DRUG DELIVERY SYSTEM FOR BLOOD-BRAIN BARRIER PENETRATION

[0001] This application claims the benefit of Korean Patent Application No. 10-2024-0091296, filed on Jul. 10, 2024, at the Korean Intellectual Property Office, the entire disclosure of which is incorporated herein by reference for all purposes.

[0002] The contents of the electronic sequence listing (“NewApp_0210520010_20250704LFC_APC-2023-0696.xml”; Size is 28,745 bytes and it was created on Jul. 4, 2025) is herein incorporated by reference in its entirety.

[0003] One or more embodiments relate to the use of a cube-shaped DNA nanostructure as a drug delivery system for the purpose of penetrating the blood-brain barrier (BBB).

[0004] Oligonucleotide therapeutics (OTs) such as small interference RNAs (siRNAs) and antisense oligonucleotides (ASOs) hybridize with disease-related mRNA sequences and downregulate the expression of the downstream proteins. OTs have emerged as a strategy for treating diseases that are difficult to treat with traditional small molecule drugs. With systemic administration, most of the clinically available OTs may be delivered to the liver by lipid nanoparticles (LNPs) or GalNacs (triantennary or N-acetylgalactosamine), the hepatocyte-specific ligands which are used to treat various liver diseases. However, a suitable method for systemic administration and delivery of OTs into organs or tissues other than the liver has not yet been developed.

[0005] The blood-brain barrier (BBB) as a protective layer of the central nervous system (CNS) presents a significant challenge for the delivery of systemically injected therapeutics to the brain. The BBB is composed of brain microvascular endothelial cells (BMEC), which are components of brain capillaries, and is composed of other brain tissue components such as pericytes, smooth muscle cells, and astrocytes. Only a limited number of hydrophobic substances with a low molecular weight of <500 Da and fewer than 10 hydrogen bonds may passively diffuse through the BBB. While the highly ionic and hydrophilic small molecules unable to diffuse through the BBB may reach the brain parenchyma via the paracellular pathway, the tight junctions between endothelial cells filled with multiprotein junctional complexes maintain the low paracellular permeability of the BBB. Nutrients and proteins required for brain function and homeostasis may pass through the BBB by transcytosis mediated by specific transporters and receptors expressed on each BMEC. Another transcytosis pathway for BBB penetration is adsorptive-mediated transcytosis, which is triggered by non-specific interactions between positively charged molecules and the negatively charged BMEC membrane. Polyanionic macromolecules such as OTs are intrinsically unable to penetrate the BBB through diffusion or transcytosis. OTs may be delivered into the brain parenchyma via BBB-bypassing routes such as intraventricular and intrathecal injections. However, these invasive methods may limit the applications for OTs. If BBB penetration via a systemic route, such as intravenous administration, is available, OTs may be delivered to the brain parenchyma in a relatively less invasive manner.

[0006] A prevalent approach for enhancing the delivery of OTs to the brain via a systemic route involves the conjugation of OT-loaded nanocarriers with ligands that target endocytic receptors in BMEC and promote transcytosis through the BBB. Various receptor-targeting ligands have been conjugated with nanocarriers to improve the distribution of OTs within the brain. However, this delivery method does not always guarantee an increase in brain distribution, and in certain cases, there is no considerable improvement in brain distribution or even a decrease in degree of brain delivery compared to when unconjugated nanocarriers are used. It is suspected that the formation of a protein corona, a layer of serum proteins adsorbed onto the surface of the nanocarriers, inhibits the ligand-based enhancement of brain delivery. Meanwhile, the transcytosis efficiency may also be limited in case where receptors are saturated with high levels of endogenous ligands and/or the targeting ligands are not sufficiently stable. Given that the protein corona inevitably forms in situ and affects the in vivo distribution of nanocarriers, the design of nanocarriers for enhanced systemic delivery of OTs to the brain is important.

[0007] The inventors discovered a DNA construct with a protein corona that may enhance brain distribution through in vivo screening of various DNA nanostructures and created the present disclosure. More specifically, the inventors prepared six different wireframe DNA nanostructures and examined their biodistribution upon intravenous injection (FIG. 1). The results showed that a cube-shaped DNA nanostructure had brain distribution properties. The inventors subsequently investigated the role of the protein corona in the brain distribution of this DNA nanostructure. Finally, the inventors employed the DNA nanostructure as a carrier for delivering ASOs to treat glioblastoma multiforme (GBM) in an orthotopic GBM mouse model. The results showed that the cube-shaped DNA nanostructure had practical potential as a platform for enhanced systemic delivery of OTs to the brain.

[0008] Hence, the technical goal to be achieved by the present disclosure is to provide a DNA nanostructure as a drug delivery system for penetrating the BBB.

[0009] However, the technical goal to be achieved is not limited to the one described above, and other goals not mentioned above will be clearly understood by one of ordinary skill in the art from the following description.

[0010] To achieve the technical goal described above, the present disclosure provides a DNA nanostructure as a drug delivery system for penetrating the blood-brain barrier (BBB).

[0011] The inventors fabricated DNA nanostructures in the structures of a tetrahedron, a triangular prism (the term triangular prism is used interchangeably with the term trigonal prism), and a regular hexahedron and confirmed the BBB permeability of the nanostructures. As a result, it was confirmed that the regular hexahedron structure has excellent BBB permeability. Therefore, the DNA nanostructure of the present disclosure is a cube structure using double-stranded deoxyribonucleic acids (DNA) as a frame.

[0012] In the present disclosure, the DNA nanostructure is a cube structure. As used herein, the term cube structure is used interchangeably with the term regular hexahedral structure, but although the intention is that the terms may refer to a regular hexahedron, the terms may not strictly refer to a regular hexahedron.

[0013] When one side of the cube-structured DNA nanostructure of the present disclosure is 5 bp or less in length, there is a problem with the stability of the structure, and when it exceeds 30 bp in length, the BBB permeation efficiency is reduced. Thus, one side of the DNA nanostructure of the present disclosure may preferably have a length of greater than 5 bp and less than 30 bp, and may have a length of greater than 5 bp and less than 25 bp, greater than 7 bp and less than 25 bp, greater than 9 bp and less than 25 bp, greater than 5 bp and less than 20 bp, greater than 7 bp and less than 20 bp, greater than 9 bp and less than 20 bp, greater than 5 bp and less than 17 bp, greater than 7 bp and less than 17 bp, greater than 9 bp and less than 17 bp, greater than 18 bp and less than 25 bp, greater than 18 bp and less than 25 bp, greater than 18 bp and less than 25 bp.

[0014] As used herein, the term double-stranded DNA is used interchangeably with the terms skeleton and frame in that double-stranded DNA forms the frame of a DNA nanostructure, and the term frame is used interchangeably with the term wireframe in that the frame is double-stranded.

[0015] Meanwhile, the inventors found that the cube-shaped DNA nanostructures formed from D-form DNA had better BBB permeability than the cube-shaped DNA nanostructures formed from L-form DNA. Therefore, the DNA nanostructure of the present disclosure may consist of D-form DNA.

[0016] As used herein, a DNA nanostructure is represented by its structure and the type of DNA constituting the nanostructure. For example, a cube-shaped DNA nanostructure consisting of D-form DNA is denoted as D-Cb.

[0017] The DNA nanostructure of the present disclosure may penetrate the BBB and further show accumulation in brain tumor cells and thus, may be used as a drug delivery system for treating brain tumors by loading a drug capable of inhibiting the proliferation of tumor cells or inducing tumor cell death.

[0018] Specifically, the inventors loaded ASO targeting PLK1 mRNA, a target molecule for the treatment of glioblastoma, into D-Cb to treat glioblastoma cells (U87MG) in order to evaluate the gene silencing effect. As a result, it was confirmed that D-Cb significantly enhanced the cellular uptake of ASO, and the cellularly introduced ASO inhibited the expression of the target molecule, i.e. PLK1.

[0019] In addition, the inventors loaded ASO into D-Cb and intravenously injected it into GBM-induced mice. Treatment with ASO@D-Cb resulted in a higher distribution level in the brain than treatment with ASO alone. The D-Cb protects the ASO until the ASO enters the target cells. Furthermore, ASO loaded onto D-Cb was introduced into glioblastoma cells and exhibited therapeutic efficacy.

[0020] Accordingly, the present disclosure provides a pharmaceutical composition for treating brain tumors including the drug-loaded DNA nanostructure as an active ingredient.

[0021] In one embodiment of the present disclosure, the drug may be a known drug that inhibits the proliferation of cancer cells or induces cell death, and preferably may be an oligonucleotide or a hydrophobic anticancer drug such as doxorubicin.

[0022] According to embodiments, the present disclosure provides a DNA nanostructure for penetrating the BBB. It has been confirmed that the DNA nanostructure of the present disclosure has high stability in vivo, efficiently penetrates the BBB, has brain tissue selectivity, and may be accumulated in brain tumors. In addition, the DNA nanostructure of the present disclosure may deliver drugs to brain tissue stably without being affected by brain accessibility even after drug loading and thus, may be used as a drug delivery system capable of loading drugs for treating brain tumors. Further, it is expected that the DNA nanostructure of the present disclosure may be used in the development of treatments for degenerative brain diseases, whose prevalence is increasing since the population is aging.

[0090] Three-dimensional DNA nanostructures are known to be usable as a drug delivery system, but DNA nanostructures capable of penetrating the BBB have not yet been developed. The BBB is considered to be the primary barrier to drug delivery into the brain. The inventors developed DNA nanostructures capable of penetrating the BBB in order to deliver drugs into the brain.

[0091] More specifically, the inventors attempted to determine whether the structure of a three-dimensional DNA nanostructure and the form of DNA affect the permeability of the barrier. Using L-form DNA and D-form DNA, the inventors fabricated DNA nanostructures with tetrahedral, triangular prismatic, and hexagonal structures and confirmed the BBB permeability of the nanostructures. As a result, the inventors found that DNA nanostructures with a cube structure exhibited high BBB permeability. Meanwhile, they found that DNA nanostructures fabricated with D-form DNA showed higher brain distribution characteristics than those manufactured with L-form DNA, when administered systemically.

[0092] Accordingly, the inventors provide a DNA nanostructure having a cube structure as a drug delivery system for the purpose of delivering a drug into the brain.

[0093] The present inventors investigated whether a therapeutic effect on brain tumors could be obtained by loading a drug into D-Cb nanostructures that exhibit high brain distribution characteristics upon systemic administration. Specifically, ASO targeting PLK1 mRNA was loaded into glioblastoma-induced mice by adding it to the 3-terminus of the S6 strand of D-Cb. In this specification, D-Cb loaded with ASO is denoted as ASO@D-Cb. ASO@D-Cb exhibited high brain distribution characteristics upon intravenous administration to mice, which were not affected by ASO loading. Further, ASO loaded into DNA nanostructures was incorporated into glioblastoma cells and the expression level of the target molecule, i.e. PLK1, was down-regulated.

[0094] Accordingly, the present disclosure provides a pharmaceutical composition for treating brain tumors by loading a drug capable of inhibiting the proliferation of cancer cells or inducing apoptosis into the above-described DNA nanostructures.

[0095] As used herein, “brain tumors” may refer to gliomas, astrocytomas, malignant astrocytomas, glioblastomas, etc.

[0096] In the present disclosure, the drug may be an oligonucleotide targeting a gene differentially expressed in normal cells and cancer cells, and may include an RNAi, ASO (antisense oligonucleotide), ADAR (adenosined deaminases acting on RNA), etc., that may down-regulate the expression of the target gene by including a sequence complementary to part or all of the target gene.

[0097] Meanwhile, the drug delivery system provided by the present disclosure consists of DNA, enabling loading of hydrophobic anticancer drugs such as doxorubicin. Therefore, the drug may be an anticancer agent with hydrophobic properties among the known anticancer agents.

[0098] Hereinafter, specific embodiments will be described in detail with reference to the accompanying drawings, although the present disclosure may have various embodiments and various changes may be made to the embodiments. Such illustrations and descriptions are not intended to limit the present disclosure to specific embodiments, and should be understood as including all transformations, equivalents, and substitutes that may be included in the spirit and scope of the present disclosure. In the description of the present disclosure, any detailed description of well-known related structures or functions has been omitted where it is deemed that such description will cause ambiguous interpretation of the present disclosure.

[0099] All quantitative RT-PCR (qRT-PCR) primers and phosphoramidites required for D-DNA synthesis were purchased from Bioneer (Daejeon, Korea). The phosphoramidites for L-DNA synthesis and the CPG for 3′ modifications (3′-FAM and 3′-NH₂) were purchased from Glen Research (Sterling, VA, USA). Streptavidin-coated magnetic beads (Dynabeads™ MyOne Streptavidin™ T1) and the SYBR green Master Mix used for qRT-PCR were obtained from Thermo Fisher Scientific (Waltham, MA, USA). The BALB/c mice used in the study, specifically male individuals aged 5 weeks, were provided by Orient Bio Inc. (Seongnam, Korea). Various additional buffers, organic solvents, and chemical reagents essential for the experimental procedures were purchased from Biosesang (Seongnam, Korea), Samchun Chemicals (Seoul, Korea), and Sigma Aldrich (Missouri, USA), respectively. The RNeasy Mini kit was obtained from Qiagen (Hilden Germany), while the cDNA synthesis kit was purchased from Enzynomics (Daejeon, Korea). The antibodies employed in western blotting and flow cytometry were purchased from Cell Signaling Technology (Danvers, MA, USA), Santa Cruz Biotechnology (Dallas, TX, USA), Abcam (Cambridge, UK), R&D Systems (Minneapolis, MN, USA), Bethyl Laboratories Inc. (Montgomery, TX, USA), and Biolegend (San Diego, CA, USA).

[0100] The data is presented as the mean±standard error of the mean (SEM). To assess the significance of observed differences, statistical analysis was conducted through one-way analysis of variance (ANOVA) using Tukey's multiple comparison test by GraphPad Prism software. For this analysis, data with *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001 is considered statistically significant.

[0101] Oligonucleotides were synthesized at a 1 μmol-scale using the Mermaid-4 DNA/RNA synthesizer (Bioautomation, MN, USA) with conventional phosphoramidite chemistry. After synthesis, the oligonucleotides were cleaved from CPG and deprotected in 33% aqueous ammonia at 55° C. for 17 hours. Subsequent purification was achieved through denaturing polyacrylamide gel electrophoresis (PAGE), followed by ethanol precipitation. The molecular weight of all of the purified strands was characterized via ESI-MS analysis, conducted by Novatia Inc. (Pennsylvania, USA).

