US 5,985,589 AGrant

Lipid Kinase

Issue Date:1999-11-16

•5 Claims

•2 Drawing Sheets

Abstract

The present invention generally relates to a novel catalytic subunit of a lipid kinase designated p110.delta.. Polynucleotides encoding p110.delta. and recombinant p110.delta. polypeptides are provided along with antibodies to p110.delta., assays for identifying inhibitors of p110.delta., and the like.

Metadata

Assignee

ICOS Corporation

Inventors

David H. Chantry
Merl F. Hoekstra
Douglas A. Holtzman

Application Information

Application Number:US 2259516

Filing Date:1999-01-06

Priority Date:1996-11-25

Art Unit:162

Classifications

IPC:

C12Q 148C12N 912C12P 2106C07H 2104

Field of Search:

43553053615;194;7.7;69.1;69.2;252.3;320.135023.2;23.5

Patent Drawings (2 sheets)

Description

Field of the Invention

The present invention relates generally to the identification and isolation of a novel lipid kinase and more particularly to the discovery of a novel catalytic subunit related to phosphatidylinositol 3-kinase, herein designated p110.delta..

Background of the Invention

Phosphatidylinositol 3-kinase (PI 3-kinase) was originally identified as an activity associated with viral oncoproteins and growth factor receptor tyrosine kinases which phosphorylates phosphatidylinositol (PI) and phosphorylated derivatives of PI at the 3'-hydroxyl of the inositol ring [Panayotou et al., Trends in Cell Biol., 2:358-360 (1992)]. The initial purification and molecular cloning of PI 3-kinase revealed that it was a heterodimer consisting of p85 and p110 subunits [Otsu et al., Cell, 65:91-104 (1992); Hiles et al., Cell, 70:419-429 (1992)].

The p85 subunit acts to localize PI 3-kinase to the plasma membrane by the interaction of its SH2 domain with phosphorylated tyrosine residues (present in an appropriate sequence context) in target proteins [Rameh et al. Cell, 83:821-830 (1995)]. Two isoforms of p85 have been identified, p85.alpha. which is ubiquitously expressed, and p85.beta., which is primarily found in brain and lymphoid tissues [Volinia et al., Oncogene, 7:789-793 (1992)].

The p110 subunit contains the catalytic domain of PI 3-kinase and three isofoniis (.alpha., .beta. and .gamma.) of p110 have thus far been identified. p110.alpha. and .beta. associate with p85 whereas p110.gamma. which is activated by G protein .beta..gamma. subunits, does not [Stoyanov et al., Science, 269:690-693 (1995)]. The cloning of p110.gamma. revealed additional complexity within this family of enzymes. p110.gamma. is closely related to p110.alpha. and .beta. (45-48% identity in the catalytic domain), but does not make use of p85 as a targeting subunit, instead p110.gamma. contains an additional domain termed a pleckstrin homology domain near its amino terminus. This domain allows interaction with the .beta..gamma. subunits of heterotrimeric G proteins and it appears that it is this interaction that regulates its activity [Stoyanov et al., 1995]. Thus PI 3-kinases are defined by their amino acid identity or their activity. Additional members of this growing gene family include more distantly related lipid and protein kinases including Vps34, TOR1 and TOR2 of Saccharomyces cerevisiae (and their mammalian homologous such as FRAP and mTOR), the ataxia telangiectasia gene product, and the catalytic subunit of DNA dependent protein kinase. [See, generally, the review of Hunter, Cell, 83:1-4 (1995).]

The levels of phospliatidylinositol (3, 4, 5) triphosphate (PIP.sub.3), the primary product of PI 3-kinase activation, increase upon treatment of cells with a wide variety of agonists. PI 3-kinase activation is therefore believed to be involved in a range of cellular responses including cell growth, differentiation and apoptosis [Parker et al., Current Biology, 5:577-579 (1995); Yao et al., Science, 267:2003-2005 (1995)]. The downstream targets of the phosphorylated lipids generated following PI 3-kinase activation have not been well characterized. In vitro, some isoforms of protein kinase C (PKC) are directly activated by PIP.sub.3 and the PKC related protein kinase PKB has been shown to be activated by PI 3-kinase through an as-yet-undetermined mechanism [Burgering and Coffer, Nature, 376:599-602 (1995)].

PI 3-kinase also appears to be involved in a number of aspects of leukocyte activation. A p85 associated PI 3-kinase activity has been shown to physically associate with the cytoplasmic domain of CD28, an important co-stimulatory molecule for the activation of T cells in response to antigen [Pages et al., Nature, 369:327-329 (1994); Rudd, Immunity, 4:527-534 (1996)]. Activation of T cells through CD28 lowers the threshold for activation by antigen and increases the magnitude and duration of the proliferative response. These effects are linked to increases in the transcription of a number of genes including the T cell growth factor interleukin 2 (IL-2) [Fraser et al., Science, 251:313-316 (1992)]. Mutation of CD28 such that it can no longer interact with PI 3-kinase leads to a failure to initiate IL-2 production, suggesting a critical role for PI 3-kinase in T cell activation [Pages et al. 1994]. Based on studies using the PI 3-kinase inhibitor, wortmannin, there is evidence that PI 3-kinase(s) are also required for some aspects of leukocyte signalling through G protein-coupled receptors [Thelen et al., Proc. Natl. Acad. Sci. USA., 91:4960-4964 (1994)].

There thus continues to exist a need in the art for further insights into the nature, function and distribution of PI 3-kinase providing means for effecting beneficial modulation of PI 3-kinase effects.

Summary of the Invention

The present invention provides novel purified and isolated polynucleotides (i.e., DNA and RNA both sense and antisense strands) encoding a heretofore unknown catalytic member of the PI 3-kinase family, designated p110.delta., which is expressed predominantly in leukocytes and thus likely plays a role in PI 3-Kinase mediated signaling in the immune system. Preferred DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. The DNA sequence encoding p110.delta. that is set out in SEQ ID NO: 1 and DNA sequences which hybridize to the noncoding strand thereof under standard stringent conditions (or which would hybridize but for the redundancy of the genetic code) are contemplated by the invention. Exemplary stringent hybridization conditions are as follows: hybridization at 65.degree. C. in 3.times. SSC, 20 mM NaPO.sub.4 pH 6.8 and washing at 65.degree. C. in 0.2.times. SSC. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are expected to allow the isolation of DNAs encoding allelic variants of p110.delta.; non-human species enzymes homologous to p110.delta.; and other structurally related proteins sharing one or more of the enzymatic activities, or abilities to interact with members or regulators, of the cell pathways in which p110.delta. participates.

Also contemplated by the invention are biological replicas (i.e., copies of isolated DNA sequences made in vivo or in vitro) of DNA sequences of the invention. Autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating p110.delta. sequences and especially vectors wherein DNA encoding p110.delta. is operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The skilled worker will understand the various components of vectors [e.g. promoter(s), selectable marker(s), origin of replication(s), multiple cloning site(s), etc.], methods for manipulating vectors and the uses of vectors in transforming or transfecting host cells (prokaryotic and eukaryotic) and expressing p110.delta. of the present invention.

According to another aspect of the invention, procaryotic or eukaryotic host cells are stably or transiently transformed with DNA sequences of the invention in a manner allowing the expression of p110.delta.. Host cells expressing p110.delta. or p110.delta. along with a binding partner thereof can serve a variety of useful purposes. Such cells constitute a valuable source of immunogen for the development of antibody substances specifically immunore-active with p110.delta.. Host cells of the invention are also useful in methods for the large scale production of p110.delta. wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.

