US 6,054,313 AGrant
Nucleic Acid and Amino Acid Sequences for Mammalian Sulfonylurea Receptor
Issue Date:2000-04-25
•9 Claims
•13 Drawing Sheets
Abstract
Sulfonylurea receptor nucleic acid and amino acid sequences are disclosed. The invention is also directed to expression vectors comprising the nucleic acid sequences and to isolated host cells that express the nucleic acid sequences.
Metadata
Assignee
- Baylor College of Medicine
Inventors
- Joseph Bryan
- Lydia Aguilar Bryan
- Daniel Nelson
Application Information
Application Number:US 4885465
Filing Date:1995-06-07
Priority Date:1994-04-13
Art Unit:162
Classifications
IPC:
C12N 500C12N 1500C07H 2104C07K 100
Field of Search:
53643553023.5320.1;69.1;172.1;172.3;325;361;375;252.3;455350
Patent Drawings (13 sheets)
Description
BACKGROUND OF THE INVENTION
Sulfonylureas are oral hypoglycemics widely used in the treatment of Non-Insulin Dependent Diabetes Mellitus (NIDDM). They enter the bloodstream, bind with high affinity to a pancreatic .beta.-cell plasma membrane protein termed the sulfonylurea receptor, and stimulate insulin release. The mechanism of stimulation is thought to be through inhibition of an ATP-sensitive K+ channel (K.sub.ATP), a key protein which sets the .beta.-cell resting membrane potential (Ashcroft, et al. Cell. Signal. 1990, 2, 197-214, all references cited herein are incorporated by reference in their entirety). A reduction in potassium outflow causes depolarization of the plasma membrane, activation of L-type voltage-dependent calcium channels (VDCCs), and increased cytosolic calcium. This triggers insulin release by as yet unknown mechanisms (Rajan, et al. Diabetes Care 1990, 13, 340-363). In NIDDM patients on sulfonylureas, the consequent reduction in blood glucose to more normal levels is thought to be critical in controlling the disease (Gerich, J. E. New Engl. J. Med. 1989, 321, 1231-1245).
The biochemistry of the sulfonylurea receptor (SUR) (Ashcroft et al Biochem. Biophys Acta 1992, 1175, 45-49 and Panten et al. Horm. Metab. Res. 1992, 24, 549-554) is consistent with the electrophysiology of the .beta.-cell K.sub.ATP channel. The endogenous regulators of channel activity include cytosolic nucleotides (ATP and Mg-ADP) and possibly phosphorylation. In the absence of cytosolic nucleotides, sulfonylureas weakly inhibit channel activity (Schwanstecher et al. Br. J. Pharmacol 1992, 107, 87-94). When channels are activated by Mg-ADP, inhibition by ATP is strongly promoted by the presence of sulfonylureas. These results are interpreted as evidence that simultaneous occupancy of two nucleotide binding sites is required for effective channel inhibition by the sulfonylureas. The reported allosteric interactions correlate well with evidence that the brain receptor has two nucleotide binding sites (de Weille, et al. J. Biol. Chem 1992, 267, 4557-4563) physically located on the same polypeptide chain as the sulfonylurea binding site (Bernardi et al. Biochemistry 1992, 31, 6328-6332). One binding site appears to be specific for ATP, and is proposed to be the same site at which micromolar concentrations of ATP inhibit the K.sub.ATP channel. A second site has high affinity for Mg-ADP, with occupancy at this site promoting channel opening. Absolute concentrations of ATP and ADP in the cell are thought to regulate channel activity in a straightforward fashion (Hopkins et al. J. Membrane Biol. 1992, 129, 287-295). High ATP concentrations as a result of high serum glucose levels close the channel, stimulating insulin secretion. Reduced glucose levels increase intracellular ADP concentrations, and thereby increase the open channel probability, and decrease insulin secretion.
Although sulfonylureas, particularly tolbutamide and more potent second generation drugs like glyburide and glipizide, are considered to be relatively specific inhibitors of the K.sub.ATP channel, the exact relationship between the sulfonylurea receptor and the K.sub.ATP channel is not clear (Nichols et al. Am. J. Physiol. 1991, 261, H1675-H1686, Takano et al. Progress in Neurobiology 1993, 41, 21-30, and Edwards et al. Annu. Rev. Pharmacol. Toxicol. 1993, 33, 597-637). In the insulin-secreting CRI-G1 cell line, the addition of glyburide, or tolbutamide to inside-out plasma membrane patches inhibits the K.sub.ATP channel (Khan et al. Proc. R. Soc. Lond. B. 1993, 253, 225-231), intimating direct interactions between sulfonylureas and the channel protein. In another insulin secreting cell line, CRI-G11 cells, however, the loss of sulfonylurea binding sites with the retention of K.sub.ATP activity suggests these two activities may uncouple and reside on separate, transiently bound subunits (Khan et al. Proc. R. Soc. Lond. B. 1993, 253, 225-231). Similarly, in other cell and tissue types, sulfonylurea binding and channel activity may be uncoupled (Ashford et al Br. J. Pharmac. 1990, 101, 531-540). A technique is not currently available to assess whether K.sub.ATP activity resides within the same polypeptide containing the putative nucleotide and sulfonylurea binding sites, or on separate loosely, or tightly bound subunits.
A previous attempt to purify the receptor from hamster insulin-secreting tumor (HIT) cells was limited by the low abundance of the receptor and the presence of a more abundant co-purifying protein. Aguilar-Bryan, L., et al., JBC, 1990, 265, 8218.
The sulfonylurea receptor is the target for drugs used in the treatment of type II diabetes (non-insulin diabetes mellitus). This association has suggested it plays a role in the regulation of insulin secretion by glucose and makes the sulfonylurea receptor a potential diabetes candidate gene.
Persistent hyperinsulinemic hypoglycemia of infancy (PHHI) is an autosomal recessive disorder of glucose homeostasis characterized by unregulated secretion of insulin and profound hypoglycemia. A. Aynsley-Green et al., Arch. Dis. Child. 1981, 56, 496. The pathophysiology of this disease remains obscure, but in vitro studies suggest a defect of glucose-regulated insulin secretion in pancreatic islet .beta.-cells. Aynsley-Green et al., supra., N. Kaiser et al., Diabetologia 1990, 33, 482. The incidence of PHHI has been estimated at 1/50,000 live births in a randomly mating population. G. J. Bruining, Curr. Opin. Pediatr. 1990, 2, 758. However, in a Saudi Arabian population in which 51% of births occurred to parents who were first or second cousins, the incidence has been established as 1/2675 live births. P. M. Mathew et al., Clin. Pediatr. 1988, 27, 148. Recently, the PHHI gene was assigned to chromosome 11p1415.1 by linkage analysis. B. Glaser et al., Nature Genet. 1994, 7, 185 and P. M. Thomas, G. J. Cote, D. M. Hallman, P. M. Mathew, Am. J. Hum. Genet. 1995, 56, 416-421. Candidate genes for this disorder include those involved in the .beta.-cell glucose sensing mechanism and insulin secretion. Localization of PHHI to chromosome 11p excluded previously mapped genes involved in .beta.-cell function. Considered as a candidate was the newly cloned high-affinity SUR gene, a member of the ATP-binding cassette superfamily, and a putative subunit of the modulator of insulin secretion, the .beta.-cell ATP-sensitive potassium channel (K.sub.ATP )- S. J. Ashcroft and F. M. Ashcroft, Biochimica et Biophysica Acta, 1992, 1175, 45; U. Panten, M. Schwanstecher, and C. Schwanstecher, Horm. Metab. Res. 1992, 24, 549. The methods of the present invention map the sulfonylurea receptor to the same chromosomal location as PHHI and provide evidence that mutations in the sulfonylurea receptor are the cause of PHHI.
Accordingly, there remains a need to identify sulfonylurea receptor and sequences encoding sulfonylurea receptor which will provide:
1. a correlation between sulfonylurea receptor and one or more forms of diabetes,
2. a sequence to purify human sulfonylurea receptors,
3. an isolated sulfonylurea receptor, prepared by recombinant methods,
4. polyclonal and monoclonal antibodies and methods of preparing the same against sulfonylurea receptor,
5. information as to whether this receptor-ion channel family involves multi-subunits within each channel for channel activity,
6. gene therapy such that sequences which encode mutant sulfonylurea receptors are replaced by wild type sulfonylurea receptor sequences,
7. a method of screening to identify drugs which react with and bind to the sulfonylurea receptor,
8. non-human transgenic animals to study diabetes and PHHI, and the physiologic effects of varying levels of sulfonylurea receptor, by using an inducible promoter to regulate the expression of the sulfonylurea receptor, for example, and
9. probes, including PCR probes, for diagnosing conditions associated with the expression of a specific sulfonylurea receptor allele.
The present invention reveals that the sequence encoding the mammalian sulfonylurea receptor maps to the sequence encoding persistent hyperinsulinemic hypoglycemia of infancy.
SUMMARY OF THE INVENTION
The present invention provides sequences encoding a sulfonylurea receptor. Nucleic acid sequences, SEQ ID NOS: 4, 5, 7, and 8 are cDNA sequences to which the present invention is directed. SEQ ID NOS: 4, 5, 7, and 8 are rodent sequences (SEQ ID NOS: 4 and 5--rat, SEQ ID NOS: 7 and 8-hamster) encoding sulfonylurea receptor which functionally bind sulfonylurea. SEQ ID NOS: 1 and 2 are human sequences which encode sulfonylurea receptor. SEQ ID NOS: 2, 5, and 8 set forth DNA sequences translated into amino acid sequences, which set forth below the DNA sequence.
A further aspect of the present invention provides sulfonylurea receptor polypeptides and/or proteins. SEQ ID NOS:1, 3, 27, 28, 29 are novel polypeptides of the invention produced from nucleotide sequences encoding rat (SEQ ID NOS: 6, 27and 28), hamster (SEQ ID NOS: 9 and 29), and human (SEQ ID NOS: 1 and 3) sulfonylurea receptor, respectively. Also within the scope of the present invention is a purified sulfonylurea receptor.
The present invention also provides nucleic acid sequences encoding a sulfonylurea receptor, expression vectors comprising a nucleic acid sequence encoding a sulfonylurea receptor, transformed host cells capable of expressing a nucleic acid sequence encoding a sulfonylurea receptor, cell cultures capable of expressing a sulfonylurea receptor, and protein preparations comprising a sulfonylurea receptor.
A method of detecting persistent hyperinsulinemic hypoglycemia of infancy comprising obtaining a sample comprising patient nucleic acids from a patient tissue sample; amplifying sulfonylurea receptor specific nucleic acids from said patient nucleic acids to produce a test fragment; obtaining a sample comprising control nucleic acids from a control tissue sample; amplifying control nucleic acids encoding wild type sulfonylurea receptor to produce a control fragment; comparing the test fragment with the control fragment to detect the presence of a sequence difference in the test fragment, wherein a difference in said test fragment indicates persistent hyperinsulinemic hypoglycemia of infancy is also an embodiment of the present invention.
Other methods of the present invention include a method of detecting persistent hyperinsulinemic hypoglycemia of infancy comprising obtaining a sample comprising patient mRNA from a patient tissue sample; reverse transcribing said mRNA into cDNA to produce patient cDNA; amplifying sulfonylurea receptor specific cDNA from said patient cDNA to produce amplified patient cDNA; obtaining a sample comprising control nucleic acids from a control tissue sample; amplifying control DNA encoding wild type sulfonylurea receptor to produce control cDNA; digesting said test fragment and said control fragment with a selected endonuclease; and comparing the test fragment to the control fragment, wherein said test fragment indicates persistent hyperinsulinemic hypoglycemia of infancy.
Another embodiment of the present invention is a diagnostic kit for detecting persistent hyperinsulinemic hypoglycemia of infancy comprising in one or more containers a pair of primers, wherein one primer within said pair is complementary to a region of the sulfonylurea receptor, wherein one of said pair of primers is selected from the group consisting of SEQ ID NOS: 12-20, a probe specific to the amplified product, and a means for visualizing amplified DNA, such as and not limited to fluorescent stain, .sup.32 P, and biotin, and optionally including one or more size markers, positive and negative controls, and restriction endonucleases.
Still another embodiment of the present invention includes the primer sequences identified in SEQ ID NOS: 12-20.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A and 1B display characteristics of the purified HIT cell receptor. The radiolabeled receptor (lanes 1 and 3) cleaved with endoglycosidase F/N-glycosidase F (endo F), increases the mobility of the protein by approximately 3 kDa (lane 2). Subsequent partial V8 protease digestion (lanes 4 and 6) yielded radiolabeled fragments that also shift mobility with endo F treatment (lane 5). Each of these species has the same N-terminal sequence (left side of figure), except that receptor deglycosylation results in an Asp at residue 9. The amino acid sequences set forth in FIG. 1 are SEQ ID NOS: 33, 34, 35, 36, 37, 38, and 39.
