo (5'-ATAGCCACCAACAGTCACCA-3') (SEQ ID NO:7), 10 pmol of oligo (5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3') (SEQ ID NO:8) and 25 pmol of oligo (5'-GACTCGAGTCGACATCGA-3') (SEQ ID NO:9), 10 .mu.l of 10.times. Taq polymerase buffer (500 mM KCl/100 mM Tris--HCl, pH 8.3), 8 .mu.l of 25 mM MgCl.sub.2, 8 .mu.l of a dNTP solution (2.5 mM dNTP). The volume was brought to 100 .mu.l with H.sub.2 O. The tube was heated at 95.degree. C. for 7 min and 0.5 .mu.l (2.5 U) of Taq polymerase (Perkin Elmer Cetus) were added. Annealing was carried out for 2 min at 58.degree. C. and polymerization for 2.5 min at 72.degree. C. The cycle was repeated 40 times. PCR products were blotted on a nitrocellulose filter and hybridized as described in Example 3 with a oligonucleotide probe (5'-ACCACTGACGAAGATCCTGGCAAGTTTCTTTGGGGAGC-3') (SEQ ID NO:10), based on the known sequence of the partial CDNA human clone. Probe was labeled with (.lambda..sup.32 p) dATP by T4 polynucleotide Kinase (Boehringer) and purified on a Nap5 column (Pharmacia). A positive band (330 bp), termed 5'-hKAT, was re-amplified using an oligo with SalI linkers then cloned in pUC18. DNA sequencing was performed on both strands confirming correspondence between the PCR fragment and the missing 5'-part of the human KAT clone.

The expression plasmid encoding rat KAT was constructed as follows: to remove the 5' and the 3' untranslated sequences, as well as the putative mitochondrial targeting peptide, PCR amplification was performed using two specific oligonucleotides with XhoI linkers. The sense orientation oligonucleotide (5'-TGTCCTCGAGACCATGACCAAACGGCTGCAGGCTCGGA-3') (SEQ ID NO:26) begins at +241 of cDNA-1, whereas the antisense-orientation oligonucleotide (5'-GTACCTCGAGTCAGGGTTGGAGCTCTTTCCACTTG-3') (SEQ ID NO:27) complements the sequence starting from the end of the coding sequence. The XhoI-digested fragment, after being confirmed by sequencing, was cloned into the XhoI site of pSVL expression vector (Pharmacia Biotechnology).

The expression plasmid encoding human KAT was constructed as follows. In order to join the two cDNA fragments corresponding to the full length sequence of human KAT, two different PCR reactions were carried out. 5' hKAT was amplified by PCR using two specific oligonucleotides: a sense primer with XhoI linker (TGTCCTCGAGACCATGGCCAAACAGCTC) (SEQ ID NO:11) and as reverse primer (CAGGGCCTGGAAGGCTGTGA) (SEQ ID NO:6) the oligonucleotide used for the reverse transcription of Race (see Example 4). The partial CDNA sequence coding for human KAT obtained after cDNA library screening (Example 4) was PCR amplified using two primers flanking the cloning site: sense primer (GTAATACGACTCACTATAGGGC) (SEQ ID NO:12) and reverse primer (TGTCCTCGAGCGCTCTAGAACTAGTGGATC) (SEQ ID NO:13). The two PCR product were were digested with ApaI, linked together, digested XhoI and cloned into the PSVL vector. COS-1 cells were transfected with 10 .mu.g of pSVL-ratKAT plasmid or pSVL-humanKAT by the calcium phosphate method (Maniatis et al, supra). 72 h after transfection, cells were disrupted by freezing and thawing, and after centrifugation, the supernatant was tested for KAT, glutamine transaminase K and cysteine conjugate .beta.-lyase activities.

Kynurenine transaminase assay

The reaction mixture (100 .mu.l) contained 70 .mu.M pyridoxal phosphate, 5 mM pyruvate, 3 mM kynurenine, and KAT sample in 0.17 M potassium phosphate buffer, pH 8.1, and was incubated at 37.degree. C. for 1 h and 30 min. Reaction was stopped by adding 20 .mu.l TCA 50% and the precipitate was removed by centrifugation. The supernatant was analyzed by HPLC with a C18 column (Vydac 201TP54, 25.times.4.6 cmxmm) at 1 ml/min, equilibrated with 5 mM acetic acid, 5% methanol, 0.1% heptane sulfonic acid, pH 3.0; kynurenic acid was eluted with 5OmM acetic acid, 5% methanol, 0.5% heptane sulfonic acid, pH 4.5. Absorbance at 243 nm was measured.

Glutamine Transaminase K Assay

Glutamine transaminase K activity was measured as described by Cooper and Meister (Methods Enzymol., 113:344-349 (1985)).

Cysteine Conjugate .beta.-lyase Assay

The .beta.-lyase assay was a coupled assay as described by Abraham and Cooper (1991). The product of the .beta.-lyase reaction (pyruvate) was assayed by measuring the oxidation of NADH during the transformation of pyruvate to lactate catalyzed by alanine dehydrogenase. The reaction mixture (200 ml in a microtiter plate) contained 2 mM S-(1,2-dichlorovinyl)-L-cysteine (DCVC), 0.5 mM MTB, 0.1 mM PLP and the enzyme in 100 mM Tris buffer pH 8.8, and was incubated at 37.degree. C. for 5, 10, 15 min prior the addition of 0.3 mM NADH, 7.3 U/ml alanine dehydrogenase, and ammonium acetate 0.1 M. Absorbance at 340 nm was measured using a microplate reader (Cerves uv900) and NADH concentration was calculated using a .epsilon.l=4200 M.sup.-1.

Human KAT was prepared essentially as described by Baran et al, J. Neurochem., 62:730-738 (1994).

500 pmoles of the purified human KAT sample were digested by trypsin as described (Hugli, In: Techniaues in Protein Chem., pages 377-391, Eds., Academic Press, Inc., (1989)). Briefly, human KAT was desalted using SMART system equipped with a Fast desalting column equilibrated in 10 mM ammonium bicarbonate. After the chromatography step, the sample was concentrated to a final volume of % ml. Cysteine residues in the molecule were reduced in 8 M urea, 10 mM DTT at 50.degree. C. for 15 min then the alkylation was carried out with 20 mM iodoacetic acid for 15 min at room temperature. After this time the sample solution was diluted to have a final urea concentration of 2 M and the sample was digested overnight with trypsin (Boehringer) (enzyme:substrate ratio 1:25). Peptides resulting from digestion were analyzed by RP-HPLC using a Vydac C18 column and a linear gradient from 5 to 65% eluent B during 60 min, where eluent A was 0.1% trifluoroacetic acid (TFA) in water and eluent B was 0.07% TFA, 95% acetonitrile. Eluted peaks were manually collected, concentrated using a vacuum speedvac (Savant) and then loaded onto a 477 N-terminal protein sequencer (ABI, Perkin Elmer) for protein sequence determination.

Sequence analysis was performed essentially as described (Fabbrini et al, FEBS Lett., supra). FIG. 6 shows the amino acid sequence of three peptides of human KAT, namely F11 (SEQ ID NO:2), F13 (SEQ ID NO:3) and F14 (SEQ ID NO:4).

While the invention has been described in detail, and with reference to specific embodiments thereof, it will be apparent to one of ordinary skill in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.