As described herein, p110.delta. is a polypeptide which possess kinase catalytic activity.

In one aspect, the present invention provides p110.delta. polypeptides. The catalytic domain of p110.delta. polypeptide (amino acid residues 723-1044 of SEQ ID NO: 2) exhibits greater than 72% identity to the catalytic domain of p110.beta.. Preferably, the polypeptides of this invention exhibit identity to the catalytic domain of p110.beta. of 75% or greater. Even more preferably, the polypeptides comprise the amino acid residues according to SEQ ID NO: 2.

Yet another aspect of this invention provides polypeptide fragments or analogs of p110.delta.. The fragments of p110.delta. are useful in modulating the binding of p110.delta. and a binding partner (e.g., p85, Ras, and growth factor receptors). Analogs are polypeptides in which additions, substitutions, including conservative substitutions, or deletions of amino acid residues have been made in order to increase or decrease the binding affinity of the analog and a binding partner. These analogs of p110.delta. may be useful for modulating (i.e., blocking, inhibiting, or stimulating) the interaction between p110.delta. and a binding partner.

The polypeptides of this invention may be modified to facilitate passage into the cell, such as by conjugation to a lipid soluble moiety. For example, p110.delta. (or fragments or analogs thereof) may be conjugated to myristic acid. The peptides may be myristoylated by standard techniques as described in Eichholtz et al., J. Biol. Chem. 268:1982-1986 (1993), incorporated herein by reference. Alternatively, the peptides may be packaged in liposomes that may fuse with cell membranes and deliver the peptides into the cells. Encapsulation of the peptides in liposomes may also be performed by standard techniques as generally described in U.S. Pat. Nos. 4,766,046; 5,169,637; 5,180,713; 5,185,154; 5,204,112; and 5,252,263 and PCT Patent Application No. 92/02244, each of which is incorporated herein by reference.

Another aspect of this invention provides antibody substances (e.g., polyclonal and monoclonal antibodies, antibody fragments, single chain antibodies, chimeric antibodies, CDR-grafted antibodies, humanized antibodies and the like) specifically immunoreactive with p110.delta.. Antibody substances can be prepared by standard techniques using isolated naturally-occurring or recombinant p110.delta.. Specifically illustrating monoclonal antibodies of the present invention is the monoclonal antibody produced by hybridoma cell line 208F which was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852 on Oct. 8, 1996 and was assigned Accession No. HB 12200. The antibody substances are useful in modulating (i.e., blocking, inhibiting, or stimulating) the binding between p110.delta. and its binding partner. Antibody substances are also useful for purification of p110.delta. and are also useful for detecting and quantifying p110.delta. in biological samples by known immunological procedures. In addition, cell lines (e.g., hybridomas) or cell lines transformed with recombinant expression constructs which produce antibody substances of the invention are contemplated.

In another aspect, methods of identifying a modulator that inhibits or activates the kinase activity of p110.delta. are contemplated. In a preferred method, kinase activity of p110.delta. in the presence and absence of a potential modulator compound is determined and compared. A reduction in the kinase activity observed in the presence of the test compound indicates that the test compound is an inhibitor. An increase in the kinase activity observed in the presence of the test compound indicates that the test compound is an activator.

In another aspect, this invention provides methods of identifying a modulator that affects the binding of p110.delta. and a binding partner (e.g., p85, Ras and growth factor receptors) and thereby increases or decreases the effective specific subcellular concentration of p110.delta.. In this method, p110.delta. and its binding partner are incubated in the presence and absence of a putative modulator under conditions suitable for binding. The observed binding in the presence and absence of the modulator compound is compared. A reduction in the observed binding indicates that the compound inhibits binding. An increase in the observed binding indicates that the compound increases binding. These modulators are useful in affecting localization of p110.delta. to a specific subcellular location.

Modulators contemplated by the invention, for example, include polypeptides, polypeptide fragments of p110.delta., and other organic and inorganic chemical compounds.

This invention further provides a method of detecting the presence of p110.delta. in a biological sample. The method comprises exposing a p110.delta. specific antibody to a biological sample to be tested. The binding of the p110.delta. specific antibody to p110.delta. in the biological sample is detected by well-known means. For example, a second antibody conjugated to horseradish peroxidase (HRP) that specifically recognizes anti-p110.delta. antibody is used to detect anti-p110.delta. antibody. A positive color reaction catalyzed by HRP indicates that p110.delta. is present in the biological sample.

Yet another aspect of this invention provides a diagnostic reagent for detecting the presence of polynucleotides that encode p110.delta. in biological samples. The diagnostic reagent is a detectably labeled polynucleotide encoding part or all of the amino acid residues of p110.delta. set out in SEQ ID NO: 2. The presence of the polynucleotide in the biological sample is determined by hybridization of the diagnostic reagent to the polynucleotide encoding p110.delta.. Exemplary biological samples include chromosomes and chromosomal DNA. The diagnostic reagent is detectably labeled with well-known labels, including radioactive, enzymatic or other ligands, such as avidin/biotin, and fluorescent tags which are capable of providing a detectable signal.

The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see e.g. Capecchi, Science 244:1288-1292 (1989)] of mammals that fail to express a functional p110.delta. or that express a variant analog of p110.delta.. The mammals of the present invention comprise a disrupted p110.delta. gene or a disrupted homolog of the p110.delta. gene. The general strategy utilized to produce the mammals of the present invention involves the preparation of a targeting construct comprising DNA sequences homologous to the endogenous gene to be disrupted. The targeting construct is then introduced into embryonic stem cells (ES cells) whereby it integrates into and disrupts the endogenous gene or homolog thereof. After selecting cells which include the desired disruption, the selected ES cells are implanted into an embryo at the blastocyst stage. Exemplary mammals include rabbits and rodent species.

Polynucleotides of the invention are also expected to be useful in chromosomal localization studies potentially useful in detection of inappropriate and/or over expression of p110.delta. in abnormal cell types.

Also made available by the invention are antisense polynucleotides relevant to regulating expression of p110.delta. by those cells which ordinarily express the same.

Numerous additional aspects and advantages of the present invention will be apparent from the following detailed description of illustrative embodiments thereof.

Brief Description of the Drawings

FIG. 1 presents an alignment of the predicted catalytic domain of p110.delta. with the corresponding domain of other members of the PI 3-kinase family. The alignment was performed using Geneworks (Intelligenetics, Inc., Mountain View, Calif.).

FIG. 2 presents an alignment of the predicted Ras regulatory region of p110.delta. with the corresponding region of other members of the PI 3-kinase family. The conserved lysine which is essential for interaction with Ras is indicated by the symbol # below the consensus line.

Detailed Description of the Invention

The present invention is illustrated by the following examples. Example 1 describes the cloning and characterization of cDNA encoding p110.delta.. p110.delta. was obtained by combining three separate cDNA clones spanning the full length p110.delta. cDNA. Example 2 describes the expression and kinase activity of recombinant p110.delta.. Example 3 describes the isolation of a mouse genomic p110.delta. clone. Baculovirus expression of p110.delta. is described in Example 4. Example 5 assesses the ability of recombinant p110.delta. to associate with p85 in transfected mammalian cells. The expression of p110.delta. in various human tissues is disclosed in Example 6. Example 7 provides monoclonal antibodies specific for p110.delta.. Example 8 describes experiments directed to chromosomal localization of p110.delta.. Example 9 describes experiments related to the association of p110.delta. and growth factor receptors. Example 10 discusses the use of transgenic animals which are engineered to include a disruption in the p110.delta. gene.

