US 5,948,664 AGrant
PI 3-Kinase Polypeptides
Issue Date:1999-09-07
•16 Claims
•23 Drawing Sheets
Abstract
The present invention generally provides polypeptides that are related to and/or derived from the family of PI3-kinases. These polypeptides are generally involved in cell signaling cascades which control, e.g., cell cycle progression and intracellular protein sorting. The family of PI3-kinases from which the polypeptides of the invention are derived are generally characterized by their structure as well as their unique substrate specificity.
Metadata
Assignee
- The Regents of the University of California
Inventors
- Lewis T. Williams
- Lisa Molz
- Yen-Wen Chen
Application Information
Application Number:US 6090494
Filing Date:1996-02-12
Priority Date:1996-02-12
Art Unit:162
Classifications
IPC:
C12N 912
Field of Search:
42443553694.515;69.1;69.2;194;325;252.3;320.123.2
Patent Drawings (23 sheets)
Description
Background of the Invention
Phosphatidyl Inositol kinases ("PtdIns-kinases") regulate diverse cellular processes including cell signaling, cell cycle progression, and intracellular protein sorting. See, e.g., Herman et al., Nature 358:157-159 (1992), Kapellar et al., Bioessays 16:565-576 (1994), Stephens et al., Nature 351:33-39 (1991) and Kunz et al., Cell 73:585-596 (1993). PtdIns-kinases phosphorylate phosphoinositol lipids at distinct positions on the inositol ring. For example, PtdIns 3-kinases, or "PI 3-kinases", phosphorylate the D3 hydroxyl group on the inositol ring, while PtdIns 4-kinases phosphorylate the D4 hydroxyl group. All of the PtdIns kinases that have been identified to date have been found to contain a core region of sequence similarity, which, without being bound to any particular theory, is believed to be the catalytic domain. This domain, termed the "PtdIns kinase domain", shares limited sequence similarity with the catalytic domain of protein kinases and mutation of conserved residues results in loss of PtdIns kinase activity. See, Carter et al., J. Biochem. 301:415-420 (1994), Dhand et al., EMBO J. 13:522-533 (1994) and Schu et al., Science 260:88-91 (1993).
A number of receptor tyrosine kinases, src-like tyrosine kinases and viral oncoproteins bind and activate one particular cellular PtdIns 3-kinase. Studies of mutants that abrogate the binding of this PtdIns 3-kinase to these molecules indicate that PtdIns 3-kinases mediate mitogenic and cell motility responses of cells to growth factors and oncoproteins. Purification of the polypeptide subunits of this PtdIns 3-kinase reveal that the enzyme exists as a heterodimeric complex composed of a 110 KDa and an 85 KDa subunit. Carpenter et al., J. Biol. Chem. 265:19704-19711 (1990), Fry et al., Biochem. J. 288:383-393 (1992), Morgan et al., Eur. J. Biochem. 191:761-767 (1990), Shibasaki et al., J. Biol. Chem. 266:8108-8114 (1991). The 110 KDa subunit contains a C-terminal PtdIns kinase domain, as well as a small domain at its N-terminus that is sufficient for binding to the 85-Kd subunit (Hiles et al., Cell 70:419-429 (1992), Holt et al., Mol. Cell. Biol. 14:42-49 (1994), Klippel et al., Mol. Cell. Biol. 14:2675-2685 (1994). The 85 KDa subunit serves as an adapter and binds activated growth factor receptors and other tyrosine phosphorylated molecules through two Src homology 2 (SH2) domains. Hu et al., Mol. Cell. Biol. 12:981-990 (1992), McGlade et al., Mol. Cell. Biol. 12:991-997(1992) Reedijk et al., EMBO J. 11:1365-1372 (1992), Yoakim, J. Virol. 66:5485-5491 (1992), Yonezawa et al., J. Biol. Chem. 267:25958-25966 (1992). The association of the enzyme with activated growth factor receptors is believed to localize it to the plasma membrane where its phospholipid substrates reside.
The p110/p85 complex phosphorylates distinct lipids in vitro and in vivo. In vitro, the p110/p85 complex can phosphorylate phosphatidylinositol (PtdIns), phosphatidylinositol 4-phosphate (PtdIns4P) and phophatidylinositol 4,5-bisphosphate (PtdIns(4,5)P.sub.2) on the D3 hydroxyl group of the inositol ring, producing phosphatidylinositol 3-phosphate (PtdIns3P), phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P.sub.2) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P.sub.3). Kapellar et al., Bioessays 16:565-576 (1994), Stephens et al., Biochim. Biophys. Acta 1179:27-75 (1993). Activation of the p110/p85 complex in cells results in elevated levels of PtdIns(3,4)P.sub.2 and PtdIns(3,4,5)P.sub.3, but not PtdIns3P. Auger et al., Cell 57:167-175 (1989), Stephens et al., Nature 351:33-39 (1991), Traynor-Kaplan et al., Nature 334:353-356 (1988), Traynor-Kaplan J. Biol. Chem. 264:15668-15673 (1989). Studies of the pathways in cells that generate these lipids suggest that PtdIns(3,4)P.sub.2 is formed by the dephosphorylation of PtdIns(3,4,5)P.sub.3 by a PtdIns 5-phosphatase rather than the phosphorylation of PtdIns4P by a PtdIns 3-kinase. Carter et al., Biochem. J. 301:415-420 (1994), Hawkins et al., Nature 358:157-159 (1992).
The stimulation of cells with growth factors or tumor antigens results in a rapid increase in the cellular concentration of PtdIns(3,4)P.sub.2 and PtdIns(3,4,5)P.sub.3 from a low basal level, indicating that these molecules represent novel second messengers in growth factor activated signaling cascades.
Additionally, several protein kinases have recently been described which appear to represent downstream effectors of the lipid products of PtdIns 3-kinases. The Akt protein kinase can be activated in vivo by treating cells with the mitogen PDGF. The binding of PtdIns 3-kinase to the PDGF receptor is essential for Akt activation (Franke et al., Cell 81:727-736 (1995)). Akt can be directly activated in vitro with PtdIns3P. In addition to Akt, particular isoforms of protein kinase C can be activated by the lipid products of PtdIns 3-kinases. Protein kinase C isoforms .delta., .epsilon., .eta., and .zeta. can be activated in vitro with PtdIns(3,4)P.sub.2 or PtdIns(3,4,5)P.sub.3, but not with PtdIns3P. Nakanishi et al., J. Biol. Chem. 268:13-16 (1993), Toker et al., J. Biol. Chem 269:32358-32367 (1994).
PtdIns 3-kinases have also been implicated in the regulation of intracellular protein sorting. For example, the Vps34 PtdIns 3-kinase was initially identified from a Saccharomyces cerevisiae mutant that was defective in the trafficking of proteins to the lysosome-like vacuole. Herman et al., Mol. Cell. Biol. 10:6742-6754 (1990). Vps34 can phosphorylate PtdIns, but not PtdIns4P or PtdIns(4,5)P.sub.2 in vitro, which is consistent with absence of detectable PtdIns(3,4,5)P.sub.3 in yeast. Schu et al., Science 260:88-91 (1993). Vps34 is the major PtdIns 3-kinase in yeast. VPS34 mutant strains contain no detectable PtdIns3P.
Because disregulation of the cellular processes, such as signaling processes involved in cell cycle progression and intracellular protein sorting, can have disastrous effects, it is important to understand and gain control over these processes. This requires identifying the participants in the signaling events involved in these processes and elucidating their mechanism of function. The identification of these participants is important for a wide range of diagnostic, therapeutic and screening applications. In particular, by knowing the structure and function of a particular participant in a signaling cascade, one can design compounds which affect that cascade, to either activate an otherwise inactive pathway, or inactivate an overly active pathway. Similarly, having identified a particular participant in a signaling cascade, one can also identify situations where that cascade is defective, resulting in a particular pathological state.
PI3-kinases have been identified as playing critical roles in several distinct cellular signaling processes. As a result, it is of particular interest to identify these kinases, their substrates, products and effectors. Once identified, these various elements can be used for a variety of therapeutic, diagnostic and screening applications. For example, these components may be used as therapeutic agents for treating disorders resulting from anomalies in signaling cascades. Alternatively, these components may be used alone or in combination, as model systems for screening compounds that affect signaling cascades. Finally, identification of these components leads to an understanding of the cell signaling processes, anomalies in these processes which are responsible for certain disorders, and by implication, diagnostic systems for identifying these disorders. The present invention meets these and many other needs.
Summary of the Invention
The present invention generally provides novel PI3-kinase polypeptides, nucleic acids encoding these polypeptides, antibodies that are specifically immunoreactive with these polypeptides and methods of using these polypeptides in screening and therapeutic applications.
In one aspect, the present invention provides substantially pure PI3-kinase polypeptides or biologically active fragments thereof. These polypeptides are generally characterized by their ability to phosphorylate the D3 hydroxyl of an inositol ring in PtdIns and PtdIns4P but not PtdIns(4,5)P.sub.2. The polypeptides may further include a C2 domain within their structure. In a more specific aspect, the polypeptides of the invention have an amino acid sequence that is substantially homologous to the sequence of cpk and cpk-m, as shown in FIG. 1, (SEQ ID NOS:12-13) or biologically active fragments thereof.
The polypeptides may, in some aspects, be characterized by their ability to block the interaction between a cpk or cpk-m polypeptide and an antibody that is specifically immunoreactive with cpk or cpk-m. Similarly, the polypeptides may be characterized by their ability to block the interaction between a cpk and/or cpk-m polypeptide and its substrate, such as PtdIns or PtdIns4P.
In another aspect, the present invention provides nucleic acids that encode the polypeptides of the invention. In particular, the nucleic acids of the present invention will typically encode polypeptides which possess the above-described substrate specificity, or biologically active fragments. In a more specific aspect, the nucleic acids of the present invention will have a nucleic acid sequence that is substantially homologous to the nucleic acid sequence for cpk or cpk-m, as shown in FIG. 9 (SEQ ID NOS:27-28). In a related aspect, the present invention provides nucleic acid probes that have at least 15 contiguous nucleotides from the cpk or cpk-m nucleic acid sequences. The present invention also provides expression vectors containing the nucleic acids of the invention, and recombinant host cells that are capable of expressing these nucleic acids.
In a further aspect, the present invention provides methods of using the polypeptides of the present invention. In particular, the present invention provides a method of screening test compounds to identify agonists or antagonists of PI3-kinases and the signalling pathways they control. The methods comprise incubating a mixture of PtdIns or PtdIns4P and a polypeptide selected from the group consisting of cpk, cpk-m or biologically active fragments thereof, in the presence and absence of the test compound. The mixture is assayed to determine the amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the presence and absence of the test compound. The amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the presence of the test compound is compared to the amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the absence of the test compound. An increase or decrease in the amount of PtdIns3P or PtdIns(3,4)P.sub.2 in the presence of the test compound is indicative that the test compound is an agonist or antagonist of a PI3-kinase activity, respectively.