FIG. 2A shows that antibodies against residues 10-20 specifically recognize the 140 kDa polypeptide. Purified 140 kDa polypeptide was electrophoresed on a single lane of a 6% SDS gel and transferred to Immobilon P. The Immobilon P was placed in a miniblotter and the lanes incubated as follows: Lane 1--Preimmune serum. Lane 2--Immune serum. Lane 3--Immune serum+immunogen. Lane 4--immune serum+irrelevant MAP peptide. The filter was further incubated with a second antibody (goat anti-rabbit conjugated to alkaline phosphatase) and developed with the appropriate substrates. FIG. 2B displays antibodies which recognize a polypeptide with the appropriate mobility shift following Endo F treatment. Purified receptor (lane 1) was incubated for 30 min at 37.degree. C. in the presence (lane 2), or absence (lane 3) of endoglycosidase F/N-glycosidase F, incubated with first (anti-MAP 10-20) and second antibody, and developed with substrate. The bottom panel shows the autoradiogram of the immunoblot in the top panel. FIG. 2C shows antibodies which immunoprecipitate the photolabeled 140 kDa receptor. HIT cell membranes were incubated with .sup.125 I-kDa labeled iodoglyburide, photolabeled, solubilized with 1% digitonin, centrifuged at 100,000.times.g and the supernatant (lane 1) incubated with preimmune serum (lane 2), immune serum (lane 3), immune serum+anti-MAP 10-20 (lane 4) and immune serum+irrelevant MAP peptide (lane 5). Samples were co-incubated with protein A-SEPHAROSE.RTM., beaded form of agarose polysaccharides, the beads washed with buffer, heated in the presence of pH 9 sample buffer, electrophoresed on a 6% polyacrylamide SDS gel, and an autoradiogram prepared. Results using antibodies against receptor residues 1-8 were the same as those using antibodies against residues 10-20.
Multiple antigenic peptides (MAPS) were synthesized (Posnett et al. J. Biol. Chem. 1988 263:1719-1725) and polyclonal antibodies generated in rabbits produced by standard methods (Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory 1988). Interdermal injections of 1 mg of antigen were spaced 2-3 weeks apart, and contained complete, or incomplete Freund's adjuvant.
FIG. 3 is a northern blot of total RNA from .alpha.- and .beta.-cell lines hybridized with a 2.2 kb EcoRI-Xhol fragment of the sulfonylurea receptor. Approximately 10 .mu.g of RNA from (A) .alpha.TC-6 cells, (B) HIT cells, (C) RIN cells and (D) mouse liver was analyzed using standard procedures (Ausubel et al. Current Protocols in Mol. Biol. 1994). The estimated size of the major component is approximately 5000 nucleotides.
FIG. 4 displays a hydrophobicity profile of the Rat Sulfonylurea receptor. Hydrophobicity values were determined according to Kyte and Doolittle (Kyte et al. J. Mol. Biol. 1982 157:105-132) for 11-residue peptides and are plotted versus the amino acid number. The bars marked A and B are over the Walker A and B consensus sequences (Walker et al. EMBO Jour. 1982 1:945-951).
FIG. 5 shows a schematic model of the high affinity sulfonylurea receptor. The Walker A and B sites are marked within the two nucleotide binding folds. Based on the hydrophobicity and hydrophobic moment data there are nine transmembrane spanning domains before the first nucleotide binding fold and four transmembrane spanning domains between the two folds. The branched structure at the N-terminus of the mature receptor symbolizes glycosylation.
FIG. 6A reveals the results of in vitro translation of mRNA transcribed from the rat sulfonylurea cDNA. The cDNA was subcloned into pGEM4 (Promega, Inc., Madison, Wis.) and transcribed using the SP6 promoter and SP6 RNA polymerase following the manufacturer's directions. RNA was translated in rabbit reticulocyte lysate (Promega, Inc.) following the manufacturer's recommendations for .sup.35 S-methionine. Lane 1 is the HIT cell photolabeled receptor as a marker, lane 2 is the in vitro translation product resulting from addition of receptor mRNA and lane 3 is the result of no added RNA. The arrow marks the 140 kDa protein.
FIG. 6B displays a gel of the results of immunoprecipitation of the RIN cell sulfonylurea receptors with polyclonal antibodies directed against a nucleotide binding fold domain (NBF). Lane 1: 140 and 150 kDa receptors from soluble RIN cell membrane proteins, lane 2: immunoprecipitation with preimmune serum, lane 3: immune serum from rabbit immunized with NBF2, lane 4: immune serum+NBF2 fusion protein. Sulfonylurea receptor cDNA regions encoding the NBF2 domain were subcloned in frame into pMALc and expression of the proteins fused with maltose binding protein induced in E. coli. Fusion proteins were purified by electrophoresis and electroelution, and 200 .mu.g amounts, with complete, or incomplete Freund's adjuvant, injected interdermally into rabbits using a standard 2-3 week regimen of bleeding and boosting.
FIG. 7 displays the genomic organization and of the human sulfonylurea receptor (SUR) homologue in the second nucleotide binding fragment region (NBF-2). The sequence encoding NBF-2 is located within SEQ ID NO: 1, nucleic acid positions 524 to 1048. Solid rectangles represent exons which are labeled .alpha.-.phi. for identification. The numbers between rectangles represent intronic sizes. Primers used in mutational analysis are diagrammed and listed in the arrows as Primer 17=SEQ ID NO: 13; Primer 34al=SEQ ID NO: 17; Primer 16=SEQ ID NO: 12; Primer 35 al=SEQ ID NO: 18; Primer 28 =SEQ ID NO: 14; Primer 29b=SEQ ID NO: 16; Primer 29=SEQ ID NO: 15.
FIG. 8A-D display the exon mutation in the SUR NBF-2. FIG. 8A is a schematic representation of NBF-2 exons .beta., X, .delta. illustrating the normal (upper) and mutant (lower) RNA splicing patterns SEQ ID NOS: 40, 41, 42, and 43. FIG. 8B displays the sequence of a pancreatic cDNA product, and corresponding amino acid sequence, SEQ ID NOS: 44 and 45, respectively, from an affected child of Family 6, demonstrating the exon skipping event. Skipping of exon X results in a 109 bp deletion in the mRNA transcript, a frame shift and inclusion of a premature stop codon. Single upper case letters represent amino acids. FIG. 8C shows the sequence of genomic DNA from the affected patient in FIG. 8B which reveals a G to A point mutation at the 3' end of the exon, which exon is excised in mRNA, as compared to a normal sample of genomic DNA. Exonic sequence is in upper case and intronic sequence in lower case letters SEQ ID NO: 46. FIG. 8D shows Mspl restriction enzyme analysis of PCR-amplified genomic DNA from members of Family 6, indicating affected individuals. The G to A mutation destroyed a restriction site for Mspl (C/CGG). Normal PCR product is digested into 304 bp, 85 bp, and 38 bp fragments, while that containing the mutation is digested into 304 bp and 123 bp fragments. MW is 100 bp ladder (GIBCO-BRL, Gaithersburg, Md.), UC is an uncut sample, C is a control PCR reaction lacking template.
FIG. 9A-D reveal a mutation in the intron preceding NBF-2 exon .alpha., which activates cryptic 3' splice site usage. FIG. 9A displays the sequence of genomic DNA from an affected member of Family 4 which revealed a G to A mutation in the splice site preceding the first exon of the NBF-2 SEQ ID NO 47. FIG. 9B shows Ncil restriction enzyme analysis of genomic DNA from members of Family 4, indicating affected individuals. The G to A mutation destroys a restriction site for Ncil (CC/(G/C)GG). Normal PCR product is digested into 71 bp and 75 bp fragments, while that containing the mutant sequence is not cut. MW is a molecular weight marker, UC is an uncut sample, C is a control reaction. By previous haplotype analysis, the unaffected sibling in this family had two wild type alleles, P. M. Thomas, G. J. Cote, D. M. Hallman, P. M. Mathew, Am. J. Hum. Genet., supra. FIG. 9C illustrates the constructs used to examine RNA processing of exons within NBF-2. Solid rectangles and thin lines represent human SUR gene exonic and intronic sequences, respectively. The unmarked solid rectangle represents a portion of the exon which is 5' to exon .alpha. of the NBF-2 region. The rectangle labeled RSV represents the enhancer and promoter isolated from the rous sarcoma virus long terminal repeat. The thick line represents an intronic sequence derived from vector and the human metallothionine IIA gene, which also contains polyadenylation signals. Normal and mutant RNA splicing patterns, including the location of the three cryptic splice sites, are diagrammed in the lower portion along with SEQ ID NOS: 48 and 49. The open triangle marks the position of the mutated base within the splice site. FIG. 9D shows PCR amplification across splice site of normal (N) and mutant (M) cDNA transcripts, isolated 48 hours after transfection with the splicing constructs. Subcloning and sequencing of these products revealed their identity as diagrammed in FIG. 9C. The control (C) represents cDNA amplified from untransfected cells.
FIG. 10 depicts pCR.TM. 11 vector.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to the nucleic acid and protein sequences encoding a sulfonylurea receptor. The present invention provides nucleotide sequences of a sulfonylurea receptor, and SEQ ID NOS: 5, 8, and 27. Novel polypeptide sequences, SEQ ID NOS: 6, 9, 27, 28, and 29 coding for a sulfonylurea receptor are also included in the present invention. SEQ ID NOS: 1-3 provide the nucleic acid and amino acid sequences of the last 11 exons of the 3' end of human sulfonylurea receptor, hereinafter referred to, together with the rodent sequences for sulfonylurea receptor, as sequence for the sulfonylurea receptor.
SEQ ID NOS: 5 and 8 provide the cDNA sequences of rodent sulfonylurea receptor. SEQ ID NOS: 1 and 2 provide the human cDNA and genomic DNA sequence of sulfonylurea receptor, respectively. Nucleic acids within in the scope of the present invention include cDNA, RNA, genomic DNA, sequences within these larger sequences, antisense oligonucleotides. Sequences encoding the sulfonylurea receptor also include amino acid, polypeptide, and protein sequences. Variations in the nucleic acid and polypeptide sequences of the present invention are within the scope of the present invention and include N terminal and C terminal extensions, transcription and translation modifications, and modifications in the cDNA sequence to facilitate and improve transcription and translation efficiency. In addition, mismatches within the sequences identified herein, which achieve the methods of the invention, such that the mismatched sequences are substantially complementary to the sulfonylurea receptor sequences identified, are also considered within the scope of the present invention. Mismatches which permit substantial complementarity to the sulfonylurea receptor sequences, such as similarity in residues in hydrophobicity, will be known to those of skill in the art once armed with the present disclosure. In addition, the sequences of the present invention may be natural or synthetic.
A purified sulfonylurea receptor is also provided by the present invention. The purified sulfonylurea receptor may have an amino acid sequence as provided by SEQ ID NOS: 6, 9, 27, 28, and 29.
The present invention is directed to sulfonylurea receptor sequences obtained from mammals from the Order Rodentia, including and not limited to hamsters, rats, and mice; Order Logomorpha, such as rabbits; more particularly the Order Carnivora, including Felines (cats) and Canines (dogs); even more particularly the Order Artiodactyla, Bovines (cows) and Suines (pigs); and the Order Perissodactyla, including Equines (horses); and most particularly the Order Primates, Ceboids and Simoids (monkeys) and Anthropoids (humans and apes). The mammals of most preferred embodiments are humans.
There are several transfection techniques by which a sulfonylurea receptor may be obtained. An appropriate RNA may be hybridized to a cDNA to obtain a sulfonylurea receptor nucleic acid sequence. A nucleic acid sequence encoding sulfonylurea receptor may be inserted into cells and the corresponding protein immunoprecipitated with an antibody. Labeled drugs known to bind sulfonylurea receptor protein may be added to cell culture to label the receptor. The drug labeling procedure may involve modifying cells such that the cell culture provides conditions similar to .beta. cells, cells where sulfonylurea receptors naturally appear; and the sulfonylurea receptor may be part of a larger multisubunit ATP receptor channel, which may not be provided by the cells in culture.
Generally, the sequences of the invention may be produced in host cells transformed with an expression vector comprising a nucleic acid sequence encoding the sulfonylurea receptor. The transformed cells are cultured under conditions whereby the nucleic acid sequence coding for the sulfonylurea receptor is expressed. After a suitable amount of time for the protein to accumulate, the protein is purified from the transformed cells.
A gene coding for sulfonylurea receptor may be obtained from a cDNA library. Suitable libraries can be obtained from commercial sources such as Clontech, Palo Alto, Calif. Libraries may also be prepared using the following non-limiting examples hamster insulin-secreting tumor (HIT), mouse .alpha.TC-6, and rat insulinoma (RIN) cells. Positive clones are then subjected to DNA sequencing to determine the presence of a DNA sequence coding for sulfonylurea receptor. DNA sequencing is accomplished using the chain termination method of Sanger et al., Proc. Nat'l. Acad. Sci, U.S.A., 1977, 74, 5463. The DNA sequence encoding sulfonylurea receptor is then inserted into an expression vector for later expression in a host cell.
Expression vectors and host cells are selected to form an expression system capable of synthesizing sulfonylurea receptor. Vectors including and not limited to baculovirus vectors may be used in the present invention. Host cells suitable for use in the invention include prokaryotic and eukaryotic cells that can be transformed to stably contain and express sulfonylurea receptor. For example, nucleic acid coding for the recombinant protein may be expressed in prokaryotic or eukaryotic host cells, including the most commonly used bacterial host cell for the production of recombinant proteins, E. coli. Other microbial strains may also be used, however, such as Bacillus subtilis, and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcescens, various species of Pseudomonas, or other bacterial strains.
