Genetic Test for Equine Severe Combined Immunodeficiency Disease

1. Field of the Invention

The present invention relates generally to the fields of molecular genetics and veterinary medicine. More specifically, the present invention relates to the mutation of a DNA-dependent protein kinase protein which results in equine severe combined immunodeficiency and a diagnostic test to identify carriers of the mutation.

2. Description of the Related Art

V(D)J rearrangement is the molecular mechanism by which distinct gene segments (V, D, and J) are joined to form the coding sequences of immunoglobulin (Ig) and T cell receptor (TCR) variable regions. The rearrangement process is targeted by simple DNA sequence elements (recombination signal sequences, RSS) found immediately adjacent to all functional immune receptor gene segments and involves two double-stranded DNA cuts and subsequent re-ligations. This process results in the formation of two new DNA joints; coding joints which contain the coding information, and signal joints which contain the two recombination signal sequences. V(D)J rearrangement is mediated by a lymphoid-specific endonuclease (the RAG 1 and RAG 2 proteins) and ubiquitously expressed components of the double strand break repair pathway. The centrality of V(D)J recombination to the development of the vertebrate immune system is evident in situations where the process is defective.

Defective V(D)J recombination results in a complete block of B and T cell lymphopoiesis and the disease severe combined immunodeficiency (SCID). The first example of defective V(D)J recombination was described in 1983 by Bosma and colleagues, relating to a spontaneous mutation in mice that results in severe combined immunodeficiency (C.B-17 mice). In severe combined immunodeficiency mice, the only step in V(D)J recombination that appears to be impaired is resolution of coding ends. Instead of being resolved into functional immune receptors, cleaved coding ends accumulate abnormally in developing severe combined immunodeficiency lymphocytes. However, cleaved signal ends are resolved at a similar rate as in wild type lymphocytes in mice.

In 1990, it was demonstrated that the defect in severe combined immunodeficiency mice not only impairs V(D)J recombination, but also affects the more general process of double strand break repair (DSBR). This observation was the first to link V(D)J recombination and double strand break repair. In recent years it has been shown that at least four factors are required for both V(D)J recombination and double strand break repair: the Ku heterodimer, DNA-dependent protein kinase.sub.catalytic subunit (PK.sub.CS), XRCC4, and XRCC6.

Recently, defective DNA-dependent protein kinase.sub.catalytic subunit has been identified as the determinative factor in C.B-17 severe combined immunodeficiency mice. The DNA-end binding Ku heterodimer interacts with DNA-dependent protein kinase.sub.catalytic subunit to generate a protein kinase (DNA-PK) that is dependent on linear DNA for activation (i.e., DNA-dependent protein kinase). DNA-dependent protein kinase.sub.catalytic subunit is related to the phosphatidylinositol 3-kinase family whose members function in a variety of roles such as signal transduction by phosphorylation of phospholipids, control of cell cycle progression, and maintenance of telomere length.

Although DNA-dependent protein kinase.sub.catalytic subunit has been implicated in a variety of different processes, its precise role is unclear. The factor defective in the double strand break repair mutant CHO cell line XRI. In sum, defects in either the lymphocyte specific components of the V(D)J recombinase (RAG 1 -/- mice, RAG 2 -/- mice, RAG-deficient children) or any one of these double strand break repair factors (C.B-17 severe combined immunodeficiency mice, Arabian severe combined immunodeficiency foals, Ku80 -/- mice) results in B and T lymphocyte development being blocked and similar phenotypes are observed.

The occurrence of severe combined immunodeficiency in Arabian foals was initially reported in 1973 by McGuire and Poppie. Recently, it was demonstrated that severe combined immunodeficiency in Arabian foals is explained by a severe block in the generation of specific immune receptors because of defective V(D)J rearrangement. As is the case in murine severe combined immunodeficiency, equine severe combined immunodeficiency cells are hypersensitive to DNA damage because of severely diminished levels of DNA-dependent protein kinase.sub.catalytic subunit. However, these two genetic defects have important mechanistic differences. Unlike severe combined immunodeficiency mice that are preferentially defective in coding resolution, severe combined immunodeficiency foals are defective in both coding and signal resolution.

The prior art is deficient in the lack of effective means of determining the presence of the genetic deteminant for equine severe combined immunodeficiency in an animal of interest. The present invention fulfills this longstanding need and desire in the art.

