MICROBIAL MARKERS AND USES THEREFOR

[0001] This application claims priority to Australian Provisional Application No. 2013901907, entitled “Microbial Markers and Uses Therefor”, filed on 28 May 2013, and to Australian Provisional Application No. 2013903914, entitled “Microbial Markers and Uses Therefor”, filed on 11 Oct. 2013, the subject matter of each of which is incorporated herein by reference in its entirety.

[0002] This invention relates generally to methods for identifying and/or classifying microbes using one or more single nucleotide polymorphisms (SNPs) in 16S ribosomal RNA (16S rRNA) of prokaryotes and/or one or more SNPs in 5.8S ribosomal RNA (5.8S rRNA) of eukaryotes. The invention also relates to probes, primers and kits that are useful in the methods of the invention.

[0003] Prokaryotes are organisms that lack a nucleus or any membrane-bound organelles and are generally unicellular. Most prokaryotes can be broadly categorized into Gram-positive or Gram-negative, based on the peptidoglycan of Gram-positive microbes' outer cell wall staining with crystal violet and safranin (or carbol fuchsin), although some prokaryotes have a variable Gram stain. Prokaryotes contain 16S (Svedberg unit) rRNA, which is a component of the 30S small subunit of prokaryotic ribosomes. 16S rRNA is approximately 1500 nucleotides in length, encoded by the 16S rRNA gene (sometimes referred to as 16S rDNA), which is generally part of a co-transcribed operon also containing the 23S and 5S rRNA genes. The DNA sequence of the 16S rRNA genes (and thus the RNA sequence of the 16S rRNA molecules) is highly conserved between prokaryotes, although there are regions of variation (Weisburg W G, et al., (1991) J Bacterial. 173 (2): 697-703).

[0004] In contrast, eukaryotes are organisms containing membranes within cells, in particular a nuclear membrane containing DNA, and can be unicellular (e.g. most yeasts) or multicellular. All eukaryotes contain 5.8S rRNA, which is a component of the large 60S small subunit of eukaryotic ribosomes. Its length varies between species but it is usually around 160 nucleotides. The 5.8S rRNA gene (often referred to as 5.8S rDNA) is part of the 45S rDNA, which also contains the 18S and 28S rRNA genes separated by 2 internally transcribed spacers. In humans, the 45S rDNA is present in 5 clusters on 5 different chromosomes, each cluster having 30-40 repeats. The 45S rDNA is transcribed by RNA polymerase I as a single transcription unit (45S), which is then processed to produce the 5.8S, 18S and 28S rRNA molecules. The sequence of 5.8S rRNA gene (and thus the sequence of the 5.8S rRNA molecule) is highly conserved between eukaryotes, although there are regions of variation that can be used in phylogenetic studies (Field K. G et al., (1988) Science 239(4841): 748-753).

[0005] It is often desirable to classify prokaryotic and eukaryotic microbes in a sample. For example, the classification of microbes that contaminate solutions, materials or foodstuffs, and pose a threat to the wellbeing of other organisms or the quality of production of solutions or materials or foodstuffs, assists in the identification of pathogens, and management, control, eradication, elimination, limitation or removal of such microbes. It may also be desirable to determine the natural microbial population (the “microbiome”) of a sample, such as for ecological studies of microbial diversity, phylum spectrum, relative phylum abundance (Gehron, M. J. et al. (1984) J. Microbiol. Methods 2, 165-176; Claesson, M. J. et al. (2010) Nucl Acids Res 38(22), e200), or for determining or monitoring deviation of the microbiome balance from a normal state in pathological conditions, such as enteric (e.g. gastroenteritis, rumenitis, colitis, typhlitis; Bailey, S. R., et al. (2003). Appl. Environ. Microbiol. 69, 2087-2093), respiratory (e.g. pneumonia, bronchitis, mucositis), urinary (e.g. cystitis, nephritis, urethritis) and skin (e.g. wounds, pruritis, dermatitis, psoriasis) disorders including viral, fungal, parasitic and bacterial infections. It may also be useful to determine the microbiome of a sample in response to therapies or treatments or modulations such as the use of antibiotics, steroids, immune modulators, pre and probiotics, soil or water treatments, filtration, sterilization procedures, antiseptics.

[0006] Current microorganism classification schemes include, but are not limited to, phenotypic, chemotypic and genotypic. Within phenotypic classification are the sub-classification methods of Gram staining, growth requirements, biochemical reactions, antibiotic sensitivity, serological systems, environmental reservoirs (or where such microbes preferentially live and grow). Within chemotypic classification are the sub-classification methods using various technologies that can include analysis of microbial components consisting of sugars, fats, proteins or minerals. Within genotypic classification are the sub-classification methods of restriction fragment length analysis and ribosomal RNA sequence analysis, both reliant on different levels of interpretation of genetic material.

[0007] Phenotypic classification methods can suffer from a lack of sensitivity and specificity, are not rapid or easy, and have limited ability to be automated. Chemotypic methods also lack sensitivity and specificity and currently are not cost effective. Genotypic methods are often more sensitive, rapid, easy to perform, cost effective, and are able to be automated and multiplexed.

[0008] Various attempts have been made to differentiate Gram-positive and Gram-negative prokaryotes using nucleic acid molecular techniques (see e.g. Bispo, P. J. M., et al., (2011) Ophthalmol. Vis. Sci. 52, 873-881; Klaschik, S. et al. (2002) Journal of Clinical Microbiology 40, 4304-4307; Shigemura, K. et al. (2005) Clin Exp Med 4, 196-201 (2005); Carroll, N. M. et al. (2005) Journal of Clinical Microbiology 38, 1753-1757). These attempts are mostly limited in scope by the number of pathogens they detect and differentiate because of the focus on a limited number of particular pathological specimens (blood, urine, ophthalmic) and pathogen types. The implications of this deficiency could have serious downstream ramifications in, for example, a patient with a prokaryotic infection not able to be detected.

[0009] Such reported methods are generally not quantitative, which can be important. Samples rarely consist of a single type of organism and, for pathology samples, are often contaminated with potentially irrelevant and non-pathogenic prokaryotes. In addition, very few solutions or materials or foodstuffs are free of microbes and it is the number of microbes present that determines the level of contamination, lack of quality, or threat to the wellbeing of other organisms. Various methods of quantitation of microbes exist, including but not limited to, plating onto growth media and counting microbial colonies, the use of spectrophotometry to determine turbidity and the use of nanoparticles (Zhao X et al., A rapid bioassay for single bacterial cell quantitation using bioconjugated nanoparticles. PNAS, 101(42): 15027-15032. 2004.)

[0010] Few existing methods combine genotypic classification with quantification. One such example is Spiro et al., 2000 (A bead-based method for multiplexed identification and quantitation of DNA sequences using flow cytometry. App Env Micro 66(10): 4258-4265). However, this method does not describe the genotypic classification of microbes. Rather, it demonstrates the ability of bead technology to identify particular DNA sequences in an heterogenous mixture. More recent developments such as Next Generation Sequencing (NGS) hold promise for generating large quantities of data on the microbiome of samples (Claesson, M. J. et al. Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucl Acids Res 38(22), e200 (2010)). However, these technologies currently suffer from a number of limitations especially with respect to determining the simple Gram status of a sample including: lack of sensitivity (samples require PCR amplification prior and in some instances library manufacture prior to sequencing), cost, PCR bias, sequencing inaccuracies, and complex software and algorithms required to interpret the large amount of data generated.

[0011] Thus, in the field of microbiology, there is a need for a method of broad microbial classification and quantitation, which is suitably in the form of a single test, that is discriminatory, sensitive, specific, rapid, easy to perform and interpret, inexpensive, lends itself to automation and with the minimum amount of multiplexing, and preferentially performed in the field, remotely, or beside a patient or at least inexpensively in a laboratory. Such a test would allow for rapid and informed management, monitoring, enumeration, quantitation, differentiation, control, eradication, elimination, limitation or removal of such microbes.

[0012] In particular, there is a need for a method of broad microbial classification and quantitation of microbes of health significance, such as those that cause sepsis in humans.