Example 1

Degenerate oligonucleotide primers were designed for use in a PCR reaction based on sequences conserved in the catalytic domain of known PI 3-kinases. The sense primer was GCAGACGGATCCGGIGAYGAYHKIAGRCARGA (SEQ ID NO: 3) encoding the sequence GDDLRQD (SEQ ID NO: 4), and the anti-sense primer was GCAGACGAATTCRWRICCRAARTCIRYRTG (SEQ ID NO: 5) encoding the amino acid sequence HIDFGH (SEQ ID NO: 6). Bam HI and Eco RI restriction sites are underlined. PCR reactions consisted of 100 ng of cDNA template [from human peripheral blood mononuclear cells (PBMC) activated for 18 hours with 10 ng/ml phorbol myristate and 250 ng/ml calcium ionophore (Sigma)], 10 .mu.g/ml oligonucleotide primers, 50 mM KCl, 10 mM Tris HCl (pH 8.4), 1.5 mM MgCl.sub.2, 200 mM dNTPs, and 1U of Taq polymerase in a final volume of 100 .mu.l. Reactions were performed using denaturation for 1 minute at 94.degree. C., annealing at 60.degree. C. for 2 minutes and extension for at 72.degree. C. for 1 minutes for 3 cycles. The procedure was then repeated using 56.degree. C. annealing temperature for 3 cycles, 52.degree. C. annealing temperature for 3 cycles and 50.degree. C. annealing temperature for 30 cycles. Amplified products were gel purified, digested with Bam HI and Eco RI, and subcloned into the vector pBSSKII+ (Stratagene, La Jolla, Calif.) for sequencing. All DNA for sequencing was prepared using the Wizard Miniprep DNA Purification System (Promega, Madison, Wis.). Sequencing was performed on the Applied Biosystems Model 373 automated sequencer. Data bank searches were made using the BLAST program, and protein and DNA alignments were made using the Geneworks program (Intelligenetics Inc. Mountain View Calif.) One clone contained a 399 bp insert that encoded a 133 amino acid open reading frame showing similarity to p110.beta.. This clone was a partial clone of a new catalytic subunit of PI 3-kinase designated p110.delta..

To identify a cDNA encoding p110.delta., specific oligonucleotide primers were designed based on the sequence of the 399 bp PCR product. The forward primer was CATGCTGACCCTGCAGATGAT (SEQ ID NO: 7) and the reverse printer was AACAGCTGCCCACTCTCTCGG (SEQ ID NO: 8). These primers were used to screen a cDNA library from human PBMC stimulated with PMA and ionomycin (as described above) in the mammalian expression vector pRc-CMV. Successive rounds of PCR were performed initially on pools of 100,000 clones and subsequently on smaller pools until a single clone termed PBMC #249 was isolated by colony hybridization using the PCR product labelled by random priming as a probe. This cDNA was not full length. Therefore to identify longer cDNA clones the same approach was used to screen a cDNA library from human macrophages (also in the vector pRcCMV). This led to the isolation of an additional cDNA clone (M#928) which extended the cDNA sequence by 1302 bp.

The remaining 5' end of the cDNA encoding p110.delta. was obtained by 5' RACE PCR (Clonetech, Palo Alto, Calif.) Two anti-sense gene-specific oligonucleotide primers were designed based on the 5' end of cDNA M#928 for RACE PCR reactions. The primary RACE primer was GGGCCACATGTAGAGGCAGCGTTCCC (SEQ ID NO: 9) and the nested RACE primer was GGCCCAGGCAATGGGGCAGTCCGCC (SEQ ID NO: 10). Marathon-Race reactions were set up using Marathon-ready cDNA template from Human Leukocytes and the Advantage Core PCR Reaction kit (Clonetech, Palo Alto, Calif.) following the manufacturer's protocol. Touchdown PCR cycling conditions were modified to improve the specificity of the Marathon-RACE PCR primary reaction as follows: denaturation at 94.degree. C. for 2 minutes, followed by 5 cycles of denaturation at 94.degree. C. for 30 seconds and annealing and extension at 72.degree. C. for 3 minutes; 5 cycles of denaturation at 94.degree. C. for 30 seconds and annealing and extension at 70.degree. C. for 3 minutes; and 25 cycles of denaturation at 94.degree. C. for 30 seconds and annealing and extension at 68.degree. C. for 3 minutes.

Amplified products were used as templates in a nested PCR reaction using the previously described cycling parameters. The reamplified products were then analyzed by Southern blotting using oligonucleotide probes specific for p110.delta.. Probes (100 ng each) were end-labelled with .sup.32 P-.gamma.ATP, and hybridized and washed under standard conditions (Frisch and Sambrook). The sequences of the two probes were GATGCGGAACGGCTGCTCCAGGG (SEQ ID NO: 11) and CCAGGGACCACAGGGACACAGAG (SEQ ID NO: 12).

The specific 5' RACE PCR products identified in this manner were gel purified and subcloned into the TA vector PCRII (Invitrogen, San Diego, Calif.) according to the manufacturer's instructions. Three independent clones were sequenced to ensure the veracity of the 5' sequence.

A full length cDNA for p110.delta. was assembled from clones #249, M#928 and the 5' RACE PCR products. The 5' RACE product was used as a template in PCR using the 5' primer AGTTACGGATCCGGCACCATG(GACTACAAGGACGACGATGACAAG)CCCCCTGGGGTGGA CTGCCC (SEQ ID NO: 13) and the 3' primer CCACATGTAGAGGCAGCGTTCC (SEQ ID NO: 14). The 5' primer includes a Bam HI site (underlined), and sequences that encode the FLAG peptide sequence DYKDDDDK (SEQ ID NO: 15) (shown in parenthesis) which is recognized by the M2 anti-FLAG monoclonal antibody (Kodak Scientific Imaging Systems, New Haven, Conn.). The resulting PCR product was digested with Bam HI and Afl II, and was ligated along with an Afl II/Pvu I fragment derived from the clone M#928 and a Pvu II/Xba I fragment derived from PBMC clone #249 into the Bam HI/Xba I sites of the mammalian expression vector pcDNA3 (Invitrogen, San Diego, Calif.). The vector containing the FLAG-tagged composite p110.delta. cDNA is designated pCDNA3:p110.delta.FLAG. In the FLAG-tagged p110.delta., the FLAG-tag is located immediately after the initiating methionine.

A full-length composite cDNA encoding p110.delta. is shown in SEQ ID NO: 1. The sequence of p110.delta. includes an open reading frame of 3135 nucleotides which is predicted to encode a protein of approximately 114 KD. In addition, there are 197 bp of 5' and 1894 bp of 3' untranslated sequence. The sequence around the predicted initiating methionine is in good agreement with that required for optimal translational initiation [Kozak, M., J. Cell Biol., 115:887-992 (1991)] and the presence of stop codons in the 5' untranslated sequence is consistent with the isolation of the complete coding region of p110.delta..