[0102] The solution containing oligonucleotides (S1-S6, 1 μM, Table 1) in TM buffer (5 mM MgCl₂, 10 mM Tris-HCl, pH 8.3) was heated to 95° C. for 10 minutes and slowly cooled down to 4° C. for 24 hours. The self-assembled structures were verified by native PAGE (10%) in 0.5×TBE buffer. The bands were visualized using 3′-FAM incorporated in the S1 strand. The gels were imaged using the iBrightFL1000 system (Thermo Fisher Scientific).

	TABLE 1
				SEQ
				ID
			Sequence (5′ to 3′)	NO.
	Td	S1	GGG ATC CCG ATT CGA	1
			GAC AGC ATT TCT CCC
			ACA C
		S2	CGT GGT AGG TTT TGC	2
			TGT CTC GTT AGC GCC
			GGC C
		S3	TCG GGA TCC CTT CAC	3
			GGG CAA CTT GGC CGG
			CGC T
		S4	ACC TAC CAC GTT GTT	4
			GCC CGT GTT GTG TGG
			GAGA
	Tp	S1	TGC TGT CTC GTT CGT	5
			GGT AGG TTT GCA GAA
			GGT C
		S2	CGA GAC AGC ATT CAC	6
			GGG CAA CTT TCT CCC
			ACA CTT GGG AAA GGT
			C
		S3	GTG TGG GAG ATT CCG	7
			AGG GAT CTT GCG GAT
			TGT A
		S4	GGC CGG CGC TTT ACC	8
			TAC CAC GTT GAC CTT
			TCC CTT TAC AAT CCG
			C
		S5	AGC GCC GGC CTT GAT	9
			CCC TCG GTT GTT GCC
			CGT GTT GAC CTT CTG
			C
	Cb	S1	GTG TGG GAG ATT AGT	10
			CAT TAA GTT TAC AAT
			CCG CTT GTA ATC GTA
			G
		S2	GTT GCC CGT GTT CTA	11
			CGA TTA CTT GGT CGG
			GAA ATT CGT GGT AGG
			T
		S3	GCG GAT TGT ATT TAG	12
			GGG ACA TTT CGA GAC
			AGC ATT TTT CCC GAC
			C
		S4	GCA GAA GGT CTT CCG	13
			AGG GAT CTT ACC TAC
			CAC GTT TGC TGT CTC
			G
		S5	AGC GCC GGC CTT TCT	14
			CCC ACA CTT CAC GGG
			CAA CTT GAT CCC TCG
			G
		S6	CTT AAT GAC TTT GGC	15
			CGG CGC TTT GAC CTT
			CTG CTT ATG TCC CCTA

[0103] The hydrodynamic sizes of DNA nanostructures (250 nM in TM buffer) were determined by dynamic light scattering (DLS) using a Zetasizer instrument (Malvern Instruments, Worcestershire, UK).

[0104] DNA nanostructures assembled within the concentration range of 50-100 nM were suitably diluted to 20 nM in 1×TAE-Mg buffer (composed of 50 mM Tris-acetate, 2 mM EDTA, 12.5 mM MgCl₂). This diluted solution was then combined with an equal volume of 1×TAE-Mg containing 10 mM NiCl₂. The mixture was deposited onto mica surfaces pretreated with NiCl₂ and subsequently incubated for 1 minute at room temperature. Then, the samples were imaged using a non-contact mode on an atomic force microscopy (AFM) platform (ScanAsyst Multimode, Bruker, USA), employing ScanAsyst-Fluid+ tips (Bruker, USA) in a fluidic environment.

[0105] DNA nanostructures (FAM-labeled, 1 μM) were incubated in 50% mouse serum for 0, 1, 4, 7, and 24 hours at 37° C. At each time point, the enzymatic reaction was quenched by adding loading buffer (95% formamide in 0.5 M EDTA), which was followed by a treatment step of heating at 95° C. for 10 minutes. Subsequently, the samples were subjected to agarose (1%) gel electrophoresis, run in 0.5×TBE buffer at 120 V for 1 hour. The bands were imaged using an iBright FL1000 imaging system.

8. Pull-Down of Serum Proteins with D-Cb and L-Cb

[0106] Streptavidin-coated magnetic beads or biotinylated D-Cb and L-Cb (1 μM) immobilized onto the streptavidin-coated magnetic beads (20 μL) were washed three times with 1× phosphate-buffered saline (PBS) (100 μL) and then incubated in mouse serum (50 μL, Sigma-Aldrich) in a binding buffer (50 μL, 2×PBS) at 37° C. for 1 hour. The supernatant was removed. The beads were washed three times with 1×PBS. The beads were resuspended in loading buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 6% v/v glycerol, 2 mM DTT and 0.01% w/v bromophenol blue) and incubated at 95° C. for 10 minutes. The mixture was subsequently analyzed by 5-12% SDS-PAGE. The gel was stained with Coomassie Blue, and then imaged using an iBrightFL1000 system.

[0107] Proteins that were pulled down through three independent beads, D-Cb, and L-Cb binding experiments, respectively, were separated based on the molecular weight using 5-12% SDS-PAGE. After the gel was stained with Coomassie Blue, the stained gel for each lane of the samples that were pulled down with three types of beads was divided into eight slices and the proteins contained in each gel slice were subjected to tryptic digestion. The proteins were first reduced with 10 mM DTT in 25 mM NH₄HCO₃ for 1 hour at 56° C. They were then alkylated with 55 mM iodoacetamide in 25 mM NH₄HCO₃ for 1 hour at 25° C. in the dark, and subjected to trypsin digestion overnight. Peptides were then extracted with 67% acetonitrile (ACN)/5% formic acid (FA) in water and dried in a miVAC vacuum concentrator (Genevac Ltd., Ipswich, UK). Then, they were resuspended with 20 μL of 0.4% acetic acid. For mass spectral analysis, 13.5 μL of each sample was injected into a reversed-phase Magic C18AQ column (15 cm×75 μm) on an Eksigent MDLC system (Eksigent Technologies, CA, USA). Three replicates of each type of sample were analyzed using mass spectrometry (MS).

[0108] The operating flow rate was 350 nL/min, under the following gradient conditions: 0 min 100% buffer A (100% water with 0.1% FA) and 0% buffer B (100% ACN with 0.1% FA), 0-5 min 0-8% B, 5-85 min 8-30% B, 85-90 min 30-70% B, 90-100 min 70% B, 100-110 min 70-2% B, and 100-120 min 2% B. The nano HPLC system was coupled to an LTQ XL-Orbitrap mass spectrometer (Thermo Fisher Scientific, MA, USA). The spray voltage was set to 2.5 kV and the temperature of the heated capillary was set to 250° C. Survey full-scan mass spectrometry (MS) spectra (300-2000 m/z) were acquired with 1 micro scan at a resolution of 60,000, allowing a preview mode for precursor selection and charge-state determination. Tandem mass (MS/MS) spectra for the ten most intense ions were acquired in an ion trap with the following options: isolation width, 2 m/z; normalized collision energy, 35%; dynamic exclusion duration, 30 s. Precursors with +1 charge and unassigned charge states were discarded during data-dependent acquisition. A search of each LC-MS/MS file was run against the SwissProt mouse database (June 2022) having 17132 entries using Proteome Discoverer software (version 2.4, Thermo Fisher Scientific, Bremen, Germany). The search criteria were set to a mass tolerance of 15 ppm for MS data and 0.5 Da for MS/MS data with fixed modification of carbamidomethylation of cysteine (+57.021 Da) and variable modification of methionine oxidation (+15.995 Da). The false discovery rate (FDR) was set at 0.01 for the identification of peptides and proteins. All proteins were identified by two or more unique peptides. For label-free quantitative analysis performed using the three replicates of each type of sample, normalized abundance values of proteins in each sample were obtained from peak area normalized by total peptides using Minora algorithm-based label-free quantification by Proteome Discoverer 2.4. Statistical analysis of the normalized abundance values obtained from the label-free quantification was performed using Perseus software (1.6.14.0). Normalized abundance values were log-transformed, and then missing values were replaced using values computed from the normal distribution with a width of 0.3 and a downshift of 1.8. Proteins exhibiting statistical significance among samples pulled down with beads, D-Cb, and L-Cb were obtained by ANOVA comparison of the log₂ (normalized abundance) values obtained from the three replicates of each type of sample. P-value <0.05 was considered statistically significant. For hierarchical clustering of proteins showing statistically significant changes (P-value <0.05) among samples pulled down with beads, D-Cb, and L-Cb, the abundance values were first normalized using z-score and then clustering of both columns and rows was pursued based on Euclidean distance using the average linkage method using Perseus (1.6.14.0).

[0109] U87MG cells (Korean Cell Line Bank, Seoul, Korea) were seeded at a density of 5×10⁴ cells per well in a 24-well plate. After 24 hours, the cells were washed twice with PBS and were subsequently treated with Cy5.5-labeled ASO or ASO@D-Cb (50 nM) in 10% fetal bovine serum (FBS)-supplemented Dulbecco's Modified Eagle Medium (DMEM; Welgene, Gyeongsan, Korea) at 37° C., in a 5% CO₂ environment. After 6 hours, the cells were washed three times, suspended in ice-cold PBS (500 μL), and analyzed by flow cytometry (Guava, Millipore, Massachusetts, USA). A minimum of 10,000 cells were examined in triplicate for each sample. For confocal microscopic imaging, cells (2.5×10⁴) were cultured on glass-bottomed dishes and treated with Cy5.5-labeled ASO or ASO@D-Cb (50 nM) for 6 hours. Subsequently, the cells were stained with Hoechst 34580 (1 μg/mL, Thermo Fisher Scientific) for 5 minutes and washed with PBS twice. The cellular fluorescence signals were visualized using confocal microscopy (LSM 800, Carl Zeiss, Jena, Germany).

[0110] To elucidate receptor-mediated cellular uptake mechanisms, bEnd.3 cells or U87MG cells were pretreated with 10 μg/mL of antibodies (anti-TfR antibody, anti-LRP1 antibody, anti-LRP2 antibody, or anti-LDLR antibody) for 1 hour and afterwards were treated with FAM-labeled D-Cb or L-Cb for 6 hours. Then, the uptake efficiency was analyzed by flow cytometry.

[0111] To evaluate the in vitro BBB penetration of DNA nanostructures, the inventors carried out a penetration study using an in vitro BBB monolayer model. Brain endothelial bEnd.3 cells were seeded at a density of 3.0×10⁴ cells on Transwell permeable inserts (0.4 μm, 6.4 mm in diameter; Falcon®, Corning, NY, USA) with 10% FBS-containing DMEM and incubated at 37° C. in a 5% CO₂ atmosphere for one week. The integrity of the BBB model was confirmed by transendothelial electrical resistance (TEER) measurements using EVOM2 (World Precision Instruments, Sarasota, FL, USA). When the TEER value was above 250Ω, the Transwell insert was washed with PBS, and 200 μL of complete medium containing FAM-labeled DNA nanostructures (1 μM) was added to the apical side of the culture insert. The basolateral compartment of the insert was filled with 500 μL complete medium. The complete medium with DNA nanostructures was collected from the basolateral side, and the basolateral part was refilled with fresh complete medium at pre-determined times (0.5, 1, 2, and 4 hours). The fluorescence intensity of collected samples was measured with a fluorescence spectrometer (Multi-detector microplate reader, Synergy H1 Hybrid, BioTek). The DNA nanostructures in the samples were quantified. Then, the apparent permeability (Papp), indicating the in vitro BBB permeability, was calculated using the following equation:

$\begin{array}{cc}{p}_{\mathrm{app}}=\left(C_{\mathrm{receiver}}\times V_{\mathrm{receiver}}\right)/\left(A\times t\times C_{\mathrm{donor}}\right).& \left[\mathrm{Equation}1\right]\end{array}$

[0112] where C_donor, C_receiver, V_receiver, A, and t denote the concentration of DNA nanostructures in the donor (apical side), the concentration of DNA nanostructures in the receiver (basolater side), receiver volume, membrane area, and incubation time, respectively.

[0113] To investigate the receptor-mediated BBB transcytosis efficiency of D-Cb, a transpenetration study with TfR, LRP1, LRP2, LDLR antibodies was performed using an in vitro BBB monolayer model. On the day of the assay, the cells in the insert were pretreated with each antibody in serum-containing medium (10 μg/mL) for 1 hour at 37° C. After 1 hour of incubation, complete medium containing FAM-labeled D-Cb (1 μM) was added to the apical side. Samples were collected from the basolateral side at predetermined times and BBB permeability calculations were performed as described above.

[0114] In vitro U87MG-cellular uptake analysis after BBB penetration (BTB penetration assay) was performed using an in vitro BBB co-culture model. Briefly, bEnd.3 cells were seeded at a density of 3.0×10⁴ cells into the Transwell permeable inserts (apical chambers) and incubated for 5 days. Then, U87MG cells were seeded at a density of 3.0×10⁴ on the coverslip in the basolateral chambers. After 2 days, 200 μL of complete medium containing FAM-labeled DNA nanostructures (1 μM) was added to the apical side of the culture insert. The basolateral compartment of the insert was filled with 500 μL complete medium. The U87MG cells in the basolateral chambers were incubated at 37° C. for 4 hours, washed four times with PBS, stained with DAPI for 5 minutes, and then fixed using a 2% PFA solution. The coverslips were mounted with a mounting solution on the slide glass and then fluorescence intensity was observed under a confocal microscope (A1Plus, Nikon). The relative fluorescence intensity was determined by normalizing the intensity ratio FAM (Cb)/DAPI (nuclei).

[0115] All animal experiments were approved by the Institutional Animal Care and Use Committee at Gachon University (Approval number: LCDI-2022-0076). The U87MG-fLuc-GFP cell line was kindly provided by Dr. Kwang Il Kim from the Korea Institute of Radiological and Medical Sciences. Orthotopic GBM-xenografted mice were prepared using U87MG-fLuc-GFP cells following a previously established protocol. Briefly, male athymic BALB/c nude mice (5 weeks old, 20-30 g) were placed on a stereotactic device (Harvard Apparatus, MA, USA) using ear bars under 1-1.5% isoflurane inhalation anesthesia. U87MG-FLuc-GFP cells (1×10⁵ cells) suspended in 2 μL of PBS were injected into the right striatum at a flow rate of 0.5 μL/min through a tiny hole on the skull at coordinates 2.0 mm laterally, 0.2 mm anteriorly, and 3.2 mm ventrally from the bregma. Brain tumor growth was monitored by bioluminescence intensity (BLI).