Previously, the mechanistic defect responsible for the autosomal recessive disease severe combined immunodeficiency (SCID) in Arabian foals was reported to involve a V(D)J recombination. As with the murine counterpart of SCID, cells from SCID foals have severely depressed levels of DNA dependent protein kinase activity because of a deficiency in the catalytic subunit of the enzyme (DNA-dependent protein kinase.sub.catalytic subunit). However, unlike SCID mice which are specifically impaired in their ability to resolve immune receptor coding joints, SCID foals are incapable of resolving both coding and signal ends.

The present invention presents the genotypic analysis of the defective DNA-dependent protein kinase.sub.catalytic subunit allele in Arabian horses and provides the sequence for the normal and mutant DNA-dependent protein kinase.sub.catalytic subunit gene and protein. These results formally establish the importance of the DNA-dependent protein kinase.sub.catalytic subunit in signal end resolution during V(D)J rearrangement.

In the equine severe combined immunodeficiency mutation, a frameshift deletion prematurely truncates the DNA-dependent protein kinase.sub.catalytic subunit at amino acid 3160 of the normal 4127 amino acid polypeptide. This truncation apparently results in a kinase negative version of the protein. In contrast, the DNA-dependent protein kinase.sub.catalytic subunit mutation responsible for severe combined immunodeficiency in C.B-17 mice may not completely ablate kinase activity. Thus, one explanation for the mechanistic differences in these two DNA-dependent protein kinase.sub.catalytic subunit defects models is that low levels of DNA-dependent kinase (likely present in severe combined immunodeficiency mice) can support signal end resolution, but normal levels are required to support coding resolution.

In one embodiment of the present invention, there is provided a composition of matter comprising an isolated DNA molecule encoding a DNA-dependent protein kinase.sub.catalytic subunit protein in Arabian horses having a sequence shown in SEQ ID No. 28.

In another embodiment of the present invention, there is provided a composition of matter comprising an oligonucleotide having a sequence selected from the group of SEQ ID Nos. 24 and 25. These oligonucleotides precisely span the SCID-determinant region of the DNA-PK.sub.CS gene, and are diagnostic for the normal and SCID alleles, respectively.

In yet another aspect of the present invention, there is provided an isolated DNA sequence having the sequence shown in SEQ ID No: 26 or SEQ ID No: 27.

In yet another aspect of the present invention, there is provided a method of identifying an Arabian horse that is a carrier of equine severe combined immunodeficiency, comprising the step of: determining whether said horse has a mutation in a SCID determinant region of a DNA-dependent protein kinase.sub.catalytic subunit gene. In one embodiment of this aspect of the present invention, there is provided a method of identifying an Arabian horse that is a carrier of equine severe combined immunodeficiency which further includes the step of screening a sample of DNA from said horse with an oligonucleotide having the sequence SEQ ID No. 25. In yet another embodiment of this aspect of the invention, there is provided an additional step wherein a second sample of DNA from said horse is screened with an oligonucleotide having the sequence SEQ ID No. 24. In addition, the determining step may include the step of amplifying said DNA-dependent protein kinase.sub.catalytic subunit gene.

A particular aspect of the present invention provides a method of determining whether an Arabian horse has a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, or both, comprising the steps of: obtaining samples from candidate horses; treating said samples obtained from candidate horses to expose nucleic acids; incubating said sample nucleic acids with a labeled oligonucleotide selected from the group of SEQ ID No. 24 and SEQ ID No. 25, under conditions and for a time sufficient for said oligonucleotides to hybridize to a complementary sequence in said sample nucleic acid, if present; eliminating any unhybridized oligonucleotides; and detecting the presence or absence of said hybridized oligonucleotides, wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 24 indicates the presence of a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 25 indicates a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, and wherein a presence of hybridized oligonucleotides having a sequence SEQ ID No. 24 and SEQ ID No. 25 indicates a presence of both a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene and a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene. An embodiment of this aspect of the present invention includes a DNA amplification step being performed on a SCID-determinant region in a DNA-dependent protein kinase.sub.catalytic subunit gene between said obtaining step and said treating step.

An additional aspect of the present invention includes an isolated protein encoding a normal DNA-dependent protein kinase.sub.catalytic subunit protein having a sequence SEQ ID No. 29 and an isolated protein encoding a mutant DNA-dependent protein kinase.sub.catalytic subunit protein having a sequence SEQ ID No. 30. The present invention also is drawn to an a plasmid containing a DNA encoding a DNA-dependent protein kinase.sub.catalytic subunit protein (SEQ ID No. 29) and regulatory elements necessary for expression of the DNA in the cell, said plasmid adapted for expression in a recombinant cell, and a plasmid containing the DNA of SEQ ID No. 28 and regulatory elements necessary for expression of said DNA in said cell, said plasmid adapted for expression in a recombinant cell.