[0013] Systemic inflammatory response syndrome (SIRS) is an overwhelming whole body reaction that may have an infectious aetiology or non-infectious aetiology (i.e. infection-negative SIRS, or inSIRS). Sepsis is SIRS that occurs during infection. Sepsis in this instance is diagnosed by a clinician (when there is suspected infection) or through culture of an organism. Both SIRS and sepsis are defined by a number of non-specific host response parameters including changes in heart and respiratory rate, body temperature and white cell counts (Levy et al., (2003) Critical Care Medicine 31: 1250-1256; Reinhart et al., (2012) Clinical Microbiology Reviews 25(4): 609-634)

[0014] Sepsis and SIRS have had an increasing impact on health care systems worldwide. In the United States from 1993 to 2009, the number of sepsis-related hospital stays more than doubled, increasing by 153% overall, with an average annual increase of 6%. In 2009, 4,600 new patients per day were treated in hospital for sepsis, and nearly one in 23 patients in hospital had sepsis. The in-hospital sepsis mortality rate was approximately 16 percent, which has not changed since 2000, and is more than eight times higher than the mortality rate for other hospital stays. Sepsis was also the most expensive reason for hospitalization in 2009 in the United States, totaling an estimated $15.4 billion in aggregate hospital costs.

[0015] SIRS can be triggered by a number of insults including local or systemic infection, trauma, burns, surgery and sterile inflammation and consists of aberrations in at least two of four nominated clinical criteria (temperature, heart rate, respiratory rate and white blood cells). In a comprehensive survey conducted by Rangel-Fausto et al., 68% of admitted patients over a 9-month period met at least two criteria for SIRS and the incidence density of SIRS in the surveyed hospital across different wards was determined to be between 320 and 857 episodes per 1000 patient days (Rangel-Frausto et al. (1995) JAMA 273(2): 117-123. Thus, SIRS has a high incidence in hospitals.

[0016] Confirmation of a diagnosis of sepsis usually requires isolation and identification of live pathogens from blood samples using culture, but this technique has its limitations. Microbial culture usually takes a number of days to obtain a positive result and over five days to confirm a negative result. Further, culture has problems with reliability with respect to sensitivity, specificity and predictive value (Jean-Louis Vincent et al., (2006) Critical Care Medicine 34: 344-353; Lamy et al., (2002) Clinical Infectious Diseases 35: 842-850. A large percentage of blood cultures drawn from patients with suspected sepsis are either negative or contaminated (Coburn et al. (2012) JAMA 308, 502-511). Over 90% of all blood cultures drawn from patients are negative. Of the small percentage of blood cultures that are positive (4-7%) up to half are due to contaminants (false positives) as a result of poor sampling technique. False-positive blood cultures can result in an increase in total hospital charges, an increase in median length of hospital stay, and an increase in laboratory charges. Therefore, poor diagnostic procedures for determining the presence of sepsis, including sampling and testing, places a significant financial burden on the healthcare system. Other potential consequences of the diagnostic limitations of blood culture in patients suspected of having sepsis include the use and misuse of broad-spectrum antibiotics, the development of antimicrobial resistance and Clostridium difficile infection, adverse reactions, and increased treatment costs.

[0017] Alternative diagnostic approaches to SIRS and sepsis have been extensively investigated and generally fall into one of two categories: pathogen detection, or determination of host response using biomarkers. Promising rapid and sensitive pathogen detection technology includes the use of Polymerase Chain Reaction (PCR), for example, Roche's Lightcycler® SeptiFast, especially when used in conjunction with blood culture (Bauer and Reinhart (2010) International Journal of Medical Microbiology 300: 411-413; Uwe Lodes et al. (2012) Langenbeck's Archives of Surgery 397: 447-455; and Pasqualini et al., (2012) Journal of Clinical Microbiology 50: 1285-1288). A current quandary when using this technology is how best to interpret early positive PCR results in the absence of blood culture results or relevant clinical signs. Such tests are complex and involve multiple multiplexed reactions. Further, accurate quantitation of microorganisms is important in determining the relevance of pathogen detection when using sensitive assay methods. A further technical difficulty associated with PCR-based pathogen detection, especially in peripheral blood samples, is the lack of ability to detect small quantities of pathogen nucleic acid in a background of host nucleic acid.

[0018] Given that the majority of patients (>80%) admitted to the tertiary care ICU setting have SIRS, of varying aetiologies including following major surgery, it is of enormous clinical importance that those patients who have a suspected infection or are at high risk of infection can be identified early and be graded and monitored, in order to initiate evidence-based and goal-orientated medical therapy (Kumar, A. et al. (2006) Critical Care Medicine 34, 1589-1596). This is critical, as the acute management plans for SIRS with and without infection are very different. Dependence on empiric treatment means that some patients may be receiving excessive antibiotics while others are receiving treatment (e.g. corticosteroids) that is immunosuppressive because a clear site of infection has not been identified. Thus, there is a continued need for a test that is able to differentiate infection-negative SIRS (inSIRS) from infection-positive-SIRS (e.g. sepsis), quantitate microbial DNA, differentiate prokaryotic and eukaryotic DNA and differentiate Gram-positive from Gram-negative DNA across a broad range of potential pathogens, so as to assist clinicians in making appropriate patient management and treatment decisions in such patients.

[0019] There is also a need for rapid assays and tests that further classify bacteria beyond Gram-positive and Gram-negative, so as to assist the clinician to determine an appropriate course of treatment. Traditional methods typically require culturing the bacteria, typically for 2 to 10 days, depending on the species of bacteria (e.g. slow-growing and fastidious organisms such as mycobacteria can take 10 days). This culturing of bacteria, in particular anaerobic bacteria, can be labour intensive, burdensome and require special equipment and reagents. Once cultured, the first procedure the laboratory generally performs is a Gram stain and morphology assessment, the results of which are reported to clinicians promptly. A Gram stain allows for classification of the bacteria grown, if grown, into the following groups: Gram-positive cocci, Gram-positive bacilli, Gram-negative bacilli, Gram-negative cocci, anaerobes, and Candida spp. Such information, in combination with other data, may be sufficient to make an appropriate antibiotic choice. Further tests can then help determine antibiotic sensitivity and species identification, although these tests are not always performed due to cost and logistics.

[0020] Because of the high mortality associated with bacteraemia, the dangers of under treating some infections, or concern about using inappropriate antibiotics, clinicians tend to order blood cultures liberally and put patients on empirical antibiotics soon after blood cultures are taken. Thus, patients with suspected sepsis are generally put on empirical antibiotics shortly after blood cultures are taken and prior to receiving any culture or further test results. The choice of empirical antibiotic used depends on factors such as: site of infection (e.g. respiratory, skin, urinary, gastrointestinal etc), whether the infection is hospital acquired or community acquired, epidemiology of pathogens, hospital microbial resistance patterns, whether the patient has been or is on antibiotics, patient allergies, and patient co-morbidities and known antibiotic toxicities. Guidance to clinicians on choice of empirical antibiotics is often available through hospital publications, health maintenance organisations (HMOs), specialist organisations and the scientific literature (by example see http://www.clevelandclinicmeded.com/medicalpubs/antimicrobial-guidelines/; http://www.uphs.upenn.edu/bugdrug/; Huttner B, Jones M, Huttner A, Rubin M, Samore M H (2013) Antibiotic prescription practices for pneumonia, skin and soft tissue infections and urinary tract infections throughout the US Veterans Affairs system. J Antimicrob Chemother 68: 2393-2399. doi:10.1093/jac/dkt171; Snydman D R (2012) Empiric antibiotic selection strategies for healthcare-associated pneumonia, intra-abdominal infections, and catheter-associated bacteremia. J Hosp Med 7 Suppl 1: S2S12. doi:10.1002/jhm.980; Maxwell D J, Easton K L, Brien J-A E, Kaye K I (2005) Antibiotic guidelines in NSW hospitals. Aust Health Rev 29: 416-421.). However, because of the development of microbial antibiotic resistance, the aim and purpose of microbiology testing is to provide evidence and guidance on the appropriate use of narrow spectrum antibiotics and subsequently the reduction in the use of empirical broad-spectrum antibiotics. Therefore, a test that can provide timely guidance on the appropriate use of narrow spectrum antibiotics is needed, preferably without having to grow the organism.