Commonly used eukaryotic systems include yeast, such as Saccharomyces cerevisiae; insect cells, such as Spodoptera frugiperda; chicken cells, such as E3C/O and SL-29; mammalian cells, such as HeLa, Chinese hamster ovary cells (CHO), COS-7 or MDCK cells and the like. The foregoing list is illustrative only and is not intended in any way to limit the types of host cells suitable for expression of the nucleic acid sequences of the invention.
As used herein, expression vectors refer to any type of vector that can be manipulated to contain a nucleic acid sequence coding for sulfonylurea receptor, such as plasmid expression vectors and viral vectors. The selection of the expression vector is based on compatibility with the desired host cell such that expression of the nucleic acid encoding sulfonylurea receptor results. Plasmid expression vectors comprise a nucleic acid sequence of the invention operably linked with at least one expression control element such as a promoter. In general, plasmid vectors contain replicon and control sequences derived from species compatible with the host cell. To facilitate selection of plasmids containing nucleic acid sequences of the invention, plasmid vectors may also contain a selectable marker such as a gene coding for antibiotic resistance. Suitable examples include the genes coding for ampicillin, tetracycline, chloramphenicol or kanamycin resistance.
Suitable expression vectors, promoters, enhancers, and other expression control elements are known in the art and may be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), incorporated herein by reference in its entirety.
Transformed host cells containing a DNA sequence encoding sulfonylurea receptor may then be grown in an appropriate medium for the host. The cells are then grown until product accumulation reaches desired levels at which time the cells are then harvested and the protein product purified in accordance with conventional techniques. Suitable purification methods include, but are not limited to, SDS PAGE electrophoresis, phenylboronate-agarose, reactive green 19-agarose, concanavalin A sepharose, ion exchange chromatography, affinity chromatography, electrophoresis, dialysis and other methods of purification known in the art.
Protein preparations, of purified or unpurified sulfonylurea receptor produced by host cells, are accordingly produced which comprise sulfonylurea receptor and other material such as host cell components and/or cell medium, depending on the degree of purification of the protein.
Antibodies, including and not limited to monoclonal, polyclonal, and chimeric, prepared and used against a sulfonylurea receptor are also within the scope of the present invention, and may be prepared by methods known to those of skill in the art such as and not limited to the methods of Kohler and Milstein, Nature, 256: 495-497 (1975), incorporated herein by reference in its entirety.
The invention also includes a transgenic non-human animal, including and not limited to mammals, such as and not limited to a mouse, rat, or hamster, whose germ cells and somatic cells contain a sequence encoding a sulfonylurea receptor introduced into the animal or an ancestor of the animal. The sequence may be wild-type or mutant and may be introduced into the animal at the embryonic or adult stage. The sequence is incorporated into the genome of an animal such that it is chromosomally incorporated into an activated state. Embryo cells may be transfected with the gene as it occurs naturally, and transgenic animals are selected in which the gene has integrated into the chromosome at a locus which results in activation. Other activation methods include modifying the gene or its control sequences prior to introduction into the embryo. The embryo may be transfected using a vector containing the gene.
In addition, a transgenic non-human animal may be engineered wherein the sulfonylurea receptor is suppressed. For purposes of the present invention, suppression of the sulfonylurea receptor includes, and is not limited to strategies which cause the sulfonylurea receptor not to be expressed. Such strategies may include and are not limited to inhibition of protein synthesis, pre-mRNA processing, or DNA replication. Each of the above strategies may be accomplished by antisense inhibition of sulfonylurea receptor gene expression. Many techniques for transfering antisense sequences into cells are known to those of skill, including and not limited to microinjection, viral-mediated transfer, somatic cell transformation, transgene integration, and the like, as set forth in Pinkert, Carl, Transgenic Animal Technology, 1994, Academic Press, Inc., San Diego, Calif., incorporated herein by reference in its entirety.
Further, a transgenic non-human animal may be prepared such that the sulfonylurea receptor gene is knocked out. For purposes of the present invention, a knock out includes and is not limited to disruption or rendering null the sulfonylurea receptor gene. A knock out may be accomplished, for example, with antisense sequences for the sulfonylurea receptor mutating the sequence for the sulfonylurea receptor. The sulfonylurea receptor gene may be knocked out by injection of an antisense sequence for all or part of the sulfonylurea receptor sequence such as an antisense sequence for all or part of SEQ ID NO: 2. Once the sulfonylurea receptor has been rendered null, correlation of the sulfonylurea receptor to persistent hyperinsulinemic hypoglycemia of infancy may be tested. Sequences encoding mutations affecting the sulfonylurea receptor may be inserted to test alterations in glucose homeostasis.
Also in transgenic non-human animals, the sulfonylurea receptor may be replaced by preparing a construct having an insulin promoter ligated to the sulfonylurea receptor gene. This experiment permits testing of mutant sulfonylurea receptors directly in the pancreas of the transgenic animal.
Transgenic non-human animals may also be useful for testing nucleic acid changes to identify nucleotides which are responsible for ADP and ATP modulation of the sulfonylurea receptor resulting in an increase or decrease in glucose sensitivity of insulin release.
The present invention is also directed to gene therapy wherein a mutant sulfonylurea receptor is replaced by a wild type sulonylurea receptor. A resulting transgenic non-human animal thus comprises a recombinant sulfonylurea receptor. In addition, gene therapy techniques may be used for individuals with persistent hyperinsulinemic hypoglycemia of infancy. For purposes of the present invention, gene therapy refers to the transfer and stable insertion of new genetic information into cells for the therapeutic treatment of diseases or disorders. The foreign gene is transferred into a cell that proliferates to spread the new gene throughout the cell population. Known methods of gene transfer include microinjection, electroporation, liposomes, chromosome transfer, transfection techniques, calcium-precipitation transfection techniques, and the like.
Numerous techniques are known in the art for the introduction of foreign genes into cells and may be used to construct the recombinant cells for purposes of gene therapy, in accordance with this embodiment of the invention. The technique used should provide for the stable transfer of the heterologous gene sequence to the stem cell, so that the heterologous gene sequence is heritable and expressible by stem cell progeny, and so that the necessary development and physiological functions of the recipient cells are not disrupted. Techniques which may be used include but are not limited to chromosome transfer (e.g., cell fusion, chromosome-mediated gene transfer, micro cell-mediated gene transfer), physical methods (e.g., transfection, spheroplast fusion, microinjection, electroporation, liposome carrier), viral vector transfer (e.g., recombinant DNA viruses, recombinant RNA viruses) and the like (described in Cline, M. J., 1985, Pharmac. Ther. 29:69-92, incorporated herein by reference in its entirety).
The term "purified", when used to describe the state of nucleic acid sequences of the invention, refers to nucleic acid sequences substantially free of nucleic acid not coding for sulfonylurea receptor or other materials normally associated with nucleic acid in non-recombinant cells, i.e., in its "native state."
The term "purified" or "in purified form" when used to describe the state of a sulfonylurea receptor, protein, polypeptide, or amino acid sequence, refers to sulfonylurea receptor sequences free, to at least some degree, of cellular material or other material normally associated with it in its native state. Preferably the sequence has a purity (homogeneity) of at least about 25% to about 100%. More preferably the purity is at least about 50%.
To begin to elucidate the relationship between the sulfonylurea receptor and K.sub.ATP, the iodinated derivative of glyburide was used to identify, and subsequently to purify and obtain N-terminal amino acid sequence from the 140 kDa high affinity, hamster insulin-secreting tumor (HIT) cell sulfonylurea receptor. The peptide sequence data was used to clone full length cDNAs encoding the rat and hamster .beta.-cell proteins of the present invention.
Another embodiment of the present invention is a method of detecting persistent hyperinsulinemic hypoglycemia of infancy comprising obtaining a sample comprising patient nucleic acids from a patient tissue sample; amplifying sulfonylurea receptor specific nucleic acids from said patient nucleic acids to produce a test fragment; obtaining a sample comprising control nucleic acids from a control tissue sample; amplifying control nucleic acids encoding wild type sulfonylurea receptor to produce a control fragment; comparing the test fragment with the control fragment to detect the presence of a sequence difference in the test fragment, wherein a difference in said test fragment indicates persistent hyperinsulinemic hypoglycemia of infancy is also an embodiment of the present invention.
Persistent hyperinsulinemic hypoglycemia of infancy (PHHI) is an autosomal recessive disorder which results in unregulated insulin secretion. The present invention revealed several different mutations in the sulfonylurea receptor in individuals with PHHI. These mutations include nucleic acid transition and restriction fragment length polymorphism, both defined herein as sequence differences. The nucleic acid sequence transition may be a G to A transition at nucleic acid position 750 in SEQ ID NO: 1 which results in PHHI. This transition was found to occur in nine affected children in nine different families of the families studied. The pancreatic cDNA from a child with this transition involved skipping an exon. Genomic DNA template was amplified to obtain the product for Msp I digestion for testing and confirmation of the mutation at position 750 in SEQ ID NO: 1. When cDNA is amplified, the Msp I restriction site is not present. Exon X of FIG. 7 was skipped resulting in an mRNA transcript having a 109 bp deletion, a frame shift, and the inclusion of a premature stop codon. This deletion may be seen by performing rtPCR on the child's mRNA. Amplification of SEQ ID NO: 1 with primer sequences of SEQ ID NOS: 18 and 20 resulted in a 427 base pair product for the normal as well as for the mutant cDNA. Digesting the normal and mutant products with MspI, however, resulted in three fragments (304 bp, 85 bp, and 38 bp) for the normal gene and two fragments (304 bp and 123 bp) for the mutant gene of affected children.
Another mutation involves a G to A transition in intron 11 of the human sulfonylurea receptor which gives rise to PHHI. The transition site corresponds to position 27 of SEQ ID NO: 31. The G to A transition destroys a restriction site for NciI. Both normal and mutant PCR products resulted in 146 bp. Digestion with NciI resulted in two fragments (71 bp and 75 bp) fragments for normal individuals, while the mutant sequence was not be cut by NciI and thus remained at 146 bp.
A method of detecting persistent hyperinsulinemic hypoglycemia of infancy comprising obtaining a sample comprising patient genomic DNA from a patient tissue sample; amplifying sulfonylurea receptor specific DNA from said patient genomic DNA to produce a test fragment; obtaining a sample comprising control nucleic acids from a control tissue sample; amplifying control DNA encoding wild type sulfonylurea receptor to produce a control fragment; comparing the test fragment with the control fragment to detect a test fragment having G to A transition at nucleic acid position 750 of SEQ ID NO: 1, or a G to A transition at nucleic acid position 27 of SEQ ID NO: 31, wherein said test fragment indicates persistent hyperinsulinemic hypoglycemia of infancy is also an embodiment of the present invention.
Also within the scope of the present invention is a method of detecting persistent hyperinsulinemic hypoglycemia of infancy comprising obtaining a sample comprising patient genomic DNA from a patient tissue sample; amplifying sulfonylurea receptor specific DNA from said patient genomic DNA to produce a test fragment; obtaining a sample comprising control nucleic acids from a control tissue sample; amplifying control DNA encoding wild type sulfonylurea receptor to produce a control fragment; digesting said test fragment and said control fragment with an endonuclease selected from the group consisting of NciI and MspI; and comparing the test fragment with the control fragment to detect a restriction fragment length polymorphism, wherein said restriction fragment length polymorphism indicates persistent hyperinsulinemic hypoglycemia of infancy.
The restriction fragment polymorphisms include test fragments of about 304 bp and about 123 bp as a result of MspI restriction and a test fragment of about 146 bp as a result of NciI restriction using primer sequences of SEQ ID NOS: 18 and 20. The test fragments thus indicate persistent hyperinsulinemic hypoglycemia of infancy.
In accordance with methods of the present invention, methods of detecting PHHI in a patient are provided comprising obtaining a patient tissue sample for testing. The tissue sample may be solid or liquid, a body fluid sample such as and not limited to blood, serum, saliva, sputum, mucus, bone marrow, urine, lymph, and a tear; and feces. In addition, a tissue sample such as pancreatic tissue may be provided for the detection of PHHI in accordance with the present invention.
A test fragment is defined herein as an amplified sample comprising sulfonylurea receptor specific nucleic acids from a patient suspected of having PHHI. A control fragment is an amplified sample comprising normal or wild type sulfonylurea receptor specific nucleic acids from an individual not suspected of having PHHI.
The method of amplifying nucleic acids may be the polymerase chain reaction using a pair of primers wherein at least one primer within the pair is selected from the group consisting of SEQ ID NO: 12-20. When the polymerase chain reaction is the amplification method of choice, a pair of primers may be used such that one primer of the pair is selected from the group consisting of SEQ ID NOS: 13, 14, 17, and 19 and the second primer of the pair is selected from the group consisting of SEQ ID NOS: 12, 15, 16, 18, and 20.
Nucleic acids, such as DNA (such as and not limited to genomic DNA and cDNA) and/or RNA (such as and not limited to mRNA), are obtained from the patient sample. Preferably RNA is obtained. A whole blood gradient may be performed to isolate nucleated cells and total RNA is extracted such as by the RNazole B method (Tel-Test Inc., Friendswood, Tex.) or by modification of any methods known in the art such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., incorporated herein by reference in its entirety.
