US 5,460,951 AGrant
Bone-Related Carboxypeptidase-Like Protein and Process for Its Production
Issue Date:1995-10-24
•5 Claims
•3 Drawing Sheets
Abstract
A bone-related carboxypeptidase-like protein named OSF-5 which is obtained from bone tissue of a mammal including mouse or human, and a process for its production. This protein is a novel naturally occurring mammal protein which belongs to a group of carboxypeptidase molecules. OSF-5 acts as an adhesion molecule or a growth factor which takes part in the process of osteogenesis at the site of bone induction. OSF-5 can be used as an agent for treating bone metabolic diseases, and its high organ specificity for bones enables its use as a diagnostic reagent for bone metabolic diseases.
Metadata
Assignee
- Hoechst Japan Limited
Inventors
- Shinji Kawai
- Sunao Takeshita
- Makoto Okazaki
- Egon Amann
Application Information
Application Number:US 1119397
Filing Date:1993-08-26
Priority Date:1992-08-28
Art Unit:184
Classifications
IPC:
C12P 2100C12P 2102C12N 1512
Field of Search:
43553669.1;172.3;21223.1;23.2;23.5
Patent Drawings (3 sheets)
Description
This invention provides a novel bone-related protein. Named OSF-5, this protein belongs to a group of carboxypeptidase molecules. The OSF-5 can be obtained from bone tissue of a mammal including mouse or human. The present invention also provides a process for producing the OSF-5 by recombinant DNA technology using cultured cells such as animal cells.
Bone metabolic diseases include osteoporosis, Paget's disease, osteomalacia, hyperostosis, and osteopetrosis. Osteoporosis, in particular, has a high incidence enough to affect about more than a half of postmenopausal women and elderly people, and effective methods for its diagnosis and treatment have been strongly desired.
Bone metabolic diseases involve some disorder of bone metabolism at the cellular level in bone tissue. The discovery, isolation and identification of factors associated specifically with bone metabolism are very effective for elucidating this disorder.
A cell line of osteoblasts, which play a major role in osteogenesis, was used in the present invention to identify a proteinaceous factor produced specifically by this cell line. Therefore, the present invention refers to a novel protein named OSF-5 which is substantially bone-specific, and which has a high homology with various known carboxypeptidases in terms of amino acid sequence.
OSF-5 can also be produced from the DNA sequence described in the present specification by an ordinary genetic engineering technique known in the art. Furthermore, the OSF-5 or its fragment can be produced from the amino acid sequence described in the specification by a chemical peptide synthesis method.
Moreover, that fragment of the DNA sequence of the OSF-5 described in the present invention which has a high specificity particularly for other carboxypeptidase can be synthesized with a length of 15 to 50 bases by an ordinary chemical oligonucleotide synthesis method. That fragmentary sequence can be used as a DNA probe for finding and identifying bone-derived cells. This identification of bone-derived cells is useful particularly for grasping the origin of metastatic or recurrent carcinoma, thus leading to an appropriate therapy for recurrent cancer. Of the partial peptides of the OSF-5, the peptide in the epitope portion that can be recognized by antibodies is usable for preparing a monoclonal antibody specific for OSF-5. The resulting monoclonal antibody is of marked value for identifying bone-derived cells by an immunological cell tissue staining method.
The following is known about the proteins in a group of carboxypeptidases where the OSF-5 belongs.
Remarkable progress in the study of physiologically active peptides has made the importance of carboxypeptidases clearer. Carboxypeptidases are roughly classified, according to their active center, into metallo carboxypeptidases (E.C.3.4.17), serine carboxypeptidases (E.C.3.4.16), and cysteine carboxypeptidases (E.C.3.4.18). These carboxypeptidases release amino acids specific for them from the C-terminus of a peptide or protein. The metallo carboxypeptidases include basic carboxypeptidases closely related to peptide hormones. Typical of them are carboxypeptidases B, N, H (E) and M. Carboxypeptidase B was discovered as an enzyme to release arginine from protamine. It is widely present as a precursor in the mammalian pancreas, is activated in the digestive tract by the action of trypsin, and plays a role in digestion in cooperation with other digestive enzymes. Carboxypeptidase N (kininase I) is detected in the plasma of animals, and deactivates bradykinin and anaphylatoxin, thus taking part in the homeostasis of kinins. Carboxypeptidase H (enkephalin convertase) was identified as a carboxypeptidase B-like enzyme responsible for the biosynthesis of enkephalins. This enzyme is involved in the processing of peptide hormone precursors, and is localized in secretory granules. Carboxypeptidase M is a cell membrane-bound enzyme capable of controlling the receptor specificity of peptide hormones on the cell surface. Thus, the functions of carboxypeptidases are classified into at least three, (1) to generate active peptides from inactive peptide precursors, (2) to deactivate active peptides, and (3) to change the receptor specificity of peptides (Skidgel, (1988), Trends Pharmacol. Sci. vol. 9, pp. 299-304).
Growth factors and local factors, such as parathyroid hormone, interleukin-1, calcitonin, transforming growth factor-.beta. (TGF-.beta.), bone morphogenetic protein (BMP), insulin-like growth factor (IGF) or fibroblast growth factor (FGF), take part in the process of bone remodeling. Normal bone remodeling is maintained when the biological activity of these factors is strictly controlled. Much is unknown about the mechanisms of this control, but one of the possible mechanisms is by local proteases. Many proteases are present in vivo, of which carboxypeptidases can be noticed for such a mechanism. Namely, carboxypeptidases localized in bone tissue may control the biological activity of the peptide factors involved in bone metabolism. Recently, enkephalinase, a neutral metalloendopeptidase, has been shown to inhibit bone resorption in vitro (Ibbotson et al. (1992), J. Bone Miner. Res., vol. 7, pp. 273-279). Thus, light is gradually being shed on the protease-catalyzed control of bone metabolism.
During bone remodeling, the osteoid is digested by collagenase and plasminogen activator (an enzyme activating collagenase) which may be synthesized mainly in osteoblasts. As a result, the underlying calcified matrix is exposed, and osteoclasts are directed there for resorption of the bone matrix. There is a possibility that carboxypeptidases may be included in the group of proteases synthesized by osteoblasts during the bone remodeling process. The carboxypeptidases may further decompose the degradation products formed by the action of the collagenase and plasminogen activator of osteoblasts. They may also play the role of a scavenger after osteoclasia, i.e. the role of further degrading digested pieces formed by acids or proteases secreted by osteoclasts, thereby creating an environment in which osteoblasts act efficiently at the site of the calcified matrix having undergone osteoclasia. Furthermore, when osteoclasts absorb the calcified matrix, growth factors such as TGF-.beta. are secreted normally in the inactive form. These growth factors may be activated by carboxypeptidases. By removing the C-terminal amino acid residue, carboxypeptidases are assumed to supply materials, such as amino acids, necessary for bone formation (protein synthesis) by osteoblasts. However, osteoblast-specific carboxypeptidases have not been known.
Thus, the object of the present invention is to find new carboxypeptidases which are expressed specifically in bone cells, especially osteoblasts. Such bone-derived carboxypeptidases can be generally used for the C-terminal analysis of proteins. Furthermore, because of their bone origin, they control the activity of peptide hormones that act on bone tissue. Besides, they promote the digestion of osteoid tissue as well as the supply of amino acids, and function as a scavenger. Through these actions, they can be expected to treat various bone metabolic diseases.
cDNA of mouse OSF-5 was isolated from the mouse osteoblastic cell line MC3T3-E 1 cDNA library constructed by a combination of PCR (polymerase chain reaction) and the subtraction method, and cloned by the differential screening technique. The resulting clone was named OSF-5, and its DNA sequence determined. Search through the currently available DNA and amino acid sequence data bases showed the DNA sequence of the OSF-5 to be novel.
OSF-5 has a typical signal sequence (25 amino acid residues) generally known to be present in a secretory protein, but contains no typical transmembrane region. OSF-5 has lysine- and proline-rich four-fold repeating units each composed of the 11 amino acid residues,
Lys-Pro-Lys-Glu-Lys-Pro-Pro-Lys-Ala-Thr-Lys (SEQ. ID No.: 7), at the 116th to 159th positions from the N-terminus. These 11 amino acid residues show weak homology with prolactin receptor, fibroblast growth factor receptor, gamma aminobutyric acid receptor, serotonin receptor, histone H1, and so on. At the 423rd to 531st positions, there is a domain homologous with the phospholipid binding region of blood coagulation factor VIII. The phospholipid binding region of blood coagulation factor VIII may bind to phospholipids on the cell membrane surface. Thus, said domain directs the OSF-5 itself to the cell membrane surface of particular cells (osteoblasts, chondrocytes, etc.) where the OSF-5 is to function. This action can be used for targeting the OSF-5 at bone tissue as in a drug delivery system. At the 544th to 1027th positions, there is a carboxypeptidase H-homologous domain, which contains almost all regions of carboxypeptidase H. This carboxypeptidase-like domain acts as a controlling element for peptide hormones and cytokines during the process of bone metabolism.