[0021] The present invention is based on the determination that one or more single nucleotide polymorphisms within rRNA genes of bacteria and fungi are unique to Gram-positive bacteria, Gram-negative bacteria or fungi, and in some instances are unique to particular species or groups of species. Based on this determination, the inventors have developed various methods and kits that take advantage of these differentiating SNPs to identify the presence or absence of a bacterium and/or a fungus in a sample, differentiate the bacterium from the fungus, classify the bacterium as Gram-positive or Gram-negative, classify the bacterium as a member of a particular group of pathogens, identify the species of bacterium or identify the bacterium as one of several possible species, and/or identify the species of fungus. In particular instances, the methods and kits also facilitate quantitation of the microorganism in the sample.

[0022] While some of the methods and kits of the invention can be used to determine the presence of, differentiate and/or identify bacteria or fungi in any sample, in some embodiments the methods and kits of the present invention are particularly useful for determining the presence of, differentiating and/or identifying bacteria or fungi in a biological sample, such as a biological sample from a mammalian (e.g., human) subject. Even more particularly, the methods and kits are suitable for analysing blood from a subject with SIRS, to determine whether the SIRS has an infectious origin, i.e. whether the subject has sepsis, or whether the SIRS is infection-negative, or analysing blood from a subject suspected of having sepsis to determine whether the subject does indeed have sepsis. In instances where the subject has sepsis resulting from a bacterial or fungal infection, the methods and kits of the present invention can be used to determine whether the bacterium is Gram-positive or Gram-negative; classify or categorize the bacterium, for example as aerobic or anaerobic or as a member of a major antibiotic treatment group; identify the species of bacterium or identify the bacterium as one of several possible species; and/or identify the species of fungus present in the blood of the subject. Furthermore, the severity of the infection, as measured by the number of bacteria or fungi in the blood, can also be determined. As a result, the methods and kits of the present invention can be used to guide a clinician as to whether or not to hospitalize the subject, and what course of treatment, if any, is required. The methods and kits of the present invention also can be used to guide a clinician on what further tests should be performed to determine antibiotic resistance, microbial virulence and, if necessary, pinpoint the bacterial species. Because of the speed at which the methods of the invention can be performed, these decisions can be made within hours, rather than days, of the subject first being assessed by the clinician. Thus, the methods and kits of the present invention can reduce the unnecessary hospitalization, unnecessary administration of antibiotics and/or administration of ineffective or unsuitable antibiotics that may be associated with methods of the prior art, and facilitate the rapid implementation of a suitable and effective treatment regimen.

[0023] In one aspect, the present invention provides a method for determining the Gram status of a bacterium in a sample, comprising analyzing nucleic acid from the sample for single nucleotide polymorphisms (SNPs) in a 16S rRNA gene, wherein the SNPs are at positions corresponding to positions 396 and 398 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein: the bacterium is determined to be a Gram-negative bacterium when there is a C at position 396 and a T, A or C at position 398; and the bacterium is determined to be a Gram-positive bacterium when there is an A, T or G at position 396 and a C at position 398.

[0024] In some embodiments, the bacterium is selected from among Acinetobacter spp.; Actinobaccillus spp.; Actinomadura spp.; Actinomyces spp.; Actinoplanes spp.; Aeromonas spp.; Agrobacterium spp.; Alistipes spp.; Anaerococcus spp.; Arthrobacter spp.; Bacillus spp.; Brucella spp.; Bulleidia spp.; Burkholderia spp.; Cardiobacterium spp.; Citrobacter spp.; Clostridium spp.; Corynebacterium spp.; Dermatophilus spp.; Dorea spp.; Edwardsiella spp.; Enterobacter spp.; Enterococcus spp.; Erysipelothrix spp.; Escherichia spp.; Eubacterium spp.; Faecalibacterium spp.; Filifactor spp.; Finegoldia spp.; Flavobacterium spp.; Gallicola spp.; Haemophilus spp.; Helcococcus spp.; Holdemania spp.; Hyphomicrobium spp.; Klebsiella spp.; Lactobacillus spp.; Legionella spp.; Listeria spp.; Methylobacterium spp.; Micrococcus spp.; Micromonospora spp.; Mobiluncus spp.; Moraxella spp.; Morganella spp.; Mycobacterium spp.; Neisseria spp.; Nocardia spp.; Paenibacillus spp.; Parabacteroides spp.; Pasteurella spp.; Peptoniphilus spp.; Peptostreptococcus spp.; Planococcus spp.; Planomicrobium spp.; Plesiomonas spp.; Porphyromonas spp.; Prevotella spp.; Propionibacterium spp.; Proteus spp.; Providentia spp.; Pseudomonas spp.; Ralstonia spp.; Rhodococcus spp.; Roseburia spp.; Ruminococcus spp.; Salmonella spp.; Sedimentibacter spp.; Serratia spp.; Shigella spp.; Solobacterium spp.; Sphingomonas spp.; Sporanaerobacter spp.; Staphylococcus spp.; Stenotrophomonas spp.; Streptococcus spp.; Streptomyces spp.; Tissierella spp.; Vibrio spp.; and Yersinia spp. In other embodiments, the bacterium is selected from among Bacterial ID Nos. 1-1430. In particular examples, the bacterium is a mammalian (e.g., human) sepsis-associated bacterium, such as one selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans and Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia and Prevotella melaninogenica.

[0025] A further aspect of the invention is directed to a method for determining the Gram status of a mammalian (e.g., human) sepsis-associated bacterium in a sample, comprising analyzing nucleic acid from the sample for a single nucleotide polymorphism (SNP) in a 16S rRNA gene, wherein the SNP is at a position corresponding to position 396 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be a Gram-negative bacterium when there is a C at position 396; and the bacterium is determined to be a Gram-positive bacterium when there is a G at position 396. In some embodiments the mammalian (e.g., human) sepsis-associated bacterium is selected from Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans and Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia and Prevotella melaninogenica.

[0026] In another aspect, the invention provides a method for determining the Gram status of a mammalian (e.g., human) sepsis-associated bacterium in a sample, comprising analyzing nucleic acid from the sample for single nucleotide polymorphisms (SNPs) in a 16S rRNA gene, wherein the SNPs are at positions corresponding to positions 278, 286, 396, 398, and 648 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be a Gram-negative bacterium when there is a C at position 396; an A at position 396, a C at position 398 and a T at position 278; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648; or an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648; and the bacterium is determined to be a Gram-positive bacterium when there is a G at position 396; an A at position 396, a C at position 398 and a C at position 278; an A at position 396, a C at position 398, a G at position 278, and an A at position 286; an A at position 396, a C at position 398, an A at position 278 and an A at position 286; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648; or an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648. In some embodiments, bacterium is selected from Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Salmonella enterica, Serratia marcescens, Haemophilus influenzae, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori, Chlamydophila abortus, Veillonella atypica, Veillonella parvula, Veillonella denticariosi, Veillonella rogosae, Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis.

[0027] The method may also comprise identifying the bacterium or identifying the bacterium as being one of a group of bacteria, wherein: a C at position 396 indicates that the bacterium is a Gram-negative bacterium selected from Prevotella melaninogenica, Prevotella intermedia, Prevotella buccae, Bacteroides fragilis, Citrobacter freundii, Enterobacter aerogenes, Klebsiella oxytoca, Serratia marcescens, Morganella morganii, Stenotrophomonas maltophila, Acinetobacter baumannii, Enterobacter cloacae, Klebsiella pneumoniae, Salmonella enterica, Escherichia coli, Proteus mirabilis, Neisseria meningitidis, Pseudomonas aeruginosa, Haemophilus influenzae and Burkholderia cepacia; an A at position 396, a C at position 398 and a T at position 278 indicates that the bacterium is a Gram-negative bacteria selected from Campylobacter coli, Campylobact jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori and Chlamydophila abortus; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella rogosae; an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella atypica, Veillonella parvula and Veillonella denticariosi; a G at position 396 indicates that the bacteria is a Gram-positive bacterium selected from among Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis; an A at position 396, a C at position 398 and a C at position 278 indicates that the bacterium is the Gram-positive bacteria Enterococcus faecalis or Enterococcus faecium; an A at position 396, a C at position 398, a G at position 278, a T at position 286 and a T at position 648 indicates that the bacterium is the Gram-positive bacterium Clostridium perfringens; an A at position 396, a C at position 398, a G at position 278, and an A at position 286 indicates that the bacterium is the Gram-positive bacterium Streptococcus bovis, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus pyogenes, Streptococcus anginosus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus sanguinis; or an A at position 396, a C at position 398, a A at position 278 and an A at position 286 indicates that the bacterium is a Gram-positive bacterium selected from among Staphylococcus aureus, Streptococcus sobrinus, Streptococcus constellatus and Streptococcus oralis; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus epidermidis or Staphylococcus hominus; and an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus haemolyticus.