Nucleic acid extraction is followed by amplification of the same by any technique known in the art. The amplification step includes the use of at least one primer sequence which is complementary to a portion of sulfonylurea receptor specific expressed nucleic acids or sequences. Primer sequences useful in the amplification methods include and are not limited to SEQ ID NOS: 12-20, which may be used in the amplification methods. Any primer sequence of about 10 nucleotides to about 35 nucleotides, more preferably about 15 nucleotides to about 30 nucleotides, even more preferably about 17 nucleotides to about 25 nucleotides may be useful in the amplification step of the methods of the present invention. In addition, mismatches within the sequences identified above, which achieve the methods of the invention, such that the mismatched sequences are substantially complementary and thus hybridizable to the sequence sought to be identified, are also considered within the scope of the disclosure. Mismatches which permit substantial similarity to SEQ ID NOS: 12-20, such as and not limited to sequences with similar hydrophobicity and hydrophilicity, will be known to those of skill in the art once armed with the present disclosure. The primers may also be unmodified or modified. Primers may be prepared by any method known in the art such as by standard phosphoramidite chemistry. See Sambrook et al., supra.
The method of amplifying nucleic acids may be the polymerase chain reaction using a pair of primers wherein at least one primer within the pair is selected from the group consisting of SEQ ID NO: 12-20. When the polymerase chain reaction is the amplification method of choice, a pair of primers may be used such that one primer of the pair is selected from the group consisting of SEQ ID NOS: 12-20.
Primers used in mutational analysis were SEQ ID NO: 12: CACGCTCAGGTTCTGGAT; SEQ ID NO: 13: TCAACTGGATGGTGAGGA; SEQ ID NO: 14: 5' TGACATCGCCAAACTGC; SEQ ID NO: 15: TCCTGGCAGTGCCTTCA; SEQ ID NO: 16: TCCTCTCAGGGTCCAGGTTA; SEQ ID NO: 17: ACAAGGAGCCTGGGGAT; SEQ ID NO: 18: TGCATGGGTCCCAGTGA; SEQ ID NO: 19: TTGACCATTCACCACATTGGTGTGC; and SEQ ID NO: 20: TCCTGGCAGTGCCTTCA.
When an amplification method includes the use of two primers, a first primer and a second primer, such as in the polymerase chain reaction, the first primer may be selected from the group consisting of SEQUENCE ID NOS: 13, 14, 17, and 19; and the second primer may be selected from the group consisting of SEQUENCE ID NOS: 12, 15, 16, 18, and 20. Any primer pairs which transcribe nucleic acids toward each other and which are specific for sulfonylurea receptor may be used in accordance with the methods of the present invention.
Total extraction of RNA is preferably carried out. As used herein, the term "amplification" refers to template-dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial concentration, or in an increase in the concentration of a detectable signal. As used herein, the term template-dependent process is intended to refer to a process that involves the template-dependent extension of a primer molecule. The term template dependent process refers to nucleic acid synthesis of an RNA or DNA molecule wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the well-known rules of complementary base pairing (see, for example, Watson, J. D. et al., In: Molecular Biology of the Gene, 4th Ed., W. A. Benjamin, Inc., Menlo Park, Calif. (1987)). Typically, vector mediated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by Cohen et al. (U.S. Pat. No. 4,237,224), Maniatis, T. et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982.
A number of template dependent processes are available to amplify the target sequences of interest present in a sample. One of the best known amplification methods is the polymerase chain reaction (PCR) which is described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al., PCR Protocols, Academic Press, Inc., San Diego Calif., 1990, each of which is incorporated herein by reference in its entirety. Briefly, in PCR, two primer sequences are prepared which are complementary to regions on opposite complementary strands of the target sequence. An excess of deoxynucleoside triphosphates are added to a reaction mixture along with a DNA polymerase (e.g., Tag polymerase). If the target sequence is present in a sample, the primers will bind to the target and the polymerase will cause the primers to be extended along the target sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primers will dissociate from the target to form reaction products, excess primers will bind to the target and to the reaction products and the process is repeated. Preferably a reverse transcriptase PCR amplification procedure may be performed in order to quantify the amount of mRNA amplified. Polymerase chain reaction methodologies are well known in the art.
Another method for amplification is the ligase chain reaction (referred to as LCR), disclosed in EPA No. 320,308, incorporated herein by reference in its entirety. In LCR, two complementary probe pairs are prepared, and in the presence of the target sequence, each pair will bind to opposite complementary strands of the target such that they abut. In the presence of a ligase, the two probe pairs will link to form a single unit. By temperature cycling, as in PCR, bound ligated units dissociate from the target and then serve as "target sequences" for ligation of excess probe pairs. U.S. Pat. No. 4,883,750, incorporated herein by reference in its entirety, describes an alternative method of amplification similar to LCR for binding probe pairs to a target sequence.
Qbeta Replicase, described in PCT Application No. PCT/US87/00880, incorporated herein by reference in its entirety, may also be used as still another amplification method in the present invention. In this method, a replicative sequence of RNA which has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence which can then be detected.
An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]triphosphates in one strand of a restriction site (Walker, G. T., et al., Proc. Natl. Acad, Sci. (U.S.A.) 1992, 89:392-396, incorporated herein by reference in its entirety), may also be useful in the amplification of nucleic acids in the present invention.
Strand Displacement Amplification (SDA) is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e. nick translation. A similar method, called Repair Chain Reaction (RCR) is another method of amplification which may be useful in the present invention and which involves annealing several probes throughout a region targeted for amplification, followed by a repair reaction in which only two of the four bases are present. The other two bases can be added as biotinylated derivatives for easy detection. A similar approach is used in SDA.
Sulfonylurea receptor specific nucleic acids can also be detected using a cyclic probe reaction (CPR). In CPR, a probe having a 3' and 5' sequences of non-sulfonylurea receptor specific DNA and middle sequence of sulfonylurea receptor specific RNA is hybridized to DNA which is present in a sample. Upon hybridization, the reaction is treated with RNaseH, and the products of the probe identified as distinctive products, generate a signal which is released after digestion. The original template is annealed to another cycling probe and the reaction is repeated. Thus, CPR involves amplifying a signal generated by hybridization of a probe to a sulfonylurea receptor specific expressed nucleic acid.
Still other amplification methods described in GB Application No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of which is incorporated by reference in its entirety, may be used in accordance with the present invention. In the former application, "modified" primers are used in a PCR like, template and enzyme dependent synthesis. The primers may be modified by labelling with a capture moiety (e.g., biotin) and/or a detector moiety (e.g., enzyme). In the latter application, an excess of labelled probes are added to a sample. In the presence of the target sequence, the probe binds and is cleaved catalytically. After cleavage, the target sequence is released intact to be bound by excess probe. Cleavage of the labelled probe signals the presence of the target sequence.
Other nucleic acid amplification procedures include transcription-based amplification systems (TAS) (Kwoh D., et al., Proc. Natl. Acad. Sci. (U.S.A.) 1989, 86:1173, Gingeras T. R., et al., PCT Application WO 88/10315, each of which is incorporated herein by reference in its entirety), including nucleic acid sequence based amplification (NASBA) and 3SR. In NASBA, the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA. These amplification techniques involve annealing a primer which has sulfonylurea receptor specific sequences. Following polymerization, DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again. In either case the single stranded DNA is made fully double stranded by addition of second sulfonylurea receptor specific primer, followed by polymerization. The double stranded DNA molecules are then multiply transcribed by a polymerase such as T7 or SP6. In an isothermal cyclic reaction, the RNAs are reverse transcribed into double stranded DNA, and transcribed once against with a polymerase such as T7 or SP6. The resulting products, whether truncated or complete, indicate sulfonylurea receptor specific sequences.
Davey, C., et al., European Patent Application Publication No. 329,822, incorporated herein by reference in its entirety, disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA ("dsDNA") which may be used in accordance with the present invention. The ssRNA is a first template for a first primer oligonucleotide, which is elongated by reverse transcriptase (RNA-dependent DNA polymerase). The RNA is then removed from resulting DNA:RNA duplex by the action of ribonuclease H (RNase H, an RNase specific for RNA in a duplex with either DNA or RNA). The resultant ssDNA is a second template for a second primer, which also includes the sequences of an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5' to its homology to its template. This primer is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of E. coli. DNA polymerase I), resulting as a double-stranded DNA ("dsDNA") molecule, having a sequence identical to that of the original RNA between the primers and having additionally, at one end, a promoter sequence. This promoter sequence can be used by the appropriate RNA polymerase to make many RNA copies of the DNA. These copies can then re-enter the cycle leading to very swift amplification. With proper choice of enzymes, this amplification can be done isothermally without addition of enzymes at each cycle. Because of the cyclical nature of this process, the starting sequence can be chosen to be in the form of either DNA or RNA.
Miller, H. I., et al., PCT application WO 89/06700, incorporated herein by reference in its entirety, disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter/primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic; i.e. new templates are not produced from the resultant RNA transcripts. Other amplification methods include "race" disclosed by Frohman, M. A., In: PCR Protocols: A Guide to Methods and Applications 1990, Academic Press, New York) and "one-sided PCR" (Ohara, O., et al., Proc. Natl. Acad. Sci. (U.S.A.) 1989, 86:5673-5677), all references herein incorporated by reference in their entirety.
Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby amplifying the di-oligonucleotide (Wu, D. Y. et al., Genomics 1989, 4:560, incorporated herein by reference in its entirety), may also be used in the amplification step of the present invention.
Test fragment and control fragment may be amplified by any amplification methods known to those of skill in the art, including and not limited to the amplification methods set forth above. For purposes of the present invention, amplification of sequences encoding patient and wild type sulfonylurea receptor includes amplification of a portion of a sequence such as and not limited to a portion of the sulfonylurea receptor sequence of SEQ ID NO: 1, such as sequence of a length of about 10 nucleotides to about 1,000 nucleotides, more preferably about 10 nucleotides to about 100 nucleotides, or having at least 10 nucleotides occurring anywhere within the SEQ ID NO: 1, where sequence differences are known to occur within sulfonylurea receptor test fragments. Thus, for example, a portion of the sequence encoding the second nucleotide binding fragment (NBF-2) region of sulfonylurea receptor of a patient sample and a control sample may be amplified to detect sequence differences between these two sequences.
Following amplification of the test fragment and control fragment, comparison between the amplification products of the test fragment and control fragment is carried out. Sequence differences such as and not limited to nucleic acid transition and restriction digest pattern alterations may be detected by comparison of the test fragment with the control fragment. Nucleic acid transition includes and is not limited to a G to A transition at nucleic acid position 750 of SEQ ID NO: 1. Another nucleic acid transition involves a G to A transition at nucleic acid position 27 of SEQ ID NO: 31.
These nucleic acid transitions lead to restriction fragment length polymorphisms as exemplified by the altered results following MspI and NciI restriction digests set forth above. Accordingly, the restriction fragment length polymorphisms of test fragments may be compared to the restriction fragments of control fragments.
Alternatively, the presence or absence of the amplification product may be detected. The nucleic acids are fragmented into varying sizes of discrete fragments. For example, DNA fragments may be separated according to molecular weight by methods such as and not limited to electrophoresis through an agarose gel matrix. The gels are then analyzed by Southern hybridization. Briefly, DNA in the gel is transferred to a hybridization substrate or matrix such as and not limited to a nitrocellulose sheet and a nylon membrane. A labelled probe encoding a sulfonylurea mutation is applied to the matrix under selected hybridization conditions so as to hybridize with complementary DNA localized on the matrix. The probe may be of a length capable of forming a stable duplex. The probe may have a size range of about 200 to about 10,000 nucleotides in length, preferably about 500 nucleotides in length, and more preferably about 2,454 nucleotides in length. The preferred sequence of the probe is set forth in SEQ ID NO: 32. Mismatches which permit substantial similarity to SEQ ID NO: 32, such as and not limited to sequences with similar hydrophobicity and hydrophilicity, will be known to those of skill in the art once armed with the present disclosure. Various labels for visualization or detection are known to those of skill in the art, such as and not limited to fluorescent staining, ethidium bromide staining for example, avidin/biotin, radioactive labeling such as .sup.32 P labeling, and the like. Preferably, the product, such as the PCR product, may be run on an agarose gel and visualized using a stain such as ethidium bromide. See Sambrook et al., supra. The matrix may then be analyzed by autoradiography to locate particular fragments which hybridize to the probe. Yet another alternative is the sequencing of the test fragment and the control fragment to identify sequence differences. Methods of nucleic acid sequencing are known to those of skill in the art, including and not limited to the methods of Maxam and Gilbert, Proc. Natl. Acad. Sci., USA 1977, 74, 560-564 and Sanger, Proc. Natl. Acad. Sci., USA 1977, 74, 5463-5467.