Comparison of the deduced amino acid sequence of p110.delta. (SEQ ID NO: 2) with other PI 3-kinases reveals that it is most closely related to p110.beta.. Similar to p110.beta., the catalytic domain of p110.delta. is found in the C-terminus of the protein and is believed to be reside within amino acid residues 723-1044 of SEQ ID NO: 2. An alignment of the predicted carboxyl terminal catalytic domains of the PI 3-kinase family (including p110.delta. residues 723 through 1044 of SEQ ID NO: 2) is shown in FIG. 1. Table 1 shows the identity of p110.delta. to other members of the PI 3-kinase family. p110.delta. is 72% identical to p110.beta. in this region but is less closely related to p110.alpha. (49%) and p110.gamma. (45%). Table 1 also shows that p110.delta. shows low identity to cpk/p170 and the yeast Vps 34 protein, 31 and 32% respectively.

Dendrogram analysis revealed that p110.beta. and p110.delta. form a distinct sub-branch of the PI 3-kinase family. The distantly related ATM gene and the catalytic subunit of DNA dependent protein kinase have been included for comparison.

It has been demonstrated that PI 3-kinase is an important intermediate in the Ras pathway [Hu et al. 1993; Rodriguez-Viciana et al., EMBO Journal, 15:2442-2451 (1996)]. A constitutively active form of PI 3-kinase has been shown to increase transcription of the c-fos gene, activate the protein kinase Raf, and stimulate oocyte maturation [Hu et al., 1995]. The effects of PI 3-kinase in these systems can be blocked by co-expression of a dominant negative form of Ras indicating that PI 3-kinase acts upstream of Ras. Additional studies have shown that Ras can physically interact with PI 3-kinase in vitro and stimulate its kinase activity [Rodriguez-Viciana et al., 1996]. Thus PI 3-kinase can either act as an effector of Ras-dependent signalling or be directly activated by interaction with Ras. A specific region at the amino terminus of the p110 subunits termed the Ras regulatory domain is responsible for this interaction [Rodriguez-Viciana et al. 1996]. Comparison of the sequence of p110.delta. with other p110 subunits indicates that this region is also conserved in p110.delta. including a lysine residue which has been shown to be essential for physical association with Ras (Rodriguez-Viciana et al., 1996). Thus p110.delta. is also likely to interact with the Ras pathway. FIG. 2 presents an alignment of the proposed Ras binding sites of four p110 subunits including p110.delta. residues 141 through 310 of SEQ ID NO: 2.

Example 2

The FLAG-tagged p110.delta. was expressed by transfecting pCDNA3:p110.delta.FLAG into COS cells using DEAE dextran. Three days after transfection, expression of p110.delta. was determined by immunoprecipitations and western blotting using the M2 monoclonal antibody (Kodak Scientific Imaging Systems) according to the manufacturer's instructions. PI 3-kinase activity was determined as described [Hu et al., Mol. Cell. Biol., 13:7677-7688 (1993)].

To determine the PI 3-kinase activity of p110.delta., 5.mu.l of immunoprecipitated p110.delta. was mixed with 1 .mu.l of PI/EGTA and incubated at room temperature for 10 minutes [PI/EGTA is 10 mg/ml PI(Sigma) in CHCl.sub.3, which has been dried under a vacuum, resuspended in 20 mg/ml DMSO in the presence or absence of various concentrations of the PI3 kinase inhibitor wortmannin and diluted 1:10 in 5 mM EGTA] and added to 1 .mu.l 10.times. HM buffer (200 mM HEPES pH7.2, 50 mM MnCl.sub.2), 0.5 .mu.l .gamma..sup.32 PATP (10 mCi/ml-300 Ci/mmol), 1 .mu.l 100 .mu.M ATP, and 1.5 .mu.l H.sub.2 O and incubated at 30.degree. C. for 15 minutes. The reactions were terminated by addition of 100.mu.l 1M HCl. Lipids were extracted with 200 .mu.l CHCl.sub.3 /MeOH (1:1) by vortexing for 1 minute followed by centrifugation at 16,000.times.g for 2 minutes at room temperature. The lipids were further extracted with 80 .mu.l 1M HCl/MeOH (1:1) by vortexing for 1 minutes, followed by centrifugation at 16,000.times.g for 2 minutes at room temperature. The lipids were dried under vacuum, resuspended in 10 .mu.l CHCl.sub.3 /MeOH (1:1) and spotted 2 cm from the bottom of a dry Silica gel 60 chromatography plate (VWR) that had been pre-impregnated with 1% K.sub.2 C.sub.2 O.sub.4 in H.sub.2 O. 250 .mu.g of crude phosphoinositides (Sigma) were spotted as markers. The products were resolved by chromatography for 2 hours in CHCl.sub.3 /MeOH/4N NH.sub.4 OH (9:7:2), allowed to dry and placed in an Iodine vapor tank for 5 minutes in order to visualize the crude standards. The position of the standards was marked with a pencil and the plate was autoradiographed.

Phosphorylated lipids were generated in the kinase assays. The major product was phosphatidyl inositol phosphate (PIP). Furthermore, the generation of these phosphorylated lipids was inhibited in a dose dependent manner by wortmannin (approximately 50% of the activity was inhibited at 100 nM wortmannin) demonstrating that p110.delta. is a functional PI3 kinase.

Example 3

A mouse genomic clone encoding p110.delta. was isolated as described below. A mouse 129 SvEv lambda genomic library (Stratagene, La Jolla, Calif.) was screened using a fragment of the human cDNA clone for p110.delta. (corresponding to amino acids 739 to 1044 of SEQ ID NO.: 2) labelled to high specific activity (.sup..about. 1.times.10.sup.9 dpm/ug DNA) by random priming using the Random Primed DNA labelling Kit (Boehringer Mannheim). Hybridization was performed for sixteen hours at 42.degree. C. in buffer containing 50% formamide, 5.times. SSC, 5.times. Denhardts, 0.05M Na phosphate, and 100 ug/ml salmon sperm DNA. Filters were washed in 0.2.times. SSC/0.1% SDS at 50.degree. C. A single clone was isolated. Purified phage DNA was digested with Not I and inserts were subcloned into the vector pBSSKII+ (Stratagene, La Jolla, Calif.) for sequencing. This clone was approximately 16 kb and included the entire catalytic region of p110.delta..

Example 4

Recombinant p110.delta. may be expressed in SF9 insect cells using a baculovirus expression system.

As discussed in Example 1, FLAG-tagged p110.delta. encoding sequences are useful in expressing the kinases of this invention. Upon expression in insect cells, a monoclonal antibody that recognizes the FLAG tag (Eastman Kodak, Rochester, N.Y.) is used to purify large quantities of the FLAG-PIK-related kinase fusion protein. Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25 mM 2-glycerolphosphate, 50 mM sodium phosphate pH 7.2, 0.5% Triton-X 100, 2 mM EDTA, 2 mM EGTA, 25 mM sodium fluoride, 100 .mu.M sodium vanadate, 1 mM PMSF, 1 .mu.g/ml leupeptin, 1 .mu.g/ml pepstatin, 1 mM benzamidine, and 2 mM DTT). Expressed FLAG fusion proteins are purified over a column containing anti-FLAG antibody M2 affinity resin (Eastman Kodak). The column is washed with 20 column volumes of lysis buffer, then 5 column volumes of 0.5M lithium chloride, 50 mM Tris pH 7.6, 1 mM DTT, and then eluted either with 0.1M glycine pH 3.0 followed by immediate neutralization or by competitive elution with the FLAG peptide. For histidine tagged proteins, Ni-NTA agarose (Qiagen) is used for protein purification.