[0028] In one aspect, the invention provides a method for categorizing a mammalian (e.g., human) sepsis-associated bacterium in a sample as one of seven groups of mammalian (e.g., human) sepsis-associated bacteria, comprising analyzing nucleic acid from the sample for single nucleotide polymorphisms (SNPs) in a 16S rRNA gene, wherein the SNPs are at positions corresponding to positions 396, 398, 399, 400 and 401 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein: the bacterium is determined to be a Group 1 pathogen selected from among the Gram-positive species Bacillus anthracis, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius, Streptococcus pyogenes, Lactobacillus intestinalis, Clostridium perfringens, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Eubacterium desmolans, Clostridium difficile, Erysipelothrix rhusiopathiae, Streptococcus bovis, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumonia, Streptococcus sanguinis, Streptococcus sobrinus and Peptostreptococcus stomatis or Gram-negative species Helicobacter pylori, Campylobacter coli and Veillonella dispar when there is an A, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 2 pathogen selected from among the Gram-positive species Corynebacterium diphtheria, Dermatophilus congolensis, Micrococcus luteus, Rhodococcus equi, Streptomyces anulatus, Streptomyces somaliensis, Mycobacterium tuberculosis, Corynebacterium jeikeium, Corynebacterium urealyticum, Mobiluncus curtisii, Nocardia asteroids, Nocardia brasiliensis and Actinomyces massiliensis or the Gram-negative species Leptospira interrogans, Chlamydia trachomatis and Chlamydophila pneumoniae when there is a G, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 3 pathogen selected from among Gram-negative aerobic bacterium selected from among Actinobacillus hominis, Edwardsiella tarda, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Morganella morganii, Pasteurella multocida, Providencia alcalifaciens, Vibrio cholerae, Moraxella catarrhalis, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Neisseria meningitides, Aeromonas hydrophila, Citrobacter freundii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia, Proteus mirabilis, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Yersinia enterocolitica, Yersinia pestis, Acinetobacter baumannii, Brucella abortus and Flavobacterium ceti when there is a C, T, G, C and C at positions 396, 398, 399, 400 and 401 respectively; the bacterium is determined to be a Group 4 pathogen selected from among the Gram-negative aerobic species Legionella pneumophila, Burkholderia cepacia and Cardiobacterium valvarum when there is an A, T, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be the Group 5 pathogen Stenotrophomonas maltophila when there is a C, T, A, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 6 pathogen selected from among the Gram-negative anaerobic species Prevotella buccae, Prevotella melaninogenica, Bacteroides fragilis, Prevotella intermedia when there is a C, A, G, T and A at positions 396, 398, 399, 400 and 401, respectively; or the bacterium is determined to be the Group 7 pathogen Porphyromonas gingivalis when there is a C, A, G, T and C at positions 396, 398, 399, 400 and 401, respectively.

[0029] The invention also provides a method for categorizing a mammalian (e.g., human) sepsis-associated bacterium in a sample, comprising analyzing nucleic acid from the sample for single nucleotide polymorphisms (SNPs) at positions corresponding to positions 396 and 398 of the 16S rRNA gene set forth in SEQ ID NO:1, and positions corresponding to positions 399, 400 and 401 or positions 278, 286 and 648 of the 16S rRNA gene set forth in SEQ ID NO:1; wherein if positions 396, 398, 399, 400 and 401 are assessed the bacterium is categorized into one of seven groups of mammalian (e.g., human) sepsis-associated bacteria; wherein the bacterium is determined to be a Group 1 pathogen selected from among the Gram-positive species Bacillus anthracis, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius, Streptococcus pyogenes, Lactobacillus intestinalis, Clostridium perfringens, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Eubacterium desmolans, Clostridium difficile, Erysipelothrix rhusiopathiae, Streptococcus bovis, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumonia, Streptococcus sanguinis, Streptococcus sobrinus and Peptostreptococcus stomatis or Gram-negative species Helicobacter pylori, Campylobacter coli and Veillonella dispar when there is an A, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 2 pathogen selected from among the Gram-positive species Corynebacterium diphtheria, Dermatophilus congolensis, Micrococcus luteus, Rhodococcus equi, Streptomyces anulatus, Streptomyces somaliensis, Mycobacterium tuberculosis, Corynebacterium jeikeium, Corynebacterium urealyticum, Mobiluncus curtisii, Nocardia asteroids, Nocardia brasiliensis and Actinomyces massiliensis or the Gram-negative species Leptospira interrogans, Chlamydia trachomatis and Chlamydophila pneumoniae when there is a G, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 3 pathogen selected from among Gram-negative aerobic bacterium selected from among Actinobacillus hominis, Edwardsiella tarda, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Morganella morganii, Pasteurella multocida, Providencia alcalifaciens, Vibrio cholerae, Moraxella catarrhalis, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Neisseria meningitides, Aeromonas hydrophila, Citrobacter freundii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia, Proteus mirabilis, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Yersinia enterocolitica, Yersinia pestis, Acinetobacter baumannii, Brucella abortus and Flavobacterium ceti when there is a C, T, G, C and C at positions 396, 398, 399, 400 and 401 respectively; the bacterium is determined to be a Group 4 pathogen selected from among the Gram-negative aerobic species Legionella pneumophila, Burkholderia cepacia and Cardiobacterium valvarum when there is an A, T, G, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be the Group 5 pathogen Stenotrophomonas maltophila when there is a C, T, A, C and C at positions 396, 398, 399, 400 and 401, respectively; the bacterium is determined to be a Group 6 pathogen selected from among the Gram-negative anaerobic species Prevotella buccae, Prevotella melaninogenica, Bacteroides fragilis, Prevotella intermedia when there is a C, A, G, T and A at positions 396, 398, 399, 400 and 401, respectively; or the bacterium is determined to be the Group 7 pathogen Porphyromonas gingivalis when there is a C, A, G, T and C at positions 396, 398, 399, 400 and 401, respectively; and

[0030] if positions 278, 286 396, 398 and 648 are assessed the bacterium is categorized as Gram-positive or Gram-negative; wherein the bacterium is determined to be a Gram-negative bacterium when there is a C at position 396; an A at position 396, a C at position 398 and a T at position 278; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648; or an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648; and the bacterium is determined to be a Gram-positive bacterium when there is a G at position 396; an A at position 396, a C at position 398 and a C at position 278; an A at position 396, a C at position 398, a G at position 278, and an A at position 286; an A at position 396, a C at position 398, an A at position 278 and an A at position 286; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648; or an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648.

[0031] In some embodiments, if the bacterium is determined to be a Group 1 bacterium, the methods of the invention may further comprise analyzing the nucleic acid for SNPs at positions corresponding to positions 490, 491, 492, 493, 495, 496, 500 and 501 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be a Group 1a bacterium selected from among Bacillus anthracis, Enterococcus faecalis, Enterococcus faecium and Listeria monocytogenes when there is an A, A, C, C, G, A, C, and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be a Group 1b bacterium selected from among Streptococcus agalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius and Streptococcus pyogenes when there is an A, A, C, C, G, A, G and G at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be the Group 1c bacterium Lactobacillus intestinali, when there is an A, A, C, C, G, A, T and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be a Group 1d bacterium selected from among Helicobacter pylori and Campylobacter coli when there is an A, A, C, G, A, T, C and A at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be the Group 1e bacterium Clostridium perfringens when there is an A, A, G, G, G, G, C and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be a Group 1f bacterium selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis and Staphylococcus saprophyticus when there is an A, A, T, C, G, A, C and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be the Group 1g bacterium Eubacterium desmolans when there is a G, A, A, G, A, T, C and T at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be the Group 1h bacterium Veillonella dispar when there is a G, A, A, T, G, A, C, and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be the Group 1i bacterium Clostridium difficile when there is a G, A, G, G, G, G, C and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; wherein the bacterium is determined to be the Group 1j bacterium Erysipelothrix rhusiopathiae when there is a T, A, C, C, G, A, C and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; the bacterium is determined to be a Group 1k bacterium selected from among Streptococcus bovis, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumonia, Streptococcus sanguinis, Streptococcus sobrinus, when there is a T, A, C, C, G, A, G and G at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively; and the bacterium is determined to be the Group 1l bacterium Peptostreptococcus stomatis when there is a T, G, T, G, G, G, C and C at positions 490, 491, 492, 493, 495, 496, 500 and 501, respectively.