A diagnostic kit for detecting PHHI comprising in one or more containers at least one primer which is complementary to a sulfonylurea receptor sequence and a means for visualizing amplified DNA is also within the scope of the present invention. Alternatively, the kit may comprise two primers. In either case, the primers may be selected from the group consisting of SEQ ID NOS: 12-20, for example. The diagnostic kit may comprise a pair of primers wherein one primer within said pair is complementary to a region of the sulfonylurea receptor gene, wherein one of said pair of primers is selected from the group consisting of SEQ ID NO: 12-20, a probe specific to the amplified product, and a means for visualizing amplified DNA, and optionally including one or more size markers, and positive and negative controls. The diagnostic kit of the present invention may comprise one or more of a fluorescent dye such as ethidium bromide stain, .sup.32 P, and biotin, as a means for visualizing or detecting amplified DNA. Optionally the kit may include one or more size markers, positive and negative controls, restriction enzymes such as and not limited to MspI and/or NciI, and/or a probe specific to the amplified product.
The following examples are illustrative but are not meant to be limiting of the invention.
EXAMPLES
Purification and Partial Characterization of the 140 kDa Receptor
HIT cell membranes were photolabeled using a radioiodinated derivative of the second generation hypoglycemic drug, glyburide, according to the methods of Nelson, D. A., et al., JBC, 1992, 267:14928, Aguilar-Bryan, L., et al., JBC, 1992, 267-14934, and Aguilar-Bryan, L., et al., JBC, 1990, 265:8218, the disclosures of which are hereby incorporated by reference in its entirety.
Glyburide (Kramer et al. FEBS Lett. 1988 229:355-359) and an iodinated derivative of glyburide (Aguilar-Bryan et al. J. Biol. Chem. 1990 265:8218-8224) are known to photolabel a 140 kDa polypeptide. The pharmacological characteristics of the photolabeling, a kD in the low nanomolar range, and appropriate rank order of displacement with other insulin-releasing sulfonylureas, are those expected from studies on glyburide-induced insulin release from islets (Panten et al. Biochem. Pharm. 1989 38:1217-1229) and .beta.cell lines (Schmid-Antomarchi et al. J. Biol. Chem. 1987 262:15840-15844) and inhibition of K.sub.ATP channel activity. Glyburide was purchased from Sigma (St. Louis, Mo.) and prepared in stock solutions of 10 mM in dimethyl sulfoxide. Radioligand stocks were prepared by diluting high pressure liquid chromatography-purified 5-[.sup.125 ] iodo-2-hydroxyglyburide in dimethyl sulfoxide. Specific activity (cpm/mol) was measured on radioligand diluted 1/1000 into 10 mM Tris, 100 mM NaCl, 2 mM EDTA, pH 7.4, and the absorbance determined at 2.5 nm intervals in a UV-VIS Gilford spectrophotometer. Dimethylsulfoxide was diluted 1/1000 into the same buffer, and the absorbance of the buffer without drug was subtracted at each wavelength to generate the final absorbance profile.
HIT cells, passage 67-73, were seeded in roller bottles at 50.times.10.sup.6 cells/bottle in 100 ml of Dulbecco's modified Eagle's medium plus 10% fetal bovine serum. Cells were fed with 200 ml of medium plus serum 4-5 times over a period of 2 weeks until the cells were confluent. After plating and each feeding, bottles were gassed with 5% CO.sub.2 prior to capping.
The cells in confluent roller bottles were washed with phosphate-buffered saline (0.14 M NaCl, 3 mM KCl, 2 mM KH.sub.2 PO.sub.4, 1 mM Na.sub.2 HPO4, pH 6.8) and then incubated at room temperature with 25 ml of phosphate-buffered saline plus 2 mM EDTA until cells detached from the sides of the bottles. Cells were pelleted at 900 xg for 10 minutes at 4.degree. C.
All steps were carried out at 0-4.degree. C. Cell pellets were resuspended in 5 mM Tris, 2 mM EDTA, 0.1 mM PMSF, pH 7.4, using approximately 5 ml of buffer for each roller bottle. Cells were placed on ice for 40 minutes to allow swelling and then homogenized with 10 strokes of a motorized glass-TEFLON.TM., insoluble, nonadhesive polymer; homogenizer (500 rpm). The homogenate was centrifuged at 1000 xg for 10 minutes to remove nuclei and cellular debris, and the supernatant transferred to 30 ml of Beckman polycarbonate, screw-cap ultracentrifuge tubes. Supernatants were centrifuged at 100,000 xg for 60 minutes in a Beckman 60 Ti rotor. The pellets were resuspended in membrane storage buffer (10 mM Tris, 100 mM NaCl, 2 mM EDTA, 20% glycerol, 0.1 mM PMSF, pH 7.4). 200 mg of membrane protein were typically obtained from 20 roller bottles.
Membranes were stored at -80.degree. C. at 5 mg/ml protein in 10 mM Tris (pH 7.5), 0.1 M NaCl, 2 mM EDTA, 20% glycerol. To monitor receptor purification, an aliquot (5-20 ml) of the membranes was incubated with 1 nM [.sup.125 I ]-iodo-2-hydroxyglyburide for 15 minutes and the sample photolabeled. Binding of 5-[.sup.125 I]-iodo-2-hydroxyglyburide (5-10 nM) to membranes was done for 30 minutes at 23.degree. C. Aliquots were pipetted onto parafilm and irradiated at 23.degree. C. in a UV cross-linker (Fisher Scientific). The energy settings for the UV cross-linker were factory calibrated at 254 nm. For cross-linking at 312 nm, a conversion factor was estimated by determining the time required for the UV cross-linker to deliver a specific amount of energy with each set of bulbs, and then multiplying by the ratio of these times.
All subsequent steps were performed at room temperature in the presence of 0.1 mM PMSF, 0.1 mM phenanthroline and 0.1 mM iodoacetamide. 20% (w/v) digitonin was freshly prepared by boiling in deionized water, then added to 200-400 mg thawed labeled membranes to a final concentration of 1%. Membranes were solubilized for 15 minutes then sedimented for 1 hr at 100,000 xg. The supernatant was divided into 4 ml aliquots and each aliquot was chromatographed over a 1 ml Concanavalin A-Sepharose column equilibrated with 25 mM Tris-HCl, pH 7.5,0.1 M NaCl, 2 mM EDTA, 1% digitonin. The solution was cycled through the column twice before washing the column with 8 ml of the equilibration buffer. Retained protein was eluted with 4 ml of the same buffer containing 0.5 M methyl .alpha.-D-mannopyranoside. The eluted protein was stored at -80.degree. C. Three Con A eluates were combined, then cycled twice over a 1 ml column of reactive green 19-agarose equilibrated with 50 mM HEPES (pH 8.5), 2 mM EDTA, 0.2% digitonin. The column was washed with 8 ml of the equilibration buffer followed by 8 ml of the same buffer containing 0.4 M NaCl. The retained protein was eluted with 4 ml of the equilibration buffer containing 1.5 M NaCl. The two pooled eluates were diluted 1:1 with the HEPES equilibration buffer without NaCl and cycled twice over a 1 ml phenylboronate-10 agarose column. The column was washed with 8 ml of the HEPES buffer, followed by 2 ml of 0.1 M Tris-HCl, pH 7.5, 2 mM EDTA, 0.1% digitonin. Protein was eluted with 4 ml of 0.1 M Tris (pH 7.5), 2 mM EDTA, 0.1% SDS. The protein was concentrated to 0.5 ml using a 100,000 MW cutoff Amicon filter, pretreated with 5% Tween-20.RTM., detergent, then loaded onto a single 5 cm wide lane of a 5.5% polyacrylamide SDS gel. After electrophoresis the gel was stained with Coomassie blue, destained, and the receptor band excised with a razor blade. The receptor was electroeluted into a 14,000 MW cutoff dialysis bag and concentrated by Amicon filtration.
Table 1 summarizes the yields and fold-purification in the scheme developed for receptor purification. The amount of receptor, yields, and fold-purification reported after each step are based on the radioactivity, determined by .gamma. counting, in the 140 kDa band after electrophoresis relative to the total protein loaded on a gel lane (as determined using the BioRad protein assay). HIT cell membranes contain approximately 1.6 pmol of receptor per mg of membrane protein as determined by filtration binding (Aguilar-Bryan et al. J. Biol. Chem. 1990 265:8218-8224).
For the autoradiogram depicted in FIG. 1A, 1-2 .mu.g of purified, radiolabeled receptor was made 1% in .beta.-octylglucoside and divided into 6 aliquots. Lane 1 contained receptor kept on ice. The receptor was incubated in the presence (lane 2) and absence (lane 3) of Endo F for 30 min at 37.degree. C. Aliquots of the samples for lanes 1-3 were further incubated with V8 protease (1 .mu.g/10 .mu.l) for 30 min at 37.degree. C., yielding two radiolabeled peptides of 66 and 49 kDa (lanes 4 and 6), both of which are N-glycosylated as indicated by the mobility shift after endo F treatment (lane 5). To obtain N-terminal sequence from the intact receptor, 2 .mu.g of protein was separated by electrophoresis on a single, 0.8 cm wide lane of a 5.5% gel. The receptor was transferred to ProBlot (Applied Biosystems) in 10 mM CAPS (pH 11), 10% MeOH, the filter stained for 10-20 seconds with Coomassie blue, destained, the band excised and microsequenced. To prepare receptor fragments for microsequencing, 10 .mu.g of purified receptor was cleaved with V8, electrophoresed on a single lane and the fragments from the partial digest transferred to ProBlot. Fragments were prepared and sequenced multiple times as indicated in the figure. Gels used in the preparation of receptor and fragments for microsequencing were aged overnight, and the top tray buffer contained 0.1 mM thioglycolate.
The purified receptor showed a small apparent molecular weight decrease (.DELTA.M.sub.r .about.3000) following treatment with Endoglycosidase F/N-glycosidase F (Endo F) and yielded two bands following limited cleavage with V8 protease (FIGS. 1A and 1B). Each of the major labeled proteolytic fragments, M.sub.r .about.69 and 49 kDa, shift mobility after digestion with Endo F. Identical N-terminal sequence, 15-25 residues, were recovered from each of the major labeled peptides. No residue was obtained at residue 9 when the glycosylated peptides were sequenced; an aspartic acid was identified at residue 9 in the deglycosylated receptor indicating this is an N-glycosylated asparagine. In addition, N-terminal sequences were recovered on two unlabeled V8 peptides and a third minor labeled peptide. The results indicate there is an N-linked glycosyl group at residue nine in the mature receptor, suggesting that the N terminus is extracellular, and that the sulfonylurea labeling site is within the first 50 kDa of the receptor.
Two multiple antipeptide antibodies (MAPs), directed against residues 1 through 8 and 10 through 20 both immunoprecipitate photolabeled 140 kDa receptors from HIT, mouse .alpha.TC-6, and rat insulinoma (RIN) cells. MAPs were prepared by synthetic protein sequencing (Perkin Elmer-ABI, 430 A Peptide Synthesizer, Foster City, Calif.) to obtain antibodies to M-P-L-A-F-C-G-T, SEQ ID NO: 10, residues 1-8 of SEQ ID NOS: 28 and 29. This process was repeated for residues 10-20 of SEQ ID NOS: 28 and 29, N-H-S-A-A-Y-R-V-D-Q-G, SEQ ID NO: 11. A purified sulfonylurea receptor protein was immunoprecipitated from HIT cells using the MAPs prepared as set forth above.
HIT cell membranes were incubated with 5-[.sup.125 I]iodo-2-hydroxyglyburide, photolabeled, solubilized with 1% digitonin, centrifuged at 100,000 xg and the supernatant incubated with 1/10 volume of preimmune serum, immune serum, immune serum+anti-MAP 10-20, or immune serum+irrelevant MAP peptide. 50 .mu.l of protein A-Sepharose was added and the mixture was incubated for 2 hours at room temperature, the beads washed with buffer, heated in the presence of pH 9 sample buffer, electrophoresed on a 6% polyacrylamide SDS gel, and an autoradiogram prepared.
The immunoprecipitation was competed using the immunizing peptide, but not the other MAPS (FIGS. 2A-C). The amino acid sequence is derived from the photolabeled protein and the N-terminal amino acid sequence is conserved between mouse, rat, and hamster.
Isolation and Characterization of cDNA Clones
Degenerate PCR primers with flanking restriction sites were designed based on the sequence obtained from the labeled peptides. The primers used were as follows: primer 1 (SEQ ID NO: 23):
5' GAGAGAAGCTT(T/C)TG(T/C)GG(T/C/G/A)GA(A/G)AA(T/C)CA-3' primer 2 (SEQ ID NO: 24):
5' GAGAGAGAATTCC(T/C)TG(A/G)TC(T/C/G/A)AC(T/C/G/A)C(G/T)(A/G)TA-3',
The bases in parenthesis indicate the degeneracy at that position. The sequence in bold was derived from the peptide sequence obtained from the N-terminus of the sulfonylurea receptor. The remaining 5' sequence was added to facilitate subcloning. Primer 1 has a HindIII site at the 5' end; Primer 2 was engineered with an EcoRI site at the 5' end. These primers were used in a standard PCR reaction with a random primed cDNA library, constructed in .lambda.ZAPII using mouse .alpha.-cell poly A+ mRNA, as template. The following cycle times and temperatures were employed: 94.degree. C. for 10 minutes; 85.degree. C. for 3 minutes, [50.degree. C. for 2 minutes, 72.degree. C. for 5 minutes, 94.degree. C. for 2 minutes,] 50.degree. C. for 2 minutes, 72.degree. C. for 5 minutes.