Peptides were synthesized which corresponded to 11 amino acid residues (KPKEKPPKATK) (SEQ ID NO.: 7) at the 116th to 126th positions, and 15 amino acid residues each at the 482nd to 496th positions (GYEEMTFYGNVDKDT) (SEQ. ID. NO.: 8), at the 557th to 571st positions (SYKDMRQLMKAVDEE) (SEQ ID NO.: 9), at the 701st to 715th positions (WAAEEKKWVPYRVPN) (SEQ ID NO.: 10), and at the 872nd to 886th positions (PHESELPREWENNKE) (SEQ ID NO.: 11), each derived from the hydrophilic regions of OSF-5. Each peptide was conjugated with ovalbumin, and used for immunization of rabbits. Anti-OSF-5 peptide antisera obtained were used for immunohistochemical detection of OSF-5 in systemic slices of the mouse neonate. OSF-5 was detected in the osteoblasts and chondrocytes.
Generally, the OSF-5 can be directly extracted from bone tissue or cartilage tissue of a human, bovine, murine or other source by a known biochemical technique.
Moreover, the mouse OSF-5 of the present invention can be used to isolate and identify other mammalian OSF-5 proteins similar in DNA sequence and amino acid sequence. That is, the DNA coding for the OSF-5 can be obtained by constructing a cDNA library or a genomic library from mRNA extracted from vertebrate bone tissue, and using a probe comprising a labeled fragment of the mouse DNA sequence disclosed in the present specification. A full length cDNA clone can be obtained by combining the above-described and other standard techniques on molecular biology.
The present invention further provides polypeptides comprising analogues of OSF-5, i.e. mutants and fused proteins having OSF-5 activity, as well as fragments containing at least 11, preferably 15, particularly the main part of the OSF-5 namely the Factor VIII-like domain and/or the carboxypeptidase-like domain. This invention also provides a process for producing the OSF-5 by recombinant DNA technology.
BRIEF EXPLANATION OF FIGURES AND TABLES
FIG. 1 is a schematic drawing of the structure of mouse OSF-5 precursor protein. OSF-5 is divided into four regions consisting of a signal sequence, four-fold repeating sequence composed of 11 amino acids, blood coagulation factor VIII-like region which may bind to phospholipid on the cell membrane surface, and carboxypeptidase-like region.
FIG. 2 shows a restriction enzyme map of cDNA coding for mouse OSF-5. The bold letters indicate the region coding for the amino acid of OSF-5. There are no Kpnl, HindIll, Sall and Xbal sites.
FIG. 3 shows the tissue-specific expression of mouse OSF-5. This was analyzed by purifying RNA from various tissue and cultured cells followed by RNA dot blotting. This diagram shows the results of autoradiography.
Table 1 shows an alignment of the amino acid sequences of mouse OSF-5 and other carboxypeptidase molecules, Common amino acid residues are shown in the form of a consensus.
Table 2 shows a continuation of the alignment of the amino acid sequences of mouse OSF-5 and other carboxypeptidase molecules shown in Table 1. Common amino acid residues are shown in the form of a consensus.
Table 3 shows a continuation of the alignment of the amino acid sequences of mouse OSF-5 and other carboxypeptidase molecules shown in Table 2. Common amino acid residues are shown in the form of a consensus.
Table 4 shows an alignment of the amino acid sequences of mouse OSF-5 and the phospholipid binding region of other blood coagulation factors. Common amino acid residues are shown in the form of a consensus.
This application claims priority from Japanese Application No. 230029/92 and Japanese Application No. 324033/92, the contents of which are incorporated herein by reference.
EXAMPLES
The present invention will be described in more detail by reference to the following Examples:
Example 1
Construction of cDNA library by subtraction and PCR
The construction of a cDNA library specific for the osteoblastic cell line MC3T3-E1 will be hereinafter described, This cDNA library is constructed by a combination of the subtraction method and the PCR with the gene expressed in mouse liver tissue being subtracted. Each cDNA clone has gene fragments with an average length of about 300 bases, and is characterized in that the gene with a low content has been amplified.
Unless otherwise specified, all general recombinant DNA protocols complied with Sambrook et al., "Molecular Cloning Manual" (1989), Cold Spring Harbor Laboratory, Cold Spring Harbor, U.S.A. Total RNAs were extracted from 8.times.10.sup.7 MC3T3-E 1 cells and about 1 g of mouse liver tissue by the guanidine method. Poly A.sup.+ RNAs were purified from the total RNAs by means of the commercially available product "Oligo dT Latex mRNA Purification Kit" (Takara Shuzo). cDNAs were synthesized by a cDNA synthesis kit (Amersham) using 1 .mu.g of each poly A.sup.+ RNA as a template. However, a random primer was used, instead of an oligo dT primer, in an amount of 1.5 times its ordinary amount used, whereby the cDNA chain elongation was restricted to an average length of about 300 bases. After the cDNAs were made double-stranded blunt-ended by use of the above kit, they were joined with T4 DNA ligase (Takara Shuzo) to the below-described two DNA linkers, i.e. ATOS-1/2 (SEQ. ID NO. 3 and SEQ. ID NO.: 4) for the MC3T3-E1 cDNA, and ATOS-4/5 (SEQ. ID NO.: 5 and SEQ. ID NO.: 6 of the Sequence Table) for the liver cDNA. ##STR1## Then, each reaction product was subjected to DNA amplification by the PCR (polymerase chain reaction) method using ATOS-1 and ATOS-4, respectively, as primers. The amplified DNA concentration was determined with the DNA assay kit "DNA Dipstick" (Invitrogen). The subtraction method was performed using photobiotin (Pirce). Photobiotin (20 ng) was added to 20 .mu.g of the PCR-amplified liver cDNA, and light from a sunlamp 10 cm apart was projected onto the liver cDNA for 10 minutes to label it with biotin. To 3.0 .mu.g of the labeled liver cDNA was added 0.3 .mu.g of unlabeled MC3T3E1 cDNA for hybridization. Then, streptavidin (Takara Shuzo) was reacted, and the reaction mixture was extracted with phenol to remove cDNA common to the liver cDNA from the MC3T3-E1 cDNA. The subtraction method was repeated to remove as much of the common cDNA as possible from the MC3T3-E 1 cDNA. DNA was amplified by PCR using the aforementioned ATOS-1, and the DNA concentration was measured. This cDNA (10 ng) was digested with the restriction enzyme EcoRI, and then ligated with T4 ligase to 1 .mu.g of the phage vector lambda gt10 (lambda gt10/EcoRI cloning kit, Stratagene) which was digested with EcoRI and dephosphorylated at its ends. The resulting recombinant DNA was packaged into lambda phage particles by use of the in vitro packaging kit "Gigapack-gold" (Stratagene). The recombinant phages were infected into E. coil C600 (preserved as HT003 at Japanese Cancer Research Resources Bank, National Institute of Health of Japan), and the organisms were applied to an agar medium along with a soft agar medium to form phage plaques. The efficiency of infection was determined to be 3.times.10.sup.6 phage plaques/.mu.g vector DNA.
The resulting cDNA library was subjected to differential screening to select clones with a high specificity for MC3T3-E1. Specifically, 2.25.times.10.sup.4 phages were applied to total 10 plates, and the resulting plaques on each plate were transferred to two nylon membrane filters (total 20 filters). These series of plaques were subjected to plaque hybridization using as the probe radiolabeled MC3T3-E1 cDNA for one of the series, and radiolabeled liver cDNA for the other series. In 273 clones, expression was observed with the MC3T3-E1 cDNA probe, but not with the liver cDNA probe. These clones were used as a minilibrary in subsequent experiments.
EXAMPLE 2
Isolation of mouse OSF-5 clone
A description will be made of methods to identify a cDNA fragment of OSF-5 as an MC3T3-E 1 specific clone from the mini-library constructed in Example 1, and to clone full length cDNA from the cDNA library of MC3T3-E1 with the use of this fragment.
The total RNAs from MC3T3-E1 and liver prepared in Example 1 were spotted in an amount of 1 .mu.g each onto nylon membrane filters. 273 of the filters were prepared, and used for hybridization to be described later on. Separately, the DNA of the inserts of the 273 phage clones prepared in Example 1 was amplified by PCR. This DNA was agarose gel electrophoresed, and main bands were lo cut out, purified, and radiolabeled for use as a probe. A clone showing expression with MC3T3-E1 cDNA but no expression with liver cDNA upon autoradiography was recloned into a plasmid vector. Specifically, the DNA of the inserts amplified by PCR and then purified was digested with the restriction enzyme EcoRI, and recloned into the EcoRI site of the plasmid vector pUC118 (Takara Shuzo). The DNA sequence of the resulting clone was determined with commercially available "DNA Sequence Kit" (Takara Shuzo) using a universal primer. Search through DNA and protein data bases showed that DNA sequence to constitute a novel clone dissimilar to the existing DNAs or proteins. This clone was designated as pMCLS68, and used for subsequent cloning of the full length cDNA.
For cloning of the full length cDNA, blund-ended double-stranded cDNA was synthesized with the cDNA synthesis kit "cDNA Synthesis System Plus" (Amersham) using 5 .mu.g of the poly A+RNA of MC3T3-E1 purified in Example 1. The resulting cDNA was ligated to EcoRI/Notl adaptor (Takara Shuzo) using T4 ligase, and the product was agarose gel electrophoresed to purify a fragment more than about 700 base pair long. This fragment was joined to the EcoRI site of lambda gt10 phage vector (Stratagene), and packaged into phage particles in the same way as in Example 1. The packages were infected into E. coil as in Example 1, and the efficiency of infection was determined to be 1.5.times.10.sup.7 phage plaques/.mu.g vector DNA. The aforementioned pMCLS68 was radioactively labeled for use as a probe, and 1.0.times.10.sup.6 phage clones of the cDNA library were screened by plaque hybridization. Five positive hybridization signals were obtained, whereafter the EcoRI fragment of the phage clone with the longest insert was recloned into the EcoRI site of the plasmid vector pUC118 (Takara Shuzo). The resulting clone was designated as pKOT20.