A further aspect of the present invention provides a method of identifying an Arabian horse that is a carrier for equine severe combined immunodeficiency, comprising the step of: determining whether said horse has a gene that encodes a protein having a sequence SEQ ID No. 30, wherein a presence of said gene indicates a horse that is a carrier for equine severe combined immunodeficiency.

Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure .

So that the matter in which the above-recited features, advantages and objects of the invention are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.

FIG. 1 is a diagramatic representation of the DNA-dependent protein kinase.sub.catalytic subunit transcript. Arrows and numbers denote positions of oligonucleotide primers used to amplify the equine transcripts. Each box represents an overlapping cDNA fragment derived from the 0176 and 1821 cell lines. Cloning the fragment from nucleotide 4950 to 9539 from the 1821 cell line was unsuccessful. Thus, the sequence of the 0176 transcript was determined for this region, and then four separate fragments were cloned and sequenced (denoted by dotted lines) from the 1821 cell line.

FIGS. 2A-2L present the deduced amino acid sequence comparison of the equine DNA-dependent protein kinase.sub.catalytic subunit transcript (derived from the 0176 cell line) compared to the human counterpart. Comparison starts at amino acid 180 of the human sequence. FIG. 2A shows the amino acid sequence from 180 to 523, FIG. 2B continues the amino acid sequence from 524 to 873, FIG. 2C continues the amino acid sequence from 874 to 1223, FIG. 2D continues the amino acid sequence from 1224 TO 1573, FIG. 2E continues the amino acid sequence from 1574 to 1923, FIG. 2F continues the amino acid sequence from 1924 to 2272, FIG. 2G continues the amino acid sequence from 2273 to 2621, FIG. 2H continues the amino acid sequence from 2622 to 2966, FIG. 2I continues the amino acid sequence from 2967 to 3316, FIG. 2J continues the amino acid sequence from 3317 to 3666, FIG. 2K continues the amino acid sequence from 3667 to 4016, and FIG. 2L completes the amino acid sequence from 4017 to 4127. Potential DNA-PK autophosphorylation sites and Leucine zipper motifs have been underlined. The conserved protein kinase motifs are shown in bold.

FIG. 3 shows the results of RT-PCR analysis of the DNA-dependent protein kinase.sub.catalytic subunit mutation. RT-PCR was performed on cDNA derived from the 0176 (normal) and 1821 (SCID) cell lines using primer combination 396/392. Amplified products were electrophoresed on agarose gels and transferred to nylon membranes. One filter was hybridized with the N probe (left panel) and the other with the S probe (right panel).

FIG. 4A is a diagramatic depiction of the strategy used to determine the intron/exon organization of the region including the mutated DNA-dependent protein kinase.sub.catalytic subunit exon.

FIG. 4B shows genomic DNA from cell lines 0176 and 1821 amplified with oligonucleotides 392/405. Amplified fragments were cloned and sequenced with primer 392. Sequence analysis of the two clones reveals a five nucleotide deletion in the 1821 genomic fragment.

FIG. 4C shows the sequence comparison of the genomic fragments isolated from the 1821 and 0176 cell lines. These splice acceptor site is underlined. Positions of amplification primers are denoted with arrows.

FIG. 5 shows the genomic PCR analysis of DNA derived from SCID and phenotypically normal animals using primer combinations 392/405. Amplified products were electrophoresed on agarose gels and transferred to nylon membranes. One filter was hybridized with the N probe (top panel) and the other with the S probe (bottom panel). Phenotype and genotype (as determined by this analysis) is indicated. S denotes SCID; N denotes normal; H denotes heterozygote.

FIG. 6 is a the diagrammatic representation of DNA-dependent protein kinase.sub.catalytic subunit isoforms generated by P13K splice variation. Subregions of homology to other P13K family members are as noted by Poltoratsky et al. The murine SCID mutation results in an 80 amino acid truncation which leaves the P13K domain intact. The equine SCID mutation results in a 967 amino acid truncation which deletes the P13K domain.