The present invention also provides therapeutic methods for treating a symptom of a disorder caused by the dysregulation of a growth factor activation signaling cascade. These methods generally comprise administering to a patient suffering from the disorder, a therapeutically effective amount of a polypeptide or blocking antibody of the present invention.
Brief Description of the Drawings
FIGS. 1A and 1B, show a comparison of the amino acid sequences of the Drosophila and murine cpk proteins (SEQ ID NOS:12-13). Both conserved and identical residues are shaded. The following groups of amino acids were considered to be conserved: A, V, L, I, M; D, E; K, R; N, Q; F, Y; S, T. The amino acid numbers are indicated to the right of the sequence.
FIGS. 2A, 2B, and 2C show the domain structure of the cpk proteins. FIG. 2A shows a schematic ribbon diagram comparing the domain structures of cpk with p110, Tor2, Pik1 and Vps34 PtdIns kinases. The PtdIns kinase domains are depicted in black, a region in which cpk and p110 are related is depicted with stripes, and the C2 domain and p85 binding domains are indicated. FIG. 2B shows a comparison of the amino acid sequence of the C2 domains in Drosophila and murine cpk (SEQ ID NO:14-18) with the C2 domains in rabphilin ("rab") (SEQ ID NO:16), synaptotagmin II ("syt II")(SEQ ID NO:17), and protein kinase C ("pkc") (SEQ ID NO:18). Both conserved and identical residues are shaded. FIG. 2C shows a comparison of the amino acid sequences of a part of the catalytic domains of cpk (SEQ ID NOS:19) and cpk-m (SEQ ID NO:20) with the catalytic domains of p110.alpha. (SEQ ID NO:12), p110.beta., (SEQ ID NO:22) p110.gamma. (SEQ ID NO:23), Vps34 (SEQ ID NO:24), Pik1 (SEQ ID NO:25) and Tor2 (SEQ ID NO:26). Only identical amino acids are indicated, i.e., shaded/boxed. The amino acid numbers are indicated to the right of the sequence.
FIGS. 3A and 3B illustrate the detection of cpk protein in lysates prepared from Drosophila embryos. FIG. 3A is an immunoblot of lysates (30 .mu.g) prepared from 0-12 hr Drosophila embryos probed with .alpha.-cpk polyclonal serum. FIG. 3B illustrates the precipitation of cpk protein from embryo lysates. Lysates were precipitated with .alpha.-cpk preimmune (lane 1), .alpha.-cpk immune (lane 2), .alpha.-P6 preimmune (lane 3), and .alpha.-P6 immune sera (lane 4). Preimmune and immune sera are indicated by P and I, respectively.
FIG. 4 shows an immunoblot of cpk protein immunoprecipitated from Drosophila lysates and probed with .alpha.-phosphotyrosine. Drosophila lysates were precipitated using .alpha.-cpk preimmune (lane 1), .alpha.-cpk immune (lane 2), .alpha.-P6 preimmune (lane 3) or .alpha.-P6 immune sera (lane 4).
FIGS. 5A and 5B show the precipitation of proteins from Drosophila lysates using .alpha.-cpk serum and .alpha.-P6 serum. FIG. 5A is an immunoblot of lysates prepared from 0-12 hr Drosophila embryos precipitated with .alpha.-cpk preimmune serum (lane 1), .alpha.-cpk immune serum (lane 2), .alpha.-P6 preimmune serum (lane 4), or .alpha.-p6 immune serum (lane 5). Precipitates were divided in half and half was assayed for PI 3-kinase activity by thin layer chromatography (left panel). Lysates were also precipitated with .alpha.-cpk serum which had been preincubated with cpk protein (lane 3) or .alpha.-P6 serum which had been preincubated with the P6 peptide (lane 6). FIG. 5B is a blot and TLC (left) showing wild-type (lane 1) and kinase deficient (lane 2) cpk proteins which had been tagged with an HA epitope were expressed in COS-7 cells. P and I indicate preimmune and immune sera, respectively. I.sup.c represents either .alpha.-cpk or .alpha.-P6 sera which had been preincubated for 10 min. with 0.5 .mu.g of competitor (cpk and P6, respectively).
FIGS. 6A and 6B show the results of thin layer chromatography of the products of cpk protein activity on PtdIns substrate. The cpk was precipitated from Drosophila (FIG. 6A) and COS-7 cells (FIG. 6B) using .alpha.-cpk or .alpha.-HA serum, respectively. The cpk reaction products (lane 3) migrated at approximately the same position as a .gamma..sup.32 P!-PtdIns3P standard (lane 2), but not a .gamma..sup.32 P!-PtdIns4P standard (lane 1). Cpk reaction products were also mixed with either .gamma..sup.32 P!-PtdIns3P (lane 5) or .gamma..sup.32 P!-PtdIns4P (lane 4) standards and the mixtures were separated. The cpk reaction products comigrated with .gamma..sup.32 P!-PtdIns3P (lane 5). The cpk reaction products are designated by cpk-p.
FIG. 7 is a thin layer chromatograph showing phosphorylation of either PtdIns (lane 2), PtdIns4P (lane 4) or PtdIns(4,5)P.sub.2 (lane 6) using cpk protein precipitated from Drosophila embryo lysates. A consitutively active p110 protein (p110*) capable of phosphorylating PtdIns (lane 1), PtdIns4P (lane 3) and PtdIns(4,5)P.sub.2 (lane 5) substrates was used as a control. PIP, PIP.sub.2 and PIP.sub.3 refer to phosphatidylinositol phosphate, phosphatidylinositol bisphosphate, and phosphatidylinositol trisphosphate, respectively.
FIGS. 8A, 8B, and 8C show the coprecipitation of two protein components with cpk, from Drosophila lysates. FIG. 8A shows an immunoblot of lysates (30 .mu.g) prepared from 0-12 hr Drosophila embryos and probed with .alpha.-cpk.m1 serum. FIG. 8B shows the visualization of 90 KDa and 190 KDa proteins which were coprecipitated with cpk. Drosophila lysates were precipitated with Protein A beads alone (1) or beads upon which .alpha.-cpk.m1 had previously been immobilized (2). FIG. 8C shows a blot probed with .alpha.-phosphotyrosine showing that both cpk and the 190 KDa protein may be tyrosine phosphorylated.
FIG. 9 shows the nucleic acid sequence and deduced amino acid sequence of cpk (SEQ ID NOS:27-28).
FIG. 10 shows the nucleic acid sequence and deduced amino acid sequence of cpk-m (SEQ ID NO:29-32).
Description of the Preferred Embodiment
I. Abbreviations
The various embodiments of the present invention may be described with reference to certain abbreviations. Several of the most commonly used abbreviations are as follows:
II. General Description
The present invention generally provides polypeptides that are related to and/or derived from the family of PI3-kinases. These polypeptides are generally involved in cell signaling cascades which control various cellular processes including cell cycle progression and intracellular protein sorting. The family of PI3-kinases from which the polypeptides of the invention are derived are generally characterized by their structure as well as their unique substrate specificity.
The present invention also provides nucleic acids encoding the above-described PI3-kinase polypeptides, antibodies that are capable of interacting with these polypeptides and methods of utilizing these polypeptides in screening systems for identification of agonists or antagonists of cell signaling pathways, generally, and PtdIns phosphorylation, specifically.
III. Proteins and Polypeptides of the Invention
In a first aspect, the present invention provides isolated, or substantially pure polypeptides that are derived from the family of PI3-kinases. The terms "substantially pure" or "isolated", when referring to proteins and polypeptides, denote those polypeptides that are separated from proteins or other contaminants with which they are naturally associated. A protein or polypeptide is considered substantially pure when that protein makes up greater than about 50% of the total protein content of the composition containing that protein, and typically, greater than about 60% of the total protein content. More typically, a substantially pure or isolated protein or polypeptide will make up from about 75 to about 90% of the total protein. Preferably, the protein will make up greater than about 90%, and more preferably, greater than about 95% of the total protein in the composition.
The polypeptides of the present invention are typically derived from PI3-kinases that include a C2 domain within their structure. A C2 domain is generally characterized by its structure, e.g., its homology to similar domains in other proteins, is generally believed to mediate binding to phospholipids or other proteins. The PI3-kinases from which the polypeptides of the present invention are derived may be further characterized by their substrate specificity. In particular, the PI3-kinases from which the polypeptides of the present invention are derived have PI3-kinase activity and are capable of phosphorylating the D3 hydroxyl group on the inositol ring of PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2.
The polypeptides may be further characterized by their relation to a PtdIns 3-kinase isolated from Drosophila melanogaster. This Drosophila PI3-kinase contains a C2 domain and is therefore generally referred to herein as "cpk" for C2 containing PtdIns kinase. The cpk gene represents the first PI3-kinase identified from Drosophila. Additional preferred polypeptides are characterized by their relation to a similar PI3-kinase identified from murine sources, termed cpk-m, which contains a C2 domain and shares extensive sequence identity with cpk. The cpk and cpk-m polypeptides represent a new class of PtdIns 3-kinases. The deduced amino acid sequences for the cpk and cpk-m kinases are shown in FIG. 1.
Analysis of the sequence of the Drosophila and murine cpk proteins reveals a similarity to the p110 family of PtdIns 3-kinases. The cpk genes are 31% identical and 43% similar to a large central region of p110. This region includes both the PtdIns kinase domain (FIG. 2A, black box) and an adjacent region in which p110 and cpk can be distinguished from other PtdIns kinases (striped box). The cpk proteins are also similar to p110 family of PtdIns kinases in the most conserved portion of the catalytic domain (FIG. 2C) (SEQ ID NO:19-26). In this region, the cpk proteins share approximately 45-50% identity with either p110.alpha., p110.beta. or p110.gamma.. In contrast, the cpk proteins share 35%, 29% and 26% identity in this region with the Vps34, Pik1, and Tor2 PtdIns kinases, respectively.
The cpk proteins differ from p110 at both their N- and C-termini. The N-termini of the cpk and cpk-m proteins do not contain any recognizable domain, i.e., the N-terminal domain of p110 that is responsible for binding to the p85 adapter molecule (Holt et al., Mol. Cell. Biol. 14:42-49 (1994), Klippel et al., Mol. Cell Biol. 14:2675-2685 (1994)). The C-termini of cpk and cpk-m proteins contain a "C2" domain (FIG. 2C). These C2 domains are found in a diverse group of proteins and are believed to mediate binding to phospholipids or other proteins. The C2 domains in the cpk and cpk-m sequences are 52% similar to each other, and approximately 38% similar to C2 domains present in protein kinase C, synaptotagmin and rabphilin (FIG. 2B (SEQ ID NO:14-18)).
.alpha.-cpk immune serum recognizes a polypeptide from Drosophila lysates which migrates at approximately 210 KDa, the predicted molecular weight of the cpk protein (FIG. 3). This 210 KDa polypeptide is not recognized by pre-immune serum. Further studies using antibodies raised against fragments of cpk have confirmed the identity of the 210 kDa polypeptide as cpk.