[0116] All experimental procedures involving living animals were strictly conducted in accordance with the relevant regulations and institutional protocols of the Korea Institute of Science and Technology (Approval Number: IACUC-2022-047-2). Cy5.5-labeled DNA nanostructures or ASO (2 μM, 200 μL) were intravenously administered to healthy BALB/c or GBM mice. In vivo fluorescence images were acquired using an IVIS Imaging Spectrum System, utilizing an emission wavelength of 700 nm and an excitation wavelength of 640 nm. The data was subsequently analyzed with IVIS Living Imaging 3.0 software. For ex vivo imaging, at 2 hours post injection, the mice were euthanized, and the organs were extracted and imaged via the IVIS system.

[0117] At 2 hours post injection of D-Cb or L-Cb, the mice (BALB/c or GBM) were transcranially perfused with 10 mM potassium PBS at a flow rate of 1 mL/min (1 mL) to remove the nanostructures in the blood, and the brain was harvested. To estimate brain distribution levels (injected dose per gram of tissue: ID %/g) of D-Cb and L-Cb labeled with FAM or Cy5.5, the excised brain tissues were homogenized under cryogenic conditions and were subsequently lysed in RIPA buffer. The lysates were centrifuged (12,000 rpm, 10 minutes, 4° C.), and fluorescence intensity of the supernatant from each sample was measured using a plate reader (Victor Nivo, Perkin Elmer, USA) with a specific filter set (Ex 640 nm, Em 685 nm) to quantify the total amount of fluorescence-labeled structures. To quantify intact oligonucleotides, the brain lysates were analyzed using 10% denaturing PAGE (7 M urea). Reference quantities of oligonucleotides (Cy5.5-labeled; 0.032, 0.64, 0.125, 0.25, and 0.5 pmol) were collaterally loaded onto the gel. The quantity of intact oligonucleotides present was estimated based on the intensity of the gel bands, which were subsequently quantified by ImageJ software. Using the determined amount of intact oligonucleotides within each lysate, the amount of intact D-Cb and L-Cb in the brain was calculated, accounting for the total lysate volume and the tissue weight.

[0118] The brains of GBM mice were excised 2 hours after intravenous injection of Cy5.5-labeled D- or L-Cb. The harvested brains were embedded with optimal cutting temperature (OCT) compound (Leica Biosystems, Germany) and frozen in a rapid freezer. The frozen tissue blocks were sectioned into 15 μm sections by Lab Core Incorporation (Seoul, Korea). The section slides were washed with PBS, mounted with DAPI containing-mounting solution (Abcam, UK) and imaged using confocal microscopy (LSM 800).

[0119] Biotinylated D-Cb (2 μM, 200 μL) was administered intravenously to BALB/c mice. After 2 hours, brain tissues were collected and subsequently homogenized under cryogenic conditions, and lysed in RIPA buffer. The lysed tissue samples were then centrifuged at 12,000 g for 10 minutes at 4° C., and the supernatant was collected as the brain tissue lysate. Streptavidin-coated magnetic beads (30 μL) were washed with the buffer (0.5 mM EDTA, 1 M NaCl, 5 mM Tris-HCl, pH 7.5) three times and incubated with the tissue lysate at 37° C. for 2 hours. The beads were washed with PBS and 50 mM NaOH. Biotinylated S5 strands were eluted by incubating the beads with D-biotin (1 mM) in distilled water at 95° C. for 20 minutes. D-biotin was removed by filtering the eluted solution using a G25 filtration column. The filtrate was analyzed using electrospray ionization mass spectrometry (ESI-MS), which was conducted by Novatia Inc. (Pennsylvania, USA).

[0120] Orthotopic GBM-xenografted mice were intravenously administered with Cy5.5-labeled ASO@D-Cb (200 μL, 400 pmol/mouse, 20 nmol/kg) through the tail vein. After 2 hours, the GBM-bearing mice were transcranially perfused with 10 mM potassium PBS at a flow rate of 1 mL/min (50 mL) and then fixed by a 4% (v/v) paraformaldehyde (PFA) solution at a flow rate of 2 mL/min (50 mL). The brains were collected, divided into 4 mm coronal slices, and then post-fixed with a 4% (v/v) PFA solution overnight at 4° C. The brain coronal slices were sectioned into 40 μm thick sections using a vibratome (Leica V1000S, Germany) and the sections were stained by DAPI (Life Technologies). The stained tumor tissue slides were observed by laser scanning confocal microscopy (LSCM, A1Plus, Nikon, Tokyo, Japan). The fluorescence intensity in the images was quantitatively analyzed using Nikon NIS-E image analysis software.

[0121] Orthotopic GB mice were intravenously administered with Cy5.5-labeled ASO@D-Cb (200 μL, 400 pmol/mouse, 20 nmol/kg) through the tail vein. Systemic fluorescence images were obtained at predefined time points within 24 hours following intravenous administration using an IVIS optical imaging system (Ami HT imaging system, Spectral Instruments Imaging, Tucson, AZ, USA) equipped with a long wavelength emission filter (675-730 nm).

[0122] The orthotopic GBM mice were weighed and randomly divided into four groups (n=4), and each group was intravenously injected with PBS (200 μL), ASO, ASO-SC@D-Cb, or ASO@D-Cb (400 pmol ASO/mouse) via the tail vein every two days for 10 days. The bioluminescence signal from the brain tumor, generated by intraperitoneal injection of 150 mg/kg D-luciferin, was imaged on every injection day before treatment. An IVIS (Ami HT imaging system) was used to repeatedly acquire the images over 10 minutes at intervals of 2 minutes. The bioluminescence intensity was analyzed using Aura imaging software (Spectral Instruments Imaging). Mice body weights were monitored every 2 days during ASO@D-Cb treatment. After the mice were sacrificed on day 24, the major organs were collected, washed, and fixed with a 4% (v/v) PFA solution overnight at 4° C. The fixed tissues were embedded in paraffin, sectioned, and mounted on glass slides. The sections were stained with hematoxylin and eosin (H&E) and subjected to a transferase-mediated nick end labeling (TUNEL) assay.

[0123] Cell lysates (10 μg) or brain lysates (50 μg) were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After the electrophoresis, the proteins in the SDS-PAGE gel were transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with TBST (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20) containing 5% skim milk at room temperature for 1 hour and then washed with TBST three times. The membrane was incubated with primary antibodies, specifically anti-PLK1 antibody (dilution 1:1000, Santa Cruz Biotechnology) and anti-GAPDH antibody (dilution 1:1000, Cell Signaling Technology) in TBST overnight at 4° C. The unbound antibodies were washed with TBST three times. Then, the membrane was incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (dilution 1:10,000, Santa Cruz Biotechnology) in TBST containing 5% skim milk at room temperature for 1 hour. After a rigorous washing the membrane with TBST three times, protein bands were visualized utilizing the Super Signal™ West Pico Chemiluminescent substrate (Thermo Fisher Scientific). The resulting images were captured using an iBright FL1000 imaging system.

22. qRT-PCR

[0124] U87MG cells were seeded on a 12-well plate (2×10⁵ cells/well). Cells were treated with ASO, ASO@D-Cb, ASO-SC@D-Cb, PBS, D-Cb, and ASO/Lipofectamine RNAiMax in 10% FBS-supplemented DMEM. After 24 hours, the cellular RNA was extracted using an RNeasy Mini kit (Qiagen). The RNA concentration was quantified by a Nanodrop system (Thermo Fisher Scientific). The cDNA of the cellular RNA (2 μg) was prepared by random hexamer-primed reverse transcription. The cDNA was mixed with 2×SYBR Green Master Mix (Thermo Fisher Scientific) and PLK1 or GAPDH primers (primer sequences are shown in Table 2 below). PCR of the cDNA was performed using a StepOnePlus real-time PCR system (Applied Biosystems). The relative amount of PLK1 transcripts was normalized based on the amount of GAPDH transcripts, calculated with the 2-ΔΔCt method. To estimate PLK1 mRNA levels in the brain lysates, total RNA was extracted from homogenized brain tissues and analyzed using the procedure described above.

TABLE 2
			SEQ
			ID
Gene	Primer	Sequence	NO.
PLK1	F	GCACAGTGTCAATGCCTCCAAG	16
	R	GCCGTACTTGTCCGAATAGTCC	17
GAPDH	F	GTCTCCTCTGACTTCAACAGCG	18
	R	ACCACCCTGTTGCTGTAGCCAA	19

[0125] Assuming that small-sized nanocarriers are likely to be absorbed by cerebral microvascular endothelial cells and pass through the BBB, wireframe DNA nanostructures with a 10 bp duplex per side were designed to have one of three shapes: tetrahedron (Td), triangular prism (Tp), and cube (Cb), and two types of deoxyribose backbone: D-DNA and L-DNA (total of six types of DNA nanostructures) (FIG. 2A). The base sequences constituting the wireframes of each DNA nanostructure are shown in Table 1 above, and the DNA nanostructures were prepared via self-assembly of oligonucleotides through a heating and annealing process (Biomaterials 2019; 195: 1-12).

[0126] The fabricated six types of DNA nanostructures were characterized by electrospray ionization mass spectrometry (ESI-MS) and the results are shown in Table 3 below.

	TABLE 3
	Estimated		Estimated
D-DNA	[M − H]−	Observed	L-DNA	[M − H]−	Observed
Td	S1	3′FAM	10946.3	10949.3	Td	S1	3′FAM	10946.3	10945.9
	S2	3′NH	10642.8	10643.5		S2	3′NH	10642.8	10643.4
	S3	3′NH	10590.7	10590.0		S3	3′NH	10590.7	10590.7
	S4	3′NH	10659.8	10660.0		S4	3′NH	10659.8	10660.0
Tp	S1	3′FAM	11125.4	11128.4	Tp	S1	3′FAM	11125.4	11128.4
	S2	3′NH	14283.2	14283.6		S2	3′NH	14283.2	14283.8
	S3	3′NH	10803.9	10804.5		S3	3′NH	10803.9	10804.5
	S4	3′NH	14103.0	14103.8		S4	3′NH	14103.0	14103.4
	S5	3′NH	14222.1	14222.3		S5	3′NH	14222.1	14222.3
Cb	S1	3′FAM	14847.9	14847.3	Cb	S1	3′FAM	14847.9	14830.6
	S2	3′NH	14428.2	14428.3		S2	3′NH	14428.2	14428.4
	S3	3′NH	14350.2	14350.4		S3	3′NH	14350.2	14350.0
	S4	3′NH	14287.1	14287		S4	3′NH	14287.1	14287
	S5	3′NH	14138.0	14137.0		S5	3′NH	14138.0	14137.8
	S6	3′NH	14179.1	14179.4		S6	3′NH	14179.1	14179.3
indicates data missing or illegible when filed

[0127] The self-assembly of the oligonucleotides was evaluated by polyacrylamide gel electrophoresis (PAGE). DNA nanostructures were imaged by atomic force microscopy (AFM), which roughly revealed the shapes of the DNA nanostructures as designed (FIG. 2B). The hydrodynamic sizes of the DNA nanostructures measured by dynamic light scattering were 6.17±0.12 nm for Tds, 7.22±0.15 nm for Tps, and 7.45±0.11 nm for Cbs (FIG. 2C). The sizes of DNA nanostructures based on the D-DNA backbone (D-Td, D-Tp, and D-Cb) were nearly identical to those based on the L-DNA backbone (6.18±0.20 nm for L-Td, 7.22±0.20 nm for L-Tp, and 7.40±0.21 nm for L-Cb). Serum stability of the DNA nanostructures was also tested. As a result, it was determined that the D-DNA nanostructures degraded in 50% mouse serum after 2-4 hours, while all the L-DNA nanostructures were highly stable in the serum as expected (FIG. 2D).

[0128] The DNA nanostructures were fabricated and characterized, and their in vivo distribution in mice was investigated. Mice were intravenously injected with the Cy5.5-labeled DNA nanostructures and monitored for 24 hours (FIGS. 3A to 3C). In vivo imaging showed that all the DNA nanostructures except D-Tp were distributed throughout the body within 1 hour after injection. At 2 hours post-injection, major organs were harvested from the mice and imaged to estimate the distribution level of the nanostructures in each organ using Cy5.5 intensity (FIG. 4). Most of the DNA nanostructures were distributed to the liver and kidneys. Focusing on brain distribution, D-Cb showed the highest distribution level, followed by L-Cb and L-Tp (FIG. 3A). The brain distribution level of D-Cb was about 0.25% ID/g as quantified by measuring the Cy5.5 intensity of brain lysates (FIG. 3B). Since Cy5.5 intensity reports the sum of intact and fragmented structures, the inventors also attempted to estimate only the amount of intact D-Cb distributed in the brain by quantifying the band of the intact strand (Cy5.5-S1) in D-Cb based on a denaturing PAGE analysis of the homogenized brain tissue lysates (FIG. 6). The brain distribution level of intact D-Cb was 0.22% ID/g at 2 hours post injection, which was approximately 4-fold higher than that of intact L-Cb although D-Cb is less stable in serum than L-Cb (FIG. 5B and FIG. 2D). Even when the DNA nanostructures were labeled with a negatively charged dye (fluorescein, FAM) instead of a positively charged dye (Cy5.5), their brain distribution levels were not changed significantly (FIG. 5B). This indicates that the brain distribution property of D-Cb was not driven by the fluorescence label. When biotinylated D-Cb was injected, the brain distribution of D-Cb could also be detected by mass analysis of the biotinylated strand (S5) in D-Cb, which was pulled down with streptavidin-coated magnetic beads from brain lysates (FIG. 7). Interestingly, the brain distribution level of D-Cb, even without brain-targeting ligands, was comparable to that of some of the other nanoparticles conjugated with brain-targeting ligands such as ANG, bovine serum albumin (BSA), and transferrin. This demonstrates that the protein corona-assisted brain delivery may similarly be efficient as a targeted delivery system? based on ligand conjugation.

[0129] To investigate whether the brain-reaching property of D-Cb is based on BBB penetration, the inventors estimated the BBB-penetration potential of D-Cb using an in vitro BBB monolayer model (FIG. 5C). FAM-labeled D-Cb was added to the apical side of the in vitro BBB model. The amount of the transcytosed DNA nanostructures was estimated by measuring FAM intensity in the basolateral side (FIG. 5C and FIG. 8A). The transcytosis efficiency of D-Cb increased with the incubation time (FIG. 5D). L-Cb showed lower transcytosis efficiency than D-Cb of other shapes with the same cube structure or the same D-backbone (D-Td and D-Tp) (FIG. 5D), indicating that the proper combination of the backbone and the shape is critical for passing through the BBB. Transepithelial/transendothelial electrical resistance (TEER) was not changed after treatment with the DNA nanostructures, indicating that the integrity of the tight junction was maintained during the transcytosis and was not disrupted by the treatment (FIG. 8B). The apparent permeability coefficient (P_app) of D-Cb was also higher than that of any structures sharing either the backbone or the shape with D-Cb, consistently suggesting the potential of the D-Cb structure as a means for penetrating the BBB for brain delivery (FIG. 8C). Unassembled single-stranded DNA strands were hardly able to penetrate the monolayer model, indicating that the three-dimensional D-Cb structure is critical for transcytosis (FIG. 3D and FIG. 8A).