The following abbreviations may be used herein: Abbreviations: DSBR, double strand break repair; DNA-PK, DNA dependent protein kinase; DNA-PK.sub.CS, catalytic subunit of DNA dependent protein kinase; V(D)J, Variable (Diversity) Joining; RAG, recombination activating gene.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual" (1982); "DNA Cloning: A Practical Approach," Volumes I and II (D. N. Glover ed. 1985); "Oligonucleotide Synthesis" (M. J. Gait ed. 1984); "Nucleic Acid Hybridization" (B. D. Hames & S. J. Higgins eds. (1985)); "Transcription and Translation" (B. D. Hames & S. J. Higgins eds. (1984)); "Animal Cell Culture" (R. I. Freshney, ed. (1986)); "Immobilized Cells And Enzymes" (IRL Press, (1986)); B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

Therefore, if appearing herein, the following terms shall have the definitions set out below.

The amino acids described herein are preferred to be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue as long as the desired functional property of immunoglobulin-binding is retained by the polypeptide. NH.sub.2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomeclature, J Biol. Chem., 243:3552-59 (1969), abbreviations for amino acid residues are shown in the following Table of Correspondence:

It should be noted that all amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino-terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues. The above Table is presented to correlate the three-letter and one-letter notations which may appear alternately herein.

A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an automous unit of DNA replication in vivo; i.e., capable of replication under its own control.

A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.

A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).

An "origin of replication" refers to those DNA sequences that participate in DNA synthesis.

A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.

An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.

A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.

The term "oligonucleotide", as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide. The present invention is drawn to screening oligonucleotides having the sequence SEQ ID 24 or 25, or a portion of these oligonucleotides, which span the SCID-determinant portion of the DNA-dependent protein kinase.sub.catalytic subunit gene.

The term "primer" as used herein refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. In the present invention, primers used for amplification of the SCID-determinant region of DNA-dependent protein kinase.sub.catalytic subunit have the sequence of SEQ ID Nos. 22 and 23.

The primers herein are selected to be "substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence or hybridize therewith and thereby form the template for the synthesis of the extension product.

As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.

A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or a common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art.

See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.

A "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. In another example, coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to untraviolet light, and others. A number of fluorescent materials are known and can be utilized as labels. These include, for example, florescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.

Proteins can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from .sup.3 H, .sup.14 C, .sup.32 P, .sup.35 S, .sup.36 Cl, .sup.51 Cr, .sup.57 Co, .sup.58 Co, .sup.59 Fe, .sup.90 Y, .sup.125 I, .sup.131 I, and .sup.186 Re.

Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. The enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, .beta.-glucuronidase, .beta.-D-glucosidase, .beta.-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. Pat. Nos. 3,654,090, 3,850,752, and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.

As used herein, the term "normal allele" refers to the gene that codes for the wildtype DNA-PK.sub.CS, and does not cause SCID. Specifically, the normal allele does not have the 5 base pair deletion present corresponding to nucleotide 9,454 of the 12,381 nucleotide coding sequence of the human transcript, and has the sequence AGGTAATTTATCATCTCA (SEQ. ID No. 24) at the SCID-determinant region.

As used herein, the term "SCID allele" refers to the gene that codes for the mutant DNA-dependent protein kinase.sub.catalytic subunit protein, and causes equine SCID. Specifically, the SCID allele has the 5 base pair deletion present corresponding to nucleotide 9,454 of the 12,381 nucleotide coding sequence of the human transcript, and has the sequence AGGTAATTTATCAAATTC (SEQ. ID No. 25) at the SCID-determinant region of the DNA-dependent protein kinase.sub.catalytic subunit gene. The 5 base pair deletion results in premature termination of the DNA-dependent protein kinase.sub.catalytic subunit protein at amino acid 3160 of the 4127 amino acid polypeptide.

As used herein, the term "SCID determinant region" of the DNA-dependent protein kinase.sub.catalytic subunit gene refers to region of the DNA-dependent protein kinase.sub.catalytic subunit gene having the 5 base pair deletion in SCID-carrier animals which corresponds to nucleotide 9,454 of the 12,381 nucleotide coding sequence of the human transcript. The SCID determinant region in normal individuals has the sequence AGGTAATTTATCATCTCA (SEQ. ID No. 24) in normal alleles and the sequence AGGTAATTTATCAAATTC (SEQ. ID No. 25) in SCID alleles. The difference in the sequences between the normal and SCID alleles in the SCID-determinant region results in premature termination of the DNA-dependent protein kinase.sub.catalytic subunit protein at amino acid 3160 of the 4127 amino acid polypeptide in the SCID-causing DNA-dependent protein kinase.sub.catalytic subunit protein.