Preferred polypeptides of the present invention will be derived from PI3-kinases having amino acid sequences that are substantially homologous to the amino acid sequences shown in FIG. 1 or biologically active fragments thereof.
The term "biologically active fragment" as used herein, refers to portions of the proteins or polypeptides, which portions possess a particular biological activity. For example, such biological activity may include the ability to bind a particular protein, substrate or ligand, to have antibodies generated against it, to block or otherwise inhibit an interaction between two proteins, between an enzyme and its substrate, between an epitope and an antibody, or may include a particular catalytic activity. With regard to the polypeptides of the present invention, particularly preferred polypeptides or biologically active fragments include, e.g., polypeptides that possess one or more of the biological activities described above, such as the ability to interact with the PI3-kinase substrates described above, e.g., PtdIns and PtdIns4P, or the ability to affect the phosphorylation of those substrates. Fragments possessing this catalytic activity are also termed "catalytically active fragments." Fragments that are specifically recognized and bound by antibodies raised against the polypeptides of the invention are also included in the definition of biologically active fragments. Such fragments are also referred to herein as "immunologically active fragments."
Biologically active fragments of the polypeptides of the invention will generally be useful where it is desired to analyze a single particular biological activity of the polypeptide. For example, therapeutic applications will generally target a single biological activity of the PI3-kinase signaling operation, e.g., substrate binding or substrate phosphorylation, and as such, peptides having fewer than all of these activities will be desired, as discussed in greater detail, below. Alternatively, such fragments may be useful where use of a full length protein is unsuitable for the particular application.
Generally, biologically active fragments of the above described proteins may include any subsequence of a full length PI 3-kinase protein of the invention. Typically, however, such fragments will be from about 5 to about 1500 amino acids in length. More typically, these peptides will be from about 10 to about 500 amino acids in length, more typically about 10 to about 250 amino acids in length, and preferably from about 15 to about 200 amino acids in length. Generally, the length of the fragment may depend, in part, upon the application for which the particular peptide is to be used. For example, for raising antibodies, the peptides may be of a shorter length, e.g., from about 5 to about 50 amino acids in length, whereas for binding or binding inhibition applications, the peptides will generally have a greater length, e.g., from about 10 to about 1000 amino acids in length, preferably, from about 15 to about 500 amino acids in length, and more preferably, from about 15 to about 200 amino acids in length.
The terms "substantially homologous" when referring to polypeptides, refer comparatively to two amino acid sequences which, when optimally aligned, are at least about 75% homologous, preferably at least about 85% homologous more preferably at least about 90% homologous, and still more preferably at least about 95% homologous. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) 85:2444, or by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.).
As noted above, the polypeptides of the invention may also be characterized by their ability to block the interaction between two proteins or a protein and its substrate. In particular, included in the polypeptides of the present invention are PI3-kinase derived peptides that are capable of blocking or otherwise inhibiting the interaction between cpk and/or cpk-m and their substrates, e.g., PtdIns and PtdIns4P. Examples of such polypeptides include fragments of cpk or cpk-m, which encompass the substrate binding regions of cpk and cpk-m. One example of such a fragment is the PI3-kinase domain of the cpk protein, bordered by amino acids 863-1587 of the cpk protein, and homologous regions of the cpk-m protein, as well as larger portions of the cpk and cpk-m proteins.
Also as referenced above, the polypeptides of the present invention may also be characterized by their ability to bind antibodies raised against proteins or polypeptides having the amino acid sequences of cpk and cpk-m, as shown in FIG. 1 (SEQ ID NOS:12-13), or fragments thereof. These antibodies generally recognize polypeptides that are homologous to the cpk or cpk-m proteins or their immunologically active fragments. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or domain. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. Antibodies to the polypeptides of the present invention are discussed in greater detail, below.
The polypeptides of the present invention may generally be prepared using recombinant or synthetic methods well known in the art. Recombinant techniques are generally described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, (2nd ed.) Vols. 1-3, Cold Spring Harbor Laboratory, (1989). Techniques for the synthesis of polypeptides are generally described in Merrifield, J. Amer. Chem. Soc. 85:2149-2456 (1963), Atherton, et al., Solid Phase Peptide Synthesis: A Practical Approach, IRL Press (1989), and Merrifield, Science 232:341-347 (1986). In preferred aspects, the polypeptides of the present invention may be expressed by a suitable host cell that has been transfected with a nucleic acid of the invention, as described in greater detail below.
Biologically active fragments of the above described polypeptides may generally be identified and prepared using methods well known in the art. For example, selective proteolytic digestion, recombinant deletional methods or de novo peptide synthesis methods may be employed to identify portions of the above described peptides that possess the desired biological activity, e.g., substrate binding, catalytic activity and the like. See, e.g., Sambrook, et al.
Isolation and purification of the polypeptides of the present invention can be carried out by methods that are generally well known in the art. For example, the polypeptides may be purified using readily available chromatographic methods, e.g., ion exchange, hydrophobic interaction, HPLC or affinity chromatography, to achieve the desired purity. Affinity chromatography may be particularly attractive in allowing an individual to take advantage of the specific biological activity of the desired peptide, e.g., ligand binding, presence of antigenic determinants or the like. For example, antibodies raised against the cpk protein or immunologically active fragments may be coupled to a suitable solid support and contacted with a mixture of proteins containing the polypeptides of the invention under conditions conducive to the association of these polypeptides with the antibody. Once bound to the immobilized antibody, the solid support is washed to remove unbound material and/or nonspecifically bound proteins. The desired polypeptides may then be eluted from the solid support in substantially pure form by, e.g., a change in salt, pH or buffer concentration. Suitable solid supports for affinity purifications are well known in the art and are generally commercially available from, e.g., Pharmacia, Inc., or Sigma Chemical Co. Examples of such solid supports include agarose, cellulose, dextran, silica, polystyrene or similar solid supports.
In addition to those polypeptides and fragments described above, the present invention also provides fusion proteins which contain these polypeptides or fragments. The term "fusion protein" as used herein, generally refers to a composite protein, i.e., a single contiguous amino acid sequence, made up of two distinct, heterologous polypeptides which are not normally fused together in a single amino acid sequence. Thus, a fusion protein may include a single amino acid sequence that contains two entirely distinct amino acid sequences or two similar or identical polypeptide sequences, provided that these sequences are not normally found together in a single amino acid sequence. Fusion proteins may generally be prepared using either recombinant nucleic acid methods, i.e., as a result of transcription and translation of a gene fusion, which fusion comprises a segment encoding a polypeptide of the invention and a segment encoding a heterologous protein, or by chemical synthesis methods well known in the art.
Also included within the present invention are amino acid variants of the above described polypeptides. These variants may include insertions, deletions and substitutions with other amino acids. For example, in some aspects, conservative amino acid substitutions may be made, i.e., substitution of selected amino acids with different amino acids having similar structural characteristics, e.g., net charge, hydrophobicity and the like. Glycosylation modifications, either changed, increased amounts or decreased amounts, as well as other sequence modifications are also envisioned.
Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) may also be used to generate more stable peptides. In addition, constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch (1992) Ann. Rev. Biochem. 61:387; for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide. Similarly, modification of the amino or carboxy terminals may also be used to confer stabilizing properties upon the polypeptides of the invention, e.g., amidation of the carboxy-terminus or acylation of the amino-terminus. Substitution of amino acids involved in catalytic activity can be used to generate dominant negative inhibitors of signaling pathways.
Furthermore, although primarily described in terms of "proteins" or "polypeptides" one of skill in the art, upon reading the instant specification, will appreciate that these terms also include structural analogs and derivatives of the above-described polypeptides, e.g., polypeptides having conservative amino acid insertions, deletions or substitutions, peptidomimetics and the like. For example, in addition to the above described polypeptides which consist only of naturally-occurring amino acids, peptidomimetics of the polypeptides of the present invention are also provided. Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compounds are termed "peptide mimetics" or "peptidomimetics" (Fauchere, J. (1986) Adv. Drug Res. 15:29; Veber and Freidinger (1985) TINS p.392; and Evans et al. (1987) J. Med. Chem 30:1229, and are usually developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic effect. Generally, peptidomimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a biological or pharmacological activity), such as naturally-occurring receptor-binding polypeptide, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: --CH.sub.2 NH--, --CH.sub.2 S--, --CH.sub.2 --CH.sub.2 --, --CH.dbd.CH-- (cis and trans), --COCH.sub.2 --, --CH(OH)CH.sub.2 --, and --CH.sub.2 SO--, by methods known in the art and further described in the following references: Spatola, A. F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications" (general review); Morley, J. S., Trends Pharm Sci (1980) pp. 463-468 (general review); Hudson, D. et al., Int J Pept Prot Res (1979) 14:177-185 (--CH.sub.2 NH--, CH.sub.2 CH.sub.2 --); Spatola, A. F. et al., Life Sci (1986) 38:1243-1249 (--CH.sub.2 --S); Hann, M. M., J. Chem Soc Perkin Trans I (1982) 307-314 (--CH--CH--, cis and trans); Almquist, R. G. et al., J Med Chem (1980) 23:1392-1398 (--COCH.sub.2 --); Jennings-White, C. et al., Tetrahedron Lett (1982) 23:2533 (--COCH.sub.2 --); Szelke, M. et al., European Appln. EP 45665 (1982) CA: 97:39405 (1982) (--CH(OH)CH.sub.2 --); Holladay, M. W. et al., Tetrahedron Lett (1983) 24:4401-4404 (--C(OH)CH.sub.2 --); and Hruby, V. J., Life Sci (1982) 31:189-199 (--CH.sub.2 S--).
Peptide mimetics may have significant advantages over polypeptide embodiments, including, for example: more economical production; greater chemical stability; enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.); altered specificity (e.g., a broad-spectrum of biological activities); reduced antigenicity; and others.
For many applications, it may also be desirable to provide the polypeptides of the invention as labeled entities, i.e., covalently attached or linked to a detectable group, to facilitate identification, detection and quantification of the polypeptide in a given circumstance. These detectable groups may comprise a detectable protein group, e.g., an assayable enzyme or antibody epitope as described above in the discussion of fusion proteins. Alternatively, the detectable group may be selected from a variety of other detectable groups or labels, such as radiolabels (e.g., .sup.125 I, .sup.32 P or .sup.35 S) or a chemiluminescent or fluorescent group. Similarly, the detectable group may be a substrate, cofactor, inhibitor or affinity ligand. Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure-activity data and/or molecular modeling. Such non-interfering positions generally are positions that do not form direct contacts with the molecules to which the peptidomimetic binds (e.g., PtdIns) to produce the therapeutic effect. Derivitization (e.g., labeling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic. Generally, peptidomimetics of peptides of the invention bind to their ligands (e.g., PtdIns) with high affinity and/or possess detectable biological activity (i.e., are agonistic or antagonistic to one or more PI3-kinase mediated phenotypic changes).