[0032] If the bacterium is determined to be a Group 2 bacterium, the method may further comprise analyzing the nucleic acid for SNPs at positions corresponding to positions 490, 491, 492, 493, 496, 499 and 501 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be the Group 2a bacterium Corynebacterium diptheriae when there is an A, G, A, T, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be a Group 2b bacterium selected from among Dermatophilus congolensis, Micrococcus luteus and Rhodococcus equi when there is a G, C, A, G, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be a Group 2c bacterium selected from among Streptomyces anulatus and Streptomyces somaliensis when there is a G, C, A, G, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be the Group 2d bacterium Leptospira interogans when there is a G, C, C, T, A, A and C at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be the Group 2e bacterium Mycobacterium tuberculosis when there is a G, G, A, G, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be a Group 2f bacterium selected from among Corynebacterium jeikeium and Corynebacterium urealyticum when there is a G, G, A, T, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be the Group 2g bacterium Mobiluncus curtisii when there is a G, G, G, G, G, G and G at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be a Group 2h bacterium selected from among Chlamydia trachomatis and Chlamydophila pneumoniae when there is a G, G, T, A, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively; the bacterium is determined to be a Group 2i bacterium selected from among Nocardia asteroids and Nocardia brasiliensis when there is a G, T, A, G, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively, and the bacterium is determined to be a Group 2j bacterium Actinomyces massiliensis when there is a G, T, T, G, G, G and A at positions 490, 491, 492, 493, 496, 499 and 501, respectively.

[0033] In instances where the bacterium is determined to be a Group 3 bacterium, the method can further comprise analyzing the nucleic acid for SNPs at positions corresponding to positions 490, 491, 496, and 501 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be a Group 3a bacterium selected from among Actinobacillus hominis, Edwardsiella tarda, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Morganella morganii, Pasteurella multocida, Providencia alcalifaciens and Vibrio cholerae when there is an A, C, G and A at positions 490, 491, 496, and 501, respectively; the bacterium is determined to be a Group 3b bacterium selected from among Moraxella catharrallis and Pseudomonas aeruginosa, when there is an A, C, T and A at positions 490, 491, 496, and 501, respectively; the bacterium is determined to be a Group 3c bacterium selected from among Neisseria gonorrhoeae and Neisseria meningitides when there is a G, A T and A at positions 490, 491, 496, and 501, respectively; the bacterium is determined to be a Group 3d bacterium selected from among Aeromonas hydrophila, Citrobacter freundii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia, Proteus mirabilis, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Yersinia enterocolitica and Yersinia pestis when there is an G, C, G and A at positions 490, 491, 496, and 501, respectively; the bacterium is determined to be the Group 3e bacterium Acinetobacter baumannii when there is a G, C, T and A at positions 490, 491, 496, and 501, respectively; the bacterium is determined to be the Group 3f bacterium Brucella abortus when there is a G, G, G and C at positions 490, 491, 496, and 501, respectively; and the bacterium is determined to be the Group 3g bacterium Flavobacterium ceti when there is a T, A, T and A at positions 490, 491, 496, and 501, respectively.

[0034] If the bacterium is determined to be a Group 4 bacterium, the method can further comprise analyzing the nucleic acid for SNPs at positions corresponding to positions 490, 491, 496, and 499 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be the Group 4a bacterium Legionella pneumophila when there is an A, C, G and C at positions 490, 491, 496, and 499, respectively; the bacterium is determined to be the Group 4b bacterium Burkholderia cepacia when there is a G, A, T and G at positions 490, 491, 496, and 499, respectively; and the bacterium is determined to be the Group 4c bacterium Cardiobacterium valvarum when there is a G, C, G and G at positions 490, 491, 496, and 499, respectively.

[0035] If the bacterium is determined to be a Group 6 bacterium, the method may further comprise analyzing the nucleic acid for SNPs at positions corresponding to positions 490, 491 and 496 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein the bacterium is determined to be the Group 6a bacterium Prevotella buccae when there is a C, A and T at positions 490, 491 and 496, respectively; the bacterium is determined to be the Group 6b bacterium Prevotella melaninogenica when there is a T, A and C at positions 490, 491 and 496, respectively; the bacterium is determined to be the Group 6c bacterium Bacteroides fragilis, when there is an T, A and T at positions 490, 491 and 496, respectively; and the bacterium is determined to be the Group 6b bacterium Prevotella intermedia when there is a T, T and C at positions 490, 491 and 496, respectively.

[0036] In some embodiments, the methods of the invention further comprise determining whether the bacterium is resistant to one or more antibiotics.

[0037] In one embodiment, the methods described above and herein further comprise analyzing the sample to determine the presence or absence of a w452w3aq34t5yghus in the sample, which further analysis comprises analyzing the nucleic acid for a single nucleotide polymorphism (SNP) within a 5.8S rRNA gene at a position corresponding to position 142, 144, 146, 147, 148, 154, 157, 164, 167, 185, 187, 188, 194, 197, 213, 215, 216, 219, 223, 231, 232, 236, 245, 251, or 256 of the 5.8S rRNA gene set forth in SEQ ID NO:2, which SNP is indicative of the presence of a fungus in the sample, wherein the SNP is selected from among a C at position 142; an A at position 144; an A at position 146; an A at position 147; a C at position 148; a T at position 154; a T at position 157; a C or G at position 164; an A at position 167; a G at position 185; an A at position 187; an A at position 188; a T at position 194; a G at position 197; an A at position 213; a T at position 215; a T at position 216; a G at position 219; an A at position 223; a G or A at position 231; a T at position 232; a T at position 236; a C or A at position 245; a C at position 251; and a T at position 256.

[0038] The method may further comprise analyzing the sample to determine the presence and identity of a mammalian (e.g., human) fungal pathogen in the sample, which further analysis comprises analyzing the nucleic acid for at least four SNPs within a 5.8S rRNA gene, wherein: the at least four SNPs include those at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; and any two of positions corresponding to positions 163, 164, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2; the mammalian (e.g., human) fungal pathogen is selected from Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata, Ajellomyces capsulatus, Stachybotrys sp., Scedosporium apiospermum, Fusarium sp., Aspergillus fumigatus and Cryptococcus neoformans; and the presence and identity of the pathogen is determined based on the presence of SNPs set forth in following table:

	SNP position
	160	163	164	165	196	202	223	224	254	255	259
Candida albicans	T	T	C	G	C	A	A	T	T	C	T
Candida tropicalis	T	T	C	G	C	A	A	T	T	T	T
Candida parapsilosis	T	T	C	G	A	A	A	T	T	T	T
Candida krusei	T	T	C	G	C	G	A	T	C	T	C
Candida glabrata	T	T	C	G	C	G	A	T	T	C	T
Ajellomyces capsulatus	T	C	G	A	A	G	A	T	T	C	T
Stachybotrys sp.	C	T	G	G	A	G	A	T	G	C	C
Scedosporium apiospermum	T	T	G	G	A	G	A	T	G	C	T
Fusarium sp.	C	T	G	G	A	G	A	T	G	C	T
Aspergillus fumigatus	T	C	G	G	A	G	A	T	C	C	T
Cryptococcus neoformans	C	C	C	A	A	G	A	T	T	T	T

[0039] In some embodiments, the at least four SNPs are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; a position corresponding to position 164 of SEQ ID NO:2; and a position corresponding to position 163, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2. In other embodiments, the at least four SNPs are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; a position corresponding to position 223 of SEQ ID NO:2; and a position corresponding to position 163, 164, 165, 196, 202, 224 or 259 of SEQ ID NO:2.