The bracketed conditions were cycled 30 times. From the N-terminal peptide sequence of the receptor a 47 base pair coding region was expected to be amplified plus the 20 base pairs added to the primers to facilitate cloning yielding an expected 67 base pair product. The 47 base pair coding region was predicted to have 14 base pairs that were not present in the primers. The PCR product obtained was approximately 67 base pairs and was restricted with EcoRI and HindIII, subcloned into M13 and sequenced. The resulting sequence gave the expected 14 base pairs indicating the sequence was derived from the receptor. The 47 base pair oligonucleotide given below was synthesized based on the consensus sequence derived from nine M13 clones:
5'TTTTGCGGGACGGAGAATCACTCGGCCGCCTACCGCGTCGACCAAGG-3', (SEQ ID NO: 25). This oligonucleotide was used to screen the random primed mouse .alpha.TC-cell cDNA library.
A 1.1 kb cDNA was cloned which encoded 28 amino acids obtained from peptide sequencing. This cDNA fragment was used to screen RIN and HIT cell cDNA .lambda. libraries to obtain full sequence.
The nucleotide sequence of a 4635 bp rat receptor cDNA includes an open reading frame that encodes a 1498 amino acid protein with a mass of 167,834 daltons, larger that predicted by SDS polyacrylamide gel electrophoresis. Aguilar-Bryan, L., et al., JBC, 1990, 265:8218. There is a single insertion of an asparagine at position 742 and a deletion of a threonine at position 831. The first difference between the hamster and rat sequences is in the same relative position, 21 residues C-terminal of the Walker consensus site, as the .DELTA.F508 deletion seen in a common cystic fibrosis transconductance regulator (CFTR) mutation (Riordan et al. Science 1989 245:1066-1073). In addition to the insertion and deletion, the first nucleotide binding fold contains approximately a third (10/33) of all differences between the two species.
The mature rat protein, defined by peptide sequencing, begins with a proline following the methionine start site. In the RIN cell receptors the adjacent amino acid is a methionine. This is the initiating methionine based on the surrounding sequence which is a good fit to the consensus pattern for initiation, GCC(A/G)CCAUG(G) (SEQ ID NO: 26) (Kozak, M. Cell 1986 44:283), including the strongly conserved A at position -3. However, in the mouse receptor, an additional 35 amino acids is found preceding this proline which cannot eliminate the possibility that some forms of the hamster and rat receptors have similar leader sequences. Confirming the chemical sequence, residue 9 in the mature proteins is an asparagine within a consensus glycosylation site.
A Blast search of the National Center for Biotechnology Information (NCBI) nucleotide database with the receptor sequence produced matches with several members of the P-glycoprotein/multidrug resistance protein family. A similar search with the amino acid sequence indicated the sulfonylurea receptor is a member of the ATP-binding cassette superfamily with two putative nucleotide binding domains. The sulfonylurea receptor sequence revealed 29% similarity, to an ATP-binding cassette superfamily member, termed a multidrug resistance-associated protein (MRP), isolated from a small cell lung carcinoma cell line (H69AR) selected with doxorubicin (Cole et al. Science 1992 258:1650-1654). A cluster analysis of this molecule, dvhuar in the Protein Identification Resource (PIR) database, indicates it is related to the leishmania P-glycoprotein-related molecule (Lei/PgpA), the CFTRs (human (Hum/CFTR), bovine (Bov/CFTR), mouse (Mus/CFTR), and dogfish (Squ/CFTR)) (Cole et al. Science 1992 258:1650-1654). A similar result was obtained for the sulfonylurea receptor with the additional inclusion of the Xenopus CFTR indicating the receptor is a member of this cluster.
The identification of the nucleotide binding domains goes beyond simply having Walker "A" and "B" consensus sequences. The receptor is similar to the 230-240 amino acid nucleotide binding domain(s) described by (Hyde et al. Nature 1990 346:362-365) and database searches find similarities to the nucleotide binding fold of ATP-binding proteins. The more conserved of the two receptor nucleotide binding folds, based on similarity with other ATP-binding proteins and the comparison of the rat and hamster sequences, is at the C-terminal end.
RNA Analysis
Northern blot analysis of poly A+ mRNA isolated from RIN, HIT and .alpha.TC-6 cells, previously shown to have the high affinity receptor by drug binding and photolabeling studies (Aguilar-Bryan et al J. Cell. Biochem. Suppl. 1994 18A:133) each have an approximately 5000 nucleotide transcript, see FIG. 3. A preliminary tissue distribution study shows the same size transcript is present in mouse brain and heart.
Predicted Protein Structure
Sequence similarities indicate the sulfonylurea receptor has two potential ATP binding folds. The size and additional sequence similarities with P-glycoproteins and CFTRs suggest the receptor has a similar structure. Hydrophobicity (FIG. 4) and hydrophobicity versus hydrophobic moment (Eisenberg et al. J. Mol. Biol. 1984 179:125) plots were used to generate a model for the receptor (FIG. 5). Two constraints were imposed on the model structure: the glycosylation site is on the external face of the membrane and both nucleotide binding domains are on the internal face. The `classical` ATP-binding cassette superfamily model proposes duplication of a unit consisting of six transmembrane spanning helices followed by a nucleotide binding domain. The sulfonylurea receptor differs from this model and has at least nine potential transmembrane helices before the first nucleotide binding domain but only four between the two nucleotide binding domains (FIG. 5). The multidrug resistance-associated protein (MRP) is predicted to have 8 transmembrane spanning helices (Cole et al. Science 1992 258:1650-1654).
Phosphorylation has been implicated in regulation of K.sub.ATP channel activity (Schwanstecher et al. J. Pharmacol. Exper. Ther. 1992 262:495-502) and has been proposed to change the affinity of the sulfonylurea receptor for various ligands. There are 21 potential phosphorylation sites in the receptor sequence; 3 protein Kinase A (pKA) sites and 18 protein kinase C (pKC) sites. The pKA site at 278 is predicted to be on the external face of the membrane, while those at positions 1363 and 1417 are in the second nucleotide binding fold. Four of the pKC sites (positions 151, 200, 304 and 1213) are predicted to be extracellular or in a membrane spanning helix. Seven of the remaining 14 are in the nucleotide binding folds (NBF); 4 in NBF-1, and 3 in NBF-2. One of the latter sites, Thr 1297 in the Walker A consensus site, is expected to alter nucleotide binding if it is accessible for phosphorylation.
Functional Properties, In Vitro Translations
mRNA, transcribed by SP6 RNA polymerase from the rat cDNA subcloned into pGEM4, was translated in vitro. Approximately 0.5 .mu.g of mRNA was heated to 70.degree. C. for 10 minutes, immediately cooled on ice then added to rabbit reticulocyte lysate (Promega, Madison, Wis.) supplemented with ribonuclease inhibitor, an amino acid mixture, and [.sup.35 S]methionine. The reaction mixture was incubated at 30.degree. C. for 60 minutes then aliquots were subject to electrophoresis on SDS polyacrylamide gels using standard protocols. The gels were dried and autoradiographed.
The resulting protein was approximately 137 kDa, indicating the receptor behaves anonymously on SDS polyacrylamide gels having a faster than expected mobility, see FIG. 6A. A similar anomalous behavior has been reported for CFTRs (Gregory et al. Nature 1990 347:382-386).
Anti-Nucleotide Fold Antibodies Immunoprecipitate the Photolabeled 140 kDa Receptor
Antibodies were produced against two fusion proteins containing the two nucleotide binding folds. Fragments of the receptor cDNA were subcloned in frame into pMALc (New England BioLabs, Boston, Mass.) at the C-terminal end of the DNA encoding the maltose binding protein (MBP). A plasmid expressing the first nucleotide binding fold fused to MBP was constructed by restricting pMALc with StuI and SalI and restricting the sulfonylurea receptor cDNA with PvuII plus XhoI. A unique 500 base pair fragment was gel purified from the receptor cDNA digest and subcloned into pMALc. The construction was verified by sequencing. The receptor segment expressed is leu708 to leu874. Expression was obtained in E. coli following transformation and induction by isopropylthiogalactoside per the manufacturer's directions. The expressed proteins were found to be in inclusion bodies which were solubilized in SDS and separated on SDS polyacrylamide gels, see FIG. 6B. The fusion protein was electroeluted, concentrated, and used as an immunogen. The solubilized protein in 200 .mu.g amounts, with complete, or incomplete Freund's adjuvant, was injected interdermally into rabbits using a standard 2-3 week regimen of bleeding and boosting.
Injection of Xenopus Oocytes with Receptor mRNA
mRNA, approximately 50 ng, transcribed as described above, was injected into Xenopus oocytes. The injected oocytes were assayed for K+ channel activity after 1-5 days using both two-electrode and patch clamp methods. New K+ currents in the injected oocytes were not detected. Similarly, co-injection of mRNAs transcribed from cDNAs encoding two small inward rectifiers, ROMK1 (Ho et al. Nature 1993 362:31-38) or a brain homolog of IRK1 (Kelly et al. Biophysical J. 1994 66(2):A109) failed to confer sulfonylurea sensitivity on these K+ channels. The results suggest that the 140 kDa receptor does not have intrinsic K+ channel activity, or that Xenopus oocytes are not an adequate background for their expression.
Transfection Experiments
The sulfonylurea receptor cDNA has been ligated into eukaryotic expression vectors containing SV40 virus, adenovirus and cytomegalovirus (CMV) promoters. These plasmids have been transfected into COS cells which do not have the high affinity sulfonylurea receptor as determined by filtration binding and photolabeling studies. To date experiments with the SV40 plasmid have shown that the transfected cells produce an mRNA of the appropriate size as determined by Northern blots with receptor cDNA. Metabolic labeling experiments with the SV40 plasmid where transfected and non-transfected cells were labeled with [.sup.35 S] methionine indicate that the transfected, but not the non-transfected cells, synthesize an appropriate sized protein which can be immunoprecipitated with the antinucleotide binding fold antibodies. The level of receptor synthesized by COS cells using this promoter has been low using SEQ ID NOS: 27 and 28. Expression levels are high using SEQ ID NOS: 4, 5, 7, and 8 from rat and hamster.
Chromosomal localization of the Sulfonylurea Receptor Gene
Chromosomal localization of the Sulfonylurea Receptor (SUR) gene to normal male human banded chromosomes was determined by utilization of the fluorescence in situ hybridization (FISH) technique by staining with 4,6-diamidino-2-phenylindole (DAPI). A metaphase spread showed the two chromosome 11 homologues which map the SUR cDNA to 11p15.1. Overlapping human SUR cDNA plasmids "mid" and "3", totaling 3.8 kb, were labeled with biotin-14-dATP (GIBCO) and hybridized in situ to standard metaphase spreads from normal male peripheral blood lymphocytes, according to the methods of P. Lichter et al., Science 247, 64 (1990), the disclosure of which is hereby incorporated by reference in its entirety. The biotin-labeled DNA was detected using Fluorescein-Avidin DCS (Vector Laboratories, Burlingame, Calif.). Chromosomes were identified by simultaneous DAPI staining, which produces a Q-banding pattern. Fifteen metaphases were analyzed. Digital images were obtained with a cooled charge-coupled device camera mounted on a standard epifluorescent microscope (Axioplan; Zeiss, Thronwood, N.Y.). Images were acquired using the software ISee (Inovision Co.) running on a Sun workstation. Fluorescein isothiocyanate and DAPI fluorescence were recorded separately as gray scale images and then merged using the software package NIH 1.55 (J. W. Ijdo, E. A. Lindsay, R. A. Wells, A. Baldini, Genomics 14, 1019 (1992)). Eighty-five per cent of metaphases analyzed showed specific hybridization signal on both chromatids of the two chromosomes 11 at 11p15.1.
Partial cDNA clones, comprising 3.8 kb of coding sequence of the human homologue of SUR, were obtained from a human pancreatic cDNA library (provided by Graeme Bell, University of Chicago, and commercial libraries of Clontech, Palo Alto, Calif. and Invitrogen, San Diego, Calif.). The library was produced in lambda gt10 phage (Bell RIN library) and screened with a 2294 bp hamster cDNA probe encoded by SEQ ID NO: 30.
The protocol for making the library is provided by Sambrook et al., supra. Poly A+ mRNA was isolated using an oligo dT column. Poly A+ mRNA was incubated with oligo dT and random hexamers plus reverse transcriptase (such as MMLV RT from Promega, Stratagene or NEBL) and dNTPs to produce single strand cDNA. The single strand cDNA is treated with E. coli DNA polymerase, RNAseH and dNTPs, then ligated to linkers that have EcoRI sites to produce double stranded DNA. The final product is restricted with EcoRI and ligated, using T4 DNA ligase, into lambda phage DNA that has been similarly restricted and dephosphorylated with alkaline phosphatase to prevent self ligation. The ligated product is packaged into phage using commercially available packaging extracts.