Plasmids for expression of p85 and p110.delta. in the baculovirus expression system were prepared as follows.

The plasmid pcDNA3:p85 DNA as described in Example 5 was digested with BamHI and EcoRI and the 2.5 kb FLAG-p85 band containing the entire p85 coding region with the FLAG tag was gel purified and inserted in BamHI-EcoRI site of pFastbac Dual (Gibco BRL). The ligation mixture was transformed into E. coli XL-1 blue (Stratagene) and plated on ampicillin containing plate. A clone was purified that carries the pFastbac-Dual-p85 plasmid.

The pFastbac-Dual-p85 plasmid was transformed into E. coli DH10 Bac cells and white colonies were selected on plates containing kanomycin, gentamycin, tetracyoline, X-gel and IPTG. One white colony was restreaked on a similar plate for repurification. Recombinant p85-bacmid DNA was purified from this clone.

The plasmid pcDNA3:p110.delta. containing the entire p110.delta. coding region with the FLAG tag was digested with BamHI and XbaI, gel purified and inserted into the BamHI-XbaI site of pFastbac HTb (Gibco BRL) such that the coding region of FLAG-tagged p110.delta. was in frame with the coding sequences of the histidine-tag present in the vector. The ligation mixture was then transformed into E. coli XL-1 blue (Stratagene). A clone carrying pFast-bac Htb p110.delta. was isolated and the plasmid DNA was isolated and the plasmid DNA was purified. P110.delta.-bacmid DNA was prepared by transforming E. coli DH10 bac cells as described for p85-bacmid.

To prepare virus stocks, the p85-bacmid and the p1106.delta.-bacmid DNAs were separately transfected into SF-9 cells according to the Gibco BRL suggested protocol. Forty-eight hours after transfection, the SF9 cell pellet and baculovirus produced by the transfected cells were harvested. The virus was stored at 4.degree. C. in Grace's Complete media containing 10% FBS, pennicillin-streptomycin, and gentamicin. This viral prep was used to make a high titer (P2) virus stock. The P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected 48 hours after infection and centrifuged at low speed to pellet the cells without lysis. The cell pellet was stored at -20.degree. C. for 24 hours before lysis. The cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCl; 1% NP40; 100 .mu.m PMSF). Expression of p85 and p110.delta. was confirmed by immunoblot using the M2 antibody anti-FLAG as a probe. The SF-9 transfected cells produced an approximately 85 kDa protein and a 110 kDa protein which were immunoreactive with anti-FLAG antibodies.

The P2 virus stock were also used to co-infect a 2 liter culture of SF9 cells. The cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20.degree. C. A cell pellet from 150 mls of this culture was lysed in 7.5 ml of lysis buffer (50 mM NaPO.sub.4 pH7.2; 0.5% NP-40; 10 mM imidazole, 25 mM NaF, 100 .mu.M Na.sub.3 VO.sub.4 ; 0.5 mM AEBSF; 1 .mu.g/ml leupeptin; 1 .mu.g/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000.times.g. The supernatant was removed and any DNA in the lysate resulting from broken nuclei was sheared by aspirating through an 20 gauge needle. Particulate matter was then removed by filtering through a 0.8 micron filter followed by a 0.2 micron filter. This cleared lysate was adjusted to contain 5 mM .beta.-mercaptoethanol and 0.4 M NaCl. A 1 ml Ni-NTA-agarose column (Qiagen) was equilibrated in Buffer A (0.4 M NaCl; 5 mM .beta.-mercaptoethanol; 0.1% Triton X-100; 50 mM NaPO.sub.4 10 mM imidazole; 25 mM NaF, 100 .mu.M Na.sub.3 VO.sub.4 ; 0.5 mM AEBSF; 1 .mu.g/ml leupeptin; 1 .mu.g/ml pepstatin A) prior to loading the cleared lysate. The sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A.

Example 5

The ability of p110.delta. to associate with p85 was assessed by Western blot analysis. COS cells were transiently transfected with p110.delta. (see Example 2) and association with endogenous p85 was determined by coimmunoprecipitation. As controls, cells were also transfected with FLAG-tagged p85 DNA or empty vector. The cDNA encoding the p85 subunit was isolated from human leukocyte cDNA by Marathon-race PCR. The cDNA sequence of p85 was described in Otsu, Cell, 65:91-104 (1992). The p85 cDNA was modified for expression as a FLAG-tagged protein (pcDNA3:p85) in a manner similar to the protocols described herein for p110.delta..

COS cells were lysed in 3 ml Buffer R (1% Triton X-100, 150 mM NaCl, 10 mM Tris pH7.5, 1 mM EGTA, 0.5% NP-40, 0.2mM Na.sub.3 VO.sub.4, 0.2 mM PMSF, 1.times. aprotinin, 1.times. leupeptin, 1.times. pepstatin A). After 10 minutes at 4.degree. C., the lysates were sheared by passing through a 27G needle several times. The lysates were clarified by centrifugation at 16,000.times.g for 10 minutes at 4.degree. C., and immunoprecipitated for 2 hours at 4.degree. C. with either 1 .mu.g anti-p110.beta. (Santa Cruz Laboratories, Santa Cruz, Calif.), 10 .mu.g anti-FLAG-M2 (Eastman Kodak), or 1 .mu.g anti-p85 (Santa Cruz Laboratories). Immune complexes were bound to 60 .mu.l of Protein G-sepharose (Pharmacia) for 30 minutes at 4.degree. C. then washed 3 times in 300 .mu.l of Buffer R and resuspended in 25 .mu.l PAN (100 mM NaCl, 10 mM PIPES pH7.0, 20 .mu.g/ml Aprotinin). 5 .mu.l of each immunoprecipitate was resolved by 8% SDS-PAGE (Novex), transferred to Immobilon-P (Millipore), blocked one hour at room temperature in 5% non-fat dried milk in TBS, and detected by Western blotting using either anti-p85 rabbit polyclonal antibodies (Santa Cruz Laboratories) at 1 .mu.g/ml followed by goat anti-rabbit IgG HRP conjugated secondary antibody (Boehringer) or anti-FLAG-M2 monoclonal antibody at 10 .mu.g/ml followed by goat anti-mouse IgG HRP conjugated secondary antibody (Boehringer).

The Westerns showed that anti-FLAG-M2 antibody recognized immune complexes including FLAG-tagged p85 and FLAG-tagged p110.delta..

Example 6

While the activation of PI 3-kinase in a wide range of biological systems has been extensively studied, less is known concerning the cell type specific expression of particular p110 isoformis. The expression of p110.delta. in human heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, uterus, small intestine, colon, and PBMC was determined by Northern blot analysis.

.sup.32 P-labelled cDNA probes were prepared by PCR using 10 ng of plasmid DNA template encoding p110.delta., as described previously [Godiska et al, J. Neuroimmun., 58:167-176 (1995)]. The forward primer was CTGCCATGTTGCTCTTGTTGA (SEQ ID NO: 16) and the reverse primer was GAGTTCGACATCAACATC (SEQ ID NO: 17). Reactions were heated for 4 minutes at 94.degree. C., followed by 15 cycles of denaturation for 1 minutes at 94.degree. C., annealing for 1 minutes at 55.degree. C. and extension for 2 minutes at 72.degree. C.