IV. Nucleic Acids, Expression Vectors and Cell Lines Expressing Same
In another aspect, the present invention provides nucleic acids which encode the polypeptides of the invention, as well as expression vectors that include these nucleic acids, and cell lines and organisms that are capable of expressing these nucleic acids. These nucleic acids, expression vectors and cell lines may generally be used to produce the polypeptides of the invention. Generally, the isolated nucleic acids of the present invention encode a polypeptide which is derived from PI3-kinases that include a C2 domain within their structure. In preferred aspects, the nucleic acids of the invention encode polypeptides having PI3-kinase activity that is characterized by the capability of phosphorylating the D3 hydroxyl group on the inositol ring of PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2.
In preferred aspects, the nucleic acids of the invention encode a polypeptide having an amino acid sequence that is substantially homologous to the amino acid sequences shown in FIG. 1 (SEQ ID NOS:12-13). More preferred are those isolated nucleic acid sequences that are substantially homologous to the nucleotide sequences shown in FIGS. 9 (SEQ ID NOS:27-28) and 10 (SEQ ID NOS:29-30) or fragments thereof, and most preferred are those nucleic acid sequences having the nucleotide sequences shown in FIGS. 9 and 10.
"Nucleic acids" of the present invention include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands. Furthermore, different alleles of each isoform are also included. The present invention also provides recombinant nucleic acids which are not otherwise naturally occurring. The nucleic acids described herein also include self replicating plasmids and infectious polymers of DNA or RNA. Unless specified otherwise, conventional notation for nucleic acids is used herein. For example, as written, the left hand end of a single stranded polynucleotide sequence is the 5'-end, whereas the right-hand end is the 3'-end. The left hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".
The nucleic acids of the present invention may be present in whole cells, cell lysates or in partially pure or substantially pure or isolated form. When referring to nucleic acids, the terms "substantially pure" or "isolated" generally refer to the nucleic acid separated from contaminants with which it is generally associated, e.g., lipids, proteins and other nucleic acids. The substantially pure or isolated nucleic acids of the present invention will be greater than about 50% pure. Typically, these nucleic acids will be more than about 60% pure, more typically, from about 75% to about 90% pure and preferably from about 95% to about 98% pure.
The DNA compositions will generally include a coding region which encodes a polypeptide possessing PI3-kinase activity. Preferred nucleic acids will typically encode polypeptides having an amino acid sequence which is substantially homologous to the amino acid sequence shown in FIG. 1 (SEQ ID NOS:12-13), or biologically active fragments thereof. More preferred nucleic acids will comprise a segment having more than about 20 contiguous nucleotides from the nucleotide sequences shown in either of FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), with still more preferred nucleic acids having a nucleotide sequence that is substantially homologous to either of the nucleotide sequences shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32). Most preferred nucleic acids are those which include a portion or all of the nucleotide sequence shown in either of FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32).
The phrase "nucleic acid sequence encoding" refers to a nucleic acid which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
Substantial homology in the nucleic acid context means that the segments, or their complementary strands, when compared, are the same when properly aligned, with the appropriate nucleotide insertions or deletions, in at least about 60% of the nucleotides, typically, at least about 70%, more typically, at least about 80%, usually, at least about 90%, and more usually, at least about 95% to 98% of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions to a strand, or its complement, typically using a sequence of at least about 20 contiguous nucleotides derived from the nucleotide sequence shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32). However, larger segments will usually be preferred, e.g., at least about 30 contiguous nucleotides, more usually about 40 contiguous nucleotides, and preferably more than about 50 contiguous nucleotides. Selective hybridization exists when hybridization occurs which is more selective than total lack of specificity. See, Kanehisa, Nucleic Acid Res. 12:203-213 (1984). Examples of such selective hybridization conditions include, e.g., hybridization under the hybridization and wash conditions of 50% formamide at 42.degree. C. Other stringent hybridization conditions may also be selected. Generally, stringent conditions are selected to be about 5.degree. C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically, stringent conditions will be those in which the salt concentration is at least about 0.02 molar at pH 7 and the temperature is at least about 60.degree. C. As other factors may significantly affect the stringency of hybridization, including, among others, base composition and size of the complementary strands, the presence of organic solvents and the extent of base mismatching, the combination of parameters is more important than the absolute measure of any one.
There are various methods of isolating the nucleic acids which encode the polypeptides of the present invention. Typically, the DNA is isolated from a genomic or cDNA library using labeled oligonucleotide probes specific for sequences in the desired DNA. Restriction endonuclease digestion of genomic DNA or cDNA containing the appropriate genes can be used to isolate the DNA encoding the polypeptides of the invention. From the nucleotide sequence given in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), a panel of restriction endonucleases can be constructed to give cleavage of the DNA in desired regions, i.e., to obtain segments which encode biologically active fragments of the polypeptides of the invention. Following restriction endonuclease digestion, DNA encoding the polypeptides of the invention is identified by its ability to hybridize with a nucleic acid probe in, for example, a Southern blot format. These regions are then isolated using standard methods. See, e.g., Sambrook, et al., supra.
The polymerase chain reaction, or "PCR" can also be used to prepare nucleic acids which encode the polypeptides of the present invention. PCR technology is used to amplify nucleic acid sequences of the desired nucleic acid, e.g., the DNA which encodes the polypeptides of the invention, directly from mRNA, cDNA, or genomic or cDNA libraries. Alternatively, solid phase oligonucleotide synthesis methods may also be employed to produce the nucleic acids described herein. Such methods include the phosphoramidite method described by, e.g., Beaucage and Carruthers, Tetrahedron Lett. 22:1859-1862 (1981), or the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981). A double stranded fragment may then be obtained, if desired, by annealing the chemically synthesized single strands together under appropriate conditions or by synthesizing the complementary strand using DNA polymerase with an appropriate primer sequence.
Appropriate primers and probes for amplifying the nucleic acids described herein, may be generated from analysis of the nucleic acid sequences described herein, e.g., at FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS: 29-32). Briefly, oligonucleotide primers complementary to the two 3' borders of the DNA region to be amplified are synthesized. The PCR is then carried out using the two primers. See, e.g., PCR Protocols: A Guide to Methods and Applications (Innis, M., Gelfand, D., Sninsky, J. and White, T., eds.) Academic Press (1990). Primers can be selected to amplify a variety of different sized segments from the nucleic acid sequence.
The present invention also includes fragments of the above described nucleic acids. Such fragments will generally comprise a segment of from about 15 to about 150 nucleotides. These fragments can be useful as oligonucleotide probes in the methods of the present invention, or alternatively to encode the polypeptides or biologically active fragments of the present invention, described herein. Also provided are substantially similar nucleic acid sequences, allelic variations and natural or induced sequences of the above described nucleic acids. Also included are chemically modified and substituted nucleic acids, e.g., those which incorporate modified nucleotide bases or which incorporate a labelling group.
In one aspect, cDNA encoding the polypeptides of the present invention or fragments thereof, may be readily employed as nucleic acid probes useful for obtaining genes which encode the polypeptides of the present invention. "Nucleic acid probes" may be DNA or RNA fragments. DNA fragments can be prepared, for example, by digesting plasmid DNA, or by use of PCR, or synthesized by either the phosphoramidite or phosphotriester methods described in, e.g., Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press (1990). Where a specific sequence for a nucleic acid probe is given, it is understood that the complementary strand is also identified and included. The complementary strand will work equally well in situations where the target is a double-stranded nucleic acid.
Typical nucleic acid probes may be readily derived from the nucleotide sequence shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), or alternatively, may be prepared from the amino acid sequence of the cpk or cpk-m proteins, as shown in FIG. 1 (SEQ ID NOS:12-13). In particular, probes may be prepared based upon segments of the amino acid sequence which possess relatively low levels of degeneracy, i.e., few or one possible nucleic acid sequences which encode therefor. Suitable synthetic DNA fragments may then be prepared. Examples of such probes include, e.g., those having the following general sequences PK-1, PK-3 PK-1: 5' GA(AGTC)GA(TC)(ATC)T(AGTC)(CA)G(AGCT)CA(AG)GA 3' (SEQ ID NO:1); PK-3: 5' CC(GA)AA(GA)TC(TGA)AT(GA)TG(TGA)A(AT)3' (SEQ ID NO:2)!, PKIN-N and PKIN-C PKIN-N:5' AA(AG)(AG)IIGGIGAIGA(CT)TI(AC)GICA(AG)GA 3' (SEQ ID NO:3); PKIN-C: T(ACG)ICC(AG)AA(AG)TCI(AG)(CT)(AG)TGIA(AT)IA 3' (SEQ ID NO:4)!.
Such cDNA probes may be used in the design of oligonucleotide probes and primers for screening and cloning genes which encode the polypeptides of the invention or related polypeptides, e.g., using well known PCR techniques. These nucleic acids, or fragments may comprise part or all of the cDNA sequence that encodes the polypeptides of the present invention. Effective cDNA probes may comprise as few as 15 consecutive nucleotides in the cDNA sequence, but will often comprise longer segments. Further, these probes may further comprise an additional nucleotide sequence, such as a transcriptional primer sequence for cloning, or a detectable group for easy identification and location of complementary sequences.
cDNA or genomic libraries of various types may be screened for new alleles or related sequences using the above probes. The choice of cDNA libraries normally corresponds to tissue sources which are abundant in mRNA for the desired polypeptides. Phage libraries are normally preferred, but plasmid libraries may also be used. Clones of a library are spread onto plates, transferred to a substrate for screening, denatured, and probed for the presence of the desired sequences.
In addition to comprising a segment which encodes one or more of the above described polypeptides or biologically active fragments, the nucleic acids of the present invention may also comprise a segment encoding a heterologous protein, such that the gene is expressed to produce the two proteins as a fusion protein, as substantially described above.
Typically, the nucleic acids of the present invention will be used in expression vectors for the preparation of the polypeptides of the present invention, namely those polypeptides which possess the PI3-kinase activity described above. The phrase "expression vector" generally refers to nucleotide sequences that are capable of affecting expression of a structural gene in hosts compatible with such sequences. These expression vectors typically include at least suitable promoter sequences and optionally, transcription termination signals. Additional factors necessary or helpful in effecting expression may also be used as described herein. DNA encoding the polypeptides of the present invention will typically be incorporated into DNA constructs capable of introduction into and expression in an in vitro cell culture. Often, the nucleic acids of the present invention may be used to produce a suitable recombinant host cell. Specifically, DNA constructs will be suitable for replication in a prokaryotic host, such as bacteria, e.g., E. coli, or may be introduced into a cultured mammalian, plant, insect, yeast, fungi or other eukaryotic cell line. DNA constructs prepared for introduction into a particular host, e.g., bacteria or yeast, will typically include a replication system recognized by the host, the intended DNA segment encoding the desired polypeptide, and transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide encoding segment. A DNA segment is operably linked when it is placed into a functional relationship with another DNA segment. For example, a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence. DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase. However, enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof. The selection of an appropriate promoter sequence will generally depend upon the host cell selected for the expression of the DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed.), vols. 1-3 Cold Spring Harbor Laboratory (1989). The transcriptional regulatory sequences will typically include a heterologous enhancer or promoter which is recognized by the host. The selection of an appropriate promoter will depend upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available. See Sambrook et al., (1989).