Screening involved plating and hybridizing at 55.degree. C. or 65.degree. C. in 5.times. or 6.times. SSC (according to the methods of Sambrook, et al.). 55.degree. C. was used for cross species screens and 65.degree. C. was employed for the same species. Two washes were carried out at room temperature using 2.times. SSC, then one at the hybridization temperature of 65.degree. C. using 0.1.times. SSC.
Hybridizations and washes were done at reduced stringency (55.degree. C.) using methods according to F. M. Ausubel et al., Current Protocols in Molecular Biology (Greene Publishing Associates, Inc, New York, N.Y., 1989), Chap. 6, the disclosures of which are hereby incorporated by reference in their entirety. Subsequent screening was done at higher stringency (65.degree. C.), using a human cDNA of SEQ ID NO: 31 obtained from the first screen as a probe.
Characterization of these cDNA clones by sequence analysis revealed an overall homology of 95% with the rat SUR gene. A specific hybridization signal was detected at the band 11p15.1 in 85% of metaphases on both chromatids of the two chromosomes 11.
Detection of Sulfonylurea Receptor Mutations in PHHI Affected Individuals
Mutational analysis was performed on samples from 16 affected progeny of nine consanguineous matings. In each case, diagnosis of PHHI was based on criteria established by A. Aynsley-Green et al., supra., the disclosure of which is hereby incorporated by reference in its entirety. The parents in six families were first cousins, in two families second cousins, and in one family more distantly related. Eight families were of Saudi Arabian origin, recruited from the patient population of the Arabian American Oil Company Hospital Medical Services Organization, after institutional approval was received, and one was of Germanic origin. Family labels follow the form of Thomas et al., supra.
Studies indicated that no major insertions or deletions of the SUR locus had occurred in three of the families. The first region evaluated, by direct sequence analysis, was the second nucleotide binding fold (NBF-2) of the human SUR homologue (FIG. 7). This is the most highly conserved region of the SUR gene, and in other superfamily members it, as well as NBF-1, has functional importance for control of channel activity through interaction with cytosolic nucleotides. S. C. Hyde, Nature 346, 362 (1990) and M. J. Weish, A. E. Smith, Cell 73, 1251 (1993).
To obtain this genomic structure, a normal human lymphocyte genomic bacteriophage library (provided by Mary Beth Humphrey, Baylor College of Medicine) was screened, using standard methods according to F. M. Ausubel et al., supra., with a human partial SUR cDNA probe of SEQ ID NO: 31 (cDNA probe, "3prime").
The human genomic library was made in lambda FIX using materials supplied by Stratagene, Inc. Briefly, genomic DNA was partially digested with Sau3A, the fragments were precipitated with ethanol, resuspended with precut lambda FIX DNA which has compatible ends, ligated with T4 DNA ligase and packaged and screened.
Hybridizations and washes were done at reduced stringency (55.degree. C.) using methods according to F. M. Ausubel et al., Current Protocols in Molecular Biology (Greene Publishing Associates, Inc, New York, N.Y., 1989), Chap. 6, the disclosures of which are hereby incorporated by reference in their entirety. The library was screened with a 1.2 kb hamster cDNA probe of SEQ ID NO: 32, which spans the SUR NBF2 sequence. Subsequent screening was done at higher stringency (65.degree. C.), using a human cDNA.
Screening involved plating and hybridizing at 55.degree. C. or 65.degree. C. in 5.times. or 6.times. SSC (according to the methods of Sambrook, et al.) . 55.degree. C. was used for cross species screens and 65.degree. C. was employed for the same species. Two washes were carried out at room temperature using 2.times. SSC, then one at the hybridization temperature of 65.degree. C. using 0.1.times. SSC.
Inserts in the bacteriophage clone .lambda.G4 were subcloned into pBluescript 11 (Stratagene, La Jolla, Calif.). Plasmids were purified using standard cesium chloride purified methods, restricted using the appropriate desired enzyme(s). The fragments were purified by electrophoresis on low melt agarose and cut out of the gel. A 1-to-5 microliter aliquot of the desired fragment and 1 microgram of the appropriately restricted plasmid carrying a selectable ampicillin resistance marker (such as pBluescript from Stratagene, Inc.) were melted at 65.degree. C., mixed and diluted to 20 microliters with a buffer containing T4 DNA ligase and ATP, then incubated for 4-18 hours before transforming into E. coli and selecting on ampicillin plates.
Exon-intron boundaries were defined by comparing the nucleotide sequences of the human SUR gene and cDNA, which were obtained using the dideoxy chain termination method (Sequenase; U.S. Biochemicals, Cleveland, Ohio).
Because of the consanguineous matings and autosomal recessive inheritance pattern of this disorder, affected individuals are expected to be homozygous by descent at the disease gene locus. E. S. Lander and D. Botstein, Science 236, 1567 (1987), the disclosure of which is hereby incorporated by reference in its entirety. Direct sequencing of a pancreatic cDNA product, isolated from an affected child of Family 6, revealed a 109 bp deletion within the NBF-2 region which corresponded to skipping of an exon resulting in a cDNA product of about 2190 bp in length using primers of SEQ ID NOS: 16 and 17 as compared to mRNA of about 2080 bp in length. The effects of this skipping event are severe and include production of a frameshift, premature truncation of the protein due to inclusion of a stop 24 codons later, and disruption of the NBF-2 (FIG. 8A and 8B). The splice sites of the skipped exon were evaluated at the genomic DNA level and a homozygous G to A point mutation, located within the 5' splice site at the last base of the skipped exon, was found (FIG. 8C). A recognition site for the restriction endonuclease MspI is destroyed by this base change, providing a means to confirm and test for the presence of the mutation. mRNA was directly isolated using Oligotex (Qiagen Inc., Studio City, Calif.) from a fresh-frozen pancreatic tissue sample and reverse transcribed (RT), using random primers (Invitrogen, San Diego, Calif.), with Superscript 11 (GIBCO-BRL) into cDNA. For cloning of the NBF-2 region, an initial PCR amplification with SEQ ID NOS: 19 (primer 22 (located 5' of 17)) and 15 (primer 29) was followed by a second amplification of a portion of the reaction with SEQ ID NOS: 13 (primer 13) and 15 (primer 29) using conditions described by P. M. Thomas, G. J. Cote, D. M. Hallman, P. M. Mathew, Am. J. Hum. Genet., in press, supra.
PCR products were amplified using hybridization at 60.degree. C. for 1 minute, elongated at 72.degree. C. for 1 minute and denatured at 93.degree. C. for 1 minute for thirty cycles. Hybridization may be carried out at temperatures of between about 55.degree. C. to about 65.degree. C. The amplified product was cloned into pCR 11.TM. vector (Invitrogen, San Diego, Calif.) and sequenced, as above. pCR 11.TM. vector is set forth in FIG. 13. For detection of the mutation in genomic fragments, 100 ng of genomic DNA was amplified using SEQ ID NOS: 14 and 16, primers 28 and 29B, as above except in the presence of PCR buffer N (Invitrogen, San Diego, Calif.), and either directly PCR sequenced according to the methods of S. Khorana, R. F. Gagel, G. J. Cote, Nucleic Acids Res. 22, 3425 (1994), the disclosure of which is hereby incorporated herein by reference in its entirety, or cut with 5 U of Mspl (GIBCO-BRL) at 37.degree. C. for 2 hours and run on a 10% polyacrylamide gel. Visualization of products was by silver staining. Both affected children of Family 6 were homozygous, while the parents and two unaffected siblings were found to be heterozygous, for the mutation (FIG. 8D). Preliminary semiquantitative analysis revealed markedly decreased expression of the mutant SUR message upon comparison of patient and age-matched normal control pancreatic samples, suggesting instability of the mutant message.
Thirteen additional affected children, from six families of Saudi Arabian origin and one family of German origin, were found to be homozygous for this mutation, as demonstrated by loss of the Mspl restriction enzyme recognition site. In all families, homozygous loss of the Mspl site cosegregated with disease phenotype, and in Families 1-3 and 5 genotype analysis for this mutation agreed with previously reported haplotype data, P. M. Thomas, G. J. Cote, D. M. Hallman, P. M. Mathew, Am. J. Hum. Genet., in press, supra. Direct sequencing of PCR-amplified genomic DNA from a representative affected member of each family determined that all exhibited the homozygous G to A mutation.
Family 4 demonstrated a unique mutation in the 3' splice site sequence preceding the start of the NBF-2 (FIG. 9A). This G to A mutation destroys an Ncil restriction endonuclease site and homozygous loss of this site cosegregated with disease phenotype within the family. Again, genotype analysis of the members of this family supported previously reported haplotype data, P. M. Thomas, G. J. Cote, D. M. Hallman, P. M. Mathew, Am. J. Hum. Genet., in press, supra.; both parents are heterozygotes for the mutation and the unaffected sibling is homozygous for the wild type allele (FIG. 9B). Since a pancreatic tissue sample from an affected individual in Family 4 was unavailable and we were unable to recover the SUR message from transformed lymphocytes, a chimeric construct was created to examine the effects of this mutation on the RNA splicing pathways according to the methods of R. Takahashi, et al., Nature Genet. 7, 79 (1994); I. Satokata, et al., Proc, Natl. Acad. Sci. 87 9908 (1990); H. Lou, G. J. Cote, R. F. Gagel, Mol. Endo. 8, 1618 (1994), the disclosure of each hereby incorporated by reference in its entirety.
Genomic DNA from affected and normal individuals was PCR-amplified using the SEQ ID NOS: 12 and 18 and cloned into pRSVhMT2A. Constructs were transfected into the human glioblastoma cell line SNB 19 using LIPOFECTAMINE.RTM. transfection regent (Gibco-BRL, Gaithersburg, Md.). RT-PCR analysis was performed, with SEQ ID NOS:12 (primer 16) and 19 (primer DS8), as described by H. Lou, G. J. Cote, R. F. Gagel, Mol. Endo. 8, 1618 (1994), the disclosure of which is incorporated herein by reference in its entirety. The plasmids and their cDNA products were sequenced with SEQ ID NO: 17 (primer 34al). Genomic DNA fragments were PCR-amplified with SEQ ID NOS: 17 and 12 (primers 34al and 16) and digested with Ncil, as in FIG. 8. With the construct containing the mutation, no wild type splicing pattern occurred. Instead, use of three cryptic 3' splice sites was demonstrated resulting in a 7 bp addition, a 20 bp deletion, and a 30 bp deletion in the exon (FIG. 9D). A similar intronic 3' splice acceptor mutation, described in the disorder 21-hydroxylase deficiency, also resulted in lack of the wild type splicing pattern, produced several cryptic splice products, and abolished normal protein activity. Y. Higashi, et al., Proc. Natl. Acad. Sci., USA 85, 7486 (1988), the disclosure of which is incorporated herein by reference in its entirety.
All PCR products prepared from genomic DNA of 100 normal, unrelated individuals showed normal Mspi and Ncil restriction patterns, indicating that neither mutation is a common polymorphism. The data presented provides evidence that mutations in the SUR gene cause familial persistent hyperinsulinemic hypoglycemia of infancy.
Various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
Claims
Certificate of Correction present
The claims shown below may not include correction changes. Use the corrected PDF for authoritative text.
What is claimed is:
1. A purified nucleic acid sequence encoding a sulfonylurea receptor wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 4, and SEQ ID NO: 7.
2. A purified amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9.
3. An expression vector comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 4, and SEQ ID NO: 7.
4. A host cell expressing the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 4, and SEQ ID NO: 7.
5. A cell culture comprising cells that express a nucleic acid sequence encoding a sulfonylurea receptor protein comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 9.
6. A purified nucleic acid sequence encoding a sulfonylurea receptor, wherein said nucleic acid sequence comprises SEQ ID NO: 1.
7. An expression vector comprising a nucleic acid sequence of SEQ ID NO: 1.
8. An insolated host cell expressing the nucleic acid sequence of SEQ ID NO: 1.
9. A cell culture comprising cells that express a nucleic acid sequence encoding a sulfonylurea receptor comprising the amino acid sequence of SEQ ID NO: 28.
Patent Citations (12)
| Patent | Date | Inventor | Cited By |
|---|---|---|---|
| US4237224 | 1980-12-01 | Cohen et al. | |
| US4683195 | 1987-07-01 | Mullis et al. | |
| US4683202 | 1987-07-01 | Mullis | |
| US4800159 | 1989-01-01 | Mullis et al. | |
| US4883750 | 1989-11-01 | Whiteley et al. | |
| US4965188 | 1990-10-01 | Mullis et al. | |
| EPX329822A2 | 1988-08-01 | ||
| GBX2202328 | 1988-03-01 | ||
| WOXWO87/06270 | 1987-04-01 | ||
| WOXWO88/10315 | 1988-06-01 | ||
| WOXWO89/06700 | 1989-01-01 | ||
| WOXWO89/09284 | 1989-03-01 |
Non-Patent Literature (83)
- C. Groman et al. PNAS 79:6777-81, '82.
- L. Aguilar-Bryan et al. Science 268:423-426, '95.
- P. Thomas et al. Science 268:426-429, '95.
- Nelson et al. The High Affinity HIT Cell Sufonylurea Receptor Intern'l Conference on ATP-Senstivie K.sup.= Channels and Sulfonylurea Receptors, Houston TX, Sep. 30-Oct. 1, 1993.