[0130] After observing significant levels of D-Cb distribution within the brain, the inventors intended to identify the factors that contribute to the distribution of D-Cb within the brain. The serum half-life of D-Cb, exceeding 2 hours, may indicate that a significant quantity of D-Cb was distributed within the brain. However, considering that L-Cb, which is much more stable than D-Cb in serum, showed a lower level of brain distribution, the inventors believe that the main factors affecting the brain distribution of D-Cb was something other than the serum half-life. Recent studies have demonstrated the critical role of the protein corona in the biodistribution of DNA nanostructures. Based on these findings, the inventors hypothesized that the formation of a protein corona on D-Cb following intravenous injection may contribute to its distribution within the brain. To investigate the formation of a protein corona by serum proteins, the inventors used mass spectrometry (MS)-based proteomic analysis to identify the proteins in mouse serum that could form a corona on D-Cb (FIG. 9A). Sodium dodecyl sulfate (SDS)-PAGE analysis revealed significantly higher protein adsorption on D-Cb compared to L-Cb (FIG. 9B). The amount of proteins pulled down with L-Cb was similar to the background level observed with naked magnetic beads. Mass spectral analysis identified 210 proteins bound to the three types of samples, with two or more unique peptides assigned. Of these, 157, 179, and 152 proteins were identified in samples pulled down with beads, D-Cb, and L-Cb, respectively, with 114 shared proteins found among the three types of samples (FIG. 9C and Table 4). Label-free quantitative analysis based on peak areas among the three sample groups revealed 165 statistically significant proteins (p-value <0.05) using one-way analysis of variance (ANOVA) from a comparison of the log₂ (normalized abundance) values (FIG. 9D and Table 5).