Unincorporated nucleotides were removed by passing the reaction over a sephadex G50 column (Boehringer Mannheim Biochemicals). A Multiple Tissue Northern blot (Clontech, Palo Alto, Calif.) was probed and washed under stringent conditions according to the manufacturer's recommendations. The autoradiograph was exposed for 1-4 days at -80.degree. C. with intensifying screens.

Northern blot analysis revealed a single transcript of approximately 5.4 kb (consistent with the size of the composite cDNA). The highest levels of expression were seen in peripheral blood mononuclear cells (PBMC) and in spleen and thymus. On prolonged exposure of the autoradiograph, expression of p110.delta. could also be detected in testes, uterus, colon, and small intestine, but not in other tissues examined including prostate, heart, brain, and liver. In contrast, p110.beta. is expressed at high levels in brain, heart, kidney and liver, but cannot be readily detected in lymphoid tissues such as spleen. p110.beta. is expressed at high levels in the transformed Jurkat T cell line (Hu et al. 1993). The expression of the p110.alpha. isoform has not been well documented.

p110 isoforms have been shown to differ with respect to their preferred substrate specificities [Stephens et al., Current Biology, 4:203-214 (1994)]. In view of their potential for interaction with a common p85 adaptor protein, it is likely that the nature of the phosphorylated lipids generated in response to a particular agonist may be regulated at least in part by the cell/tissue specific expression of the different isoforms of the kinase enzymatic activity. The abundant expression of p110.delta. in PBL and lymphoid tissues such as spleen and thymus suggests that this isoform may be involved in aspects of leukocyte activation.

Example 7

Monoclonal antibodies were generated against the carboxy terminal portion of p110.delta. (amino acids 740-1044 of SEQ ID NO: 2) expressed as a fusion protein with glutathione S transferase (GST) [Pharmacia, Alameda, Calif.]. Five Balb/c mice (Charles River Biotechnical Services, Inc., Wilmington, Mass., IACUC #901103) were immunized subcutaneously with 30 ug of antigen in complete Freund's adjuvant [CFA] (Sigma), a second immunization of 30 ug of antigen in incomplete Freunds adjuvant (IFA) (Sigma) was administered on day 22. A third immunization with 30 ug of antigen in IFA was administered on day 44. Immune serum was collected via retro-orbital bleeding on day 55 and tested by western blotting to determine reactivity to p110.delta.. All animals showed reactivity towards the immunogen and were immunized a fourth time on day 66 with 30 ug of antigen in IFA. Immune serum was collected via retro-orbital bleeding on day 76 and tested by western blotting to determine its reactivity, animal #2321 showed the highest level of immunoreactivity and was chosen for fusion. On day 367 and 368 mouse #2321 was injected intraperitoneally with 50 ug of antigen in PBS and a fusion was performed on day 371.

The spleen was removed sterilely and a single-cell suspension was formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum free RPMI 1640, supplemented with 2 mM L-glutamine, 1mM sodium pyruvate, 100 units/ml penicillin, and 100 .mu.g/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, N.J.), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI. Thymocytes taken from 3 naive Balb/c mice were prepared in the same manner.

Two.times.10.sup.8 spleen cells were combined with 4.times.10.sup.7 NS-1 cells (kept in log phase in RPMI with 11% fetal bovine serum (FBS) for three days prior to fusion), centrifuged and the supernatant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37.degree. C. PEG 1500 (50% in 75 mM Hepes, pH 8.0) (Boehrnger Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI containing 15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5.times.10.sup.6 thymocytes/ml. The suspension was dispensed into ten 96-well flat bottom tissue culture plates (Corning, United Kingdom) at 200 .mu.I/well. Cells were fed on days 2, 4, and 6 days post-fusion by aspirating 100 .mu.l from each well with an 18 G needle (Becton Dickinson), and adding 100 .mu.l/well plating medium containing 10 U/ml IL-6 and lacking thymocytes.

When cell growth reached 60-80% confluence (day 8-10), culture supernatants were taken from each well and screened for reactivity to p110.delta. by ELISA. Immulon 4 plates (Dynatech, Cambridge, Mass.) were coated at 4.degree. C. with 50 .mu.l/well with 100 ng/well of p110.delta.:GST or GST in 50 mM carbonate buffer, pH 9.6. Plates were washed 3.times. with PBS with 0.05%, Tween 20 (PBST), blocked 30 minutes at 37.degree. C. with 0.5% Fish Skin Gelatin. Plates were washed as described above and 50 .mu.l culture supernatant was added. After incubation at 37.degree. C. for 30 minutes, 50 .mu.l of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pa.) [diluted 1:10,000 in PBST] was added. Plates were incubated at 37.degree. C. for 30 minutes, washed 4.times. with PBST and 100 .mu.l of substrate, consisting of 1 mg/ml TMB (Sigma) and 0.15 ml/ml 30% H.sub.2 O.sub.2 in 100 mM Citrate, pH 4.5, was added. The color reaction was stopped in 3 minutes with the addition of 50 ml of 15% H.sub.2 SO.sub.4. A.sub.450 was read on a plate reader (Dynatech).

Thirty-six wells showed preferential reactivity to p110.delta. versus GST. Supernatants from these wells were then screened for reactivity to recombinant p110.delta. by Western blotting. Ten wells (208A, 208B, 208C, 208D, 208E, 208F, 208G, 208H, 208I, and 208J) showed reactivity by Western blotting and were cloned twice by limiting dilution. Selected wells were tested by ELISA 7-10 days later. Activity was retained in all ten lines. Monoclonal antibodies produced by the cell lines were isotyped by ELISA assay. 208A, 208C, 208D, 208E, 208G, 208H, 208I were IgG.sub.2n, while 208J was IgG.sub.1 and 208B was IgG2b. An exemplary monoclonal antibody, produced by hybridoma cell line 208F (ATCC HB 12200), showed high reactivity with p110.delta. and recognized a 110 kD protein in PBMC by Western analysis. The molecular weight of the 110 kD protein is consistent with the molecular weight of p110.delta..

Example 8

Elevated levels of 3' phosphorylated phosphoinositides have been detected in cells transformed with viral oncoproteins. This observation suggests that PI 3-kinases may play a role in carcinogenesis. Chromosomal localization of p110.delta. provides insights into the role of PI 3-kinase in carcinogenesis. Chromosomal localization studies of p110.delta. of cancerous cells may identify inappropriate and/or over expression of p110.delta..

For example, in 90-95% of chronic myelogenous leukaemia there is a reciprocal chromosomal translocation which leads to the transfer of the tyrosine kinase c-abl from chromosome 9 into the ber gene on chromosome 22. The resultant inappropriate expression of c-abl tyrosine kinase activity is critical for cell transformation and tumorigenesis. Chromosomal localization of p110.delta. is determined by fluorescence in situ hybridization (FISH) using the complete cDNA for p110.delta. as a probe. In this manner, the role of p110.delta. in chromosomal translocations observed during tumorigenesis (e.g. leukemogenesis) is identified.

Example 9

PI 3-kinase activity has been reported to be associated with a number of growth factor receptors. In addition, it has been observed that PI 3-kinase activity increases following cell activation. The antibodies to p110.delta. disclosed in Example 5 are utilized to determine by Western blotting and immunoprecipitation the nature of the receptors with which p110.delta. associates. These antibodies are also useful in elucidating the regulation of PI 3-kinase enzymatic activity and cellular localization during cell activation. In view of the high levels of expression of p110.delta. in the immune system, it is likely that growth factor receptors involved in immune activation may associate with or be regulated by p110.delta.. These receptors include T-cell receptors CD28 and CD2 and cytokine receptors such as IL-1 and IL-4, and tyrosine kinase coupled receptors such as CSF-1 R.