As used herein, the term "carrier" refers to an animal heterozygous for a recessive genetic trait. Carriers are unaffected but have the potential to pass the trait on to their offspring.

The present invention describes the DNA-dependent protein kinase.sub.catalytic subunit gene in both normal and severe combined immunodeficiency horses. In SCID horses, a 5 base pair deletion is present corresponding to nucleotide 9,454 of the 12,381 nucleotide coding sequence of the human transcript. This 5 base pair deletion results in premature termination of the DNA-dependent protein kinase.sub.catalytic subunit protein at amino acid 3160 of the 4127 amino acid polypeptide. Unlike the murine DNA-dependent protein kinase.sub.catalytic subunit mutation (which deletes the C terminal 80 amino acids of the protein), the equine DNA-dependent protein kinase.sub.catalytic subunit mutation most likely ablates DNA-dependent protein kinase activity completely. Thus, equine DNA-dependent protein kinase.sub.catalytic subunit plays a role in both signal end resolution and coding end resolution. Asymmetry of signal versus coding ligation in severe combined immunodeficiency mice (lacking in severe combined immunodeficiency foals) may be explained by minimal DNA dependent protein kinase activity in severe combined immunodeficiency mice.

The following diagnostic strategy for differentiating SCID heterozygotes, homozygotes, and normal horses may be used by a person having ordinary skill in this art given the teachings of the present invention. Using the sequence information obtained of the DNA-PKcs transcripts from normal and SCID foals, a simple diagnostic test for determining genotype of a given animal is straightforward to one skilled in the art of molecular biology. Since the present invention has identified precisely the same mutation in eight SCID animals and in two carriers, it is likely that this mutation is responsible for the majority of SCID cases in Arabian horses. This mutation is likely the result of a breeding bottleneck and a genetic founder effect.

A desirable diagnostic test would take advantage of the genomic sequence surrounding the mutation. Such a test may use a strategy of amplifying the region of interest from DNA derived from the animal to be tested. Probes spanning the unmutated sequence or mutated sequence will, under the appropriate conditions, hybridize specifically. Thus, DNA from a normal animal which is not a carrier would hybridize with the probe based on the unmutated sequence, but would not hybridize with the probe based on the mutated sequence. DNA from a heterozygous, carrier animal will hybridize with both probes. DNA from a SCID animal will only hybridize with the probe based on the mutated sequence.

In one method of the present invention, there is provided a method of identifying an Arabian horse that is a carrier of equine severe combined immunodeficiency, comprising the step of: determining whether said horse has a mutation in a SCID determinant region of a DNA-dependent protein kinase.sub.catalytic subunit gene. In a prefered embodiment of this method, there is provided a method of determining whether an Arabian horse has a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, or both, comprising the steps of: obtaining samples from candidate horses; treating said samples obtained from candidate horses to expose nucleic acids; incubating said sample nucleic acids with a labeled oligonucleotide selected from the group of SEQ ID No. 24 and SEQ ID No. 25, under conditions and for a time sufficient for said oligonucleotides to hybridize to a complementary sequence in said sample nucleic acid, if present; eliminating any unhybridized oligonucleotides; and detecting the presence or absence of said hybridized oligonucleotides, wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 24 indicates the presence of a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 25 indicates a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, and wherein a presence of hybridized oligonucleotides having a sequence SEQ ID No. 24 and SEQ ID No. 25 indicates a presence of both a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene and a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene. An embodiment of this aspect of the present invention includes a DNA amplification step being performed on a SCID-determinant region in a DNA-dependent protein kinase.sub.catalytic subunit gene between said obtaining step and said treating step.

In another method of the present invention, there is provided a method of determining whether an Arabian horse has a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, or both, comprising the steps of: obtaining samples from candidate horses; treating said samples obtained from candidate horses to expose nucleic acids; incubating said sample nucleic acids with a labeled oligonucleotide selected from the group of SEQ ID No. 26 and SEQ ID No. 27, or portions thereof, under conditions and for a time sufficient for said oligonucleotides to hybridize to a complementary sequence in said sample nucleic acid, if present; eliminating any unhybridized oligonucleotides; and detecting a presence or absence of said hybridized oligonucleotides; wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 27 indicates a presence of a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, wherein a presence of hybridized oligonucleotide having a sequence SEQ ID No. 26 indicates a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene, and wherein a presence of hybridized oligonucleotides having a sequence SEQ ID No. 26 and SEQ ID No. 27 indicates a presence of both a normal allele for a DNA-dependent protein kinase.sub.catalytic subunit gene and a presence of a SCID allele for a DNA-dependent protein kinase.sub.catalytic subunit gene.