Conveniently available expression vectors which include the replication system and transcriptional and translational regulatory sequences together with the insertion site for the polypeptide encoding segment may be employed. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al., and in Metzger et al., Nature 334:31-36 (1988). For example, suitable expression vectors may be expressed in, e.g., COS-7 cells, by providing constructs including the subject nucleic acids and employing, e.g., a cytomegalovirus enhancer/promoter region with the translation initiation region of the herpes simplex virus thymidine kinase gene. Alternatively, an insect cell line may be selected as the host cell of choice to express the polypeptide. In this case, the cDNA encoding the polypeptides of the invention may be cloned into a baculovirus expression vector (e.g. pV-IKS). The recombinant baculovirus may then be used to transfect a suitable insect host cell, e.g., Sf9 cells, which may then express the polypeptide. See, e.g., D. K. Morrison et al., Cell 58:649-657 (1989), M. D. Summers and G. E. Smith, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Station, College Station, Tex. (1987).
V. Antibodies
The nucleic acids and polypeptides of the present invention or their immunologically active fragments are also useful in producing antibodies, either polyclonal or monoclonal, which are specifically immunoreactive with the polypeptides of the present invention.
The phrase "specifically immunoreactive," when referring to the interaction between an antibody of the invention and a particular protein, refers to an antibody that specifically recognizes and binds with relatively high affinity to the particular protein, such that this binding is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
For production of polyclonal antibodies, an appropriate target immune system is selected, typically a mouse or rabbit, but also including goats, sheep, cows, guinea pigs, monkeys and rats. The substantially purified antigen or plasmid is presented to the immune system in a fashion determined by methods appropriate for the animal. These and other parameters are well known to immunologists. Typically, injections are given in the footpads, intramuscularly, intradermally or intraperitoneally. The immunoglobulins produced by the host can be precipitated, isolated and purified by routine methods, including affinity purification.
For monoclonal antibodies, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the spleens of these animals are excised and individual spleen cells are fused, typically, to immortalized myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone are tested for the production of an appropriate antibody specific for the desired region of the antigen. Techniques for producing antibodies are well known in the art. See, e.g., Goding et al., Monoclonal Antibodies: Principles and Practice (2d ed.) Acad. Press, New York, and Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988). Other suitable techniques involve the in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively, to selection of libraries of antibodies in phage or similar vectors. Huse et al., Generation of Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda, Science 246:1275-1281 (1989). Monoclonal antibodies with affinities of 10.sup.8 liters/mole, preferably 10.sup.9 to 10.sup.10 or stronger, will be produced by these methods.
The antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting interaction between a PI3-kinase, e.g., cpk or cpk-m, and its substrate or other ligands (thereby inhibiting or reducing the signaling cascade) in diagnostic or therapeutic applications, or in research to further elucidate the mechanism of various signaling pathways. Where the antibodies are used to block the interaction between a polypeptide of the invention and an associating molecule, e.g., protein or substrate, the antibody will generally be referred to as a "blocking antibody."
The antibodies of the present invention can be used with or without modification. Frequently, the antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. Such labels include those that are well known in the art, such as the labels described previously for the polypeptides of the invention. Additionally, the antibodies of the invention may be chimeric, human-like or humanized, in order to reduce their potential antigenicity, without reducing their affinity for their target. Chimeric, human-like and humanized antibodies have generally been described in the art. Generally, such chimeric, human-like or humanized antibodies comprise hypervariable regions, e.g., complementarity determining regions (CDRs) from a mammalian animal, i.e., a mouse, and a human framework region. See, e.g., Queen, et al., Proc. Nat'l Acad. Sci. U.S.A. 86:10029 (1989), Verhoeyan, et al., Science 239:1534-1536 (1988). By incorporating as little foreign sequence as possible in the hybrid antibody, the antigenicity is reduced. Preparation of these hybrid antibodies may be carried out by methods well known in the art.
Preferred antibodies are those monoclonal or polyclonal antibodies which specifically recognize and bind the polypeptides of the invention. Accordingly, these preferred antibodies will specifically recognize and bind the polypeptides which have an amino acid sequence that is substantially homologous to the amino acid sequence shown in FIG. 1, or immunologically active fragments thereof. Still more preferred are antibodies which are capable of forming an antibody-ligand complex with the polypeptides of the invention, whereby the ability of the polypeptide to associate with its substrate or normally associated proteins, in vitro, is reduced, e.g., blocking antibodies.
VI. Methods of Use
The polypeptides, antibodies and nucleic acids of the present invention may be used in a variety of important applications. Such applications include but are not limited to screening applications for identifying compounds that generally affect growth factor signal transduction pathways, also termed "signaling cascades," and therapeutic applications for the treatment of proliferative cell disorders.
A. Screening Applications
In a particular aspect, the present invention provides methods of screening test compounds to determine whether the test compounds are capable of affecting growth cell signal transduction pathways. More particularly, the methods described herein are used to screen compounds for their ability to affect the interactions between the polypeptides of the invention, and their respective substrates and ligands, as these interactions are involved in signal transduction pathways.
In one aspect, the present invention provides a screening system for determining whether a test compound is an agonist or antagonist of PI3-kinase activity. An agonist, antagonist or test compound may be a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials such as bacteria, plants, fungi, or animal cells or tissues. Typically, test compounds may include structural analogs or peptidomimetics which are derived from the polypeptides or antibodies described herein, and particularly their biologically active fragments, or substrates or ligands thereof. Test compounds are evaluated for potential activity as agonists or antagonists of functions which result in signal transduction, by inclusion in screening assays described herein. An "agonist" will enhance the particular observed activity, e.g., PtdIns phosphorylation at the D3 hydroxyl, while an "antagonist" will diminish the particular observed activity. The terms "agonist" and "antagonist", as used herein, do not imply any particular mechanism of function. Particularly targeted test compounds include polypeptide fragments of the polypeptides of the present invention and structural analogs or peptidomimetics of these peptides.
The screening methods of the present invention typically involve the incubation of a polypeptide of the present invention, e.g., a cpk or cpk-m polypeptide, in the presence of PtdIns or PtdIns4P, as well as a particular test compound. The mixture is then assayed over time, to determine the amount of PtdIns 3P or PtdIns(3,4)P.sub.2 produced in the presence and absence of the test compound. Where the presence of the test compound results in an increase or decrease in the amount of PtdIns 3P or PtdIns(3,4)P.sub.2 produced, it will be indicative that the test compound is an agonist or antagonist of the PI3-kinase mediated signal transduction, respectively.
For determination of the amount of PtdIns3P or PtdIns(3,4)P.sub.2 formed, one may employ any number of a variety of well known assay methods. For example, HPLC analysis can be readily used to quantitatively identify the above described reaction products, using, e.g., tritiated substrates, and the like. Similarly, on a more qualitative level, thin layer chromatography (TLC) can also be used to identify reaction products. The levels of the above described reaction products produced in the presence and absence of the test compound are then compared. Where the presence of the test compound results in an increase or decrease in the level of the reaction product produced by the polypeptide, it is indicative that the test compound is an agonist or antagonist of PI3-kinase activity, respectively, and more particularly, the activity of the cpk polypeptide and/or cpk-m polypeptide, as described herein.
In a related embodiment, the present invention also provides kits for carrying out the above described screening methods. The kits of the present invention generally include a polypeptide of the present invention, e.g., the cpk polypeptide, cpk-m polypeptide or a biologically active fragment thereof, as well as a substrate of the polypeptide where the catalytic activity is to be screened, e.g., PtdIns or PtdIns4P. One or more of these components may generally be provided in premeasured aliquots. The aliquots can be contained in any suitable container such as a vial or a tube. The polypeptide component can be provided in solution or in lyophilized form, and may be immobilized. The polypeptide preparation may also contain preservatives such as sodium azide or protease inhibitors such as EDTA. A carrier protein such as BSA or ovalbumin, usually between 0.5-5%, may also be included to stabilize the polypeptide. The solution form of cpk or cpk-m polypeptide may contain up to 50% glycerol if the enzyme is to be stored frozen, e.g., at -20.degree. C. to -70.degree. C. If the cpk or cpk-m polypeptide is provided in lyophilized form, the kit can include a reconstitution buffer to reconstitute the polypeptide, as well as a reaction buffer. Alternatively, the polypeptide can be added to the reaction buffer and the solution freeze dried. This form can be readily reconstituted in distilled water with the necessary salt components already present for the particular reaction to be screened, so that no additional reaction buffer need be supplied. Thus, depending on the form and composition of the polypeptide preparation, different buffers may be included in the kit and they may be provided in more than one aliquot. Although described in substantial detail herein, these buffers are generally optional. The appropriate substrate or ligand, depending upon the particular screening method used, may be provided in a similar fashion to that of the polypeptide component. The kits will also typically include additional reagents for carrying out the particular method, e.g., stains for detection, antibodies, solid supports and the like, as well as detailed operating specifications for their use. For example, where binding interactions are being screened, the ligand component may generally be supplied within the kit, already coupled to an appropriate support.
Once identified, particular agonists or antagonists may then be used to enhance or block the activity of the polypeptides of the present invention. This may be particularly useful in therapeutic applications (see discussion, below).
B. Therapeutic Applications
In addition to the above described uses, the polypeptides, nucleic acids and antibodies of the present invention may also be used in therapeutic applications for the treatment of human or non-human mammalian patients. The term "treatment" as used herein, refers to the full spectrum of treatments for a given disorder from which the patient is suffering, including alleviation of one, most or all symptoms resulting from that disorder, outright cure for the particular disorder and prevention of the onset of the disorder.
As described previously herein, the polypeptides of the present invention have been implicated as providing a critical step in cell signal transduction, e.g., involved in the growth factor activation cascades. One such growth factor activation cascade leads to the activation of the Ras oncagene, which has been associated with a variety of proliferative disorders including atherosclerosis, inflammatory joint diseases, psoriasis, restenosis following angioplasty, and cancer. See, e.g., G. Pelicci et al. Cell 70, 93-104 (1992); M. Rozakis-Adcock et al. Nature, 360:689 (1992), Hu et al., Science 268:100-102 (1995).
Accordingly, treatment of the above described disorders may generally be carried out by blocking or inhibiting activation of Ras. This may be accomplished by blocking or inhibiting one or more of the activities responsible for signal transduction leading to activation of Ras, including, e.g., the phosphorylation of the D3 hydroxyl of PtdIns and PtdIns4P, which compounds are involved in the signal transduction pathway which activates Ras.