TABLE 4
					#
Accession	Protein	Gene	Coverage	#	Unique	#	MWc	calc.
No.	description	symbol	[%]	PSMsa	Peptides	AAsb	[kDa]	pI	Bead	D-Cb	L-Cb
P63101	14-3-3 protein zeta/delta	YWHAZ	20	79	4	245	27.8	4.79	◯	◯	◯
P68134	Actin, alpha skeletal muscle	ACTA1	55	306	7	377	42	5.39	◯	◯	◯
P60710	Actin, cytoplasmic 1	ACTB	61	417	6	375	41.7	5.48	◯	◯	◯
Q60994	Adiponectin	ADIPOQ	26	69	6	247	26.8	5.57	◯	◯	◯
O89020	Afamin	AFM	45	216	24	608	69.3	5.78	◯	◯	◯
P07724	Albumin	ALB	90	13037	78	608	68.6	6.07	◯	◯	◯
Q60590	Alpha-1-acid	ORM1	23	58	5	207	23.9	5.85	◯	◯	◯
	glycoprotein 1
P22599	Alpha-1-antitrypsin 1- 2	SERPINA1B	56	1071	7	413	45.9	5.54	◯	◯	◯
Q00896	Alpha-1-antitrypsin 1- 3	SERPINA1C	52	1463	5	412	45.8	5.44	◯	◯	◯
Q00897	Alpha-1-antitrypsin 1- 4	SERPINA1D	49	835	4	413	46	5.44	◯	◯	◯
Q00898	Alpha-1-antitrypsin 1- 5	SERPINA1E	29	537	3	413	45.9	5.73	◯	◯	◯
Q61247	Alpha-2-antiplasmin	SERPINF2	25	187	9	491	54.9	6.3	◯	◯	◯
P29699	Alpha-2-HS- glycoprotein	AHSG	46	575	9	345	37.3	6.51	◯	◯	◯
P00687	Alpha-amylase 1	AMY1	18	102	7	511	57.6	6.96	◯	◯	◯
P10107	Annexin A1	ANXA1	16	61	7	346	38.7	7.37	◯	◯	◯
P07356	Annexin A2	ANXA2	33	48	10	339	38.7	7.69	◯	◯	◯
P32261	Antithrombin-III	SERPINC1	47	315	15	465	52	6.46	◯	◯	◯
Q00623	Apolipoprotein A-I	APOA1	52	1024	16	264	30.6	5.73	◯	◯	◯
P06728	Apolipoprotein A-IV	APOA4	63	351	19	395	45	5.47	◯	◯	◯
P08226	Apolipoprotein E	APOE	34	53	9	311	35.8	5.68	◯	◯	◯
Q01339	Beta-2-glycoprotein 1	APOH	44	194	15	345	38.6	8.22	◯	◯	◯
P08607	C4b-binding protein	C4BPA	25	74	9	469	51.5	7.15	◯	◯	◯
P23953	Carboxylesterase 1C	CES1C	38	295	15	554	61	5.06	◯	◯	◯
Q9DBB9	Carboxypeptidase	CPN2	22	40	8	547	60.4	5.88	◯	◯	◯
	N subunit 2
Q9QWK4	CD5 antigen-like	CD5L	29	75	9	352	38.8	5.16	◯	◯	◯
Q61147	Ceruloplasmin	CP	53	1046	48	1061	121.1	5.85	◯	◯	◯
Q06890	Clusterin	CLU	16	148	7	448	51.6	5.67	◯	◯	◯
O88947	Coagulation factor X	F10	22	25	6	481	54	5.66	◯	◯	◯
P14106	Complement	C1QB	27	87	5	253	26.7	8.15	◯	◯	◯
	C1q subcomponent
	subunit B
Q8CG16	Complement C1r-A	C1RA	7	22	4	707	80	5.66	◯	◯	◯
	subcomponent
P01027	Complement C3	C3	71	2134	91	1663	186.4	6.73	◯	◯	◯
P01029	Complement C4-B	C4B	39	264	45	1738	192.8	7.53	◯	◯	◯
P06684	Complement C5	C5	29	265	37	1680	188.8	6.81	◯	◯	◯
P04186	Complement factor B	CFB	31	197	23	761	85	7.37	◯	◯	◯
P06909	Complement factor H	CFH	44	388	41	1234	139	6.99	◯	◯	◯
Q61129	Complement factor I	CFI	23	56	9	603	67.2	7.46	◯	◯	◯
Q06770	Corticosteroid-binding	SERPINA6	16	44	6	397	44.7	5.24	◯	◯	◯
	globulin
P10126	Elongation	EEF1A1	21	55	8	462	50.1	9.01	◯	◯	◯
	Factor 1-alpha 1
P20029	Endoplasmic	HSPA5	9	33	3	655	72.4	5.16	◯	◯	◯
	reticulum
	chaperone BiP
Q01279	Epidermal growth	EGFR	11	56	10	1210	134.8	6.86	◯	◯	◯
	factor receptor
Q9QXC1	Fetuin-B	FETUB	38	30	8	388	42.7	6.61	◯	◯	◯
P11276	Fibronectin	FN1	26	324	44	2477	272.4	5.59	◯	◯	◯
P05064	Fructose-	ALDOA	24	27	7	364	39.3	8.09	◯	◯	◯
	bisphosphate
	aldolase A
P13020	Gelsolin	GSN	38	298	23	780	85.9	6.18	◯	◯	◯
P01898	H-2 class I	H2-Q10	46	141	11	325	37.2	5.25	◯	◯	◯
	histocompatibility
	antigen, Q10
	alpha chain
Q61646	Haptoglobin	HP	59	495	18	347	38.7	6.29	◯	◯	◯
P63017	Heat shock cognate 71 kDa	HSPA8	10	32	4	646	70.8	5.52	◯	◯	◯
	protein
P01942	Hemoglobin subunit	HBA	84	741	9	142	15.1	8.22	◯	◯	◯
	alpha
P02088	Hemoglobin subunit	HBB-B1	88	743	6	147	15.8	7.65	◯	◯	◯
	beta-1
Q91X72	Hemopexin	HPX	66	1889	32	460	51.3	7.8	◯	◯	◯
P49182	Heparin cofactor 2	SERPIND1	23	60	8	478	54.5	7.34	◯	◯	◯
Q9ESB3	Histidine-rich	HRG	28	313	14	525	59.1	7.66	◯	◯	◯
	glycoprotein
Q64475	Histone H2B type 1-B	H2BC3	37	13	4	126	13.9	10.32	◯	◯	◯
P62806	Histone H4	H4F16	55	94	8	103	11.4	11.36	◯	◯	◯
P01878	Ig alpha chain		51	354	12	344	36.9	5.06	◯	◯	◯
	C region
P01869	Ig gamma-1 chain	IGHG1	44	330	12	393	43.4	6.44	◯	◯	◯
	C region,
	membrane-bound form
P01864	Ig gamma-2A chain		25	513	4	335	36.6	8.22	◯	◯	◯
	C region secreted form
P01865	Ig gamma-2A chain	IGH-1A	43	492	7	398	43.9	6.29	◯	◯	◯
	C region,
	membrane-bound form
P03987	Ig gamma-3 chain		60	153	13	398	43.9	7.14	◯	◯	◯
	C region
P18531	Ig heavy chain	IGHV3-6	31	33	2	116	13.1	8.78	◯	◯	◯
	V region 3-6
P18527	Ig heavy chain		47	47	2	97	10.7	9.17	◯	◯	◯
	V region 914
P01746	Ig heavy chain		17	25	2	140	15.5	8.4	◯	◯	◯
	V region 93G7
P06330	Ig heavy chain		72	146	3	118	12.9	7.11	◯	◯	◯
	V region AC38 205.12
P01791	Ig heavy chain		20	22	2	123	13.9	6.06	◯	◯	◯
	V region HPCM6
P18524	Ig heavy chain		44	38	3	117	12.9	19.29	◯	◯	◯
	V region RF
P01807	Ig heavy chain		48	82	2	119	13.2	7.94	◯	◯	◯
	V region X44
P01632	Ig kappa chain	IGKV7-33	14	17	2	114	12.7	8.98	◯	◯	◯
	V-I region S107A
P01631	Ig kappa chain		43	41	4	113	12.3	8.88	◯	◯	◯
	V-II region 26-10
P01630	Ig kappa chain		21	21	2	113	12.5	8.65	◯	◯	◯
	V-II region 7S34.1
P01638	Ig kappa chain		36	81	3	115	13	7.81	◯	◯	◯
	V-V region L6
	(Fragment)
P01642	Ig kappa chain	GM10881	23	12	2	115	12.6	5.94	◯	◯	◯
	V-V region L7
	(Fragment)
P01636	Ig kappa chain		35	18	3	108	12	7.28	◯	◯	◯
	V-V region MOPC 149
P01843	Ig lambda-1 chain		81	212	5	105	11.6	6.27	◯	◯	◯
	C region
P01723	Ig lambda-1 chain		34	32	2	117	12.2	5.21	◯	◯	◯
	V region
P01844	Ig lambda-2 chain	IGLC2	86	76	5	104	11.2	6.27	◯	◯	◯
	C region
P01728	Ig lambda-2 chain		34	22	2	117	12.2	5.74	◯	◯	◯
	V region
P01867	Immunoglobulin heavy	IGHG2B	45	430	10	404	44.2	6.52	◯	◯	◯
	constant gamma 2B
P01872	Immunoglobulin heavy	IGHM	45	454	18	454	49.9	7.01	◯	◯	◯
	constant mu
P01635	Immunoglobulin kappa	IGKV12-41	41	60	4	115	12.6	8.31	◯	◯	◯
	chain variable 12-41
	(Fragment)
P01633	Immunoglobulin kappa	IGKV6-17	17	35	3	149	16.4	6.92	◯	◯	◯
	chain variable 6-17
P01837	Immunoglobulin kappa	IGKC	93	797	11	107	11.9	5.9	◯	◯	◯
	constant
Q9DBD0	Inhibitor of	ICA	56	220	27	700	76.7	7.25	◯	◯	◯
	carbonic anhydrase
A6X935	Inter alpha-trypsin inhibitor,	ITIH4	46	381	33	942	104.6	6.4	◯	◯	◯
	heavy chain 4
Q61702	Inter-alpha-trypsin inhibitor	ITIH1	36	136	22	907	101	6.96	◯	◯	◯
	heavy chain H1
Q61703	Inter-alpha-trypsin inhibitor	ITIH2	29	124	20	946	105.9	7.27	◯	◯	◯
	heavy chain H2
Q61704	Inter-alpha-trypsin inhibitor	ITIH3	26	104	17	889	99.3	6.05	◯	◯	◯
	heavy chain H3
O08677	Kininogen-1	KNG1	25	324	13	661	73.1	6.54	◯	◯	◯
P28665	Murinoglobulin-1	MUG1	55	1350	39	1476	165.2	6.42	◯	◯	◯
P28666	Murinoglobulin-2	MUG2	47	802	29	1451	162.3	6.74	◯	◯	◯
O70362	Phosphatidylinositol-	GPLD1	18	53	13	837	93.2	7.12	◯	◯	◯
	glycan-specific
	phospholipase D
P09411	Phosphoglycerate	PGK1	10	16	3	417	44.5	7.9	◯	◯	◯
	kinase 1
Q9DBJ1	Phosphoglycerate	PGAM1	14	16	3	254	28.8	7.18	◯	◯	◯
	mutase 1
P26262	Plasma kallikrein	KLKB1	26	93	13	638	71.3	8.02	◯	◯	◯
P97290	Plasma protease C1	SERPING1	41	129	16	504	55.5	6.29	◯	◯	◯
	inhibitor
P20918	Plasminogen	PLG	72	543	47	812	90.7	6.6	◯	◯	◯
Q61838	Pregnancy zone protein	PZP	61	2568	71	1495	165.7	6.68	◯	◯	◯
P11680	Properdin	CFP	14	68	4	464	50.3	7.84	◯	◯	◯
Q07456	Protein AMBP	AMBP	19	57	6	349	39	6.32	◯	◯	◯
Q9D2Q8	Protein S100-A14	S100A14	21	12	2	104	11.6	5.5	◯	◯	◯
P19221	Prothrombin	F2	31	170	16	618	70.2	6.43	◯	◯	◯
Q00724	Retinol-binding protein 4	RBP4	34	23	5	201	23.2	5.99	◯	◯	◯
P07759	Serine protease	SERPINA3K	61	1041	16	418	46.9	5.16	◯	◯	◯
	inhibitor A3K
Q921I1	Serotransferrin	TF	73	5294	65	697	76.7	7.18	◯	◯	◯
P12246	Serum amyloid P-	APCS	27	104	6	224	26.2	6.35	◯	◯	◯
	component
P52430	Serum paraoxonase/	PON1	34	109	8	355	39.5	5.22	◯	◯	◯
	arylesterase 1
Q8BND5	Sulfhydryl oxidase 1	QSOX1	18	60	11	748	82.7	7.17	◯	◯	◯
P35441	Thrombospondin-1	THBS1	26	176	23	1170	129.6	4.96	◯	◯	◯
P07309	Transthyretin	TTR	67	449	8	147	15.8	6.16	◯	◯	◯
P17751	Triosephosphate isomerase	TPI1	30	17	6	249	26.7	7.3	◯	◯	◯
P68368	Tubulin alpha-4A chain	TUBA4A	11	18	4	448	49.9	5.06	◯	◯	◯
P20152	Vimentin	VIM	26	190	9	466	53.7	5.12	◯	◯	◯
P21614	Vitamin D-binding protein	GC	74	474	26	476	53.6	5.5	◯	◯	◯
P29788	Vitronectin	VTN	20	98	5	478	54.8	5.88	◯	◯	◯
Q64726	Zinc-alpha-2- glycoprotein	AZGP1	35	69	8	307	35.3	6.18	◯	◯	◯
P07361	Alpha-1-acid glycoprotein 2	ORM2	15	33	2	207	23.8	5.45	X	◯	◯
P11859	Angiotensinogen	AGT	22	28	8	477	52	5.44	X	◯	◯
E9Q414	Apolipoprotein B-100	APOB	9	103	32	4505	509.1	6.81	X	◯	◯
P01887	Beta-2-microglobulin	B2M	16	15	2	119	13.8	8.44	X	◯	◯
Q9JJN5	Carboxypeptidase	CPN1	22	37	7	457	51.8	8.28	X	◯	◯
	N catalytic chain
O88783	Coagulation factor V	F5	2	26	4	2183	247.1	6.05	X	◯	◯
Q07968	Coagulation factor XIII B	F13B	4	15	3	669	76.1	6.92	X	◯	◯
	chain
P06683	Complement component C9	C9	8	14	3	548	62	5.78	X	◯	◯
P01749	Ig heavy chain	IGHV1-61	28	66	2	117	13	7.87	X	◯	◯
	V region 3
P01801	Ig heavy chain		43	196	3	115	12.8	7.12	X	◯	◯
	V-III region J606
P84750	Ig kappa chain		16	3	2	121	13.2	8.81	X	◯	◯
	V region Mem5
	(Fragment)
P01660	Ig kappa chain		49	14	2	111	12.1	5.38	X	◯	◯
	V-III region
	PC 3741/TEPC 111
P08071	Lactotransferrin	LTF	3	11	2	707	77.8	8.53	X	◯	◯
P42703	Leukemia inhibitory factor	LIFR	8	16	6	1092	122.5	6.04	X	◯	◯
	receptor
P26041	Moesin	MSN	5	4	2	577	67.7	6.6	X	◯	◯
Q8VCS0	N-acetylmuramoyl-L-	PGLYRP2	6	19	3	530	57.7	6.98	X	◯	◯
	alanine amidase
P97298	Pigment epithelium-	SERPINF1	27	17	8	417	46.2	6.98	X	◯	◯
	derived factor
Q61233	Plastin-2	LCP1	3	16	2	627	70.1	5.33	X	◯	◯
P31532	Serum amyloid A-4 protein	SAA4	42	23	6	130	15.1	9.26	X	◯	◯
Q62351	Transferrin receptor	TFRC	13	19	10	763	85.7	6.57	X	◯	◯
	protein 1
O70456	14-3-3 protein sigma	SFN	17	19	4	248	27.7	4.78	◯	X	◯
P17182	Alpha-enolase	ENO1	6	3	2	434	47.1	6.8	◯	X	◯
E9Q557	Desmoplakin	DSP	8	78	18	2883	332.7	6.8	◯	X	◯
Q8VCM7	Fibrinogen gamma chain	FGG	7	12	2	436	49.4	5.86	◯	X	◯
P16858	Glyceraldehyde-3-	GAPDH	29	20	6	333	35.8	8.25	◯	X	◯
	phosphate dehydrogenase
Q61696	Heat shock 70 kDa	HSPA1A	9	21	4	641	70	5.72	◯	X	◯
	protein 1A
P07901	Heat shock protein	HSP90AA1	1	9	2	733	84.7	5.01	◯	X	◯
	HSP 90-alpha
P11499	Heat shock protein	HSP90AB1	8	14	4	724	83.2	5.03	◯	X	◯
	HSP 90-beta
Q02257	Junction plakoglobin	JUP	10	21	6	745	81.7	6.14	◯	X	◯
P11247	Myeloperoxidase	MPO	5	12	3	718	81.1	9.55	◯	X	◯
Q8VDD5	Myosin-9	MYH9	2	6	3	1960	226.2	5.66	◯	X	◯
P17742	Peptidyl-prolyl	PPIA	32	15	4	164	18	7.9	◯	X	◯
	cis-trans isomerase A
P97350	Plakophilin-1	PKP1	6	24	4	728	80.8	8.91	◯	X	◯
P48678	Prelamin-A/C	LMNA	6	14	3	665	74.2	6.98	◯	X	◯
P09103	Protein disulfide- isomerase	P4HB	7	15	3	509	57	4.88	◯	X	◯
P68372	Tubulin beta-4B chain	TUBB4B	21	43	2	445	49.8	4.89	◯	X	◯
Q60930	Voltage-dependent	VDAC2	11	3	2	295	31.7	7.49	◯	X	◯
	anion-selective channel
	protein 2
Q9R269	Periplakin	PPL	1	2	2	1755	203.9	5.54	X	X	◯
P98086	Complement C1q	C1QA	16	29	3	245	26	9.11	◯	◯	X
	subcomponent
	subunit A
Q02105	Complement C1q	C1QC	16	140	3	246	26	8.54	◯	◯	X
	subcomponent
	subunit C	C8A
Q8K182	Complement component		7	9	3	587	66	6.54	◯	◯	X
	C8 alpha chain
Q8BH35	Complement component	C8B	16	23	6	589	66.2	7.77	◯	◯	X
	C8 beta chain
P62897	Cytochrome c,	CYCS	24	9	2	105	11.6	9.58	◯	◯	X
	somatic
Q08879	Fibulin-1	FBLN1	5	7	2	705	78	5.16	◯	◯	X
Q9R098	Hepatocyte growth factor	HGFAC	6	53	3	653	70.5	7.03	◯	◯	X
	activator
P06151	L-lactate dehydrogenase A	LDHA	16	38	4	332	36.5	7.74	◯	◯	X
	chain
O70570	Polymeric immunoglobulin	PIGR	5	12	2	771	84.9	5.4	◯	◯	X
	receptor
Q8R121	Protein Z-dependent	SERPINA10	17	27	6	448	51.8	5.67	◯	◯	X
	protease inhibitor
Q91WP6	Serine protease	SERPINA3N	20	251	5	418	46.7	5.82	◯	◯	X
	inhibitor A3N
P61939	Thyroxine-binding globulin	SERPINA7	11	28	4	418	47	6.54	◯	◯	X
Q9QZ25	Vascular non-inflammatory	VNN3	7	6	3	500	56.3	6.29	◯	◯	X
	molecule 3
Q6GQT1	Alpha-2- macroglobulin-P	A2M	3	36	2	1474	164.2	6.61	X	◯	X
Q9Z1R3	Apolipoprotein M	APOM	7	5	2	190	21.3	6.52	X	◯	X
P00920	Carbonic anhydrase 2	CA2	18	16	4	260	29	7.01	X	◯	X
Q9JHH6	Carboxypeptidase B2	CPB2	13	20	4	422	48.8	7.97	X	◯	X
P10605	Cathepsin B	CTSB	9	3	2	339	37.3	5.91	X	◯	X
Q03311	Cholinesterase	BCHE	4	2	2	603	68.4	7.25	X	◯	X
Q80YC5	Coagulation factor XII	F12	16	29	6	597	65.7	6.84	X	◯	X
Q8CG14	Complement C1s-1	C1S1	14	20	7	688	76.8	5.08	X	◯	X
	subcomponent
P21180	Complement C2	C2	8	25	5	760	84.7	7.56	X	◯	X
Q8VCG4	Complement component	C8G	34	26	5	202	22.5	9.25	X	◯	X
	C8 gamma chain
P14847	C-reactive protein	CRP	17	28	3	225	25.3	6.2	X	◯	X
Q8BPB5	EGF-containing fibulin-like	EFEMP1	6	6	2	493	54.9	5.14	X	◯	X
	extracellular matrix protein 1
Q8K1B8	Fermitin family	FERMT3	6	12	3	665	75.6	7.05	X	◯	X
	homolog 3
Q8BTM8	Filamin-A	FLNA	1	11	2	2647	281	6.04	X	◯	X
Q923D2	Flavin reductase	BLVRB	13	5	2	206	22.2	7.01	X	◯	X
	(NADPH)
Q91Y97	Fructose-bisphosphate	ALDOB	9	14	2	364	39.5	8.27	X	◯	X
	aldolase B
P46412	Glutathione peroxidase 3	GPX3	29	21	5	226	25.4	8.22	X	◯	X
P14426	H-2 class I histocompatibility	H2-D1	11	10	3	362	40.6	5.47	X	◯	X
	antigen,
	D-K alpha chain
P02089	Hemoglobin subunit beta-2	HBB-B2	62	343	3	147	15.9	8.05	X	◯	X
P06336	Ig epsilon chain C region		15	49	5	421	47.3	7.44	X	◯	X
P01670	Ig kappa chain		60	44	2	111	12	8	X	◯	X
	V-III region PC 6684
P70389	Insulin-like growth factor-	IGFALS	22	36	11	603	66.9	6.6	X	◯	X
	binding protein complex
	acid labile subunit
P09581	Macrophage colony-stimulating	CSF1R	2	8	2	977	109.1	6.21	X	◯	X
	factor 1 receptor
P16301	Phosphatidylcholine-sterol	LCAT	5	2	2	438	49.7	6.43	X	◯	X
	acyltransferase
Q9Z126	Platelet factor 4	PF4	29	15	3	105	11.2	9.29	X	◯	X
O08742	Platelet glycoprotein V	GP5	8	16	3	567	63.4	8.97	X	◯	X
Q60963	Platelet-activating	PLA2G7	6	23	2	440	49.2	7.12	X	◯	X
	factor acetylhydrolase
P70274	Selenoprotein P	SELENOP	12	21	3	380	42.7	7.09	X	◯	X
Q03734	Serine protease	SERPINA3M	36	423	5	418	47	6.1	X	◯	X
	inhibitor A3M
P26039	Talin-1	TLN1	2	5	4	2541	269.7	6.18	X	◯	X
O88968	Transcobalamin-2	TCN2	16	3	3	430	47.6	6.33	X	◯	X
P82198	Transforming growth factor-	TGFBI	3	2	2	683	74.6	7.06	X	◯	X
	beta-induced protein ig-h3
Q7TPR4	Alpha-actinin-1	ACTN1	6	16	2	892	103	5.38	◯	X	X
Q9JI91	Alpha-actinin-2	ACTN2	14	13	9	894	103.8	5.45	◯	X	X
Q9WUA3	ATP-dependent 6-	PFKP	2	4	2	784	85.4	7.11	◯	X	X
	phosphofructokinase,
	platelet type
P21550	Beta-enolase	ENO3	5	3	2	434	47	7.18	◯	X	X
P07310	Creatine kinase M-type	CKM	11	3	2	381	43	7.06	◯	X	X
Q9WUB3	Glycogen phosphorylase,	PYGM	9	10	6	842	97.2	7.11	◯	X	X
	muscle form
P97457	Myosin regulatory	MYL11	17	2	2	169	18.9	4.92	◯	X	X
	light chain 11
Q5SX40	Myosin-1	MYH1	22	111	2	1942	223.2	5.76	◯	X	X
P13541	Myosin-3	MYH3	12	61	2	1940	223.7	5.81	◯	X	X
Q91Z83	Myosin-7	MYH7	10	29	2	1935	222.7	5.76	◯	X	X
P13542	Myosin-8	MYH8	20	97	2	1937	222.6	5.83	◯	X	X
A2ASS6	Titin	TTN	0	10	6	35213	3904.1	6.2	◯	X	X
P21107	Tropomyosin alpha-3 chain	TPM3	26	53	2	285	33	4.72	◯	X	X