Example 3
DNA sequence of mouse OSF-5
Deletion mutants of the pKOT20 and a subclone containing its cDNA fragment were prepared with "the Deletion Kit for Kilo Sequence" (Takara Shuzo) by cutting at intervals of 300 base pairs in each opposite direction. The DNA sequence of each deletion mutant was determined with the automatic DNA sequencer 373A (Applied Biosystems, U.S.A.). The entire DNA sequence of the cDNA, and an amino acid sequence translated from this DNA sequence are shown as SEQ. ID NO.: 2 of the Sequence Table. No. 1 of the amino acid residue corresponds to the N-terminus of the predicted OSF-5 precursor protein. The protein encoded by this cDNA was designated as OSF-5. The structure of the resulting mouse OSF-5 protein is schematically shown in FIG. 1, and the restriction enzyme map of the cDNA coding for mouse OSF-5 is shown in FIG. 2. Search through DNA and protein data bases showed that the resulting DNA sequence contained the phospholipid binding domain of blood coagulation factor VIII, as well as domains homologous with all domains of carboxypeptidase H. Alignments of amino acids between mouse OSF-5 and other carboxypeptidase molecules are shown in Tables 1 to 3, and an alignment of amino acids between mouse OSF-5 and the phospholipid binding domains of other blood coagulation factors are shown in Table 4.
Example 4
Tissue specific expression of mouse OSF-5
RNA dot blotting was performed to investigate the tissue specific expression of mouse OSF-5. The total RNAs of the thymus, spleen, brain, kidney, liver, lung, testis and heart of mice (purchased from Nippon Clea) were prepared by the guanidine method. Calvarial osteoblast-rich cells were obtained from a culture of newborn mice calvaria. Total RNA was extracted from these cells in the same way as described above. One .mu.g of the total RNA each from the above-mentioned tissues, calvarial cultured cells, MC3T3-E1 and mouse fibroblast cell line NIH3T3 (ATCC CRL 1658) were dotted onto nylon membrane filters (Biodyne, PALL), fixed by heating, and used for hybridization. Separately, the pKOT20 was digested with Sphl, and isolated by agarose gel electrophoresis for purification. Then, the isolate was radioactively labeled and used as a probe. Autoradiography indicated high expression for the calvarial cultured cells and MC3T3-E 1 (FIG. 3).
Example 5
Preparation of anti-OSF-5 antisera
In preparing anti-peptide antibodies against mouse OSF-5, total five peptides, i.e. 11 amino acid residues at the 116th to 126th positions from the N-terminus of the repeating domain, 15 amino acid residues at the 482nd to 496th positions of the blood coagulation factor VIII-like domain, and 15 amino acid residues each at the 557th to 571st, the 701st to 715th, and the 872nd to 886th positions of the carboxypeptidase-like domain, were synthesized by the solid phase synthesis method using a peptide synthesizer (430A, Applied Biosystems). The synthetic peptides were, respectively, OSF-5.1 (KPKEKPPKATK, SEQ. ID No. 6), OSF-5.2 (GYEEMTFYGNVDKDT, SEQ. ID NO.: 7), OSF-5.3 (SYKDMRQLMKAVDEE, SEQ. ID NO.: 8), OSF-5.4 (WAAEEKKWVPYRVPN, SEQ. ID NO.: 9), and OSF-5.5 (PHESELPREWENNKE, SEQ. ID NO:. 10). These synthetic peptides were each joined to ovalbumin using glutaraldehyde as a coupling agent, and used for immunization of rabbits. The resulting antisera could be used to search immunohistochemically nohistochemically for the presence of OSF-5 in newborn mouse systemic slices, and to detect the expression of OSF-5 in E. coil, yeast and animal cells.
Example 6
Expression of OSF-5 in animal cells
Notl fragment containing the cDNA domain of mouse OSF-5 was cloned using pRc/CMV, a vector for expression in animal cells. The resulting plasmid DNA was introduced into Chinese hamster ovarian cells (CHO) by the calcium-phosphate coprecipitation method. The resulting G418-resistant colonies were isolated and proliferated so that each clone was analyzed for OSF-5 expression by Northern blotting analysis. The cloned cells with the highest expression of OSF-5 were analyzed by Western blot analysis, whereby a band with about 80 kilodaltons was detected.
OSF-5 provided by the present invention can be used as an agent for treating bone metabolic diseases, and because of its high organ specificity for bones, it can also be used as a diagnostic reagent for bone metabolic diseases.
Claims
What is claimed is:
1. DNA coding for a protein comprising OSF-5 having an amino acid sequence at the 26th to 1128th positions in Sequence ID No. 1 of the Sequence Listing.
2. DNA coding for a protein comprising an OSF-5 precursor protein having an amino acid sequence at the 1st to 1128th positions, including a signal peptide at the 1st to 25th positions, in Sequence ID No. 1 of the Sequence Listing.
3. A process for the production of a recombinant mammalian OSF-5 protein, wherein said recombinant mammalian OSF-5 protein comprises an amino acid sequence at the 26th to 1128th positions in Sequence ID No. 1 of the Sequence Listing, comprising the steps of: (a) obtaining a population of cells containing a DNA composed of the following DNA sequences: (i) a sequence that can function in the cells to control transcription and translation, and (ii) a DNA sequence joined downstream of said controlling sequence to code for said recombinant protein, and (b) culturing said population of cells under conditions permit the production of said recombinant protein.
4. The process of claim 3 wherein the controlling sequence further contains a DNA coding for signal peptide for secreting said recombinant protein extracellularly such that said DNA is positioned immediately upstream of said DNA sequence coding for said recombinant protein.