Generally, inhibition of the particular activity may be carried out by providing a polypeptide of the invention which will compete with the endogenous PI3-kinases. For example, by administering to a patient an effective amount of a substrate binding portion of a polypeptide of the invention, as described herein, one may block association of endogenous PI3-kinases with their substrates, and thereby reduce the level of Ras activation. Similar strategies may be employed using blocking antibodies of the present invention, i.e., those antibodies capable of inhibiting the interaction between the polypeptides of the invention and their substrates or other ligands.
The quantities of reagents necessary for effective therapy, also referred to herein as an "effective amount," or "therapeutically effective amount," will depend upon many different factors, including means of administration, target site, physiological state of the patient and other medicants administered. Thus, treatment doses will need to be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide further predictive indication of human dosage. Generally, therapeutically effective amounts of the GA5Ptase containing polypeptides of the present invention will be from about 0.0001 to about 10 mg/kg, and more usually, from about 0.001 to about 0.1 mg/kg of the host's body weight. Various considerations are described, e.g., in Gilman et al., (Eds.), Goodman and Gilman's: The Pharmacological Basis of Therapeutics, (8th ed. 1990), Pergamon Press, and Remington's Pharmaceutical Sciences (7th ed. 1985) Mack Publishing Co., Easton, Pa. Methods of administration, also discussed in the above references, include, e.g., oral, intravenous, intraperitoneal or intramuscular administration, and local administration, including topical, transdermal diffusion and aerosol administration, for therapeutic, and/or prophylactic treatment. The active agent, i.e., the polypeptide component, will generally be administered in a composition additionally comprising a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include water, saline, buffers and other compounds described in, e.g., the Merck Index, Merck and Co., Rahway, N.J. For some methods of administration, e.g., oral, it may be desirable to provide the active ingredient in a liposomal formulation. This is particularly desirable where the active ingredient may be subject to degradative environments, for example, proteolytic digestive enzymes. Liposomal formulations are well known in the art, and are discussed in, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES, supra. Administration may also be carried out by way of a controlled release composition or device, whereby a slow release of the active ingredient allows continuous administration over a longer period of time.
Constituents of pharmaceutical compositions, in addition to the active agents described herein, include those generally known in the art for the various administration methods used. For example, oral forms generally include powders, tablets, pills, capsules, lozenges and liquids. Similarly, intravenous, intraperitoneal or intramuscular formulations will generally be dissolved or suspended in a pharmaceutically acceptable carrier, e.g., water, buffered water, saline and the like. Additionally, these compositions may include additional constituents which may be required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like. For solid compositions, conventional nontoxic solid carriers may be used which include, e.g., pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate and the like.
Administration may also be carried out by way of a controlled release composition or device, whereby a slow release of the active ingredient allows continuous administration over a longer period of time.
Additionally, as PI3-kinases play critical roles in cell signaling pathways, the present invention may also provide an exogenous regulatory mechanism in the treatment of disorders where these regulatory mechanisms are disfunctional. In particular, the treatment of a particular disorder may comprise gene therapy techniques involving the mutation, dysregulation or augmentation of levels of exogenous PI3-kinase. For example, gene therapy techniques may involve the introduction into afflicted cells, of genes which encode a protein or polypeptide which possesses the PI3-kinase activity. These exogenously introduced genes' products may then augment existing levels of this activity in cells that may be otherwise deficient.
Strategies for gene therapy are reviewed in Friedmann, Science 244:1275 (9189). Genetic constructs encoding the cpk, cpk-m or functional derivatives, can be used in these gene therapy techniques. Delivery of the genetic construct of interest, i.e., the nucleic acid encoding a PI3-kinase protein or fragment, may be accomplished in vivo by administering the therapy vector to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial administration). Alternatively, the vector may be used to deliver nucleic acids to cells ex vivo, such as cells explanted from an individual patient or universal donor hematopoietic stem cells, neurons, etc, e.g., by transfection of the cells with nucleic acids of interest cloned into retroviruses. Following transfection, the cells are reimplanted into the patient, usually after selection for cells which have incorporated the nucleic acid. The infusion into the patient of transfected cells can replace cells which are dysfunctional for the particular regulatory scheme which results in the disorder being treated.
The present invention is further illustrated by the following examples. These examples are merely to illustrate aspects of the present invention and are not intended as limitations of this invention.
VII. Examples
Example 1
Identification of the Drosophila and Murine cpk Genes
The cpk and cpk-m genes were obtained by PCR amplification of Drosophila and murine cDNA libraries with the degenerate primers PK-1 and PK-3 PK-1: 5' GA(AGTC)GA(TC)(ATC)T(AGTC)(CA)G(AGCT)CA(AG)GA 3' (SEQ ID NO:1); PK-3: 5' CC(GA)AA(GA)TC(TGA)AT(GA)TG(TGA)A(AT)3' (SEQ ID NO:2)! for Drosophila. These primers correspond to two regions of conserved amino acids in PtdIns kinase domains, (DE)D(LI)RQD (SEQ ID NO:5) and (FI)HIDFG (SEQ ID NO:6). The murine cpk-m gene was amplified using primers PKIN-N and PKIN-C PKIN-N:5' AA(AG)(AG)IIGGIGAIGA(CT)TI(AC)GICA(AG)GA 3' (SEQ ID NO:3); PKIN-C: T(ACG)ICC(AG)AA(AG)TCI(AG)(CT)(AG)TGIA(AT)IA 3' (SEQ ID NO:4)!. PCR products of approximately 400 base pairs were recovered and sequencing revealed open reading frames with sequence identity to p110 PtdIns 3-kinases. These DNA fragments were then used as probes to screen cDNA libraries. Large cDNAs, which did not contain the 5' ends of the cpk cDNAs, were recovered from the Drosophila and murine libraries. The 5' ends of the cDNAs were extended using a 5' RACE kit (Gibco BRL). Construction of the Drosophila cDNA library from 4-8 hr Drosophila embryos was previously described in Brown et al., J. Mol. Biol. 203:425-437 (1988). The murine cDNA libraries used were random and oligo(dT) primed mouse brain and mouse liver libraries purchased from Clontech. Standard procedures were used for cloning. The sequence of DNA was determined using an A.L.F. DNA Sequencer (Pharmacia). The size of the cDNA (6.9 kb) is consistent with the size of the mRNA as estimated by northern blot analysis. Conceptual translation of the cDNA revealed a large open reading frame (ORF) encoding a protein with a predicted molecular weight of 210 KDa. The first methionine in this ORF is encoded by the first ATG in the cDNA and it is preceded by an in frame stop codon. The Drosophila and murine cpk proteins are 34% identical and 48% similar (FIG. 1 (SEQ ID NOS:12-13)).
Example 2
Generation of .alpha.-cpk Polyclonal Sera
A fragment of the Drosophila cpk protein was expressed in the E. coli strain BL21DE3(lysS) as a hexahistidine fusion protein. The Drosophila cpk cDNA was digested with NcoI (cleaving at position 1892) and HpaI (at position 4157) and the resulting 2265 base pair fragment (corresponding to the fragment encoding amino acids 563-1317) was ligated into the NcoI and Ecl136II sites of pet23d (Novagen). This construct drives expression of an 85 KDa cpk hexahistidine fusion protein, named pet.1. This protein was found to reside completely in inclusion bodies. Accordingly, the inclusion bodies were purified, solubilized in 1.times. Laemmli sample buffer, and electrophoresed on a 8% preparative gel. The pet.1 polypeptide was eluted from a gel slice and then used to immunize rabbits (Berkeley Antibody Company). The resulting polyclonal serum, designated .alpha.-cpk, was purified on an affinity column. The affinity column was prepared by coupling two milligrams of pet.1 protein to an affigel 10 solid support, according to the manufacturer's instructions (Biorad). This antigen column was used to immunoaffinity purify .alpha.-cpk serum. The affinity purified serum was then incubated with whole cell BL21DE3(lysS) lysates that had been immobilized to a PVDF membrane (Millipore). In this manner, antibodies to E. coli proteins that coelute with pet.1 from the gel slice were eliminated. Preimmune serum was similarly treated, for use as a control.
In order to produce an independent serum that recognizes cpk protein, polyclonal .alpha.-peptide serum was also generated by immunizing rabbits with the P6 peptide (NH.sub.2 -CRQDFLSQPSTSSSQY-COOH (SEQ ID NO:7)), which corresponds to amino acids 419-434 of the cpk protein. The P6 peptide was conjugated to the carrier and then used to immunize rabbits (Berkeley Antibody Company).
The resulting .alpha. P-6 serum, which was designated .alpha.-P6, was used to precipitate protein from Drosophila lysates. The precipitates were resolved by SDS-PAGE, transferred to a PVDF membrane and probed with .alpha.-cpk serum (FIG. 3B). Both the .alpha.-cpk and .alpha.-P6 immune sera precipitated a 210 KDa polypeptide that was recognized by .alpha.-cpk serum. p210 was not detected in control precipitates using preimmune sera. Half of each precipitate (e.g., .alpha.-cpk and .alpha.-P6 precipitates) was assayed for PtdIns kinase activity and the other half was used for the detection of cpk protein on a immunoblot. PtdIns kinase activity was detected in precipitates using the .alpha.-cpk and .alpha.-P6 immune sera, but not in precipitates using preimmune sera. The PtdIns kinase activity was competed by preincubating the .alpha.-cpk serum with the cpk fusion protein or the .alpha.-P6 serum with the P6 peptide. Therefore, cpk protein precipitated from Drosophila lysates has a PtdIns kinase activity.
Polyclonal .alpha.-peptide serum against murine cpk-m was generated by immunizing rabbits with the NB-70 peptide (NH.sub.2 -CQGQVSQKDPNGTSS-COOH (SEQ ID NO:8)). This peptide was conjugated with KLH carrier protein before immunizing rabbits (Caltag). The resulting serum, which was designated 4863, was used to precipitate and probe protein from fibroblast cell lysates. A polypeptide with a molecular weight of approximately 210 kDa in the crude cell lysates and precipitates was recognized by the immune serum but not by the preimmune serum. PtdIns kinase activity was detected in precipitates using 4863 immune serum, but not in precipitates obtained using preimmune serum. Both the PtdIns kinase activity and the 210 kDa protein band on a Western blot were competed by preincubating the 4683 serum with the NB-70 peptide.
In order to eliminate the possibility that the activity detected in the .alpha.-cpk and .alpha.-P6 precipitates resulted from a PtdIns kinase coprecipitating with cpk, rather than from cpk protein itself, it was independently determined that cpk can phosphorylate PtdIns. This was accomplished by assaying the activity of cpk protein obtained by exogenous expression in COS-7 cells (FIG. 5B). Wild-type and kinase deficient cpk proteins were tagged with an HA epitope and then expressed in COS-7 cells. A kinase deficient cpk mutant was constructed by changing a conserved lysine in the catalytic domain to arginine. Wild type and mutant cpk proteins were precipitated from COS-7 cell lysates. One half of each precipitate was assayed for PtdIns kinase activity and the other half was used for the detection of cpk protein on an immunoblot. Precipitates containing wild-type cpk protein contained a PtdIns kinase activity, while precipitates containing an equivalent amount of the mutant cpk protein did not (FIG. 5B). These data indicate that cpk protein possesses intrinsic PtdIns kinase activity.