TABLE 5
			Normalized	Normalized
Accession	Protein	Gene	abundance_bead	abundance_D-Cb
No.	description	symbol	1	2	3	1	2	3
P19221	Prothrombin	F2	2.64E+07	2.18E+07	2.29E+07	1.27E+08	1.63E+08	1.52E+08
E9Q557	Desmoplakin	DSP	6.10E+06	7.98E+06	1.14E+07	8.18E+04	2.48E+05	2.01E+05
P06684	Complement C5	C5	1.07E+07	8.69E+06	9.72E+06	1.26E+08	2.34E+08	1.63E+08
P52430	Serum	PON1	1.35E+07	1.60E+07	1.49E+07	1.85E+08	1.12E+08	1.87E+08
	paraoxonase/
	arylesterase 1
Q9R269	Periplakin	PPL	1.82E+05	Not	Not	Not	Not	Not
				detected	detected	detected	detected	detected
Q9R098	Hepatocyte	HGFAC	8.74E+05	1.03E+06	6.60E+05	5.67E+06	9.34E+06	7.83E+06
	growth
	factor
	activator
Q61646	Haptoglobin	HP	1.02E+09	1.13E+09	9.61E+08	4.33E+09	3.45E+09	5.26E+09
P98086	Complement	C1QA	5.50E+06	4.95E+06	5.74E+06	8.33E+07	5.19E+07	4.37E+07
	C1q
	subcomponent
	subunit A
Q61247	Alpha-	SERPIN	4.97E+07	3.09E+07	2.60E+07	1.59E+08	1.60E+08	1.49E+08
	2-	F2
	antiplasmin
Q9Z1R3	Apolipoprotein M	APOM	1.66E+06	1.87E+06	3.15E+06	2.20E+07	1.55E+07	1.23E+07
P26041	Moesin	MSN	Not	Not	Not	3.24E+05	5.27E+04	3.85E+05
			detected	detected	detected
P35441	Thrombospondin-1	THBS1	1.06E+07	1.26E+07	1.15E+07	1.15E+08	2.05E+08	3.40E+08
Q02105	Complement	C1QC	5.77E+06	4.10E+06	9.06E+06	8.11E+07	6.05E+07	4.38E+07
	C1q
	subcomponent
	subunit C
O88783	Coagulation	F5	5.66E+05	5.09E+05	4.01E+05	1.03E+07	4.73E+06	1.60E+07
	factor V
P14106	Complement	C1QB	1.66E+07	1.84E+07	1.23E+07	2.18E+08	9.06E+07	1.14E+08
	C1q
	subcomponent
	subunit B
P01029	Complement	C4B	4.70E+07	7.13E+07	2.93E+07	5.97E+08	4.88E+08	9.63E+08
	C4-B
P01872	Immunoglobulin	IGHM	2.14E+08	2.50E+08	1.55E+08	2.40E+09	1.49E+09	3.65E+09
	heavy
	constant
	mu
P01878	Ig alpha		3.87E+08	3.01E+08	2.11E+08	1.25E+09	1.74E+09	1.75E+09
	chain C
	region
P21180	Complement C2	C2	7.54E+05	8.99E+05	2.92E+05	1.13E+07	1.01E+07	1.44E+07
Q61233	Plastin-2	LCP1	5.26E+05	3.28E+05	1.96E+05	6.14E+05	5.73E+05	4.66E+05
P01898	H-2 Class I	H2-Q10	3.56E+07	5.22E+07	1.79E+07	4.02E+08	2.53E+08	4.63E+08
	histocompatibility
	antigen, Q10
	alpha chain
P14847	C-reactive	CRP	6.92E+05	5.00E+05	1.10E+06	2.15E+07	1.10E+07	9.75E+06
	protein
P14426	H-2 Class I	H2-D1	7.21E+05	9.16E+05	3.23E+05	8.76E+06	6.23E+06	1.08E+07
	histocompatibility
	antigen, D-K
	alpha chain
Q61696	Heat shock	HSPA1A	3.00E+06	3.75E+06	5.92E+06	4.72E+06	2.19E+06	5.72E+06
	70 kDa
	protein 1A
P08226	Apolipoprotein	APOE	1.85E+07	2.11E+07	1.48E+07	5.22E+07	4.19E+07	6.42E+07
	E
P01791	Ig heavy chain		1.42E+06	1.40E+06	2.44E+06	1.87E+07	1.74E+07	3.02E+07
	V region
	HPCM 6
P12246	Serum amyloid	APCS	7.48E+07	5.26E+07	9.80E+07	8.15E+08	4.68E+08	3.85E+08
	P-component
P01631	Ig kappa chain		1.65E+08	1.25E+08	2.37E+08	1.20E+09	9.16E+08	6.80E+08
	V-II region
	26-10
P62806	Histone H4	H4F16	2.26E+07	3.32E+07	1.08E+08	1.08E+07	5.92E+06	2.74E+06
P01632	Ig kappa chain	IGKV7-33	3.67E+07	3.01E+07	5.79E+07	2.96E+08	2.04E+08	1.68E+08
	V-I region
	S107A
P01844	Ig lambda-2	IGLC2	4.49E+06	2.15E+06	6.61E+06	6.58E+07	4.69E+07	4.02E+07
	chain C region
P01843	Ig lambda-1		1.62E+07	1.10E+07	2.53E+07	2.14E+08	1.53E+08	9.50E+07
	chain C region
O70362	Phosphatidylinositol-	GPLD1	1.14E+07	9.88E+06	7.27E+06	4.88E+07	1.22E+08	1.24E+08
	glycan-specific
	phospholipase D
A6X935	Inter alpha-	ITIH4	3.11E+08	2.13E+08	1.33E+08	7.99E+08	1.30E+09	9.49E+08
	trypsin inhibitor,
	heavy chain 4
P28666	Murinoglobulin-2	MUG2	1.89E+07	2.25E+07	1.39E+07	1.89E+08	5.36E+08	1.01E+09
P01630	Ig kappa chain		1.31E+07	9.57E+06	2.26E+07	1.55E+08	1.18E+08	7.31E+07
	V-II region
	7S34.1
P01638	Ig kappa chain		1.61E+07	1.33E+07	3.18E+07	2.40E+08	1.40E+08	1.09E+08
	V-V region
	L6 (Fragment)
Q923 D2	Flavin	BLVRB	6.19E+05	2.47E+05	2.79E+0.5	3.82E+06	2.80	2.15E+06
	reductase
	(NADPH)
P01635	Immunoglobulin	IGKV12-41	8.63E+07	7.01E+07	1.46E+08	7.71E+08	5.26E+08	4.20E+08
	kappa chain
	variable 12-41
	(Fragment)
P01728	Ig lambda-2		3.43E+06	3.42E+06	7.00E+06	3.59E+07	2.29E+07	1.83E+07
	chain V region
P84750	Ig kappa chain		7.60E+06	5.04E+06	1.32E+07	8.51E+07	6.07E+07	4.46E+07
	V region
	Mem5 (Fragment)
Q60994	Adiponectin	ADIPOQ	1.43E+07	2.63E+07	8.52E+06	1.34E+08	7.88E+07	1.32E+08
Q07968	Coagulation	F13B	8.44E+05	1.28E+06	2.97E+05	1.79E+07	9.09E+06	2.23E+07
	factor XIII
	B chain
Q60590	Alpha-1-acid	ORM1	1.66E+07	1.48E+07	2.92E+07	1.62E+08	1.61E+08	2.89E+08
	glycoprotein 1
P09103	Protein	P4HB	4.73E+05	1.61E+06	1.93E+06	3.07E+05	4.67E+05	7.23E+05
	disulfide-
	isomerase
P08607	C4b-binding	C4BPA	1.67E+07	2.38E+07	1.01E+07	1.42E+08	8.89E+07	2.30E+08
	protein
Q61702	Inter-alpha-	ITIH1	1.13E+07	1.59E+07	4.90E+06	1.21E+08	2.11E+08	1.91E+08
	trypsin inhibitor
	heavy chain H1
Q07456	Protein AMBP	AMBP	1.78E+07	1.47E+07	8.54E+06	8.29E+07	1.98E+08	2.28E+08
Q9JJN5	Carboxypeptidase	CPN1	2.22E+06	3.00E+06	7.65E+06	5.05E+07	4.69E+07	6.89E+07
	N catalytic chain
Q80YC5	Coagulation	F12	4.67E+06	2.43E+06	1.14E+06	2.94E+07	2.88E+07	4.49E+07
	factor XII
P06909	Complement	CFH	6.63E+07	9.01E+07	4.68E+07	5.13E+08	1.24E+09	2.31E+09
	factor H
P01837	Immunoglobulin	IGKC	6.82E+08	7.05E+08	1.44E+09	4.76E+09	3.84E+09	3.28E+09
	kappa constant
P01636	Ig kappa chain		3.97E+07	2.83E+07	6.64E+07	4.10E+08	2.67E+08	1.96E+08
	V-V region
	MOPC 149
O08742	Platelet	GP5	2.35E+05	6.35E+05	1.77E+05	5.36E+06	3.19E+06	7.86E+06
	glycoprotein V
P48678	Prelamin-A/C	LMNA	3.67E+07	9.70E+07	1.01E+07	2.28E+05	6.54E+05	8.63E+05
Q9DBD0	Inhibitor of	ICA	2.62E+07	4.07E+07	1.09E+07	5.07E+08	2.68E+08	7.64E+08
	carbonic
	anhydrase
Q921I1	Serotransferrin	TF	8.14E+09	1.13E+10	4.70E+09	9.07E+10	5.01E+10	1.25E+11
P29788	Vitronectin	VTN	2.36E+07	1.32E+07	9.25E+06	9.30E+07	1.29E+08	9.23E+07
Q61704	Inter-alpha-	ITIH3	2.63E+07	2.82E+07	1.56E+07	1.33E+08	3.77E+08	5.38E+08
	trypsin inhibitor
	heavy chain H3
P01642	Ig kappa chain	GM10881	6.05E+06	3.57E+06	9.95E+06	7.44E+07	4.68E+07	3.87E+07
	V-V region
	L7 (Fragment)
P28665	Murinoglobulin-1	MUG1	3.57E+08	3.87E+08	2.69E+08	1.99E+09	5.40E+09	1.00E+10
P97350	Plakophilin-1	PKP1	2.25E+06	2.63E+06	Not	Not	Not	Not
					detected	detected	detected	detected
Q8VCG4	Complement	C8G	3.41E+06	2.26E+06	6.16E+06	3.83E+07	2.30E+07	1.74E+07
	component C8
	gamma chain
Q8CG16	Complement	C1RA	4.02E+06	3.72E+06	1.61E+06	1.32E+07	2.69E+07	2.01E+07
	C1r-A
	subcomponent
Q61703	Inter-alpha-	ITIH2	2.50E+07	2.44E+07	1.46E+07	1.25E+08	3.87E+08	2.98E+08
	trypsin inhibitor
	heavy chain H2
Q61147	Ceruloplasmin	CP	1.60E+08	1.99E+08	1.16E+08	9.74E+08	2.80E+09	5.03E+09
Q61838	Pregnancy	PZP	4.07E+09	5.65E+09	2.56E+09	1.66E+10	2.62E+10	5.23E+10
	zone protein
P01807	Ig heavy chain		5.15E+07	5.04E+07	1.11E+08	3.72E+08	4.88E+08	8.60E+08
	V region X44
P00920	Carbonic	CA2	3.20E+06	1.92E+06	3.89E+06	4.37E+07	2.44E+07	1.74E+07
	anhydrase 2
P01746	Ig heavy chain		9.21E+06	1.31E+07	2.16E+07	9.31E+07	1.22E+08	1.99E+08
	V region 93G7
Q8BND5	Sulfhydryl	QSOX1	1.58E+07	1.11E+07	5.35E+06	6.89E+07	7.06E+07	6.06E+07
	oxidase 1
P23953	Carboxylesterase 1C	CES1C	4.60E+08	4.57E+08	2.13E+08	3.25E+09	1.85E+09	5.03E+09
P01723	Ig lambda-1		8.50E+06	6.32E+06	1.57E+07	8.56E+07	5.14E+07	4.50E+07
	chain V region
Q62351	Transferrin	TFRC	1.38E+06	4.87E+05	8.72E+05	7.60E+06	2.68E+07	6.94E+06
	receptor
	protein 1
Q91Y97	Fructose-	ALDOB	2.39E+05	3.77E+05	1.14E+05	1.90E+06	1.13E+06	2.20E+06
	bisphosphate
	aldolase B
P20918	Plasminogen	PLG	1.79E+08	7.59E+07	1.23E+08	7.21E+08	2.05E+09	5.68E+08
O70456	14-3-3	SFN	2.10E+07	6.09E+07	1.03E+08	1.84E+07	1.19E+07	1.27E+07
	protein
	sigma
Q60930	Voltage-	VDAC2	Not	8.89E+05	3.02E+05	Not	Not	Not
	dependent		detected			detected	detected	detected
	anion-
	selective
	channel
	protein 2
P01801	Ig heavy chain		2.33E+07	2.21E+07	4.38E+07	1.72E+08	1.96E+08	3.12E+08
	V-III region J606
P68372	Tubulin beta-	TUBB4B	3.95E+06	9.94E+06	2.11E+07	2.90E+06	2.90E+06	4.57E+06
	4B chain
P01633	Immunoglobulin	IGKV6-17	1.26E+08	8.51E+07	2.14E+08	1.26E+09	6.54E+08	4.96E+08
	kappa chain
	variable 6-17
O88947	Coagulation	F10	4.43E+06	4.94E+06	8.05E+06	3.92E+07	4.43E+07	9.25E+07
	factor X
P32261	Antithrombin-III	SERPIN	9.22E+07	7.55E+07	5.82E+07	2.39E+08	3.42E+08	1.64E+08
		C1
P01660	Ig kappa chain		1.24E+07	8.10E+06	2.15E+07	1.11E+08	7.34E+07	5.79E+07
	V-III region
	PC3741/TEPC111
Q9ESB3	Histidine-rich	HRG	2.08E+08	1.88E+08	1.06E+08	4.68E+08	3.20E+08	5.55E+08
	glycoprotein
P46412	Glutathione	GPX3	2.62E+06	3.51E+06	8.41E+06	2.45E+07	2.37E+07	1.42E+07
	peroxidase 3
P26262	Plasma	KLKB1	5.26E+06	3.13E+06	9.94E+06	3.55E+07	5.52E+07	8.25E+07
	kallikrein
Q8R121	Protein Z-	SERPIN	5.24E+06	1.42E+06	1.05E+06	1.39E+07	1.74E+07	2.32E+07
	dependent	A10
	protease
	inhibitor
P04186	Complement	CFB	7.29E+07	3.13E+07	3.68E+07	2.22E+08	5.10E+08	1.55E+08
	factor B