[0040] In some embodiments, the methods of the invention further comprise determining the number of bacteria and/or the number of fungal cells in the sample. In particular examples, the sample is a biological sample from a mammalian (e.g., human) subject presenting with systemic inflammatory response syndrome (SIRS) or suspected of having sepsis, such as a blood sample. In some embodiments of the methods of the invention, the nucleic acid is extracted from the sample prior to analysis. In further embodiments, the analysis comprises amplification of the nucleic acid. In some examples, the analysis is performed using sequencing, 5′ nuclease digestion, molecular beacons, oligonucleotide ligation, microarray, or any combination thereof.

[0041] A further aspect of the invention is directed to a method for determining the presence or absence of fungi in a sample, comprising analyzing nucleic acid from the sample for a single nucleotide polymorphism (SNP) in a 5.8S rRNA gene, which SNP is indicative of the presence of fungi in the sample, wherein the SNP is selected from among a C at position 142; an A at position 144; an A at position 146; an A at position 147; a C at position 148; a T at position 154; a T at position 157; a C or G at position 164; an A at position 167; a G at position 185; an A at position 187; an A at position 188; a T at position 194; a G at position 197; an A at position 213; a T at position 215; a T at position 216; a G at position 219; an A at position 223; a G or A at position 231; a T at position 232; a T at position 236; a C or A at position 245; a C at position 251; and a T at position 256. In some embodiments, the sample is selected from soil, food, water, surface swab and biological sample from a subject. In a particular embodiment, the biological sample is selected from among blood, tissue, sputum, lavage fluid, feces, urine and saliva.

[0042] The method may further comprise determining the number of fungal cells in the sample. In particular examples, nucleic acid is extracted from the sample prior to analysis. In some embodiments, the analysis comprises amplification of the nucleic acid. In further embodiments, the analysis is performed using sequencing, 5′ nuclease digestion, molecular beacons, oligonucleotide ligation, microarray, or any combination thereof.

[0043] The present invention also provides a method for determining the identity of a mammalian (e.g., human) fungal pathogen in a sample, comprising analyzing nucleic acid from the sample for at least 4 SNPs in a 5.8S rRNA gene, wherein: the at least four SNPs are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; and any two of positions corresponding to positions 163, 164, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2; the mammalian (e.g., human) fungal pathogen is selected from Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata, Ajellomyces capsulatus, Stachybotrys sp., Scedosporium apiospermum, Fusarium sp., Aspergillus fumigatus and Cryptococcus neoformans; and the identity of the pathogen is determined based on the presence of SNPs set forth in following table:

	SNP position
	160	163	164	165	196	202	223	224	254	255	259
Candida albicans	T	T	C	G	C	A	A	T	T	C	T
Candida tropicalis	T	T	C	G	C	A	A	T	T	T	T
Candida parapsilosis	T	T	C	G	A	A	A	T	T	T	T
Candida krusei	T	T	C	G	C	G	A	T	C	T	C
Candida glabrata	T	T	C	G	C	G	A	T	T	C	T
Ajellomyces capsulatus	T	C	G	A	A	G	A	T	T	C	T
Stachybotrys sp.	C	T	G	G	A	G	A	T	G	C	C
Scedosporium apiospermum	T	T	G	G	A	G	A	T	G	C	T
Fusarium sp.	C	T	G	G	A	G	A	T	G	C	T
Aspergillus fumigatus	T	C	G	G	A	G	A	T	C	C	T
Cryptococcus neoformans	C	C	C	A	A	G	A	T	T	T	T

[0044] In particular examples, the at least four SNPs are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; a position corresponding to position 164 of SEQ ID NO:2; and a position corresponding to position 163, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2. In other examples, the at least four SNPs are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; a position corresponding to position 223 of SEQ ID NO:2; and a position corresponding to position 163, 164, 165, 196, 202, 224 or 259 of SEQ ID NO:2.

[0045] The present invention also provides a method for determining the identity of a mammalian (e.g., human) fungal pathogen in a sample, comprising analyzing nucleic acid from the sample for at least two SNPs in a 5.8S rRNA gene, wherein: the at least two SNPs are at a position corresponding to position 163 of SEQ ID NO:2, and a position corresponding to position 164 of SEQ ID NO:2, wherein the presence of T at position 163 and C at position 164 indicates that the fungal pathogen in the sample is a Candida species. Suitably, the Candida species is selected from Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata.

[0046] The present invention also provides a method for determining the presence or absence of a Candida species in a sample, comprising analyzing nucleic acid from the sample for at least two SNPs in a 5.8S rRNA gene, wherein: the at least two SNPs are at a position corresponding to position 163 of SEQ ID NO:2, and a position corresponding to position 164 of SEQ ID NO:2, wherein the presence of T at position 163 and C at position 164 indicates the presence of a Candida species in the sample, and wherein the absence of T at position 163 and C at position 164 indicates the absence of a Candida species in the sample. Suitably, the Candida species is selected from Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata.

[0047] In some embodiments, the method for determining the identity of a mammalian (e.g., human) fungal pathogen in a sample further comprises determining the Gram status of a mammalian (e.g., human) sepsis-associated bacterium in the sample, comprising analyzing nucleic acid from the sample for a single nucleotide polymorphism (SNP) in a 16S rRNA gene, wherein the SNP is at a position corresponding to position 396 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein: the bacterium is determined to be a Gram-negative bacterium when there is a C at position 396; and the bacterium is determined to be a Gram-positive bacterium when there is a G at position 396. In some examples the bacterium is selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans and Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia and Prevotella melaninogenica.

[0048] In further embodiments, the method for determining the identity of a mammalian (e.g., human) fungal pathogen in a sample further comprises determining the Gram status of a mammalian (e.g., human) sepsis-associated bacterium in the sample, comprising analyzing nucleic acid from the sample for SNPs in a 16S rRNA gene, wherein the SNPs are at positions corresponding to positions 278, 286, 396, 398, and 648 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein: the bacterium is determined to be a Gram-negative bacterium when there is: a C at position 396; an A at position 396, a C at position 398 and a T at position 278; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648; or an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648; and the bacterium is determined to be a Gram-positive bacterium when there is: a G at position 396; an A at position 396, a C at position 398 and a C at position 278; an A at position 396, a C at position 398, a G at position 278, and an A at position 286; an A at position 396, a C at position 398, an A at position 278 and an A at position 286; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648; or an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648. In some examples, the bacterium is selected from Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Salmonella enterica, Serratia marcescens, Haemophilus influenzae, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori, Chlamydophila abortus, Veillonella atypica, Veillonella parvula, Veillonella denticariosi, Veillonella rogosae, Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis.

[0049] The methods may further comprising identifying the bacterium or identifying the bacterium as being one of a group of bacteria, wherein: a C at position 396 indicates that the bacterium is a Gram-negative bacterium selected from Prevotella melaninogenica, Prevotella intermedia, Prevotella buccae, Bacteroides fragilis, Citrobacter freundii, Enterobacter aerogenes, Klebsiella oxytoca, Serratia marcescens, Morganella morganii, Stenotrophomonas maltophila, Acinetobacter baumannii, Enterobacter cloacae, Klebsiella pneumoniae, Salmonella enterica, Escherichia coli, Proteus mirabilis, Neisseria meningitidis, Pseudomonas aeruginosa, Haemophilus influenzae and Burkholderia cepacia; an A at position 396, a C at position 398 and a T at position 278 indicates that the bacterium is a Gram-negative bacteria selected from Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori and Chlamydophila abortus; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella rogosae; an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella atypica, Veillonella parvula and Veillonella denticariosi; a G at position 396 indicates that the bacteria is a Gram-positive bacterium selected from among Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis; an A at position 396, a C at position 398 and a C at position 278 indicates that the bacterium is the Gram-positive bacteria Enterococcus faecalis or Enterococcus faecium; an A at position 396, a C at position 398, a G at position 278, a T at position 286 and a T at position 648 indicates that the bacterium is the Gram-positive bacterium Clostridium perfringens; an A at position 396, a C at position 398, a G at position 278, and an A at position 286 indicates that the bacterium is the Gram-positive bacterium Streptococcus bovis, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus pyogenes, Streptococcus anginosus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus sanguinis; or an A at position 396, a C at position 398, an A at position 278 and an A at position 286 indicates that the bacterium is a Gram-positive bacterium selected from among Staphylococcus aureus, Streptococcus sobrinus, Streptococcus constellatus and Streptococcus oralis; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus epidermidis or Staphylococcus hominus; and an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus haemolyticus.