Example 3
Preparation of Drosophila Lysates and Immunochemical Assays
Lysates were prepared by dounce homogenizing 0-12 hr Drosophila embryos in lysis buffer (20 mM N-2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid (HEPES) pH 7.5, 150 mM sodium chloride, 2 mM EDTA 10 mM sodium fluoride, 10 mM sodium phosphate (pH 7.5), 10 mM tetrasodium pyrophosphate, 10 mM sodium orthovanadate, 2 mM phenylmethylsulfonyl fluoride, 10% glycerol, 10 trypsin inhibiting units/ml aprotinin, and 20 .mu.M leupeptin). The lysates were then frozen in aliquots at -70.degree. C. Immediately prior to use, an aliquot was thawed, diluted with lysis buffer containing 1% Triton X-100, and the insoluble proteins were pelleted in a microfuge. cpk protein was detected by immunoblotting in the following manner: proteins from lysates were resolved by SDS-PAGE on a 6% gel and then transferred to a PVDF membrane (Millipore) using high molecular weight transfer buffer; the blots were incubated with the appropriate serum diluted in TBS-T (TBS-T: 50 mM Tris pH 8.0; 150 mM sodium chloride, and 0.1% Tween-20) containing 5% dry milk and 1% ovalbumin; and then processed using an enhanced chemiluminescence kit (Amersham).
To determine if the cpk protein is a substrate of a tyrosine kinase, e.g., tyrosine phosphorylated, similar blots were probed with an .alpha.-phosphotyrosine antibody (FIG. 4). The cpk precipitations contained an .alpha.-phosphotyrosine reactive polypeptide migrating at 210 KDa, the molecular weight of the cpk protein.
Example 4
PtdIns Kinase Assays
cpk protein was precipitated from either COS-7 cell or Drosophila lysates as described in Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988)). The precipitations were washed four times in lysis buffer containing 1.0% Triton X-100 and then two times in PtdIns kinase assay buffer (PtdIns kinase assay buffer: 30 mM HEPES pH 7.5, 30 mM magnesium chloride). PtdIns kinase assays in which PtdIns was used as the substrate were performed as previously described in Kaplan et al., Cell 50:1021-1029 (1987) and Whitman et al., Nature 322:644-646 (1988). The PtdIns kinase assays were modified in the following manner for the determination of PtdIns, PtdIns4P and PtdIns(4,5)P.sub.2 substrate specificities. The PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2 lipid substrates were mixed with an equal amount of phosphatidylserine (PS) and then sonicated to form vesicles. Preparation of vesicles with PS assures that the physical properties of the PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2 vesicles are approximately equivalent. The products of these kinase assays were resolved by TLC (Thin Layer Chromatography) using silica gel 60 plates (Whatman) in a buffer consisting of chloroform:acetone:methanol:acetic acid:water (80:30:26:24:14). cpk Kinase assays were further modified by the addition of 0.05% 3-(3-cholamidopropyl)dimethylammonio!-1-propanesulfonate (CHAPS) to the vesicle substrates and to the PtdIns kinase assay buffer. The addition of CHAPS was determined to stimulate cpk PtdIns kinase activity in vitro.
Example 5
Determination of the Position on the Inositol Ring Phosphorylated by cpk
Since the cpk proteins are related to PtdIns kinases, it was of interest to determine whether they could phosphorylate PtdIns, and whether this phosphorylation occurred on the D3 or D4 position of the inositol ring.
PtdIns3P and PtdIns4P were resolved using TLC with a borate buffer system that has previously been described in detail in Walsh et al., Proc. Nat'l Acad. Sci. U.S.A. 88:9184-9187 (1991). .gamma..sup.32 P!-PtdIns3P and .gamma..sup.32 P!-PtdIns4P standards were generated in the following manner. PtdIns3-.gamma..sup.32 P was produced by phosphorylating PtdIns with .gamma..sup.32 P!-ATP using a constitutively active p110 mutant protein (p110*) whose construction and expression was previously described in Hu et al., Science 268:100-102 (1995). PtdIns4-.gamma..sup.32 P was produced by phosphorylating PtdIns with .gamma..sup.32 P!-ATP with lysates (20 .mu.g) prepared from 0-12 hr Drosophila embryos. PtdIns 4-kinases are generally the most abundant PtdIns kinases found in lysates. In order to verify that the major product of this reaction is indeed PtdIns4P, the reaction products were demonstrated to comigrate with an unlabeled PtdIns4P standard (Sigma), but could be resolved from the PtdIns3-.gamma..sup.32 P standard. The unlabeled PtdIns4P standard was visualized by iodine staining. Cpk protein was precipitated from either Drosophila lysates (FIG. 6A) or COS-7 cell lysates (FIG. 6B) and used to phosphorylate PtdIns. The .gamma..sup.32 P! labeled products of these reactions were separated by TLC. The cpk products migrated at the position of a .gamma..sup.32 P! labeled PtdIns3P standard, but not a PtdIns4P standard. The cpk products were then mixed with either PtdIns3P or PtdIns4P standards and the mixtures were resolved by TLC. The lipid products of cpk comigrated with the PtdIns3P standard, but not with the PtdIns4P standard, suggesting that the cpk reaction products are PtdIns3P and that cpk is a PtdIns 3-kinase.
PtdIns 3-kinases have distinct substrate specificities in vitro. For example, Vps34 can only phosphorylate PtdIns, while p110/p85 can phosphorylate PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2. Using in vitro kinase assays, cpk was also determined to have a unique substrate specificity, being capable of phosphorylating PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2 (FIG. 7). A constitutively active 110 (p110*, Hu et al., Science 268:100-102 (1995)) was used as a control and it phosphorylated PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2. It has also been determined that wild-type cpk protein obtained from exogenous expression in COS-7 cells displayed the same substrate specificity as protein derived from Drosophila lysates. A kinase deficient cpk protein obtained from exogenous expression in COS-7 cells served as a control and was unable to phosphorylate any of these substrates.
Example 6
Expression of Proteins in COS-7 Cells
A plasmid was constructed that expressed cpk-HA fusion proteins in COS-7 cells. NotI and SmaI sites were introduced into the cpk cDNA at the position of the stop condon using the primer dPIK 34 (dPIK 34: 5' CCCCGGGTCAGCGGCCGCCGTTCCTGGACACCGCGCCCAG 3' (SEQ ID NO:9)), which corresponds to nucleotides 5755-5795 of the cDNA. A triple tandem copy of HA1 epitope on a NotI DNA fragment was ligated into the NotI site. An SpeI site was introduced at the position of the initiating methionine using the primer dPIK 29 (dPIK29: 5' TTAGACGAGACTAGTATGTCAAATCAAGCG 3' (SEQ ID NO:10)), which corresponds to nucleotides 132-162 of the cpk cDNA. The resulting 5683 base pair SpeI/SmaI fragment was ligated into the XbaI/SmaI sites of the mammalian expression vector pCG. pCG is a derivative of pEVRF with a modified polylinker that contains the human cytomegalovirus enhancer/promoter region and the translation initiation region of the herpes simplex virus thymidine kinase gene. A kinase deficient cpk protein was constructed by changing lysine 1347 to arginine with the primer dPIK 27 (dPIK27: 5' GTGGGACCTGATGCCGAATCTTTACCGGCTATCTTTAGGTGCGGA 3' (SEQ ID NO:11)). A constitutively active p110 mutant protein (p110*) was expressed as a control.
Example 7
Drug Sensitivity of cpk
Drug sensitivity and divalent cation requirement were determined for the cpk PtdIns kinase activity relative to p110. P110 PtdIns 3-kinase activity is sensitive to wortmannin, a fungal metabolite that has been shown to be a selective inhibitor of PtdIns kinases. In vitro, the wortmannin sensitivity of the cpk PI3-kinase activity is similar to that of p110. The IC-50 (half maximal inhibition) value for p110 was determined to be 7.5 nM, which is a value consistent with previous studies (Woscholski et al., FEBS Lett. 342:109-114 (1994)). The IC-50 for wortmannin inhibition of cpk was 11 nM. Also, p110 requires the addition of either Mg.sup.2+ or Mn.sup.2+ to in vitro kinase assays, although the enzyme is more active in the presence of Mg.sup.2+ (Volinia et al., EMBO J. 14:3339-3348 (1995)). In contrast, cpk strictly requires the presence of Mg.sup.2+ in in vitro kinase assays, and the enzyme is inactive in the presence of Mn.sup.2+.
Example 8
Identification of cpk Binding Proteins
Monoclonal antibody serum was generated which specifically recognizes cpk (.alpha.-cpk.m1), for the purpose of identifying cpk binding proteins. The serum recognizes cpk on an immunoblot of lysates prepared from 0-12 hr Drosophila embryos (FIG. 8A). cpk protein was precipitated from Drosophila lysates using .alpha.-cpk.m1 and the precipitates were resolved by SDS-PAGE. The proteins were visualized by silver staining (FIG. 8B). In addition to cpk, two other proteins were observed having approximate molecular weights of 90 KDa and 190 KDa (p90 and p190, respectively). These proteins were not recognized by .alpha.-cpk.m1 serum on an immunoblot, indicating that these fragments are not related to cpk. This also indicates that these proteins are not independently precipitated by the serum. Blots of cpk precipitates containing cpk, p90 and p190 were probed with .alpha.-phosphotyrosine to determine whether these proteins were tyrosine phosphorylated. Proteins migrating at approximately 190 KDa and 210 KDa reacted with the antiphosphotyrosine antibody, indicating tyrosine phosphorylation, and probable regulation by tyrosine kinases (See also FIG. 4).
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. All publications and patent documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent document were so individually denoted.
Claims
What is claimed is:
1. A substantially pure PI 3-kinase polypeptide, said polypeptide being capable of phosphorylating a D3 hydroxyl of an inositol ring in PtdIns and PtdIns4P but not PtdIns(4,5)P.sub.2.
2. The polypeptide of claim 1, wherein said polypeptide further comprises a C2 domain.
3. The polypeptide of claim 1, wherein said polypeptide has a molecular weight of approximately 210 kDa, wherein said molecular weight is determined by an SDS-PAGE technique.
4. A substantially pure polypeptide, said polypeptide being encoded by a nucleic acid sequence that is capable of hybridizing with a nucleic acid probe selected from the group consisting of: 5'-GA(AGC)GA(C)(AC)T(ATC) (C)G(GCT)CA(G)GA-3' (SEQ ID NO:1); 5'-CC(GA)AA(GA)TC(TGA)AT (GA)TG (TGA)A(AT)-3' (SEQ ID NO:2); 5'-AA(AG)(AG)IIGGIGAIGA(CT) TI(AC)GICA(AG)GA-3' (SEQ ID NO:3); and 5'-T(ACG)ICC(AG)AA(AG)TCI (AG)(CT)(AG)TGIA(AT)IA-3' (SEQ ID NO:4).