In addition, several alternative amplification strategies are envisioned. Since equine SCID is the result of a 5 nucleotide deletion, primers can be designed easily which selectively amplify the mutated or the normal allele. Further, it is well within the expertise of the skilled artisan that primers can be designed such that products amplified from the mutated and normal alleles have unique sizes or unique restriction endonuclease sites to allow for rapid diagnosis. The main point being that no matter what molecular technique is used, all strategies involve detecting the portion of the DNA-dependent protein kinase.sub.catalytic subunit gene in which the 5-nucleotide deletion occurs in the mutated DNA-dependent protein kinase.sub.catalytic subunit gene. The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.

Cell Lines

The 0176 fibroblast cell line was derived from a normal (non-Arabian) horse. The 1821 fibroblast cell line was derived from a homozygous severe combined immunodeficiency foal. All cultures were carried out in DMEM medium (GIBCO Laboratories, Grand Island, N.Y.) supplemented with 10% FCS.

RT-PCR

RT-PCR was performed on RNA isolated from the 0176 and 1821 cell lines. RNA was isolated using RNAzol (Biotecx; Houston, Tex.). After ethanol precipitation, cDNA was prepared using Superscript (reverse transcriptase); PCR was performed using Elongase (Taq polymerase) according to the manufacturers recommendations (Gibco BRL, Gaithersburg, Md.). Transcripts amplified in this manner were subcloned and sequenced using standard techniques.

Oligonucleoties

Position of amplification primers is illustrated in FIG. 1. Sequences of oligonucleotides used were as follows:

262: GTATATGAGCTCCTAGG (SEQ. ID No. 1);

265: GGGAGAATCTCTCTGCAA (SEQ. ID No. 2); TCAGGAGTTC ATCAGCTT (SEQ ID No. 3)

266: GATCCAGCGGCTAACTTG (SEQ. ID No. 4);

285: CATGTGCTAAGGCCAGAC (SEQ. ID No. 5);

286: TCTACAGGGAATTCAGGG (SEQ. ID No. 6);

293: CACCATGAATCACACTTC (SEQ. ID No. 7);

296: CACCAAGGACTGAAACTT (SEQ. ID No. 8);

330: GCACTTTCATTCTGTCAC (SEQ. ID No. 9);

317: ATTCATGACCTCGAAGAG (SEQ. ID No. 10);

318: TGGACAAACAGATATCCAG (SEQ. ID No. 11);

259: ATCGCCGGGTTTGATGAGCGGGTG (SEQ. ID No. 12);

255: CAGACCTCACATCCAGGGCTCCCA (SEQ. ID No. 13);

348: GAGACGGATATTTAATG (SEQ. ID No. 14);

414: GGAGTGCAGAGCTATTCAT (SEQ. ID No. 15);

415: GCAATCGATTTGCTAACAC (SEQ. ID No. 16);

350: GTCCCTAAAGATGAAGTG (SEQ. ID No. 17);

382: GTCATGAATCCACATGAG (SEQ. ID No. 18);

357: TTCTTCCTGCTGCCAAAA (SEQ. ID No. 19);

358: CTTTGTTCCTATCTCACT (SEQ. ID No. 20);

383: AGACTTGCTGAGCCTCGA (SEQ. ID No. 21);

405: TTCCTGTTGCAAAAGGAG (SEQ. ID No. 22);

392: TTTGTGATGATGTCATCC (SEQ. ID No. 23);

N: AGGTAATTTATCATCTCA (SEQ. ID No. 24);

S: AGGTAATTTATCAAATTC (SEQ. ID No. 25).

Genomic PCR

Total genomic DNA was analyzed from spleen, bone marrow, peripheral blood or fibroblast cell lines as indicated. DNA was isolated using ABI DNA lysis buffer (Applied Biosystems, Foster City, Calif.). Oligonucletide primers 405 and 392 (SEQ ID Nos. 22 and 23) were used to screen for the mutant severe combined immunodeficiency allele. Amplification conditions were 94.degree. C. for 30 seconds, 55.degree. C. for 90 seconds, and 68.degree. C. for five minutes. Amplified DNA was loaded onto 1.5% duplicate agarose gels for Southern filter hybridization analysis. After electrophoresis, DNA was transferred in 0.4 N NaOH onto nylon membranes (Zeta-probe, Biorad, Hercules, Calif.). Southern filter hybridization was done in 6.times. SSC, 0.5% SDS, and 5.times. Denhardts at 42.degree. C. .sup.32 P-end labeled oligonucleotides specific for the normal and severe combined immunodeficiency alleles were used as hybridization probes. Filters were washed in 6.times. SSC and 0.5% SDS at 65.degree. C.