[0050] The methods also may further include categorizing a mammalian (e.g., human) sepsis-associated bacterium in the sample as one of seven groups of mammalian (e.g., human) sepsis-associated bacteria, comprising analyzing nucleic acid from the sample for single nucleotide polymorphisms (SNPs) in a 16S rRNA gene, wherein the SNPs are at positions corresponding to positions 396, 398, 399, 400 and 401 of the 16S rRNA gene set forth in SEQ ID NO:1, as described above and herein. In addition, further grouping of the bacteria into Groups 1a-l, 2a-j, 3a-g, 4a-c and 6a-d, can be performed as described above and herein.

[0051] In some examples, the number of fungal cells and/or bacteria in the sample is also determined. The sample may be, for example, a biological sample from a mammalian (e.g., human) subject, such as for example blood, tissue, sputum, lavage fluid, feces, urine or saliva. In particular embodiments, the biological sample is blood. In some embodiments, the nucleic acid is extracted from the sample prior to analysis. In further embodiments, the analysis comprises amplification of the nucleic acid. In some instances, the analysis is performed using sequencing, 5′ nuclease digestion, molecular beacons, oligonucleotide ligation, microarray, or any combination thereof.

[0052] The present invention also provides a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for a SNP in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP is indicative of sepsis, wherein: the SNP in the 16S rRNA gene is at a position corresponding to position 396 of the 16S rRNA gene set forth in SEQ ID NO:1 and wherein sepsis resulting from a Gram-negative bacterial infection is diagnosed when there is a C at position 396, and sepsis resulting from a Gram-positive bacterial infection is diagnosed when there is a G at position 396; and the SNP in the 5.8S rRNA gene is at a position corresponding to position 142, 144, 146, 147, 148, 154, 157, 164, 167, 185, 187, 188, 194, 197, 213, 215, 216, 219, 223, 231, 232, 236, 245, 251, or 256 of the 5.8S rRNA gene set forth in SEQ ID NO:2, and sepsis resulting from a fungal infection is diagnosed when there is a C at position 142; an A at position 144; an A at position 146; an A at position 147; a C at position 148; a T at position 154; a T at position 157; a C or G at position 164; an A at position 167; a G at position 185; an A at position 187; an A at position 188; a T at position 194; a G at position 197; an A at position 213; a T at position 215; a T at position 216; a G at position 219; an A at position 223; a G or A at position 231; a T at position 232; a T at position 236; a C or A at position 245; a C at position 251; or a T at position 256. In some embodiments of the method, the bacterial infection is an infection by a bacterium selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans and Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumoniae, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia and Prevotella melaninogenica.

[0053] In another aspect, the invention provides a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for SNPs in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP(s) is indicative of sepsis, wherein: the SNPs in the 16S rRNA gene are at positions corresponding to positions 278, 286, 396, 398, and 648 of the 16S rRNA gene set forth in SEQ ID NO:1, and wherein: sepsis resulting from a Gram-negative bacterial infection is diagnosed when there is: a C at position 396; an A at position 396, a C at position 398 and a T at position 278; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648; or an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648; and sepsis resulting from a Gram-positive bacterial infection is diagnosed when there is: a G at position 396; an A at position 396, a C at position 398 and a C at position 278; an A at position 396, a C at position 398, a G at position 278, and an A at position 286; an A at position 396, a C at position 398, an A at position 278 and an A at position 286; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648; or an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648; and the SNP in the 5.8S rRNA gene is at a position corresponding to position 142, 144, 146, 147, 148, 154, 157, 164, 167, 185, 187, 188, 194, 197, 213, 215, 216, 219, 223, 231, 232, 236, 245, 251, or 256 of the 5.8S rRNA gene set forth in SEQ ID NO:2, and sepsis resulting from a fungal infection is diagnosed when there is a C at position 142; an A at position 144; an A at position 146; an A at position 147; a C at position 148; a T at position 154; a T at position 157; a C or G at position 164; an A at position 167; a G at position 185; an A at position 187; an A at position 188; a T at position 194; a G at position 197; an A at position 213; a T at position 215; a T at position 216; a G at position 219; an A at position 223; a G or A at position 231; a T at position 232; a T at position 236; a C or A at position 245; a C at position 251; or a T at position 256.

[0054] In one example, the bacterial infection is an infection by a bacterium selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Salmonella enterica, Serratia marcescens, Haemophilus influenzae, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori, Chlamydophila abortus, Veillonella atypica, Veillonella parvula, Veillonella denticariosi, Veillonella rogosae, Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis.

[0055] In some embodiments, the methods further comprise identifying the bacterium or identifying the bacterium as being one of a group of bacteria when the sepsis is determined to be caused by a Gram-positive bacterium or a Gram-negative bacterium, wherein a C at position 396 indicates that the bacterium is a Gram-negative bacterium selected from Prevotella melaninogenica, Prevotella intermedia, Prevotella buccae, Bacteroides fragilis, Citrobacter freundii, Enterobacter aerogenes, Klebsiella oxytoca, Serratia marcescens, Morganella morganii, Stenotrophomonas maltophila, Acinetobacter baumannii, Enterobacter cloacae, Klebsiella pneumoniae, Salmonella enterica, Escherichia coli, Proteus mirabilis, Neisseria meningitidis, Pseudomonas aeruginosa, Haemophilus influenzae and Burkholderia cepacia; an A at position 396, a C at position 398 and a T at position 278 indicates that the bacterium is a Gram-negative bacteria selected from Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori and Chlamydophila abortus; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella rogosae; an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella atypica, Veillonella parvula and Veillonella denticariosi; a G at position 396 indicates that the bacteria is a Gram-positive bacterium selected from among Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis; an A at position 396, a C at position 398 and a C at position 278 indicates that the bacterium is the Gram-positive bacteria Enterococcus faecalis or Enterococcus faecium; an A at position 396, a C at position 398, a G at position 278, a T at position 286 and a T at position 648 indicates that the bacterium is the Gram-positive bacterium Clostridium perfringens; an A at position 396, a C at position 398, a G at position 278, and an A at position 286 indicates that the bacterium is the Gram-positive bacterium Streptococcus bovis, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus pyogenes, Streptococcus anginosus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus sanguinis; or an A at position 396, a C at position 398, an A at position 278 and an A at position 286 indicates that the bacterium is a Gram-positive bacterium selected from among Staphylococcus aureus, Streptococcus sobrinus, Streptococcus constellatus and Streptococcus oralis; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus epidermidis or Staphylococcus hominus; and an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus haemolyticus.

[0056] In another aspect, the invention provides a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for a SNP in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP is indicative of sepsis, wherein: the SNP in the 16S rRNA gene is at a position corresponding to position 396 of the 16S rRNA gene set forth in SEQ ID NO:1 and wherein sepsis resulting from a Gram-negative bacterial infection is diagnosed when there is a C at position 396 or and sepsis resulting from a Gram-positive bacterial infection is diagnosed when there is a G at position 396; and the SNPs in the 5.8S rRNA gene are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; and any two of positions corresponding to positions 163, 164, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2, and wherein sepsis resulting from an infection by a fungus selected from among Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata, Ajellomyces capsulatus, Stachybotrys sp., Scedosporium apiospermum, Fusarium sp., Aspergillus fumigatus and Cryptococcus neoformans is diagnosed based on the presence of SNPs set forth in following table:

	SNP position
	160	163	164	165	196	202	223	224	254	255	259
Candida albicans	T	T	C	G	C	A	A	T	T	C	T
Candida tropicalis	T	T	C	G	C	A	A	T	T	T	T
Candida parapsilosis	T	T	C	G	A	A	A	T	T	T	T
Candida krusei	T	T	C	G	C	G	A	T	C	T	C
Candida glabrata	T	T	C	G	C	G	A	T	T	C	T
Ajellomyces capsulatus	T	C	G	A	A	G	A	T	T	C	T
Stachybotrys sp.	C	T	G	G	A	G	A	T	G	C	C
Scedosporium apiospermum	T	T	G	G	A	G	A	T	G	C	T
Fusarium sp.	C	T	G	G	A	G	A	T	G	C	T
Aspergillus fumigatus	T	C	G	G	A	G	A	T	C	C	T
Cryptococcus neoformans	C	C	C	A	A	G	A	T	T	T	T

[0057] In some embodiments, the bacterial infection is an infection by a bacterium selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans and Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia and Prevotella melaninogenica.