5. The process of claim 3 wherein the population of cells is Escherichia coli, or yeast, or mammalian cells. SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 27 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3728 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (B) STRAIN: osteoblastic cell line MC3T3E1 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 69..3452 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GAATTCGCGGCCGCCTGCCACCCAAGTCCCTGCTCAAGCCCGCCCGGCTCCCGCGCGTGC60 CCAGAGCCATGGCT CCAGTGCGCACCGCATCCCTGCTCTGCGGCCTCCTG110 MetAlaProValArgThrAlaSerLeuLeuCysGlyLeuLeu 1510 GCACTGCTGACGCTGTG CCCTGAGGGGAACCCACAGACGGTGCTGACG158 AlaLeuLeuThrLeuCysProGluGlyAsnProGlnThrValLeuThr 15202530 GACGACGAGAT CGAGGAGTTCCTCGAAGGCTTCCTTTCGGAGTTGGAG206 AspAspGluIleGluGluPheLeuGluGlyPheLeuSerGluLeuGlu 354045 ACCCAGTC CCCGCCCCGGGAAGACGACGTGGAAGTCCAGCCGCTTCCC254 ThrGlnSerProProArgGluAspAspValGluValGlnProLeuPro 505560 GAACCCAC CCAGCGTCCCCGCAAATCCAAGGCAGGGGGCAAGCAGCGG302 GluProThrGlnArgProArgLysSerLysAlaGlyGlyLysGlnArg 657075 GCAGATGTAGA AGTCCCTCCAGAAAAAAACAAAGACAAAGAGAAGAAA350 AlaAspValGluValProProGluLysAsnLysAspLysGluLysLys 808590 GGAAAGAAGGACAAAGG CCCCAAAGCCACAAAACCCCTGGAGGGCTCT398 GlyLysLysAspLysGlyProLysAlaThrLysProLeuGluGlySer 95100105110 ACCAGGCCCAC CAAGAAACCAAAGGAGAAGCCACCCAAGGCCACCAAG446 ThrArgProThrLysLysProLysGluLysProProLysAlaThrLys 115120125 AAGCCCAA GGAGAAACCACCCAAGGCCACCAAGAAGCCCAAGGAGAAG494 LysProLysGluLysProProLysAlaThrLysLysProLysGluLys 130135140 CCACCCAA GGCCACCAAGAAGCCTAAGGAGAAGCCACCCAAGGCCACT542 ProProLysAlaThrLysLysProLysGluLysProProLysAlaThr 145150155 AAGAGGCCCTC GGCAGGAAAGAAGTTCTCAACTGTGGCCCCCTTGGAA590 LysArgProSerAlaGlyLysLysPheSerThrValAlaProLeuGlu 160165170 ACGCTGGATCGGTTACT CCCCTCACCCTCCAACCCCAGCGCCCAGGAG638 ThrLeuAspArgLeuLeuProSerProSerAsnProSerAlaGlnGlu 175180185190 CTACCGCAGAA GAGAGACACACCCTTCCCAAATGCCTGGCAAGGTCAA686 LeuProGlnLysArgAspThrProPheProAsnAlaTrpGlnGlyGln 195200205 GGAGAAGA GACCCAGGTGGAGGCCAAGCAGCCCCGGCCAGAGCCAGAG734 GlyGluGluThrGlnValGluAlaLysGlnProArgProGluProGlu 210215220 GAGGAGAC TGAGATGCCCACACTGGACTACAATGACCAGATAGAGAAG782 GluGluThrGluMetProThrLeuAspTyrAsnAspGlnIleGluLys 225230235 GAGGATTACGA GGATTTTAAGTACATCCTTTGCCAGAAGCAGCCCAGG830 GluAspTyrGluAspPheLysTyrIleLeuCysGlnLysGlnProArg 240245250 CCAACACCCAGCAGGAG GAGGCTCTGGCCAGAGCGCCCTGAGGAGAAG878 ProThrProSerArgArgArgLeuTrpProGluArgProGluGluLys 255260265270 ACTGAAGAGCC AGAGGAAAGGAAGGAAGTCGAGCCACCTCTGAAGCCC926 ThrGluGluProGluGluArgLysGluValGluProProLeuLysPro 275280285 CTGCTGCC TCCGGACTATGGGGATAGCTACGTGATCCCCAACTATGAT974 LeuLeuProProAspTyrGlyAspSerTyrValIleProAsnTyrAsp 290295300 GACTTGGA CTATTATTTCCCCCACCCTCCACCGCAGAAGCCTGATGTT1022 AspLeuAspTyrTyrPheProHisProProProGlnLysProAspVal 305310315 GGACAAGAGGT GGATGAGGAAAAGGAAGAGATGAAGAAGCCCAAAAAG1070 GlyGlnGluValAspGluGluLysGluGluMetLysLysProLysLys 320325330 GAGGGTAGTAGCCCCAA GGAGGACACAGAGGACAAGTGGACCGTGGAG1118 GluGlySerSerProLysGluAspThrGluAspLysTrpThrValGlu 335340345350 AAAAACAAGGA CCACAAAGGGCCCCGGAAGGGTGAGGAGCTGGAGGAG1166 LysAsnLysAspHisLysGlyProArgLysGlyGluGluLeuGluGlu 355360365 GAGTGGGC GCCAGTGGAGAAAATCAAGTGCCCACCTATTGGGATGGAG1214 GluTrpAlaProValGluLysIleLysCysProProIleGlyMetGlu 370375380 TCACACCG CATTGAGGACAACCAGATCCGTGCCTCCTCCATGCTGCGC1262 SerHisArgIleGluAspAsnGlnIleArgAlaSerSerMetLeuArg 385390395 CACGGCCTCGG AGCCCAGCGGGGCCGGCTCAACATGCAGGCTGGTGCC1310 HisGlyLeuGlyAlaGlnArgGlyArgLeuAsnMetGlnAlaGlyAla 400405410 AATGAAGATGACTACTA TGACGGGGCATGGTGTGCTGAGGACGAGTCG1358 AsnGluAspAspTyrTyrAspGlyAlaTrpCysAlaGluAspGluSer 415420425430 CAGACCCAGTG GATCGAGGTGGACACCCGAAGGACAACTCGGTTCACG1406 GlnThrGlnTrpIleGluValAspThrArgArgThrThrArgPheThr 435440445 GGCGTCAT CACTCAGGGCCGTGACTCCAGCATCCATGACGACTTCGTG1454 GlyValIleThrGlnGlyArgAspSerSerIleHisAspAspPheVal 450455460 ACTACCTT CTTTGTGGGCTTCAGCAATGACAGCCAGACCTGGGTGATG1502 ThrThrPhePheValGlyPheSerAsnAspSerGlnThrTrpValMet 465470475 TACACCAATGG CTACGAGGAAATGACCTTCTATGGAAATGTGGACAAG1550 TyrThrAsnGlyTyrGluGluMetThrPheTyrGlyAsnValAspLys 480485490 GACACACCTGTGCTGAG CGAGCTCCCTGAGCCAGTTGTGGCCCGTTTC1598 AspThrProValLeuSerGluLeuProGluProValValAlaArgPhe 495500505510 ATCCGCATCTA TCCACTCACCTGGAACGGTAGCCTGTGCATGCGCCTG1646 IleArgIleTyrProLeuThrTrpAsnGlySerLeuCysMetArgLeu 515520525 GAGGTGCT AGGCTGCCCCGTGACCCCTGTCTACAGCTACTACGCACAG1694 GluValLeuGlyCysProValThrProValTyrSerTyrTyrAlaGln 530535540 AATGAGGT GGTAACTACTGACAGCCTGGACTTCCGGCACCACAGCTAC1742 AsnGluValValThrThrAspSerLeuAspPheArgHisHisSerTyr 545550555 AAGGACATGCG CCAGCTGATGAAGGCTGTCAATGAGGAGTGCCCCACA1790 LysAspMetArgGlnLeuMetLysAlaValAsnGluGluCysProThr 560565570 ATCACTCGCACATACAG CCTGGGCAAGAGTTCACGAGGGCTCAAGATC1838 IleThrArgThrTyrSerLeuGlyLysSerSerArgGlyLeuLysIle 575580585590 TACGCAATGGA AATCTCAGACAACCCTGGGGATCATGAACTGGGGGAG1886 TyrAlaMetGluIleSerAspAsnProGlyAspHisGluLeuGlyGlu 595600605 CCCGAGTT CCGCTACACAGCCGGGATCCACGGCAATGAGGTGCTAGGC1934 ProGluPheArgTyrThrAlaGlyIleHisGlyAsnGluValLeuGly 610615620 CGAGAGCT CCTGCTCCTGCTCATGCAATACCTATGCCAGGAGTACCGC1982 ArgGluLeuLeuLeuLeuLeuMetGlnTyrLeuCysGlnGluTyrArg 625630635 GATGGGAACCC GAGAGTGCGCAACCTGGTGCAGGACACACGCATCCAC2030 AspGlyAsnProArgValArgAsnLeuValGlnAspThrArgIleHis 640645650 CTGGTGCCCTCGCTGAA CCCTGATGGCTATGAGGTGGCAGCGCAGATG2078 LeuValProSerLeuAsnProAspGlyTyrGluValAlaAlaGlnMet 655660665670 GGCTCAGAGTT TGGGAACTGGGCACTGGGGCTGTGGACTGAGGAGGGC2126 GlySerGluPheGlyAsnTrpAlaLeuGlyLeuTrpThrGluGluGly 675680685 TTTGACAT CTTCGAGGACTTCCCAGATCTCAACTCTGTGCTCTGGGCA2174 PheAspIlePheGluAspPheProAspLeuAsnSerValLeuTrpAla 690695700 GCTGAGGA GAAGAAATGGGTCCCCTACAGGGTCCCAAACAATAACTTG2222 AlaGluGluLysLysTrpValProTyrArgValProAsnAsnAsnLeu 705710715 CCAATCCCTGA ACGTTACCTGTCCCCAGATGCCACGGTCTCCACAGAA2270 ProIleProGluArgTyrLeuSerProAspAlaThrValSerThrGlu 720725730 GTCCGGGCCATTATTTC CTGGATGGAGAAGAACCCCTTTGTGCTGGGT2318 ValArgAlaIleIleSerTrpMetGluLysAsnProPheValLeuGly 735740745750 GCAAATCTGAA CGGTGGTGAGCGGCTTGTGTCTTATCCCTATGACATG2366 AlaAsnLeuAsnGlyGlyGluArgLeuValSerTyrProTyrAspMet 755760765 GCCCGGAC ACCTAGCCAGGAGCAGCTGTTGGCCGAGGCACTGGCAGCT2414 AlaArgThrProSerGlnGluGlnLeuLeuAlaGluAlaLeuAlaAla 770775780 GCCCGCGG AGAAGATGATGACGGGGTGTCTGAGGCCCAGGAGACTCCA2462 AlaArgGlyGluAspAspAspGlyValSerGluAlaGlnGluThrPro 785790795 GATCACGCTAT TTTCCGCTGGCTGGCCATCTCATTTGCCTCCGCCCAT2510 AspHisAlaIlePheArgTrpLeuAlaIleSerPheAlaSerAlaHis 800805810 CTCACCATGACGGAGCC CTACCGGGGAGGGTGCCAGGCCCAGGACTAC2558 LeuThrMetThrGluProTyrArgGlyGlyCysGlnAlaGlnAspTyr 815820825830 ACCAGCGGCAT GGGCATTGTCAACGGGGCCAAGTGGAATCCTCGCTCT2606 ThrSerGlyMetGlyIleValAsnGlyAlaLysTrpAsnProArgSer 835840845 GGGACTTT CAATGACTTTAGCTACCTGCACACAAACTGTCTGGAGCTC2654 GlyThrPheAsnAspPheSerTyrLeuHisThrAsnCysLeuGluLeu 850855860 TCCGTATA CCTGGGCTGTGACAAGTTCCCCCACGAGAGTGAGCTACCC2702 SerValTyrLeuGlyCysAspLysPheProHisGluSerGluLeuPro 865870875 CGAGAATGGGA GAACAACAAAGAAGCGCTGCTCACCTTCATGGAGCAG2750 ArgGluTrpGluAsnAsnLysGluAlaLeuLeuThrPheMetGluGln 880885890 GTGCACCGTGGCATTAA GGGTGTGGTGACAGATGAGCAAGGCATCCCC2798 ValHisArgGlyIleLysGlyValValThrAspGluGlnGlyIlePro 