Results

An RT-PCR strategy (depicted in FIG. 1) was used to clone and sequence the normal and severe combined immunodeficiency equine DNA-dependent protein kinase.sub.catalytic subunit transcripts. Amplification primers were based upon the published human DNA-dependent protein kinase.sub.catalytic subunit sequence. cDNA was derived from two fibroblast cell lines, 0176 (derived from a normal, non-Arabian animal) and 1821 (derived from a severe combined immunodeficiency foal). Previously, it was demonstrated that 1) the 1821 cell line was hypersensitive to ionizing radiation, 2) had no detectable DNA-dependent protein kinase activity, 3) lacks DNA-dependent protein kinase.sub.catalytic subunit protein, and 4) could not support RAG-induced recombination as assayed by signal joint formation.

Six overlapping cDNA fragments were isolated from the 0176 cell line; ten overlapping cDNA fragments were isolated from the 1821 cell line. Using this strategy, 11,811 nucleotides of the 12,381 DNA-dependent protein kinase.sub.catalytic subunit transcript were sequenced. Isolation of the first 570 bp of the two equine transcripts was unsuccessful using this strategy. This may indicate less evolutionary conservation of this region between the human and equine DNA-dependent protein kinase.sub.catalytic subunit genes.

The deduced amino acid sequence of equine DNA-dependent protein kinase.sub.catalytic subunit is compared to the human counterpart in FIG. 2. Overall, the two proteins are 84% homologous. There are several small insertions within the equine transcript adding an additional 6 codons. Though the P13K domain is well conserved between the human and equine sequences (87%), homology within this region was not dramatically higher than throughout the rest of the protein. The region within the P13K domain corresponding to the putative kinase active site was slightly more conserved. This corresponds to subdomain II as noted by Poltoratsky et al. which includes the conserved protein kinase motifs; homology within this subdomain between human and equine DNA-dependent protein kinase.sub.catalytic subunit is 92%. The leucine residues comprising a potential leucine zipper motif noted by Hartley et al. were completely conserved in the equine protein. Similarly, 17 of 18 potential DNA-dependent protein kinase autophosphorylation sites noted by Hartley et al. were also conserved.

In the RT-PCR fragment spanning nucleotide .about.8000 to .about.9650 from the 1821 severe combined immunodeficiency cell line, a 5 nucleotide deletion was found. To rule out the possibility that this deletion was the result of a Taq polymerase error, this region was amplified again from both the 0176 and 1821 cell lines (FIG. 3). Two oligonucleotides spanning this region representing the normal (N probe) and severe combined immunodeficiency (S probe) sequences were synthesized. As can be seen, the product amplified from the normal cell line, 0176, hybridizes well with probe N but not at all with probe S. In contrast, the product amplified from the severe combined immunodeficiency cell line, 1821, hybridizes exclusively with the S probe.

Next, germline sequences encoding this region were isolated by amplifying spleen DNA derived from a severe combined immunodeficiency foal with oligonucleotides spanning the deletion. A 1.8 kB fragment including portions of two exons and a 1.5 kB intron was cloned (depicted in FIG. 4). The intron exon border of the exon containing the 5 bp deletion was determined. Genomic fragments spanning this region from the 0176 and 1821 cell lines were cloned; sequence analysis of the normal allele and severe combined immunodeficiency allele is shown in FIG. 4C, confirming this 5 bp deletion in DNA derived from the 1821 cell line.

Next, it was determined whether this 5 bp deletion accounts for severe combined immunodeficiency in many Arabian foals, or just a subset of affected animals. To that end, genomic DNA was derived from eight different severe combined immunodeficiency foals and five normal animals (four Arabian and one non-Arabian). For the severe combined immunodeficiency animals, the diagnosis of severe combined immunodeficiency was established on the basis of lymphopenia (<1,000 lymphocytes/.mu.l peripheral blood), absence of IgM, and hypoplasia of lymphoid tissues as described previously. The eight severe combined immunodeficiency foals were derived from eight different mares and sired by three different stallions. The adult heterozygotes were obtained from across the USA and were not related to one another.