P01027	Complement C3	C3	4.41E+09	3.59E+09	1.99E+09	1.61E+10	1.30E+10	1.19E+10
Q03734	Serine protease	SERPIN	1.04E+07	6.79E+06	5.91E+06	2.78E+07	4.57E+07	2.47E+07
	inhibit or A3M	A3M
P01867	Immunoglobulin	IGHG2B	6.98E+08	7.66E+08	1.92E+09	6.98E+09	8.99E+09	1.46E+10
	heavy constant
	gamma 2B
P20152	Vimentin	VIM	6.79E+07	2.14E+08	1.50E+08	2.74E+07	1.60E+07	2.32E+07
P01869	Ig gamma-1	IGHG1	5.97E+08	5.28E+08	1.33E+09	4.79E+09	5.89E+09	9.48E+09
	chain C
	region,
	membrane-
	bound form
P18527	Ig heavy chain		4.98E+06	3.35E+06	9.83E+06	4.50E+07	4.06E+07	7.71E+07
	V region 914
P01865	Ig gamma-2A	IGH-1A	1.13E+09	1.18E+09	2.69E+09	9.19E+09	1.11E+10	1.77E+10
	chain C region,
	membrane-
	bound form
P01864	Ig gamma-2A		4.72E+08	5.26E+08	1.22E+09	4.33E+09	5.17E+09	7.16E+09
	chain C region
	secreted form
P18531	Ig heavy chain	IGHV3-6	3.28E+06	2.85E+06	8.60E+06	3.98E+07	4.11E+07	8.46E+07
	V region 3-6
P49182	Heparin	SERPIN	1.59E+07	9.24E+06	3.56E+06	1.03E+08	6.64E+07	9.42E+07
	cofactor 2	D1
Q6GQT1	Alpha-2-	A2M	2.04E+05	3.20E+05	4.96E+04	1.91E+06	5.48E+06	9.95E+06
	macroglobulin-P
Q64726	Zinc-alpha-	AZGP1	1.11E+07	6.86E+06	2.02E+07	8.94E+07	9.67E+07	1.62E+08
	2-glycoprotein
Q8VCS0	N-acetyl	PGLYRP2	1.52E+06	1.93E+06	4.77E+05	1.79E+07	9.50E+06	2.24E+07
	muramoyl-L-
	alanine
	amidase
P06683	Complement	C9	3.31E+05	5.62E+05	2.47E+05	5.03E+06	5.24E+06	7.82E+06
	component C9
P70274	Selenoprotein P	SELENOP	3.02E+05	2.24E+05	4.81E+05	2.65E+06	3.98E+06	9.22E+06
Q06890	Clusterin	CLU	3.48E+07	4.15E+07	1.99E+07	8.39E+07	7.20E+07	1.41E+08
P17182	Alpha-	ENO1	1.78E+06	2.21E+05	4.80E+06	2.49E+05	Not	Not
	enolase						detected	detected
P10126	Elongation	EEF1A1	2.36E+07	5.98E+07	1.60E+08	1.48E+07	7.21E+06	1.01E+07
	factor
	1-alpha 1
Q8CG14	Complement	C1S1	3.91E+06	1.02E+06	1.78E+06	8.86E+06	3.30E+07	1.56E+07
	C1s-1
	subcomponent
P07361	Alpha-1-acid	ORM2	1.39E+06	1.32E+06	7.32E+06	2.39E+07	2.68E+07	3.00E+07
	glycoprotein 2
P13020	Gelsolin	GSN	1.03E+08	4.51E+07	8.13E+07	3.08E+08	9.56E+08	3.03E+08
O08677	Kininogen-1	KNG1	3.06E+08	1.87E+08	1.32E+08	5.33E+08	7.16E+08	5.38E+08
Q61129	Complement	CFI	9.47E+06	9.91E+06	1.64E+07	4.94E+07	1.13E+08	7.01E+07
	factor I
O88968	Transcobalamin-2	TCN2	Not	Not	Not	6.15E+05	8.90E+05	9.99E+05
			detected	detected	detected
P02089	Hemoglobin	HBB-B2	1.86E+06	2.78E+06	4.16E+06	1.22E+07	1.07E+07	6.70E+06
	subunit
	beta-2
P97290	Plasma	SERPIN	7.84E+07	2.34E+07	3.17E+07	1.51E+08	4.19E+08	1.92E+08
	protease	G1
	C1 inhibitor
P01670	Ig kappa chain		1.24E+07	3.56E+06	1.14E+07	9.20E+07	5.35E+07	4.97E+07
	V-III region
	PC 6684
Q02257	Junction	JUP	6.50E+06	1.01E+07	1.10E+05	1.28E+05	4.02E+04	1.30E+05
	plakoglobin
Q01339	Beta-2-	APOH	7.95E+07	9.25E+07	1.53E+08	3.66E+08	6.06E+08	4.07E+08
	glycoprotein 1
P11859	Angiotensinogen	AGT	3.35E+06	2.71E+06	8.28E+06	3.24E+07	4.16E+07	4.19E+07
P21614	Vitamin D-	GC	1.50E+08	1.39E+08	3.96E+08	1.28E+09	1.85E+09	2.69E+09
	binding protein
P03987	Ig gamma-3		1.37E+08	1.21E+08	3.66E+08	1.15E+09	1.46E+09	2.15E+09
	chain C region
P97298	Pigment	SERPIN	3.38E+06	2.45E+06	6.49E+06	2.99E+07	3.71E+07	6.04E+07
	epithelium-	F1
	derived
	factor
P18524	Ig heavy chain		3.19E+07	2.88E+07	6.94E+07	1.98E+08	2.66E+08	3.86E+08
	V region RF
Q8VCM7	Fibrinogen	FGG	Not	Not	3.25E+06	4.67E+05	Not	Not
	gamma chain		detected	detected			detected	detected
P11276	Fibroectin	nFN1	4.63E+07	5.56E+07	1.40E+07	2.38E+08	1.04E+09	1.02E+09
P07356	Annexin A2	ANXA2	1.94E+07	4.34E+07	1.37E+08	2.11E+07	1.72E+07	1.36E+07
Q9Z126	Platelet	PF4	1.86E+07	2.58E+07	3.36E+07	1.41E+08	1.37E+08	5.30E+07
	factor 4
Q00724	Retinol	RBP4	6.20E+06	8.30E+06	2.34E+07	6.25E+07	4.03E+07	3.70E+07
	binding
	protein 4
Q8BTM8	Filamin-A	FLNA	Not	5.66E+04	3.06E+04	3.11E+05	7.09E+05	1.66E+06
			detected
P42703	Leukemia	LIFR	1.65E+06	1.12E+06	6.78E+05	3.39E+06	8.66E+06	1.41E+07
	inhibitory
	factor
	receptor
P11247	Myeloperoxidase	MPO	8.11E+05	3.64E+05	1.69E+07	2.65E+06	Not	Not
							detected	detected
P11680	Properdin	CFP	2.41E+06	2.05E+06	4.34E+06	1.73E+07	3.26E+07	2.74E+07
P06330	Ig heavy chain V		2.29E+08	2.74E+08	6.13E+08	1.21E+09	2.28E+09	3.54E+09
	Region AC38 205.12
P70389	Insulin-like	IGFALS	6.86E+06	1.20E+06	2.59E+06	1.38E+07	5.29E+07	1.92E+07
	growth factor-
	binding protein
	complex acid
	labile subunit
P06336	Ig epsilon		3.35E+06	5.36E+05	1.24E+06	8.24E+06	2.82E+07	8.26E+06
	chain C region
Q91X72	Hemopexin	HPX	5.83E+09	4.44E+09	2.22E+09	1.52E+10	1.03E+10	2.17E+10
Q03311	Cholinesterase	BCHE	2.84E+05	Not	Not	6.73E+05	2.42E+06	7.68E+05
				detected	detected
Q9QWK4	CD5 antigen-	CD5L	1.96E+07	1.76E+07	4.54E+07	1.42E+08	2.07E+08	1.27E+08
	like
P07309	Transthyretin	TTR	6.17E+08	6.98E+08	8.07E+08	1.68E+09	1.46E+09	1.11E+09
Q06770	Corticosteroid-	SERPIN	2.13E+07	1.19E+07	6.55E+06	6.35E+07	8.05E+07	4.41E+07
	binding globulin	A6
P26039	Talin-1	TLN1	5.44E+04	Not	Not	2.32E+05	2.32E+06	3.62E+06
				detected	detected
Q9D2Q8	Protein	S100A14	4.64E+05	Not	1.60E+07	9.17E+05	Not	1.54E+05
	S100-A14			detected			detected
O89020	Afamin	AFM	9.84E+07	2.24E+07	3.15E+07	1.23E+08	2.30E+08	1.57E+08
Q9DBB9	Carboxypeptidase	CPN2	1.41E+07	2.31E+06	5.55E+06	2.23E+07	5.21E+07	2.28E+07
	N subunit 2
P10107	Annexin A1	ANXA1	3.37E+07	2.20E+07	9.56E+08	6.51E+07	1.02E+07	2.65E+06
P01749	Ig heavy chain	IGHV1-61	1.88E+06	2.21E+06	7.53E+06	1.84E+07	3.56E+07	5.13E+07
	V region 3
E9Q414	Apolipoprotein	APOB	1.03E+07	2.23E+07	1.66E+07	3.48E+07	1.07E+08	2.01E+08
	B-100
P01887	Beta-2-	B2M	6.30E+06	1.35E+07	1.46E+07	4.89E+07	4.95E+07	2.04E+07
	microglobulin
P09581	Macrophage	CSF1R	1.75E+05	Not	Not	8.09E+05	4.87E+06	6.92E+05
	colony			detected	detected
	stimulating
	factor 1
	receptor
P63017	Heat shock	HSPA8	3.59E+06	2.97E+07	1.43E+07	2.47E+06	3.48E+06	4.26E+06
	cognate
	71 kDa
	protein
Q60963	Platelet-	PLA2G7	1.34E+06	2.52E+05	4.30E+05	6.45E+06	5.38E+06	3.07E+06
	activating
	factor
	acetylhydrolase
Q9JHH6	Carboxypeptidase	CPB2	1.61E+06	2.14E+06	7.63E+05	1.47E+07	1.17E+07	1.38E+07
	B2
Q08879	Fibulin-1	FBLN1	1.86E+05	Not	9.35E+04	2.88E+05	1.81E+06	4.16E+05
				detected
P21107	Tropomyosin	TPM3	2.70E+07	1.41E+08	4.34E+08	1.09E+07	9.20E+06	1.37E+07
	alpha-3 chain
P07901	Heat shock	HSP90A	Not	6.27E+04	4.41E+06	Not	Not	Not
	protein HSP	A1	detected			detected	detected	detected
	90-alpha
P82198	Transforming	TGFBI	1.69E+06	1.02E+06	3.30E+05	4.75E+06	4.86E+06	2.71E+06
	growth factor-
	beta-induced
	protein ig-h3
P07724	Albumin	ALB	1.41E+11	1.08E+11	5.09E+10	3.57E+11	3.90E+11	2.29E+11
P20029	Endoplasmic	HSPA5	8.63E+06	5.04E+07	2.23E+07	3.59E+06	3.23E+06	5.52E+06
	reticulum
	chaperone BiP
P11499	Heat shock	HSP90A	6.78E+06	2.02E+07	1.72E+07	2.09E+06	2.53E+06	5.02E+06
	protein HSP	B1
	90-beta
P16301	Phosphatidylcholine-	LCAT	9.58E+05	9.08E+05	1.65E+05	3.05E+06	1.54E+06	1.50E+06
	sterolacyltransferase
P31532	Serum	SAA4	1.50E+07	2.04E+07	3.90E+07	8.50E+07	3.42E+07	3.77E+07
	amyloid A-4
	protein
Q01279	Epidermal	EGFR	1.15E+07	2.53E+06	5.55E+06	1.70E+07	5.73E+07	1.70E+07
	growth factor
	receptor
P10605	Cathepsin B	CTSB	Not	7.93E+05	Not	3.56E+06	8.72E+05	5.75E+06
			detected		detected
P17742	Peptidyl-	PPIA	Not	Not	6.30E+07	4.52E+06	Not	Not
	prolyl		detected	detected			detected	detected
	cis-trans
	isomerase A
P29699	Alpha-2-HS-	AHSG	1.29E+08	1.50E+08	1.68E+08	2.76E+08	5.02E+08	4.75E+08
	glycoprotein
	Normalized	P-value	Abundance ratio
	Accession	abundance_L-Cb	(one-way	D-Cb/	D-Cb/	L-Cb/
	No.	1	2	3	ANOVA)	L-Cba	Beada	Beada
	P19221	2.80E+07	2.81E+07	2.76E+07	6.59E−07	5.29	6.23	1.18
	E9Q557	1.18E+08	1.30E+08	1.95E+08	3.11E−06	0.00	0.02	17.37
	P06684	1.81E+07	1.50E+07	1.18E+07	9.60E−06	11.65	17.97	1.54
	P52430	2.57E+07	1.80E+07	2.24E+07	1.59E−05	7.33	10.93	1.49
	Q9R269	8.20E+06	1.59E+07	2.12E+07	2.71E−05	—	—	82.95
	Q9R098	7.40E+05	1.00E+06	1.01E+06	2.87E−05	8.31	8.91	1.07
	Q61646	1.24E+09	1.03E+09	1.30E+09	4.15E−05	3.66	4.20	1.15
	P98086	5.51E+06	9.13E+06	5.25E+06	5.92E−05	8.99	11.05	1.23
	Q61247	3.99E+07	3.31E+07	3.46E+07	1.42E−04	4.35	4.39	1.01
	Q9Z1R3	2.67E+06	2.44E+06	2.69E+06	1.45E−04	6.38	7.44	1.17
	P26041	1.23E+07	1.58E+07	2.14E+07	1.97E−04	0.02	—	—
	P35441	2.59E+07	2.87E+07	1.51E+07	2.11E−04	9.45	18.95	2.00
	Q02105	7.88E+06	1.11E+07	7.07E+06	2.46E−04	7.11	9.79	1.38
	O88783	1.32E+06	8.04E+05	8.70E+05	2.58E−04	10.34	20.96	2.03
	P14106	1.84E+07	2.33E+07	1.64E+07	2.61E−04	7.28	8.94	1.23
	P01029	1.26E+08	8.03E+07	7.66E+07	2.73E−04	7.25	13.88	1.91
	P01872	4.06E+08	2.26E+08	3.83E+08	3.03E−04	7.42	12.17	1.64
	P01878	3.93E+08	2.77E+08	2.28E+08	3.19E−04	5.29	5.28	1.00
	P21180	1.87E+06	8.76E+05	1.24E+06	3.29E−04	8.98	18.40	2.05
	Q61233	6.48E+06	3.47E+06	3.27E+06	3.30E−04	0.13	1.58	12.59
	P01898	5.16E+07	4.34E+07	3.59E+07	4.34E−04	8.54	10.58	1.24