895900905910 ATTGCCAATGC CACCATCTCTGTGAGTGGCATCAACCATGGTGTGAAG2846 IleAlaAsnAlaThrIleSerValSerGlyIleAsnHisGlyValLys 915920925 ACAGCAAG TGGAGGTGACTACTGGCGCATTCTGAACCCGGGTGAGTAC2894 ThrAlaSerGlyGlyAspTyrTrpArgIleLeuAsnProGlyGluTyr 930935940 CGTGTGAC AGCTCACGCAGAGGGCTACACCTCAAGTGCCAAGATCTGC2942 ArgValThrAlaHisAlaGluGlyTyrThrSerSerAlaLysIleCys 945950955 AATGTGGACTA CGATATTGGGGCCACTCAGTGCAACTTCATCCTGGCT2990 AsnValAspTyrAspIleGlyAlaThrGlnCysAsnPheIleLeuAla 960965970 CGATCCAACTGGAAGCG CATTCGGGAGATCTTGGCTATGAACGGGAAC3038 ArgSerAsnTrpLysArgIleArgGluIleLeuAlaMetAsnGlyAsn 975980985990 CGTCCCATTCT CGGAGTTGACCCCTCACGACCCATGACCCCCCAGCAG3086 ArgProIleLeuGlyValAspProSerArgProMetThrProGlnGln 99510001005 CGGCGCA TGCAGCAGCGCCGTCTACAGTACCGGCTCCGCATGAGGGAA3134 ArgArgMetGlnGlnArgArgLeuGlnTyrArgLeuArgMetArgGlu 101010151020 CAGATG CAACTGCGTCGCCTCAATTCTACCGCAGGCCCTGCCACAAGC3182 GlnMetGlnLeuArgArgLeuAsnSerThrAlaGlyProAlaThrSer 102510301035 CCCACTCCT GCCCTTATGCCTCCCCCTTCCCCTACACCAGCCATTACC3230 ProThrProAlaLeuMetProProProSerProThrProAlaIleThr 104010451050 TTGAGGCCCTGGGA AGTTCTACCCACTACCACTGCAGGCTGGGAGGAG3278 LeuArgProTrpGluValLeuProThrThrThrAlaGlyTrpGluGlu 1055106010651070 TCAGAGA CTGAGACCTATACAGAAGTAGTGACAGAGTTTGAGACAGAG3326 SerGluThrGluThrTyrThrGluValValThrGluPheGluThrGlu 107510801085 TAT GGGACTGACCTAGAGGTGGAAGAGATAGAGGAGGAGGAGGAGGAG3374 TyrGlyThrAspLeuGluValGluGluIleGluGluGluGluGluGlu 109010951100 GAG GAGGAAGAGATGGACACAGGCCTTACATTTCCACTCACAACAGTG3422 GluGluGluGluMetAspThrGlyLeuThrPheProLeuThrThrVal 110511101115 GAGAC CTACACAGTGAACTTTGGGGACTTCTGAGACTGGGATCTCAAAGC3472 GluThrTyrThrValAsnPheGlyAspPhe 11201125 CCTGCCCAATTCAAACTAAGGCAGCACCTCCCAAGCCTGTGCCAGCAGACAC ATAGCCAT3532 CAGATGTCCCTGGGGTGGACCCCACTCCCCCAGTGTGGGACATCAAAGCTACCGGGACTC3592 TGCATAGACTCTGGTCTACCCGCCCCAGCTCTTACCTGCCAGCCTTTGGGGGAGGGGCAG3652 GCAAAGGAAGCCAACGTTCAACATCAA TAAAACCAAGCTCATGACACCAAAAAAAAAAAA3712 AAGCGGCCGCGAATTC3728 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1128 amino acids (B) TYPE: amino acid (D ) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: MetAlaProValArgThrAlaSerLeuLeuCysGlyLeuLeuAlaLeu 151015 LeuThrLeuCysProGluGlyAsn ProGlnThrValLeuThrAspAsp 202530 GluIleGluGluPheLeuGluGlyPheLeuSerGluLeuGluThrGln 3540 45 SerProProArgGluAspAspValGluValGlnProLeuProGluPro 505560 ThrGlnArgProArgLysSerLysAlaGlyGlyLysGlnArgAlaAsp 65 707580 ValGluValProProGluLysAsnLysAspLysGluLysLysGlyLys 859095 LysAsp LysGlyProLysAlaThrLysProLeuGluGlySerThrArg 100105110 ProThrLysLysProLysGluLysProProLysAlaThrLysLysPro 115 120125 LysGluLysProProLysAlaThrLysLysProLysGluLysProPro 130135140 LysAlaThrLysLysProLysGluLysProPro LysAlaThrLysArg 145150155160 ProSerAlaGlyLysLysPheSerThrValAlaProLeuGluThrLeu 165170 175 AspArgLeuLeuProSerProSerAsnProSerAlaGlnGluLeuPro 180185190 GlnLysArgAspThrProPheProAsnAlaTrpGlnGlyGlnG lyGlu 195200205 GluThrGlnValGluAlaLysGlnProArgProGluProGluGluGlu 210215220 ThrGluMetProThr LeuAspTyrAsnAspGlnIleGluLysGluAsp 225230235240 TyrGluAspPheLysTyrIleLeuCysGlnLysGlnProArgProThr 245 250255 ProSerArgArgArgLeuTrpProGluArgProGluGluLysThrGlu 260265270 GluProGluGluArgLysGluVal GluProProLeuLysProLeuLeu 275280285 ProProAspTyrGlyAspSerTyrValIleProAsnTyrAspAspLeu 2902953 00 AspTyrTyrPheProHisProProProGlnLysProAspValGlyGln 305310315320 GluValAspGluGluLysGluGluMetLysLysProLysLysGluG ly 325330335 SerSerProLysGluAspThrGluAspLysTrpThrValGluLysAsn 340345350 LysAsp HisLysGlyProArgLysGlyGluGluLeuGluGluGluTrp 355360365 AlaProValGluLysIleLysCysProProIleGlyMetGluSerHis 370 375380 ArgIleGluAspAsnGlnIleArgAlaSerSerMetLeuArgHisGly 385390395400 LeuGlyAlaGlnArgGlyArgLeuAsn MetGlnAlaGlyAlaAsnGlu 405410415 AspAspTyrTyrAspGlyAlaTrpCysAlaGluAspGluSerGlnThr 420425 430 GlnTrpIleGluValAspThrArgArgThrThrArgPheThrGlyVal 435440445 IleThrGlnGlyArgAspSerSerIleHisAspAspPheValThrT hr 450455460 PhePheValGlyPheSerAsnAspSerGlnThrTrpValMetTyrThr 465470475480 AsnGlyTyr GluGluMetThrPheTyrGlyAsnValAspLysAspThr 485490495 ProValLeuSerGluLeuProGluProValValAlaArgPheIleArg 500 505510 IleTyrProLeuThrTrpAsnGlySerLeuCysMetArgLeuGluVal 515520525 LeuGlyCysProValThrProValTyr SerTyrTyrAlaGlnAsnGlu 530535540 ValValThrThrAspSerLeuAspPheArgHisHisSerTyrLysAsp 545550555 560 MetArgGlnLeuMetLysAlaValAsnGluGluCysProThrIleThr 565570575 ArgThrTyrSerLeuGlyLysSerSerArgGlyLeuLysIleT yrAla 580585590 MetGluIleSerAspAsnProGlyAspHisGluLeuGlyGluProGlu 595600605 PheArgTyr ThrAlaGlyIleHisGlyAsnGluValLeuGlyArgGlu 610615620 LeuLeuLeuLeuLeuMetGlnTyrLeuCysGlnGluTyrArgAspGly 625630 635640 AsnProArgValArgAsnLeuValGlnAspThrArgIleHisLeuVal 645650655 ProSerLeuAsnProAspGlyTyr GluValAlaAlaGlnMetGlySer 660665670 GluPheGlyAsnTrpAlaLeuGlyLeuTrpThrGluGluGlyPheAsp 675680 685 IlePheGluAspPheProAspLeuAsnSerValLeuTrpAlaAlaGlu 690695700 GluLysLysTrpValProTyrArgValProAsnAsnAsnLeuProIle 705 710715720 ProGluArgTyrLeuSerProAspAlaThrValSerThrGluValArg 725730735 AlaIle IleSerTrpMetGluLysAsnProPheValLeuGlyAlaAsn 740745750 LeuAsnGlyGlyGluArgLeuValSerTyrProTyrAspMetAlaArg 755 760765 ThrProSerGlnGluGlnLeuLeuAlaGluAlaLeuAlaAlaAlaArg 770775780 GlyGluAspAspAspGlyValSerGluAlaGln GluThrProAspHis 785790795800 AlaIlePheArgTrpLeuAlaIleSerPheAlaSerAlaHisLeuThr 805810 815 MetThrGluProTyrArgGlyGlyCysGlnAlaGlnAspTyrThrSer 820825830 GlyMetGlyIleValAsnGlyAlaLysTrpAsnProArgSerG lyThr 835840845 PheAsnAspPheSerTyrLeuHisThrAsnCysLeuGluLeuSerVal 850855860 TyrLeuGlyCysAsp LysPheProHisGluSerGluLeuProArgGlu 865870875880 TrpGluAsnAsnLysGluAlaLeuLeuThrPheMetGluGlnValHis 885 890895 ArgGlyIleLysGlyValValThrAspGluGlnGlyIleProIleAla 900905910 AsnAlaThrIleSerValSerGly IleAsnHisGlyValLysThrAla 915920925 SerGlyGlyAspTyrTrpArgIleLeuAsnProGlyGluTyrArgVal 9309359 40 ThrAlaHisAlaGluGlyTyrThrSerSerAlaLysIleCysAsnVal 945950955960 AspTyrAspIleGlyAlaThrGlnCysAsnPheIleLeuAlaArgS er 965970975 AsnTrpLysArgIleArgGluIleLeuAlaMetAsnGlyAsnArgPro 980985990 IleLeu GlyValAspProSerArgProMetThrProGlnGlnArgArg 99510001005 MetGlnGlnArgArgLeuGlnTyrArgLeuArgMetArgGluGlnMet 1010 10151020 GlnLeuArgArgLeuAsnSerThrAlaGlyProAlaThrSerProThr 1025103010351040 ProAlaLeuMetProProProSerP roThrProAlaIleThrLeuArg 104510501055 ProTrpGluValLeuProThrThrThrAlaGlyTrpGluGluSerGlu 10601065 1070 ThrGluThrTyrThrGluValValThrGluPheGluThrGluTyrGly 107510801085 ThrAspLeuGluValGluGluIleGluGluGluGluGluGlu GluGlu 109010951100 GluGluMetAspThrGlyLeuThrPheProLeuThrThrValGluThr 1105111011151120 Tyr ThrValAsnPheGlyAspPhe 1125 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: linker DNA with sequence complementary to Sequence ID No. 4, termed "ATOS-1" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CTCTTGCTTGAATTCGGACTA21 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: linker DNA with sequence complementary to Sequence ID No. 3, termed "ATOS-2" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: TAGTCCGAATTCAAGCAAGAGCACA25 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: linker DNA with sequence complementary to Sequence ID No. 6, termed "ATOS-4" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CTCTTGCTTAAGCTTGGACTA 21 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: linker DNA with sequence complementary to Sequence ID No. 5, termed "ATOS-5" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: TAGTCCAAGCTTAAGCAAGAGCACA25 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other ( A) DESCRIPTION: OSF 5.1 (antigen peptide) segment of mouse OSF-5 from the 116th to the 126th amino acid residue (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: LysProLysGluLysProProLysAlaThrLys 15 10 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: OSF 5.1 (antigen peptide) segment of mouse OSF-5 from the 482nd to the 496th amino acid residue (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GlyThrGlnGlnMetThrPheTyrGlyAsnValAspLysAspThr 151015 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: OSF 5.1 (antigen peptide) segment of mouse OSF-5 from the 557th to the 571st amino acid residue (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: SerTyrLysAsp MetArgGlnLeuMetLysAlaValAspGluGlu 151015 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: OSF 5.1 (antigen peptide) segment of mouse OSF-5 from the 701st to the 715th amino acid residue (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: TrpAlaAlaGluGluLysLysTrpValProTyrArgValProAsn 151015 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other (A) DESCRIPTION: OSF 5.1 (antigen peptide) segment of mouse OSF-5 from the 872nd to the 886th amino acid residue (vi) ORIGINAL SOURCE: (A) ORGANISM: Mus musculus (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ProHisGluSerGluLeuProArgGluTrpGluAsnAsnLysGlu 1510 15 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 484 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GluValValThrThrAspSerLeuAspPheArgHisHisSerTyr Lys 151015 AspMetArgGlnLeuMetLysAlaValAsnGluGluCysProThrIle 2025 30 ThrArgThrTyrSerLeuGlyLysSerSerArgGlyLeuLysIleTyr 354045 AlaMetGluIleSerAspAsnProGlyAspHisGluLeuGlyG luPro 505560 GluPheArgTyrThrAlaGlyIleHisGlyAsnGluValLeuGlyArg 657075 80 GluLeuLeuLeuLeuLeuMetGlnTyrLeuCysGlnGluTyrArgAsp 859095 GlyAsnProArgValArgAsnLeuValGlnAspThrArg IleHisLeu 100105110 ValProSerLeuAsnProAspGlyTyrGluValAlaAlaGlnMetGly 115120 125 SerGluPheGlyAsnTrpAlaLeuGlyLeuTrpThrGluGluGlyPhe 130135140 AspIlePheGluAspPheProAspLeuAsnSerValLeuTrpAl aAla 145150155160 GluGluLysLysTrpValProTyrArgValProAsnAsnAsnLeuPro 165170 175 IleProGluArgTyrLeuSerProAspAlaThrValSerThrGluVal 180185190 ArgAlaIleIleSerTrpMetGluLysAsnP roPheValLeuGlyAla 195200205 AsnLeuAsnGlyGlyGluArgLeuValSerTyrProTyrAspMetAla 210215 220 ArgThrProSerGlnGluGlnLeuLeuAlaGluAlaLeuAlaAlaAla 225230235240 ArgGlyGluAspAspAspGlyValSerGlu AlaGlnGluThrProAsp 245250255 HisAlaIlePheArgTrpLeuAlaIleSerPheAlaSerAlaHisLeu 260 265270 ThrMetThrGluProTyrArgGlyGlyCysGlnAlaGlnAspTyrThr 275280285 SerGlyMetGlyIleValAsnGlyAla LysTrpAsnProArgSerGly 290295300 ThrPheAsnAspPheSerTyrLeuHisThrAsnCysLeuGluLeuSer 305310 315320 ValTyrLeuGlyCysAspLysPheProHisGluSerGluLeuProArg 325330335 GluTrpGluAsnAsnLysGl uAlaLeuLeuThrPheMetGluGlnVal 340345350 HisArgGlyIleLysGlyValValThrAspGluGlnGlyIleProIle 355 360365 AlaAsnAlaThrIleSerValSerGlyIleAsnHisGlyValLysThr 370375380 AlaSerGlyGlyAspTyrTrpArgI leLeuAsnProGlyGluTyrArg 385390395400 ValThrAlaHisAlaGluGlyTyrThrSerSerAlaLysIleCysAsn 405 410415 ValAspTyrAspIleGlyAlaThrGlnCysAsnPheIleLeuAlaArg 420425430 SerAsnTrpLys ArgIleArgGluIleLeuAlaMetAsnGlyAsnArg 435440445 ProIleLeuGlyValAspProSerArgProMetThrProGlnGlnArg 450 455460 ArgMetGlnGlnArgArgLeuGlnTyrArgLeuArgMetArgGluGln 465470475480 MetGlnLeuArg (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 434 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: ArgProGlnGluAspGlyIleSerPheGluTyrHisArgTyrProGlu 1 51015 LeuArgGluAlaLeuValSerValTrpLeuGlnCysAlaAlaValSer 202530 Arg IleTyrThrValGlyArgSerPheGluGlyArgGluLeuLeuVal 354045 LeuGluLeuSerAspAsnProGlyValHisGluProGlyGluProGlu 505560 PheLysTyrIleGlyAsnMetHisGlyAsnGluAlaValGlyArgGlu 65707580 LeuL euIlePheLeuAlaGlnTyrLeuCysAsnGluTyrGlnLysGly 859095 AsnGluThrIleValGlnLeuIleHisAsnThrArgIleHisIleMet 100105110 ProSerLeuAsnProAspGlyPheGluLysAlaAlaSerGlnLeuGly 115120125 G luLeuLysAspTrpPheValGlyArgSerAsnAlaGlnGlyIleAsp 130135140 LeuAsnArgAsnPheProAspLeuAspArgIleValTyrIleAsnGlu 145 150155160 LysGluGlyGlyProAsnAsnHisLeuLeuLysAsnLeuLysLysIle 165170175 ValAspGlnAsnThrLysLeuAlaProGluThrLysAlaValIleHis 180185190 TrpIleMetAspIleProPheValLeuSerAlaAsnLeuHisG lyGly 195200205 AspLeuValAlaAsnTyrProTyrAspGluThrArgSerGlySerAla 210215220 HisGluTyrSerSerCysProAspAspAspIlePheGlnSerLeuAla 225230235240 ArgAlaTyrSerSerPheAsnProProMetSerAspProAsp ArgPro 245250255 ProCysArgLysAsnAspAspAspSerSerPheValGluGlyThrThr 260265 270 AsnGlyAlaAlaTrpTyrSerValProGlyGlyMetGlnAspPheAsn 275280285 TyrLeuSerSerAsnCysPheGluIleThrValGluLeu SerCysGlu 290295300 LysPheProProGluGluThrLeuLysAsnTyrTrpGluAspAsnLys 305310315 320 AsnSerLeuIleSerTyrIleGlnGlnIleHisArgGlyValLysGly 325330335 PheValArgAspLeuGlnGlyAsnProIleAl aAsnAlaThrLeuSer 340345350 ValGluGlyIleAspHisAspValThrSerAlaLysAspGlyAspTyr 355360 365 TrpArgLeuLeuValProGlyAsnTyrLysLeuThrAlaSerAlaPro 370375380 GlyTyrLeuAlaIleAlaLysLysValAlaValProT yrSerProAla 385390395400 ValArgValAspPheGluLeuGluSerPheSerGluArgLysGluGlu 405 410415 GluLysGluGluLeuMetGluTrpTrpLysMetMetSerGluThrLeu 420425430 AsnPhe (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 435 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: ArgLeuGlnGlnGluAspGlyIleSerPheGluTyrHisArgTyrPro 15 1015 GluLeuArgGluAlaLeuValSerValTrpLeuGlnCysThrAlaIle 202530 SerArgIleTyrThrValGly ArgSerPheGluGlyArgGluLeuLeu 354045 ValIleGluLeuSerAspAsnProGlyValHisGluProGlyGluPro 5055 60 GluPheLysTyrIleGlyAsnMetHisGlyAsnGluAlaValGlyArg 65707580 GluLeuLeuIlePheLeuAlaGl nTyrLeuCysAsnGluTyrGlnArg 859095 GlyAsnGluThrIleValAsnLeuIleHisSerThrArgIleHisIle 