- Vu et al. Pancreatic .beta.-Cell Ion Channels: Role in Diabetes Pathogenesis and Therapy, Amer. Diab. Assoc. 24th Internat'l Res. Symp., Oct. 27, 1989, Marco Island, Florida.
- Aguilar-Bryan Synthesis and Characterization of an Iodinated Sulfonylurea J. Cell Biol 1988 107:561.
- Aguilar-Bryan Photoaffinity Labeling of the .beta. cell sulfonylurea Receptor Using a Novel Glyburide Analog Clinical Research National Meeting Apr. 1989 vol. 37.
- Aguilar-Bryan Co-Expression of Sulfonylurea Receptors and K.sub.ATP Channels: Evidence that a 140 kDA Protein is an Integral Part of this Channel Biophysical Soc. Houston Texas 1992.
- Aguilar-Bryan Photoaffinity Labeling and Partial Puriciation of the .beta. Call Sufonylurea Receptor Using a Novel Biologically Active Glyburide Analogs J. Biol. Chem. 1990 265:8218.
- Aguilar-Bryan Cloning of a High Affinity Sulfonylurea Receptor From Rodent .alpha.- and .beta.- Cells J. Cell. Biochem. Suppl. 1994 18:133.
- Aguilar-Bryan et al. Co-Expression of Sulfonylurea Receptors and K.sub.ATP Channels in Hamster Insulinoma Tumor (HIT) Cells JBC 1992 267:14934.
- Ashcroft et al. Properties and Functions of ATP-Sensitive K-Channels Cell Signal. 1990 2:197-214.
- Ashcroft et al. The Sulfonylurea Receptor Biochim. Biophys. Acta 1992 1175:45-49.
- Ashford et al. Tolbutamide excites rat glucoreceptive ventromedial hypothallamic neurones by indirect inhibition of ATP-K.sup.+ channels Br. J. Pharmac. 1990 101:531-540.
- Bernardi et al. ATP/ADP Binding Sites are Present in the Sulfonylurea Binding Protein Associated with Brain ATP-Sensitive K.sup.+ Channels Biochemistry 1992 31:6328-6332.
- Boyle et al. Electrophysiological Expression of Ion Channels in Xenopus Oocytes Methods in Neuroscience 1991 4:157-173.
- Bryan et al. Cloning of a Sulfonylurea Receptor (ATP-Sensitive K.sup.= Channel?) From Rodent .alpha.- and .beta.-Cells Intern'l Conference on ATP-Sensitive K.sup.= Channels and Sulfonylurea Receptors, Houston, Tx 1993.
- Cole et al. Overexpression of a Transporter Gene in a Multidrug-Resistant Human Lung Cancer Cell Line Science 1992 258:1650-1654.
- de Weille et al. Activation and Inhibition of APT-Sensitive K.sup.+ Channels By Fluorescein Derivatives J. Biol. Chem 1992 267:4557-4563.
- Edwards et al. The Pharmacology of ATP-Sensitive Potassium Channels Annu. Rev. Pharmacol. Toxicol. 1993 33:597-637.
- Eisenberg et al. Analysis of Membrane and Surface Protein Sequence with the Hydrophobic Moment Plot J. Mol. Biol. 1984 179:125.
- Feng et al. Progressive Sequence Alignment as a Prerequisite to Correct Phylogenetic Trees J. Mol. Evol. 1987 25:351.
- Gerich J.E. Oral Hypoglycemic Agents New Engl. J. Med. 1989 321:1231-1245.
- Gregory et al. Expression and characterization of the cystic fibrosis transmembrane conductance regulator Nature 1990 347:382-386.
- Ho et al. Cloning and Expression of an inwardly rectifying ATP-regulated Potassium Channel Nature 1993 362:31-38.
- Hopkins et al. Two Sites for Adenine-Nucleotide Regulation of ATP-Sensitive Potassium Channels in Mouse Pancreatic .beta.-Cells and HIT Cells J. Membrane Biol. 1992 129:287-295.
- Hyde et al. Structural Model of ATP-Binding Proteins Associated with Cystic Fibrosis, multidrug resistance and bacterial transport Nature 1990 346:362-365.
- Kelly et al. Cloning and Expression of A Novel Inward Rectifier K+ Channel HRKl From Human Hippocampus Biophysical J. 1994 66(2) :A109.
- Khan et al. Dissociation of K.sub.ATP channel and sulphonylurea receptor in the rat clonal insulin-secreting cell line, CR1-D11 Proc. R. Soc. Lond. B 1993 253:225-231.
- Kozak M. Point Mutations Define a Sequence Flanking the AUG Initator Codon That Modulates Traslation by Eukaryotic Ribosomes Cell 1986 44:283.
- Kramer et al. Direct Photoaffinity labeling of the putative sulfonylurea receptor in rat .beta.-Cell tumor membranes by [H3] glibenclamide FEBS Lett. 1988 229:355-359.
- Kyte et al. A simple method for displaying the hydropathic Character of a Protein J. Mol. Biol. 1982 157:105-132.
- Nelson et al. Evidence that a 140 kDa Protein Contains the .beta.-Cell High Affinity Sulfonylurea Binding Site and is an Integral Part of the ATP-Sensive Potassium Channel Amer. Diab. Assoc. Diabetes 1992 41:78A.
- Nelson et al. The High Affinity HIT Cell Sufonylurea Receptor Intern'l Conference on ATP-Sensitive K.sup.= Channels and Sulfonylurea Receptors, Houston Tx.
- Nelson et al. Photolabeling of .beta.-Cell Membrane Proteins with an .sup.125 I-Labeled Glyburide Analog: The High Affinity Sulfonylurea Binding Site Residesona 140kDa Polypeptide Houston Tx.
- Nelson et al. Purification and Characterization of the High Affinity Sulfonylurea Receptors Biophys. J. 1993 64:311.
- Nelson et al. Purification of the 140 kDa High Affinity Sulfonylurea Recptor Diabetes 1993 42:129.
- Nelson et al. Specificity of Photolabeling of .beta.-Cell Membrane Proteins with an .sup.125 I-Labeled Glyburide Analog JBC 1992 267:14928.
- Nichols et al. Adenosine triphosphate-sensitive potassium channels in the cardiovascular system Am. J. Physiol. 1991 261:H1675-H1686.
- Panten et al. Pancreatic and Extrapancreatic Sulfonylurea Receptors Horm. Metab. Res. 1992 24:549-554.
- Panten et al. Control of Insulin Secetion by Sulfonylureas, Meglitinide and Diazoxide in Relation to Their Binding to the Sulfonylurea Receptor in Pancreatic Islets Biochem. Pharm. 1989 38:1217-1229.
- Posnett et al. A Novel Method for Producing Anti-peptide Antibodies J. Biol. Chem. 263:1719-1725.
- Rajan et al. Sulfonylurea Receptors and ATP-Sensitive K.sup.+ Channels in a Glucagon Secreting Pancreatic Alpha Cell Line Diabetes 1992 41:47A.
- Rajan et al. ATP-Sensitive K+ Channels in Pancreatic Alpha Cells Biophys J. 64:A311.
- Rajan et al. Ion Channels and Insulin Secretion Diabetes Care 1990 13:340-363.
- Rajan et al. Sulfonylurea Receptors and ATP-sensivitive K.sup.+ Channels in Clonal Pancreatic .alpha. Cells J. Biol. Chem. 1993 268:15221-15228.
- Riordan et al. Identification of the Cystic Fibrosis Gene: Cloning and Characterization of Complementary DNA Science 1989 245:1066-1073.
- Sanger et al. DNA sequencing with chain-terminating inhibitors Proc. Nat'l. Acad. Sci USA 1977 74:5463.
- Schmid-Antomarchi et al. The Receptor for Antidiabetic Sulfonylureas Controls the Activity of ATP-modulated K.sup.+ Channel in Insulin-secreting Cells J. Biol. Chem. 1987 262:15840-15844.
- Schwanstecher et al. The Binding Properties of the Solubilized Sulfonylurea Receptor from a Pancreatic B-Cell Line are Modulated by the Mg.sup.++ -Complex of ATP.sup.1 J. Phar. Exper. Ther. 1992 262:495-502.
- Schwanstecher et al. Br. J. Pharm. 1992 107:87-94.
- Takano et al. The ATP-Sensitive K.sup.+ Channel Progress in Neurobiology 1993 41:21-30.
- Vu et al. Functional Solubilization of the HIT Cell SUlfonylurea Receptor Diabetes 1989 38:178a.
- Vu et al. Pancreatic .beta.-Cell Ion Channels: Role in Diabetes Pathogenesis and Therapy Amer. Diab. Assoc. 24th Internat'l Res. Symp. 1989.
- Vu et al. Partial Purification of the HIT Cell SUlfonylurea Receptor J. Cell BIol. 1989 109:102.
- Walker et al. EMBO Jour. 1982 1:945-951.
- Aynsley-Green et al. Nesidioblastosis of the pancreas: definitionof the syndrome and the Management of the severe neonatal hyperinsulinaemic hyppoglycaemia Arch. Dis. Child. 1981 56:496.
- Kaiser et al. Regulation of insulin release in persistent hyperinsulinaemic hypoglycaemia of infancy Studied in long-term culture of pancreatic tissue Diabetologia 1990 33:482.
- Bruining, Recent advances in hyperinsulinism and the pathogenesis of diabetes mellitus Curr. Opin. Pediatr. 1990 2:758.
- Mathew et al. Persistent Neonatal Hyperinsuinism Clin. Pediatr. 1988 27:148.
- Glaser et al. Familial hyperinsulinism maps to chromosome 11p14-15.1, 30 cM centromeric to the insulin gene Nature Genet. 1994 7:185.
- Thomas et al. Homozygosity Mapping, to Chromosome 11p, of the Gene for Familial Persistent Hyperinsulinemic Hypoglycemia of Infancy Am. J. Hum. Genet. 1995 56:416-421.
- Kohler et al. Continuous Cultures of fused cells secreting antibody of predefined specificity Nature 1975 256:495-497.
- Cline M. J. Perspectives for Gene Therapy: Inserting New Genetic Information Into Mammalian Cells by Physical Techniques and Viral Vectors Pharmac. Ther. 1985 29:69-92.
- Walker G.T. et al. Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system Proc. Natl. Acad. Sci. (U.S.A.) 1992 89:392-396.
- Kwoh et al. Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format Proc. Natl. Acad. Sci. (U.S.A.) 1989 86:1173.
- Ohara et al. One-sided polymerase chain reaction: The amplification of cDNA Proc. Natl. Acad. Sci. (U.S.A.) 1989 86:5673-5677.
- Wu et al. The Ligation Amplification Reaction (LAR)-Amplification of Specific DNA Sequences Using Sequential Rounds of Template-Dependent Ligation Genomics 1989 4:560.
- Maxam et al. A new method for sequencing DNA Proc. Natl. Acad. Sci. USA 1977 74:560-564.
- Aguilar-Bryan et al. Photoaffinity Labeling and Partial Purification of the .beta. Cell Sulfonylurea Receptor Using a Novel, Biologically Active Glyburide Analog J. Biol. Chem. 1990 265:8218-8224.
- Thomas et al. Mutations in the Sulfonylurea Receptor Gene in Familia Persistent Hyperinsulinemic Hypoglycemia of Infancey Science 1995 268:426-429.
- Lichter et al. High-Resolution Mapping of Human Chromosome 11 by in Situ Hybridization with Cosmid Clones Science 1990 247:64.
- Ijdo et al. Multiple Variants in Subtelomeric Regions of Normal Karyotypes Genomics 1992 14:1019.
- Weish et al. Molecular Mechanisms of CFTR chloride Channel Dysfunction in Cystic Fibrosis Cell 1993 73:1251.
- Khorana et al. Direct sequencing of PCR products in agarose gel slices Nucleic Acids Res. 1994 22:3425.
- Lou et al. The Calcitonin Exon and its Flanking Intronic Sequences Are Sufficient for the Regulation of Human Calcitonin/Calcitonin Gene-Related Peptide Alternative RNA Splicing Mol. Endo. 1994 8:1618.
- Takahashi et al. A null mutation in the human CNTF gene is not causally related to neurological diseases Nature Genet. 1994 7:79.
- Satokata et al. Characterizationof a splicing mutation in group A xeroderma pigmentosum Proc. Natl. Acad. Sci. 1990 87:9908.
- Higashi et al. Aberrant splicing and missense, mutations cause steroid 21-hydroxylase [P-450 (C21)] deficiency in humans: Possible gene conversion products Proc. Natl. Acad. Sci., USA 85, 7486 1988.
- Philipson et al. Pas de Deux or More: The Sulfonylurea Receptor and K+ Channels Science 1995 268:372-373.
- Aguilar-Bryan et al. Cloning of the .beta.Cell High-Affinity Sulfonylurea Receptor: A Regulator of Insulin Secretion Science 1995 268:423-425.
- Scangos et al. Gene Transfer into Mice Advance In Genetics: Molecular Genetics of Development 1987 24:285-323.
- Virsolvy-Vergine et al. Endosulfine, an endogenous kpeptidic ligand for the sulfonylurea receptor: Purification and partial characterization from ovine brain Proc. Natl. Acad. Sci. USA 1992 89:6629-66363.