As can be seen in FIG. 5, in all severe combined immunodeficiency foals tested the probe specific for the 5 bp deletion hybridizes strongly; the probe specific for the normal allele does not hybridize at all. Furthermore, in all samples derived from normal animals, the hybridization probe derived from the normal allele hybridizes strongly. In two normal animals, both the N probe and the S probes hybridize well identifying these two animals as heterozygotes. From these data, it can be concluded that this specific 5 bp mutation is responsible for a significant fraction of the cases of severe combined immunodeficiency in Arabian horses.

Severe combined immunodeficiency in Arabian foals was first described by McGuire and Poppie in 1973 and the mechanistic defect in these animals is V(D)J recombination and double strand break repair has now been demonstrated. The present invention establishes that the factor responsible for this genetic disease is a truncated form of the catalytic subunit of the DNA dependent protein kinase. Unlike the situation in the human disease ataxia telangiectasia, where mutations in the ATM gene (another P13K family member) occur throughout the protein, in all severe combined immunodeficiency foals examined to date, the same mutation exists. Thus, since eight unrelated severe combined immunodeficiency foals have the identical DNA-dependent protein kinase.sub.catalytic subunit mutation it is likely that this DNA-dependent protein kinase.sub.catalytic subunit allele has common origins and because of a bottleneck in breeding results in a genetic "founder" effect.

Since there are several clear mechanistic differences between mice and horses, the finding that DNA-dependent protein kinase.sub.catalytic subunit levels were severely diminished in both was initially paradoxical. The differences between severe combined immunodeficiency mice and severe combined immunodeficiency foals are actually twofold. First, in severe combined immunodeficiency foals, both signal and coding joint ligation is impaired; whereas signal ligation is relatively normal in severe combined immunodeficiency mice. In addition, by limiting dilution PCR analysis, it was determined that coding ligation is more severely impaired in severe combined immunodeficiency foals than in severe combined immunodeficiency mice. Whereas it is very easy to detect some coding ligation in severe combined immunodeficiency mice ("leaky" severe combined immunodeficiency phenotype), demonstration of any coding joint formation in severe combined immunodeficiency foals is exceedingly difficult. Thus, it was thought originally that the defective factors in these two animal models of severe combined immunodeficiency might be distinct. The definition of the specific DNA-dependent protein kinase.sub.catalytic subunit mutation in equine severe combined immunodeficiency coupled with the description of the precise mutation responsible for murine severe combined immunodeficiency provide a good explanation for the mechanistic differences observed between severe combined immunodeficiency mice and severe combined immunodeficiency horses.

FIG. 6 depicts the result of the equine DNA-dependent protein kinase.sub.catalytic subunit mutation and the murine severe combined immunodeficiency mutation described earlier this year by Blunt et al. and Danska et al. The difference in the two mutated forms of DNA-dependent protein kinase.sub.catalytic subunit is dramatic. In the murine mutation, the conserved regions shared between DNA-dependent protein kinase.sub.catalytic subunit and other P13 kinase family members are intact. This region is absent in the mutated equine protein. Thus, in cells from severe combined immunodeficiency foals, there can clearly be no DNA-dependent kinase activity; however, since the mutation in severe combined immunodeficiency mice preserves most of the P13K homology domain, some kinase activity may be present.

The description of defective signal ligation in severe combined immunodeficiency foals is not the only evidence linking DNA-dependent protein kinase.sub.catalytic subunit to signal ligation. The double strand break repair mutant cell line V3 also has diminished (though not absent) signal end resolution. As in murine severe combined immunodeficiency cells, in V3 cells some protein immunoreactive with anti-DNA-dependent protein kinase.sub.catalytic subunit antibodies can be detected. Thus, an attractive hypothesis is that preferentially-defective coding versus signal resolution may result from diminished levels of DNA-dependent protein kinase kinase activity; whereas absence of DNA-dependent protein kinase activity impairs both signal and coding ligation. In support of that conclusion, Errami et al. recently demonstrated that cells which are completely defective in the regulatory subunit of DNA-dependent protein kinase, Ku (specifically in the 86 kD subunit of Ku), which were transfected with low levels of Ku80 are like mouse severe combined immunodeficiency cells, preferentially defective in coding joint ligation. Thus, this hypothesis can be extended in that preferentially defective coding versus signal resolution may result from diminished levels of any component of DNA-dependent protein kinase; whereas absence of any component of DNA-dependent protein kinase impairs both signal and coding ligation.

Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.