100 105110 MetProSerLeuAsnProAspGlyPheGluLysAlaAlaSerGlnPro 115120125 GlyGluLeuLysAspTrpPh eValGlyArgSerAsnAlaGlnGlyIle 130135140 AspLeuAsnArgAsnPheProAspLeuAspArgIleValTyrValAsn 145150 155160 GluLysGluGlyGlyProAsnAsnHisLeuLeuLysAsnLeuLysLys 165170175 IleValAspGlnA snSerLysLeuAlaProGluThrLysAlaValIle 180185190 HisTrpIleMetAspIleProPheValLeuSerAlaAsnLeuHisGly 195 200205 GlyAspLeuValAlaAsnTyrProTyrAspGluThrArgSerGlyThr 210215220 AlaHisGluTyrSerSer CysProAspAspAlaIlePheGlnSerLeu 225230235240 AlaArgAlaTyrSerSerPheAsnProValMetSerAspProAsnArg 245250255 ProProCysArgLysAsnAspAspAspSerSerPheValAspGlyThr 260265270 ThrAsn GlyGlyAlaTrpTyrSerValProGlyGlyMetGlnAspPhe 275280285 AsnTyrLeuSerSerAsnCysPheGluIleThrValGluLeuSerCys 2 90295300 GluLysPheProProGluGluThrLeuLysSerTyrTrpGluAspAsn 305310315320 LysAs nSerLeuIleAsnTyrLeuGluGlnIleHisArgGlyValLys 325330335 GlyPheValArgAspLeuGlnGlyAsnProIleAlaAsnAlaThrIle 340345350 SerValAspGlyIleAspHisAspValThrSerAlaLysAspGlyAsp 355360365 T yrTrpArgLeuLeuValProGlyAsnTyrLysLeuThrAlaSerAla 370375380 ProGlyTyrLeuAlaIleThrLysLysValAlaValProPheSerPro 385 390395400 AlaValGlyValAspPheGluLeuGluSerPheSerGluArgLysGlu 405410415 GluGluLysGluGluLeuMetGluTrpTrpLysMetMetSerGluThr 420425430 LeuAsnPhe 435 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 435 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: ArgLeuGlnGlnGluAspGlyIleSerPheGluTyrHisArgTyrPro 15 1015 GluLeuArgGluAlaLeuValSerValTrpLeuGlnCysThrAlaIle 202530 SerArgIleTyrThrValGlyAr gThrPheGluGlyArgGluLeuLeu 354045 ValIleGluLeuSerAspAsnProGlyValHisGluProGlyGluPro 5055 60 GluPheLysTyrIleGlyAsnMetHisGlyAsnGluAlaValGlyArg 65707580 GluLeuLeuIlePheLeuAlaGln TyrLeuCysAsnGluTyrGlnArg 859095 GlyAsnGluThrIleValAsnLeuIleHisSerThrArgIleHisIle 100 105110 MetProSerLeuAsnProAspGlyPheGluLysAlaAlaSerGlnPro 115120125 GlyGluLeuLysAspTrpPhe ValGlyArgSerAsnAlaGlnGlyIle 130135140 AspLeuAsnArgAsnPheProAspLeuAspArgIleValTyrValAsn 145150 155160 GluLysGluGlyGlyProAsnAsnHisLeuLeuLysAsnLeuLysLys 165170175 IleValAspGlnAsn SerLysLeuAlaProGluThrLysAlaValIle 180185190 HisTrpIleMetAspIleProPheValLeuSerAlaAsnLeuHisGly 195 200205 GlyAspLeuValAlaAsnTyrProTyrAspGluThrArgSerGlyThr 210215220 AlaHisGluTyrSerSerCy sProAspAspAlaIlePheGlnSerLeu 225230235240 AlaArgAlaTyrSerSerPheAsnProValMetSerAspProAsnArg 245250255 ProProCysArgLysAsnAspAspAspSerSerPheValAspGlyThr 260265270 ThrAsnG lyGlyAlaTrpTyrSerValProGlyGlyMetGlnAspPhe 275280285 AsnTyrLeuSerSerAsnCysPheGluIleThrValGluLeuSerCys 290 295300 GluLysPheProProGluGluThrLeuLysSerTyrTrpGluAspAsn 305310315320 LysAsn SerLeuIleAsnTyrLeuGluGlnIleHisArgGlyValLys 325330335 GlyPheValArgAspLeuGlnGlyAsnProIleAlaAsnAlaThrIle 340345350 SerValAspGlyIleAspHisAspValThrSerAlaLysAspGlyAsp 355360365 Tyr TrpArgLeuLeuValProGlyAsnTyrLysLeuThrAlaSerAla 370375380 ProGlyTyrLeuAlaIleThrLysLysValAlaValProPheSerPro 385 390395400 AlaValGlyValAspPheGluLeuGluSerPheSerGluArgLysGlu 405410415 GluGluLysGluGluLeuMetGluTrpTrpLysMetMetSerGluThr 420425430 LeuAsnPhe 435 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 435 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: ArgLeuGlnGlnGluAspGlyIleSerPheGluTyrHisArgTyrPro 15 1015 GluLeuArgGluAlaLeuValSerValTrpLeuGlnCysThrAlaIle 202530 SerArgIleTyrThrValGlyArg SerPheGluGlyArgGluLeuLeu 354045 ValIleGluLeuSerAspAsnProGlyValHisGluProGlyGluPro 5055 60 GluPheLysTyrIleGlyAsnMetHisGlyAsnGluAlaValGlyArg 65707580 GluLeuLeuIlePheLeuAlaGlnTy rLeuCysAsnGluTyrGlnLys 859095 GlyAsnGluThrIleValAsnLeuIleHisSerThrArgIleHisIle 100 105110 MetProSerLeuAsnProAspGlyPheGluLysAlaAlaSerGlnPro 115120125 GlyGluLeuLysAspTrpPheVa lGlyArgSerAsnAlaGlnGlyIle 130135140 AspLeuAsnArgAsnPheProAspLeuAspArgIleValTyrValAsn 145150 155160 GluLysGluGlyGlyProAsnAsnHisLeuLeuLysAsnMetLysLys 165170175 IleValAspGlnAsnT hrLysLeuAlaProGluThrLysAlaValIle 180185190 HisTrpIleMetAspIleProPheValLeuSerAlaAsnLeuHisGly 195 200205 GlyAspLeuValAlaAsnTyrProTyrAspGluThrArgSerGlySer 210215220 AlaHisGluTyrSerSerSer ProAspAspAlaIlePheGlnSerLeu 225230235240 AlaArgAlaTyrSerSerPheAsnProAlaMetSerAspProAsnArg 245250255 ProProCysArgLysAsnAspAspAspSerSerPheValAspGlyThr 260265270 ThrAsnGly GlyAlaTrpTyrSerValProGlyGlyMetGlnAspPhe 275280285 AsnTyrLeuSerSerAsnCysPheGluIleThrValGluLeuSerCys 290 295300 GluLysPheProProGluGluThrLeuLysThrTyrTrpGluAspAsn 305310315320 LysAsnSe rLeuIleSerTyrLeuGluGlnIleHisArgGlyValLys 325330335 GlyPheValArgAspLeuGlnGlyAsnProIleAlaAsnAlaThrIle 340345350 SerValGluGlyIleAspHisAspValThrSerAlaLysAspGlyAsp 355360365 TyrT rpArgLeuLeuIleProGlyAsnTyrLysLeuThrAlaSerAla 370375380 ProGlyTyrLeuAlaIleThrLysLysValAlaValProTyrSerPro 385 390395400 AlaAlaGlyValAspPheGluLeuGluSerPheSerGluArgLysGlu 405410415 GluGluLysGluGluLeuMetGluTrpTrpLysMetMetSerGluThr 420425430 LeuAsnPhe 435 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 438 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: ValThrPheArgHisHisArgTyrAspAspLeuValArgThrLeuTyr 15 1015 LysValGlnAsnGluCysProGlyIleThrArgValTyrSerIleGly 202530 ArgSerValGluGlyArgHisLeuTy rValLeuGluPheSerAspHis 354045 ProGlyIleHisGluProLeuGluProGluValLysTyrValGlyAsn 5055 60 MetHisGlyAsnGluAlaLeuGlyArgGluLeuMetLeuGlnLeuSer 65707580 GluPheLeuCysGluGluPheArgAsn ArgAsnGlnArgIleValGln 859095 LeuIleGlnAspThrArgIleHisIleLeuProSerMetAsnProAsp 100 105110 GlyTyrGluValAlaAlaAlaGlnGlyProAsnLysProGlyTyrLeu 115120125 ValGlyArgAsnAsnAlaAsnGly ValAspLeuAsnArgAsnPhePro 130135140 AspLeuAsnThrTyrIleTyrTyrAsnGluLysTyrGlyGlyProAsn 145150 155160 HisHisLeuProLeuProAspAsnTrpLysSerGlnValGluProGlu 165170175 ThrArgAlaValIleArg TrpMetHisSerPheAsnPheValLeuSer 180185190 AlaAsnLeuHisGlyGlyAlaValValAlaAsnTyrProTyrAspLys 195 200205 SerPheGluHisArgValArgGlyValArgArgThrAlaSerThrPro 210215220 ThrProAspAspLysLeuPheGl nLysLeuAlaLysValTyrSerTyr 225230235240 AlaHisGlyTrpMetPheGlnGlyTrpAsnCysGlyAspTyrPhePro 245250255 AspGlyIleThrAsnGlyAlaSerTrpTyrSerLeuSerLysGlyMet 260265270 GlnAspPheA snTyrLeuHisThrAsnCysPheGluIleThrLeuGlu 275280285 LeuSerCysAspLysPheProProGluGluGluLeuGlnArgGluTrp 290 295300 LeuGlyAsnArgGluAlaLeuIleGlnPheLeuGluGlnValHisGln 305310315320 GlyIleLys GlyMetValLeuAspGluAsnTyrAsnAsnLeuAlaAsn 325330335 AlaValIleSerValSerGlyIleAsnHisAspValThrSerGlyAsp 340345350 HisGlyAspTyrPheArgLeuLeuLeuProGlyIleTyrThrValSer 355360365 AlaThr AlaProGlyTyrAspProGluThrValThrValThrValGly 370375380 ProAlaGluProThrLeuValAsnPheHisLeuLysArgSerIlePro 385 390395400 GlnValSerProValArgArgAlaProSerArgArgHisGlyValArg 