Example 10

To determine the functional role of p110.delta. in vivo, the p110.delta. gene is inactivated in the germline of mammals by homologous recombination. Animals in which an endogenous gene has been inactivated by homologous recombination are also known as "knockout" animals. Exemplary mammals include rabbits and rodent species such as mice. "Knockout" animals can be prepared by homologous recombination methods using the p110.delta. genomic clone of Example 3.

These "knockout" animals allow for the determination of the role of p110.delta. in immune and proliferative responses. The role of p110.delta. in immune and proliferative response is determined by analysis of the development of the immune system in these animals (as determined by FACS analysis of cell populations at different stages of development), characterization of the effector function of the mature lymphoid populations of these animals both in vivo (as determined by antibody responses to injected antigens, cytotoxic T cell responses to viruses and or injected tumor cell lines, and the ability to reject allografts) and in vitro (as determined by proliferation of lymphocytes in response to allo-antigen, polyclonal activation by mitogens/superantigens, and the ability to elaborate cytokines).

While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

Claims

What is claimed:

1. A method of identifying a compound that is a modulator of p110.delta. having SEQ ID NO: 2, comprising the steps of: a) determining the kinase activity of p110.delta. in the absence and presence of the compound; b) comparing the kinase activities observed in step (a); and c) identifying the compound as a modulator of p110.delta. wherein a difference in kinase activity is observed in the presence and absence of said compound.

2. A method of identifying a compound that is a modulator of binding between p110.delta. of SEQ ID NO: 2, and a binding partner comprising the steps of: a) determining the level of binding between p110.delta. and the binding partner in the absence and presence of the compound; b) comparing the level of binding observed in step (a); and c) identifying the compound as a modulator of the binding between p110.delta. and the binding partner wherein a difference in binding is observed in the presence and absence of said compound.

3. The method of claim 2 wherein said binding partner is p85.

4. The method of claim 2 wherein said binding partner is Ras.

5. The method of claim 2 wherein said binding partner is a growth factor receptor.

Patent Citations (10)

Patent	Date	Inventor
US4766046	1988-08-01	Abra et al.
US5169637	1992-12-01	Lenk et al.
US5180713	1993-01-01	Abra et al.
US5185154	1993-02-01	Lasic et al.
US5204112	1993-04-01	Hope et al.
US5252263	1993-10-01	Hope et al.
US5480906	1996-01-01	Creemer et al.
WOXWO92/02244	1992-02-01
WOXWO96/25488	1996-08-01
WOXWO97/46688	1997-12-01

Non-Patent Literature (29)

Burgering and Coffer, "Protein Kinase B(c-Akt) in Phosphatidylinositol-3-OH Kinase Signal Transduction," Nature, 376:599-602 (1995).
Capecchi, M.R., "Altering the Genome by Homologous Recombination," Science, 244:1288-1292 (1989).
Eichholtz et al., "A Myristoylated Pseudosubstrate Peptide, a Novel Protein Kinase C Inhibitor," J. Biol. Chem., 268:1982-1986 (1993).
Fraser et al., "Regulation of Interleukin-2 Gene Enhancer Activity by the T Cell Accessory Molecule CD28," Science, 251:313-316 (1991).
Godiska et al., "Chemokine Expression in Murine Experimental Allergic Encephalomyelitis," J. Neuroimmun., 58:167-176 (1995).
Hiles et al., "Phosphatidylinositol 3-Kinase: Structure and Expression of the 110 kd Catalytic Subunit," Cell, 70:419-429 (1992).
Hu et al., "Cloning of a Novel, Ubiquitously Expressed Human Phosphatidylinositol 3-Kinase and Identification of its Binding Site on p85," Mol. Cell. Biol., 13:7677-7688 (1993).
Hu et al., "Ras-Dependent Induction of Cellular Responses by Constitutively Active Phosphatidylinositol-3 Kinase," Science, 268:100-102 (1995).
Hunter, T., "When is a Lipid Kinase Not a Lipid Kinase? When it is a Protein Kinase," Cell, 83:1-4 (1995).
Kozak, M., "An Analysis of Vertebrate mRNA Sequences: Intimations of Translational Control," J. Cell. Biol., 115:887-992 (1991).
Otsu et al., "Characterization of Two 85 kd Proteins that Associate with Receptor Tyrosine Kinases, Middle-T/pp60.sup.c-src Complexes, and PI3-Kinase," Cell, 65:91-104 (1991).
Pages et al., "Binding of Phosphatidyl-inositol-3-OH Kinase to CD28 is Required for T-cell Signalling," Nature, 369:327-329 (1994).
Panayotou and Waterfield, "Phosphatidyl-inositol 3-kinase: A Key Enzyme in Diverse Signalling Processes," Trends in Cell Biol., 2:358-360 (1992).
Parker,P.J., "PI 3-kinase puts GTP on the Rac," Current Biology, 5:577-579 (1995).
Rameh et al., "Phosphatidylinositol (3,4,5)P.sub.3 Interacts with SH2 Domains and Modulates PI 3-Kinase Association with Tyrosine-Phosphorylated Proteins," Cell, 83:821-830 (1995).
Rodriguez-Viciana et al., "Activation of Phosphoinositide 3-Kinase by Interaction with Ras and by Point Mutation," EMBO Journal., 15:2442-2451 (1996).
Rudd, C.E., "Upstream-Downstream: CD28 Cosignaling Pathways and T Cell Function," Immunity, 4:527-534 (1996).
Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, (1989).
Stephens et al., "Characterization of a Phosphatidylinositol-Specific Phosphoinositide 3-kinase from Mammalian Cells," Current Biology, 4:203-214 (1994).
Stoyanov et al., "Cloning and Characterization of a G Protein-Activated Human Phosphoinositied-3 Kinase," Science, 269:690-693 (1995).
Thelan et al., "Wortmannin Binds Specifically to 1-phosphatidylinositol 3-kinase While Inhibiting Guanine Nucleotide-binding Protein-coupled Receptor Signaling in Neutrophil Leukocytes," Proc. Natl. Acad. Sci. USA., 91:4960-4964 (1994).
Volinia et al., "Chromosomal Localization of Human p85.alpha., a Subunit of Phosphatidylinositol 3-kinase, and its Homologous p85.beta.," Oncogene, 7:789-793 (1992).
Yao and Cooper, "Requirement for Phosphatidylinositol-Kinase in the Prevention of Apoptosis by Nerve Growth Factor," Science, 267:2003-2006 (1995).
Chantry, D. et al., "p110.delta., a Novel Phosphatidylinositol 3-Kinase Catalytic Subunit That Associates with p85 and Is Expressed Predominantly in Leukocytes," J. Biological Chemistry, 272(31):19236-19241 (Aug. 1, 1997).
Genbank Accession No. U57843, "Human phosphatidylinositol 3-kinase delta catalytic subunit mRNA," deposited by Morris, A.J., dated May 10, 1997.
Vanhaesebroeck, B. et al., "p110.delta., a novel phosphoinositide 3-kinase in leukocytes," Proc. Natl. Acad. Sci., USA, 94:4330-4335 (Apr. 1997).
Volinia, S. et al., "A human phosphatidylinositol 3-kinase complex related to the yeast Vps34p-Vps15p protein sorting system," EMBO J., 14(14):3339-3348 (1995).
Hu, P. et al., "Cloning of a Novel, Ubiquitously Expressed Human Phosphatidylinositol 3-Kinase and Identification of Its Binding Site on p85," Molecular and Cellular Biology, 13(12):7677-7688 (1993).
Vanhaesebroeck et al. Faseb Journal (1996) vol. 10, No. 6, pp A 1395 (abstract only), Jun. 6, 1996.