	P14847	1.19E+06	2.44E+06	9.75E+05	4.41E−04	9.17	18.43	2.01
	P14426	1.18E+06	7.56E+05	1.44E+06	4.65E−04	7.65	13.16	1.72
	Q61696	3.36E+07	6.05E+07	8.20E+07	4.76E−04	0.07	1.00	13.90
	P08226	2.07E+07	1.62E+07	1.93E+07	4.81E−04	2.82	2.91	1.03
	P01791	1.59E+06	1.90E+06	4.64E+06	5.89E−04	8.14	12.59	1.55
	P12246	7.53E+07	1.21E+08	7.22E+07	5.95E−04	6.21	7.40	1.19
	P01631	1.73E+08	2.74E+08	2.07E+08	6.83E−04	4.28	5.32	1.24
	P62806	2.84E+08	2.67E+08	3.77E+08	6.92E−04	0.02	0.12	5.68
	P01632	3.87E+07	6.18E+07	4.47E+07	7.03E−04	4.60	5.36	1.16
	P01844	5.59E+06	1.10E+07	6.37E+06	7.41E−04	6.67	11.54	1.73
	P01843	1.79E+07	3.08E+07	1.97E+07	7.77E−04	6.76	8.82	1.30
	O70362	2.28E+07	2.13E+07	1.34E+07	8.37E−04	5.12	10.31	2.01
	A6X935	2.10E+08	2.52E+08	2.22E+08	9.29E−04	4.46	4.64	1.04
	P28666	6.42E+07	5.60E+07	3.30E+07	9.30E−04	11.33	31.38	2.77
	P01630	1.52E+07	2.51E+07	1.65E+07	9.47E−04	6.11	7.66	1.25
	P01638	2.34E+07	3.65E+07	2.36E+07	1.12E−03	5.86	8.00	1.36
	Q923 D2	5.05E+05	7.57E+05	4.14E+05	1.13E−03	5.23	7.66	1.46
	P01635	9.16E+07	1.64E+08	1.20E+08	1.18E−03	4.57	5.69	1.24
	P01728	5.11E+06	5.97E+06	6.76E+06	1.20E−03	4.33	5.57	1.29
	P84750	7.69E+06	1.41E+07	1.14E+07	1.20E−03	5.74	7.36	1.28
	Q60994	1.58E+07	2.25E+07	1.61E+07	1.23E−03	6.32	7.01	1.11
	Q07968	2.29E+06	1.01E+06	1.49E+06	1.27E−03	10.28	20.39	1.98
	Q60590	2.22E+07	1.69E+07	5.14E+07	1.31E−03	6.76	10.08	1.49
	P09103	1.10E+07	7.18E+06	7.93E+06	1.32E−03	0.06	0.37	6.51
	P08607	4.15E+07	2.69E+07	2.94E+07	1.34E−03	4.71	9.09	1.93
	Q61702	3.45E+07	2.87E+07	1.12E+07	1.36E−03	7.04	16.36	2.32
	Q07456	3.59E+07	2.90E+07	1.60E+07	1.42E−03	6.30	12.40	1.97
	Q9JJN5	4.72E+06	5.74E+06	1.33E+07	1.48E−03	7.00	12.92	1.85
	Q80YC5	3.13E+06	3.06E+06	6.77E+06	1.49E−03	7.95	12.50	1.57
	P06909	2.20E+08	1.79E+08	1.02E+08	1.54E−03	8.11	19.96	2.46
	P01837	9.31E+08	1.28E+09	7.98E+08	1.56E−03	3.95	4.21	1.07
	P01636	4.32E+07	7.80E+07	5.27E+07	1.62E−03	5.02	6.50	1.29
	O08742	1.40E+06	6.22E+05	8.22E+05	1.64E−03	5.77	15.68	2.72
	P48678	1.37E+07	1.16E+07	2.93E+07	1.67E−03	0.03	0.01	0.38
	Q9DBD0	9.43E+07	3.47E+07	4.63E+07	1.69E−03	8.78	19.79	2.25
	Q921I1	2.52E+10	1.03E+10	1.39E+10	1.71E−03	5.37	11.00	2.05
	P29788	2.48E+07	2.32E+07	1.07E+07	1.76E−03	5.34	6.81	1.27
	Q61704	6.27E+07	6.19E+07	3.65E+07	1.86E−03	6.51	14.96	2.30
	P01642	6.50E+06	1.43E+07	7.59E+06	1.88E−03	5.63	8.17	1.45
	P28665	9.73E+08	8.51E+08	5.60E+08	1.92E−03	7.30	17.20	2.36
	P97350	3.88E+07	3.99E+07	5.59E+07	1.93E−03	—	—	18.40
	Q8VCG4	4.84E+06	5.57E+06	3.37E+06	1.97E−03	5.71	6.65	1.16
	Q8CG16	3.93E+06	4.45E+06	5.82E+06	2.07E−03	4.24	6.43	1.52
	Q61703	6.08E+07	5.31E+07	2.28E+07	2.20E−03	5.92	12.67	2.14
	Q61147	5.00E+08	4.20E+08	2.50E+08	2.33E−03	7.53	18.50	2.46
	Q61838	6.75E+09	6.26E+09	4.81E+09	2.58E−03	5.34	7.75	1.45
	P01807	5.65E+07	6.45E+07	1.45E+08	2.64E−03	6.46	8.08	1.25
	P00920	4.06E+06	7.33E+06	2.18E+06	2.92E−03	6.30	9.49	1.51
	P01746	1.05E+07	1.25E+07	3.63E+07	2.95E−03	6.97	9.42	1.35
	Q8BND5	1.95E+07	1.11E+07	7.00E+06	3.04E−03	5.32	6.21	1.17
	P23953	1.08E+09	4.46E+08	6.40E+08	3.19E−03	4.67	8.97	1.92
	P01723	1.11E+07	2.02E+07	9.29E+06	3.23E−03	4.48	5.96	1.33
	Q62351	9.34E+05	1.92E+06	1.57E+06	3.23E−03	9.36	15.12	1.62
	Q91Y97	4.41E+05	2.45E+05	1.85E+05	3.63E−03	5.99	7.15	1.19
	P20918	8.59E+07	1.66E+08	1.36E+08	3.68E−03	8.60	8.85	1.03
	O70456	1.37E+08	1.24E+08	1.57E+08	3.74E−03	0.10	0.23	2.26
	Q60930	4.48E+06	8.39E+06	1.36E+07	3.78E−03	—	—	14.83
	P01801	2.37E+07	2.75E+07	8.10E+07	3.91E−03	5.15	7.64	1.48
	P68372	3.60E+07	3.16E+07	5.98E+07	3.97E−03	0.08	0.30	3.64
	P01633	1.57E+08	2.23E+08	1.82E+08	3.97E−03	4.28	5.68	1.33
	O88947	6.71E+06	7.13E+06	2.26E+07	3.99E−03	4.83	10.10	2.09
	P32261	7.88E+07	9.30E+07	5.54E+07	4.11E−03	3.28	3.29	1.01
	P01660	1.58E+07	2.86E+07	1.28E+07	4.12E−03	4.24	5.78	1.36
	Q9ESB3	1.52E+08	1.39E+08	1.44E+08	4.21E−03	3.09	2.68	0.87
	P46412	4.04E+06	4.07E+06	4.74E+06	4.27E−03	4.86	4.29	0.88
	P26262	5.25E+06	4.61E+06	1.48E+07	4.29E−03	7.02	9.45	1.35
	Q8R121	2.50E+06	1.55E+06	2.85E+06	4.42E−03	7.89	7.06	0.90
	P04186	3.45E+07	5.28E+07	4.68E+07	4.42E−03	6.61	6.29	0.95
	P01027	4.43E+09	4.47E+09	2.03E+09	4.56E−03	3.75	4.10	1.09
	Q03734	9.52E+06	3.43E+06	7.33E+06	4.60E−03	4.84	4.26	0.88
	P01867	8.66E+08	9.39E+08	2.96E+09	4.77E−03	6.41	9.03	1.41
	P20152	7.30E+07	9.07E+07	5.15E+07	4.78E−03	0.31	0.15	0.50
	P01869	6.59E+08	7.58E+08	2.23E+09	4.79E−03	5.53	8.20	1.48
	P18527	4.31E+06	5.77E+06	1.67E+07	5.04E−03	6.07	8.96	1.48
	P01865	1.19E+09	1.33E+09	4.07E+09	5.06E−03	5.77	7.61	1.32
	P01864	4.67E+08	5.96E+08	1.79E+09	5.22E−03	5.84	7.51	1.29
	P18531	4.04E+06	4.59E+06	1.60E+07	5.40E−03	6.71	11.23	1.67
	P49182	2.69E+07	1.33E+07	8.21E+06	5.45E−03	5.45	9.21	1.69
	Q6GQT1	9.30E+05	6.32E+05	3.03E+05	5.56E−03	9.30	30.25	3.25
	Q64726	2.50E+07	1.11E+07	4.49E+07	5.82E−03	4.30	9.14	2.12
	Q8VCS0	5.70E+06	1.79E+06	1.85E+06	5.90E−03	5.34	12.67	2.37
	P06683	3.13E+06	4.14E+05	1.73E+06	6.07E−03	3.43	15.87	4.63
	P70274	4.34E+05	3.49E+05	1.71E+06	6.20E−03	6.37	15.71	2.47
	Q06890	3.45E+07	3.19E+07	3.09E+07	6.25E−03	3.06	3.09	1.01
	P17182	3.48E+07	1.08E+07	1.03E+07	6.78E−03	0.01	0.11	8.23
	P10126	9.09E+07	1.15E+08	1.57E+08	6.82E−03	0.09	0.13	1.49
	Q8CG14	2.87E+06	3.29E+06	2.16E+06	6.83E−03	6.90	8.55	1.24
	P07361	3.47E+06	2.30E+06	5.93E+06	6.97E−03	6.90	8.05	1.17
	P13020	4.52E+07	9.41E+07	9.19E+07	7.27E−03	6.77	6.81	1.01
	O08677	2.46E+08	2.30E+08	1.47E+08	7.48E−03	2.87	2.86	1.00
	Q61129	7.60E+06	1.60E+07	2.94E+07	7.58E−03	4.39	6.50	1.48
	O88968	3.17E+05	Not	Not	7.76E−03	2.63	—	—
			detected	detected
	P02089	4.08E+06	3.38E+06	4.92E+06	7.80E−03	2.39	3.36	1.41
	P97290	3.77E+07	5.20E+07	5.19E+07	7.93E−03	5.38	5.71	1.06
	P01670	9.29E+06	2.39E+07	1.77E+07	8.13E−03	3.84	7.13	1.86
	Q02257	3.00E+07	3.27E+07	3.47E+07	8.33E−03	0.00	0.02	5.84
	Q01339	4.89E+07	7.75E+07	1.78E+08	8.38E−03	4.53	4.24	10.94
	P11859	2.54E+06	3.87E+06	1.38E+07	3.47E−03	5.74	8.08	1.41
	P21614	1.41E+08	2.01E+08	6.94E+08	9.66E−03	5.61	8.49	1.51
	P03987	1.34E+08	1.60E+08	5.95E+08	1.03E−02	5.35	7.63	1.43
	P97298	3.72E+06	4.41E+06	2.07E+07	1.04E−02	4.41	10.34	2.34
	P18524	3.11E+07	3.64E+07	1.23E+08	1.05E−02	4.45	6.54	1.47
	Q8VCM7	7.57E+06	7.34E+06	1.15E+07	1.07E−02	0.05	0.14	2.72
	P11276	8.26E+07	1.20E+08	2.16E+07	1.09E−02	10.30	19.88	1.93
	P07356	1.45E+08	1.40E+08	1.79E+08	1.09E−02	0.11	0.26	2.31
	Q9Z126	2.80E+07	2.65E+07	4.54E+07	1.20E−02	3.31	4.24	1.28
	Q00724	1.10E+07	1.10E+07	1.46E+07	1.31E−02	3.81	3.68	0.97
	Q8BTM8	Not	1.66E+05	Not	1.34E−02	5.37	20.46	3.81
		detected		detected
	P42703	2.76E+06	2.15E+06	1.08E+06	1.44E−02	4.36	7.57	1.74
	P11247	1.34E+08	4.80E+07	5.98E+07	1.47E−02	0.03	0.44	13.33
	P11680	1.92E+06	3.68E+06	1.46E+07	1.63E−02	3.82	8.77	2.29
	P06330	2.79E+08	2.46E+08	9.08E+08	1.71E−02	4.90	6.30	1.28
	P70389	1.77E+06	4.58E+06	4.15E+06	1.72E−02	8.19	8.07	0.99
	P06336	1.30E+06	2.53E+06	2.52E+06	1.73E−02	7.04	8.73	1.24
	Q91X72	7.70E+09	5.26E+09	3.59E+09	1.74E−02	2.85	3.78	1.32
	Q03311	9.57E+04	2.07E+05	2.29E+05	1.96E−02	7.27	4.54	0.62
	Q9QWK4	1.15E+07	2.54E+07	7.32E+07	2.08E−02	4.32	5.76	1.33
	P07309	7.75E+08	6.31E+08	1.13E+09	2.16E−02	1.67	2.00	1.20
	Q06770	1.87E+07	1.82E+07	4.72E+06	2.24E−02	4.52	4.73	1.04
	P26039	1.31E+05	6.84E+04	Not	2.39E−02	20.60	37.86	1.84
				detected
	Q9D2Q8	2.54E+07	1.91E+07	2.21E+07	2.40E−02	0.02	0.07	2.71
	O89020	3.68E+07	4.16E+07	5.77E+07	2.53E−02	3.75	3.35	0.89
	Q9DBB9	4.52E+06	5.86E+06	7.92E+06	2.61E−02	5.31	4.42	0.83
	P10107	1.06E+09	1.20E+09	1.33E+09	2.74E−02	0.02	0.08	3.54
	P01749	3.23E+06	2.44E+06	1.78E+07	2.93E−02	4.48	9.06	2.02
	E9Q414	6.19E+07	5.79E+07	3.26E+07	2.94E−02	2.25	6.95	3.09
	P01887	1.08E+07	1.24E+07	2.00E+07	3.12E−02	2.75	3.45	1.25
	P09581	3.90E+04	Not	1.35E+05	3.15E−02	24.40	12.14	0.50
			detected
	P63017	1.82E+07	2.30E+07	2.06E+07	3.38E−02	0.17	0.21	1.30
	Q60963	2.18E+06	6.60E+05	Not	3.39E−02	3.50	7.35	2.10
				detected
	Q9JHH6	3.53E+06	2.65E+06	2.29E+05	3.44E−02	6.26	8.91	1.42
	Q08879	9.09E+04	1.25E+05	1.24E+05	3.75E−02	7.40	5.99	0.81
	P21107	2.57E+07	3.72E+07	1.51E+07	3.78E−02	0.43	0.06	0.13
	P07901	5.74E+06	1.05E+07	1.28E+07	3.83E−02	—	—	4.33
	P82198	1.34E+06	9.82E+05	Not	3.86E−02	3.54	4.06	1.14
				detected
	P07724	1.52E+11	1.42E+11	5.27E+10	3.90E−02	2.81	3.25	1.15
	P20029	8.69E+06	1.57E+07	5.68E+06	4.22E−02	0.41	0.15	0.37
	P11499	6.79E+06	1.44E+07	4.41E+06	4.25E−02	0.38	0.22	0.58
	P16301	Not	Not	Not	4.31E−02	—	3.00	—
		detected	detected	detected
	P31532	2.68E+07	2.88E+07	3.54E+07	4.42E−02	2.27	2.79	1.22
	Q01279	5.36E+06	7.04E+06	9.53E+06	4.61E−02	4.16	4.67	1.12
	P10605	9.86E+05	3.34E+05	2.96E+05	4.68E−02	6.30	4.28	0.68
	P17742	9.42E+07	8.65E+07	1.22E+08	4.70E−02	0.04	0.07	1.60
	P29699	1.26E+08	1.17E+08	3.51E+08	4.91E−02	2.11	2.80	1.33