405410415 AlaLysValGlnProGlnAlaArgLysLysGluMetGluMetArgGln 420425430 LeuGlnArgGlyProAla 435 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 132 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: PheHisTyrValCysArgTyrGlyGlyGluSerAspProGlyHisGlu 15 1015 GluProGluTyrHisGlyAsnGluGlyArgGluLeuLeuLeuCysGlu 202530 AsnLeuThrArgIleHis ProSerAsnProAspGlyGluAlaAlaGly 354045 GlyAspPheProAspLeuGluProAsnLeuGluAlaIleTrpPheVal 50 5560 LeuAlaAsnLeuGlyGlyTyrProTyrAspProAspPheLeuAlaMet 65707580 GlyAsnGlyTrpAspPheTy rLeuAsnCysGluLeuCysLysPhePro 859095 GluLeuTrpAsnLeuGlnHisGlyLysGlyValAspAlaAsnAlaSer 100 105110 ValGlyIleHisValGlyAspTyrArgLeuProGlyTyrAlaAlaGly 115120125 TyrValPheLeu 130 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 109 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: AlaTrpCysAlaGluAspGluSerGlnThrGlnTrpIleGluValAsp 151015 ThrArgArgThrThrArgPheThrGlyValIleThrGlnGlyArgAsp 202530 SerSerIleHisAspAspPheValThrThrPhePheValGlyPheSer 354045 AsnAspSerGlnThrTrpValMetTyrThrAsnGlyTyrGluGluMet 505560 ThrPheTyrGlyAsnValAspLysAspThrProValLeuSerGluLeu 65707580 ProGluProValValAlaArgPheIleArgIleTyrProLeuThrTrp 859095 AsnGlySerLeuCysMetArgLeuGluValLeuGlyCys 100105 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 109 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: AlaTrpSerThrLysGluProPheSerTrp IleLysValAspLeuLeu 151015 AlaProMetIleIleHisGlyIleLysThrGlnGlyAlaArgGlnLys 20 2530 PheSerSerLeuTyrIleSerGlnPheIleIleMetTyrSerLeuAsp 354045 GlyLysLysTrpGlnThrTyrArgGlyAs nSerThrGlyThrLeuMet 505560 ValPhePheGlyAsnValAspSerSerGlyIleLysHisAsnIlePhe 65707 580 AsnProProIleIleAlaArgTyrIleArgLeuHisProThrHisTyr 859095 SerIleArgSerThrLeuArgMet GluLeuMetGlyCys 100105 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 109 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: AlaTrpArgP roGlnValAsnAsnProLysGluTrpLeuGlnValAsp 151015 PheGlnLysThrMetLysValThrGlyValThrThrGlnGlyValLys 202530 SerLeuLeuThrSerMetTyrValLysGluPheLeuIleSerSerSer 354045 GlnAspGly HisGlnTrpThrLeuPhePheGlnAsnGlyLysValLys 505560 ValPheGlnGlyAsnGlnAspSerPheThrProValValAsnSerLeu 65 707580 AspProProLeuLeuThrArgTyrLeuArgIleHisProGlnSerTrp 859095 ValH isGlnIleAlaLeuArgMetGluValLeuGlyCys 100105 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 115 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: AlaTrpSerValGluLysLeuAlaAlaGluPheAlaSerLysProTrp 151015 IleGlnValAspMetGlnLysGluValIleIleThr GlyIleGlnThr 202530 GlnGlyAlaLysHisTyrLeuLysSerCysTyrThrThrGluPheTyr 3540 45 ValAlaTyrSerSerAsnGlnIleAsnTrpGlnIlePheLysGlyAsn 505560 SerThrArgAsnValMetTyrPheAsnGlyAsnSerAspAlaSe rThr 65707580 IleLysGluAsnGlnPheAspProProIleValAlaArgTyrIleArg 8590 95 IleSerProThrArgAlaTyrAsnArgProThrLeuArgLeuGluLeu 100105110 GlnGlyCys 115 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 111 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: AlaTrpGlnAlaLysAlaAsnAsnAsnLysGlnTrpLeuGluIleAsp 15 1015 LeuLeuLysIleLysLysIleThrAlaIleIleThrGlnGlyCysLys 202530 SerLeuSerSer GluMetTyrValLysSerTyrThrIleHisTyrSer 354045 GluGlnGlyValGluTrpLysProTyrArgLeuLysSerSerMetVal 50 5560 AspLysIlePheGluGlyAsnThrAsnThrLysGlyHisValLysAsn 65707580 PhePheAsnProPr oIleIleSerArgPheIleArgValIleProLys 859095 ThrTrpAsnGlnSerIleThrLeuArgLeuGluLeuPheGlyCys 1 00105110 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 110 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: AlaTrpHisAlaSerAsnTyrAspS erLysProTrpIleGlnValAsn 151015 LeuLeuArgLysMetArgValSerGlyValMetThrGlnGlyAlaSer 20 2530 ArgAlaGlyArgAlaGluTyrLeuLysThrPheLysValAlaTyrSer 354045 LeuAspGlyArgLysPheGluPhe IleGlnAspGluSerGlyGlyAsp 505560 LysGluPheLeuGlyAsnLeuAspAsnAsnSerLeuLysValAsnMet 6570 7580 PheAsnProThrLeuGluAlaGlnTyrIleArgLeuTyrProValSer 859095 CysHisArgGlyCysThrL euArgPheGluLeuLeuGlyCys 100105110 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 109 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: AlaTrpThrAlaGlnSerAsnSerAlaLysGluTrpLeuGlnValAsp 151015 LeuGlyThrGlnArgGlnValThrGlyIleIle ThrGlnGlyAlaArg 202530 AspPheGlyHisIleGlnTyrValGluSerTyrLysValAlaHisSer 3540 45 AspAspGlyValGlnTrpThrValTyrGluGluGlnGlySerSerLys 505560 ValPheGlnGlyAsnLeuAspAsnAsnSerHisLysLysAs nIlePhe 65707580 GluLysProPheMetAlaArgTyrValArgValLeuProValSerTrp 8590 95 HisAsnArgIleThrLeuArgLeuGluLeuLeuGlyCys 100105 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 104 amino acids (B) TYPE: amino acid ( D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: AlaTrpCysSerSerIleValAspThrAsnGlnTyrIleValAlaGly 151015 CysGluValProA rgThrPheMetCysValAlaLeuGlnGlyArgGly 202530 AspHisAspGlnTrpValThrSerTyrLysIleArgTyrSerLeuAsp 35 4045 AsnValThrTrpSerGluTyrArgAsnGlyAlaAlaIleThrGlyVal 505560 ThrAspArgAsnThrValVal AsnHisPhePheAspThrProIleArg 65707580 AlaArgSerIleAlaIleHisProLeuThrTrpAsnAsnHisIleSer 859095 LeuArgCysGluPheTyrThrGln 100 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ( ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: AlaTrpTrpValAspLeuGlyThrGlnGlyTyrValPheTyrSerAsp 151015 TrpTyrPheGlyAsnAspAsnPh eProAlaArgTyrIleArgIlePro 202530 TrpLeuArgLeuGluLeuLeuGlyCys 3540
Non-Patent Literature (10)
- USB Molecular Biology Reagents/Protocols 1992, published by United States Biochemical (1991), pp. 315-319.
- "Basic carboxypeptidases: regulators of peptide hormone activity ", Randal A. Skidgel, Trends Pharmacol. Sci., 9:299-304 (1988).
- "Inhibition of Bone Resorption In Vitro by Human Enkephalinase (EC 3.424.11), a Neutral Metalloendopeptidase", Ibbotson et al., Journal of Bone and Mineral Research, 7(3):273-279 (1992).
- S. Howell, et al., Membrane Peptidases on Human Osteoblast-Like Cells in Culture: Hydrolysis of Calcitonin and Hormonal Regulation of Endopeptidase-24 .11; Biochemical Journal, vol. 290, part 1: 159-164 (Feb. 15, 1993).
- EPO Search Report
- Critical Synergy: The Biotechnology Industry and Intellectual Property Protection Presentation of the Intellectual Property Committee of the Biotechnology Industry Organization at the Oct. 17, 1994 Hearing of the U.S. Patent & Trademark Office, San Diego, Cal. published by the Biotechnology Industry Organization (1994), p. 100.
- Suggs et al, Proc. Natl Acad. Sci. USA 78: 6613 (1981).
- Marcus--Sekura, Anal. Biochem. 172: 289 (1988).
- Sakai et al, Genomics 5: 309 (1989).
- Lewin, Gene Expression, vol. 2, Eucaryotic Chromosomes, 1974, John Wiley & Sons, New York, N.Y. pp. 160-169.