Abstract

Description

Field of the Invention

Background of the Invention

Summary of the Invention

As described herein, p110.delta. is a polypeptide which possess kinase catalytic activity.

Modulators contemplated by the invention, for example, include polypeptides, polypeptide fragments of p110.delta., and other organic and inorganic chemical compounds.

Also made available by the invention are antisense polynucleotides relevant to regulating expression of p110.delta. by those cells which ordinarily express the same.

Numerous additional aspects and advantages of the present invention will be apparent from the following detailed description of illustrative embodiments thereof.

Brief Description of the Drawings

Detailed Description of the Invention

Example 1

Example 2

Example 3

Example 4

Recombinant p110.delta. may be expressed in SF9 insect cells using a baculovirus expression system.

Plasmids for expression of p85 and p110.delta. in the baculovirus expression system were prepared as follows.

Example 5

The Westerns showed that anti-FLAG-M2 antibody recognized immune complexes including FLAG-tagged p85 and FLAG-tagged p110.delta..

Example 6

Example 7

Example 8

Example 9

Example 10

Claims

What is claimed:

3. The method of claim 2 wherein said binding partner is p85.

4. The method of claim 2 wherein said binding partner is Ras.

5. The method of claim 2 wherein said binding partner is a growth factor receptor.

Patent Citations (10)

Patent	Date	Inventor
US4766046	1988-08-01	Abra et al.
US5169637	1992-12-01	Lenk et al.
US5180713	1993-01-01	Abra et al.
US5185154	1993-02-01	Lasic et al.
US5204112	1993-04-01	Hope et al.
US5252263	1993-10-01	Hope et al.
US5480906	1996-01-01	Creemer et al.
WOXWO92/02244	1992-02-01
WOXWO96/25488	1996-08-01
WOXWO97/46688	1997-12-01

Non-Patent Literature (29)

Burgering and Coffer, "Protein Kinase B(c-Akt) in Phosphatidylinositol-3-OH Kinase Signal Transduction," Nature, 376:599-602 (1995).

Capecchi, M.R., "Altering the Genome by Homologous Recombination," Science, 244:1288-1292 (1989).

Eichholtz et al., "A Myristoylated Pseudosubstrate Peptide, a Novel Protein Kinase C Inhibitor," J. Biol. Chem., 268:1982-1986 (1993).

Fraser et al., "Regulation of Interleukin-2 Gene Enhancer Activity by the T Cell Accessory Molecule CD28," Science, 251:313-316 (1991).

Godiska et al., "Chemokine Expression in Murine Experimental Allergic Encephalomyelitis," J. Neuroimmun., 58:167-176 (1995).

Hiles et al., "Phosphatidylinositol 3-Kinase: Structure and Expression of the 110 kd Catalytic Subunit," Cell, 70:419-429 (1992).

Hu et al., "Cloning of a Novel, Ubiquitously Expressed Human Phosphatidylinositol 3-Kinase and Identification of its Binding Site on p85," Mol. Cell. Biol., 13:7677-7688 (1993).

Hu et al., "Ras-Dependent Induction of Cellular Responses by Constitutively Active Phosphatidylinositol-3 Kinase," Science, 268:100-102 (1995).

Hunter, T., "When is a Lipid Kinase Not a Lipid Kinase? When it is a Protein Kinase," Cell, 83:1-4 (1995).

Kozak, M., "An Analysis of Vertebrate mRNA Sequences: Intimations of Translational Control," J. Cell. Biol., 115:887-992 (1991).

Otsu et al., "Characterization of Two 85 kd Proteins that Associate with Receptor Tyrosine Kinases, Middle-T/pp60.sup.c-src Complexes, and PI3-Kinase," Cell, 65:91-104 (1991).

Pages et al., "Binding of Phosphatidyl-inositol-3-OH Kinase to CD28 is Required for T-cell Signalling," Nature, 369:327-329 (1994).

Panayotou and Waterfield, "Phosphatidyl-inositol 3-kinase: A Key Enzyme in Diverse Signalling Processes," Trends in Cell Biol., 2:358-360 (1992).

Parker,P.J., "PI 3-kinase puts GTP on the Rac," Current Biology, 5:577-579 (1995).

Rameh et al., "Phosphatidylinositol (3,4,5)P.sub.3 Interacts with SH2 Domains and Modulates PI 3-Kinase Association with Tyrosine-Phosphorylated Proteins," Cell, 83:821-830 (1995).

Rodriguez-Viciana et al., "Activation of Phosphoinositide 3-Kinase by Interaction with Ras and by Point Mutation," EMBO Journal., 15:2442-2451 (1996).

Rudd, C.E., "Upstream-Downstream: CD28 Cosignaling Pathways and T Cell Function," Immunity, 4:527-534 (1996).

Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, (1989).

Stephens et al., "Characterization of a Phosphatidylinositol-Specific Phosphoinositide 3-kinase from Mammalian Cells," Current Biology, 4:203-214 (1994).

Stoyanov et al., "Cloning and Characterization of a G Protein-Activated Human Phosphoinositied-3 Kinase," Science, 269:690-693 (1995).

Thelan et al., "Wortmannin Binds Specifically to 1-phosphatidylinositol 3-kinase While Inhibiting Guanine Nucleotide-binding Protein-coupled Receptor Signaling in Neutrophil Leukocytes," Proc. Natl. Acad. Sci. USA., 91:4960-4964 (1994).

Volinia et al., "Chromosomal Localization of Human p85.alpha., a Subunit of Phosphatidylinositol 3-kinase, and its Homologous p85.beta.," Oncogene, 7:789-793 (1992).

Yao and Cooper, "Requirement for Phosphatidylinositol-Kinase in the Prevention of Apoptosis by Nerve Growth Factor," Science, 267:2003-2006 (1995).

Chantry, D. et al., "p110.delta., a Novel Phosphatidylinositol 3-Kinase Catalytic Subunit That Associates with p85 and Is Expressed Predominantly in Leukocytes," J. Biological Chemistry, 272(31):19236-19241 (Aug. 1, 1997).

Genbank Accession No. U57843, "Human phosphatidylinositol 3-kinase delta catalytic subunit mRNA," deposited by Morris, A.J., dated May 10, 1997.

Vanhaesebroeck, B. et al., "p110.delta., a novel phosphoinositide 3-kinase in leukocytes," Proc. Natl. Acad. Sci., USA, 94:4330-4335 (Apr. 1997).

Volinia, S. et al., "A human phosphatidylinositol 3-kinase complex related to the yeast Vps34p-Vps15p protein sorting system," EMBO J., 14(14):3339-3348 (1995).

Hu, P. et al., "Cloning of a Novel, Ubiquitously Expressed Human Phosphatidylinositol 3-Kinase and Identification of Its Binding Site on p85," Molecular and Cellular Biology, 13(12):7677-7688 (1993).

Vanhaesebroeck et al. Faseb Journal (1996) vol. 10, No. 6, pp A 1395 (abstract only), Jun. 6, 1996.