5. A substantially pure polypeptide, said polypeptide capable of interacting with a phosphatidyl inositol substrate, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
6. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
7. The polypeptide of claim 5, wherein said polypeptide comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
8. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence encoding a PI 3-kinase domain of a PI 3-kinase protein selected from cpk and cpk-m.
9. The polypeptide of claim 8, wherein said polypeptide comprises an amino acid sequence corresponding to amino acids 863-1587 of a cpk amino acid sequence.
10. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence which encodes an amino acid sequence selected from the group consisting of NH.sub.2 -CQGQVSQKDPNGTSS-COOH (SEQ ID NO:8), NH.sub.2 -CRQDFLSQPSTSSSQY-COOH (SEQ ID NO:7), acylated and amidated forms thereof.
11. The polypeptide of claim 5, wherein said polypeptide comprises a C2 domain.
12. The polypeptide of claim 5, wherein said polypeptide is isolatable from Drosophila.
13. The polypeptide of claim 5, wherein said polypeptide is isolatable from a mouse.
14. A substantially pure polypeptide of claim 1, said polypeptide being specifically immunoreactive with an antibody raised against a cpk or cpk-m polypeptide or immunologically active fragment thereof.
15. A substantially pure polypeptide, said polypeptide being capable of inhibiting the interaction between a PI 3-kinase selected from the group consisting of cpk and cpk-m, and a phosphatidyl inositol substrate selected from the group consisting of PtdIns and PtdIns4P, said polypeptide comprising an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
16. A substantially pure polypeptide, said polypeptide capable of interacting with a phosphatidyl inositol substrate, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence which hybridizes under stringent conditions to a nucleic acid sequence which encodes an amino acid sequence selected from the group consisting of cpk and cpk-m shown in FIG. 1 (SEQ ID Nos: 12-13).
Patent Citations (1)
| Patent | Date | Inventor | Cited By |
|---|---|---|---|
| WOX9321328 | 1993-10-01 |
Non-Patent Literature (44)
- Auger et al., "PDGF-Dependent Tyrosine Phosphorylation Stimulates Production of Novel Polyphosphoinositides in Intact Cells," Cell, 57:167-175 (1989).
- Brown et al., "Functional cDNA Libraries from Drosophila Embryos," J. Mol. Biol., 203:425-437 (1988).
- Carpenter et al., "Purification and Characterization of Phosphoinositide 3-Kinase from Rat Liver," J. Biol. Chem., 265(32):19704-19711 (1990).
- Carter et al., "Phosphatidylinositol 3,4,5-triphosphate is formed from phosphatidylinositol 4,5-bisphosphate in thrombin-stimulated platelets," Biochem. J. 301:415-420 (1994).
- Dhand et al., "PI 3-kinase is a dual specificify enzyme: autoregulation by an intrinsic protein-serine kinase activity," EMBO J., 13(3):522-533 (1994).
- Franke et al., "The Protein Kinase Encoded by the Akt Proto-Oncogene is a Target of the PDGF-Activated Phosphatidylinositol 3-Kinase," Cell, 81:727-736 (1995).
- Fry et al., "Purification and characterization of a phosphatidylinositol 3-kinase complex from bovine brain by using phosphopeptide affinity columns," Biochem J., 288:383-393 (1992).
- Hawkins et al.,"Platelet-derived growth factor stimulates synthesis of PtdIns(3,4,5)P.sub.3 by activating a PtdIns(4,5)P.sub.2 3-OH kinase," Nature, 358:157-159 (1992).
- Herman et al., "Characterization of VPS34, a Gene Required for Vacuolar Protein Sorting and Vacuole Segregation in Saccaromyces cerevisiae," Mol. Cell Biol., 10(12):6742-6754 (1990).
- Hiles et al., "Phosphatidylinositol 3-Kinase: Structure and Expression of the 110 kd Catalytic Subunit," Cell, 70:419-429 (1992).
- Holt et al., "Phosphatidylinositol 3-Kinase Activation is mediated by High-Affinity Interactions between Distinct Domains within the p110 and p85 Subunits," Mol. Cell. Biol., 14(1):42-49 (1994).
- Hu et al., "Interaction of Phosphatidylinositol 3-Kinase-Associated p85 with Epidermal Growth Factor and Platelet-Derived Growth Factor Receptors," Mol. Cell Biol., 12(3):981-990 (1992).
- Hu et al., "Ras-Dependent Induction of Cellular Responses by Constitutively Active Phosphatidylinositol-3 Kinase," Science, 268:100-102 (1995).
- Kapellar and Cantley, "Phosphatidylinositol 3-Kinase," Bioessays, 16(8):565-576 (1994).
- Kaplan et al., "Common Elements in Growth Factor Stimulation and Oncogenic Transformation: 85 kd Phosphoprotein and Phosphatidylinositol Kinase Activity," Cell, 50:1021-1029 (1987).
- Klippel et al., "The Interaction of Small Domains between the Subunits of Phosphatidylinositol 3-Kinase Determines Enzyme Activity," Mol. Cell Biol., 14(4):2675-2685 (1994).
- Kunz et al., "Target of Rapamycin in Yeast, TOR2, Is an Essential Phosphatidylinositol Kinase Homolog Required for G.sub.1 Progression," Cell, 73:585-596 (1993).
- MacDougall et al., "A family of phosphoinositide 3-kinases in Drosophila identifies a new mediator of signal transduction," Current Biology, 5(12):1404-1415 (1995).
- McGlade et al., "SH2 Domains of the p85.alpha. Subunit of Phosphatidylinositol 3-Kinase Regulate Binding to Growth Factor Receptors," Mol. Cell Biol. 12(3):991-997 (1992).
- Metzger et al., "The human oestrogen receptor functions in yeast," Nature, 334:31-36 (1988).
- Morgan et al., "Purification and characterization of bovine brain type I phosphatidylinositol kinase," Eur. J. Biochem., 191:761-767 (1990).
- Nakanishi et al., "Activation of the .zeta. Isozyme of Protein Kinase C by Phosphatidylinositol 3,4,5-Trisphosphate," J. Biol. Chem., 268(1):13-16 (1993).
- Reedijk et al., "Tyr721 regulates specific binding of the CSF-1 receptor kinase insert of PI 3'-kinase SH2 domains: a model for SH2-mediated receptor-target interactions," EMBO J., 11(4):1365-1372 (1992).
- Schu et al., "Phosphatidylinositol e-Kinase Encoded by Yeast VPS34 Gene Essential for Protein Sorting," Science, 260:88-91 (1993).
- Shibasaki et al., "Two Types of Phosphatidylinositol 3- Kinase from Bovine Thymus," J. Biol. Chem., 266(13):8108-8114 (1991).
- Stephens et al., "Pathway of phosphatidylinositol(3,4,5)-triphosphate synthesis in activated neutrophils," Nature, 351:33-39 (1991).
- Stephens et al., "Agonist-stimulated synthesis of phosphatidylinositol(3,4,5)-trisphosphate: a new intracellular signalling system?," Biochim. Biophys. Acta, 1179:27-75 (1993).
- Toker et al., Activation of Protein Kinase C Family Members by the Novel Polyphosphoinositides PtdIns-3,4-P.sub.2 and PtdIns-3,4,5-P.sub.3 J. Biol. Chem., 269(51):32358-32367 (1994).
- Traynor-Kaplan et al., "An inositol tetrakisphosphate-containing phospholipid in activated neutrophils," Nature, 334:353-356 (1988).
- Traynor-Kaplan et al., "Transient Increase in Phosphatidylinositol 3,4-Bisphosphate and Phosphatidylinositol Trisphosphate during Activation of Human Neutrophils," J. Biol. Chem., 264(26):15668-15673 (1989).
- Whitman et al., "Type I phosphatidylinositol kinase makes a novel inositol phospholipid, phosphatidylinositol-3-phosphate," Nature, 322;644-646 (1988).
- Yoakim, "Interactions of Polyomavirus Middle T with the SH2 Domains of the pp85 Subunit of Phosphatidylinositol-3-Kinase," J. Virol., 66(9):5485-5491 (1992).
- Yonezawa et al., "Insulin-dependent Formation of a Complex Containing an 85-kDa Subunit of PHosphatidylinositol 3-kinase and Tyrosine-phosphorylated Insulin Receptor Substrate 1," J. Biol. Chem., 267(36):25958-25966 (1992).
- Databases EST-STS and n-geneseq, Apr. 1997, relevant hits.
- Molz, L. et al., "Cpk is a Novel Class of Drosophila PtdIns 3-Kinase Containing a C2 Domain," J. Biol. Chem. 271(23):13892-13899 (1996).
- Virbasius, J.V. et al., "Mouse p170 is a Novel Phosphatidylinositol 3-Kinase Containing a C2 Domain," J. Biol. Chem. 271(23):13304-13307 (1996).
- Zvelebil, M.J. et al., "Structural and Functional Diversity of Phosphoinositide 3-kinases," Phil. Trans. R. Soc. Lond. B., 351:217-223 (1996).
- Vanhaesebroeck, B. et al., "The Study of Phosphoinositide 3-kinase Function," Cancer Surveys, 27:249-270 (1996).
- Volinia, S. et al., "A Human Phosphatidylinositol 3-kinase Complex Related to the Yeast Vps34p-Vps15p Protein Sorting," The EMBO Journal, 14:3339-3348 (1995).
- Stoyanov, B. et al., "Cloning and Characterization of a G Protein-Activated Human Phosphoinositide-3 Kinase," Science, 269:690-693 (Aug. 4, 1995).
- 36th Annual Drosophila Research Conference, Atlanta, Georgia, Apr. 5-9, 1995, Abstract, Molz, L. & Williams, L.T., "Identification of a PI3 Kinase Homologue in Drosophila melanogastor," p. 60.
- Abstracts of Papers Presented at the 1995 Meeting on Tyrosine Phosphorylation & Cell Sorting, May 3-7, 1995, Cold Spring Harbor, New York, Abstract, MacDougall, L.K. & Waterfield, M.D., "Characterisation of a Novel Phosphatidylinositol 3-kinase in Drosophila," p. 113.
- Abstracts of Papers Presented at the 1995 Meeting on Tyrosine Phosphorylation & Cell Sorting, May 3-7, 1995, Cold Spring Harbor, New York, Abstract, Molz, L. and Williams, L.T., "Identification of a PI3 Kinase Homologue in Drosophila melanogastor," p. 123.
- Stephens et al (1994) Curr Biol 4:203-214 "Characterization of a Phosphatidylinositol-Specific Phosphoinositide 3-Kinase From Mammalian Cells".