[0058] Also provided is a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for SNPs in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP(s) is indicative of sepsis, wherein: the SNPs in the 16S rRNA gene are at positions corresponding to positions 278, 286, 396, 398, and 648 of the 16S rRNA gene set forth in SEQ ID NO:1, and wherein sepsis resulting from a Gram-negative bacterial infection is diagnosed when there is: a C at position 396; an A at position 396, a C at position 398 and a T at position 278; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648; or an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648; and sepsis resulting from a Gram-positive bacterial infection is diagnosed when there is a G at position 396; an A at position 396, a C at position 398 and a C at position 278; an A at position 396, a C at position 398, a G at position 278, and an A at position 286; an A at position 396, a C at position 398, an A at position 278 and an A at position 286; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and an A at position 648; or an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648; and the SNPs in the 5.8S rRNA gene are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; and any two of positions corresponding to positions 163, 164, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2, and wherein sepsis resulting from an infection by a fungus selected from among Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata, Ajellomyces capsulatus, Stachybotrys sp., Scedosporium apiospermum, Fusarium sp., Aspergillus fumigatus and Cryptococcus neoformans is diagnosed based on the presence of SNPs set forth in following table:

	SNP position
	160	163	164	165	196	202	223	224	254	255	259
Candida albicans	T	T	C	G	C	A	A	T	T	C	T
Candida tropicalis	T	T	C	G	C	A	A	T	T	T	T
Candida parapsilosis	T	T	C	G	A	A	A	T	T	T	T
Candida krusei	T	T	C	G	C	G	A	T	C	T	C
Candida glabrata	T	T	C	G	C	G	A	T	T	C	T
Ajellomyces capsulatus	T	C	G	A	A	G	A	T	T	C	T
Stachybotrys sp.	C	T	G	G	A	G	A	T	G	C	C
Scedosporium apiospermum	T	T	G	G	A	G	A	T	G	C	T
Fusarium sp.	C	T	G	G	A	G	A	T	G	C	T
Aspergillus fumigatus	T	C	G	G	A	G	A	T	C	C	T
Cryptococcus neoformans	C	C	C	A	A	G	A	T	T	T	T

[0059] In particular embodiments, the bacterial infection is an infection by a bacterium selected from among Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Streptococcus anginosus, Streptococcus constellatus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus sanguinis, Streptococcus sobrinus and Streptococcus oralis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus bovis, Streptococcus sanguinis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus pyogenes, Escherichia coli, Acinetobacter baumannii, Bacteroides fragilis, Burkholderia cepacia, Klebsiella pneumonia, Klebsiella oxytoca, Pseudomonas aeruginosa, Enterobacter aerogenes, Enterobacter cloacae, Serratia marcescens, Proteus mirabilis, Citrobacter freundii, Morganella morganii, Haemophilus influenzae, Neisseria meningitidis, Stenotrophomonas maltophila, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Salmonella enterica, Serratia marcescens, Haemophilus influenzae, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori, Chlamydophila abortus, Veillonella atypica, Veillonella parvula, Veillonella denticariosi, Veillonella rogosae, Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis.

[0060] In some example, the method further comprises identifying the bacterium or identifying the bacterium as being one of a group of bacteria when the sepsis is determined to be caused by a Gram-positive bacterium or a Gram-negative bacterium, wherein: a C at position 396 indicates that the bacterium is a Gram-negative bacterium selected from Prevotella melaninogenica, Prevotella intermedia, Prevotella buccae, Bacteroides fragilis, Citrobacter freundii, Enterobacter aerogenes, Klebsiella oxytoca, Serratia marcescens, Morganella morganii, Stenotrophomonas maltophila, Acinetobacter baumannii, Enterobacter cloacae, Klebsiella pneumoniae, Salmonella enterica, Escherichia coli, Proteus mirabilis, Neisseria meningitidis, Pseudomonas aeruginosa, Haemophilus influenzae and Burkholderia cepacia; an A at position 396, a C at position 398 and a T at position 278 indicates that the bacterium is a Gram-negative bacteria selected from Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Campylobacter fetus, Helicobacter cinaedi, Helicobacter pylori and Chlamydophila abortus; an A at position 396, a C at position 398, an A at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella rogosae; an A at position 396, a C at position 398, an G at position 278, a G at position 286 and a G at position 648 indicates that the bacterium is the Gram-negative bacterium Veillonella atypica, Veillonella parvula and Veillonella denticariosi; a G at position 396 indicates that the bacteria is a Gram-positive bacterium selected from among Streptomyces anulatus, Streptomyces somaliensis and Mycobacterium tuberculosis; an A at position 396, a C at position 398 and a C at position 278 indicates that the bacterium is the Gram-positive bacteria Enterococcus faecalis or Enterococcus faecium; an A at position 396, a C at position 398, a G at position 278, a T at position 286 and a T at position 648 indicates that the bacterium is the Gram-positive bacterium Clostridium perfringens; an A at position 396, a C at position 398, a G at position 278, and an A at position 286 indicates that the bacterium is the Gram-positive bacterium Streptococcus bovis, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus pyogenes, Streptococcus anginosus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus sanguinis; or an A at position 396, a C at position 398, an A at position 278 and an A at position 286 indicates that the bacterium is a Gram-positive bacterium selected from among Staphylococcus aureus, Streptococcus sobrinus, Streptococcus constellatus and Streptococcus oralis; an A at position 396, a C at position 398, a A at position 278, a G at position 286 and an A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus epidermidis or Staphylococcus hominus; and an A at position 396, a C at position 398, a G at position 278, a G at position 286 and a T or A at position 648 indicates that the bacterium is the Gram-positive bacterium Staphylococcus haemolyticus.

[0061] The invention also provides a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for SNPs in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP(s) is indicative of sepsis, wherein the SNPs in the 16S rRNA gene are at positions corresponding to positions 396, 398, 399, 400 and 401 of the 16S rRNA gene set forth in SEQ ID NO:1, and wherein sepsis resulting from a Group 1 bacterium selected from among the Gram-positive species Bacillus anthracis, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius, Streptococcus pyogenes, Lactobacillus intestinalis, Clostridium perfringens, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Eubacterium desmolans, Clostridium difficile, Erysipelothrix rhusiopathiae, Streptococcus bovis, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumonia, Streptococcus sanguinis, Streptococcus sobrinus and Peptostreptococcus stomatis or Gram-negative species Helicobacter pylori, Campylobacter coli and Veillonella dispar is diagnosed when there is an A, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 2 bacterium selected from among the Gram-positive species Corynebacterium diphtheria, Dermatophilus congolensis, Micrococcus luteus, Rhodococcus equi, Streptomyces anulatus, Streptomyces somaliensis, Mycobacterium tuberculosis, Corynebacterium jeikeium, Corynebacterium urealyticum, Mobiluncus curtisii, Nocardia asteroids, Nocardia brasiliensis and Actinomyces massiliensis or the Gram-negative species Leptospira interrogans, Chlamydia trachomatis and Chlamydophila pneumoniae is diagnosed when there is a G, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 3 bacterium selected from among Gram-negative aerobic bacterium selected from among Actinobacillus hominis, Edwardsiella tarda, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Morganella morganii, Pasteurella multocida, Providencia alcalifaciens, Vibrio cholerae, Moraxella catarrhalis, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Neisseria meningitides, Aeromonas hydrophila, Citrobacter freundii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia, Proteus mirabilis, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Yersinia enterocolitica, Yersinia pestis, Acinetobacter baumannii, Brucella abortus and Flavobacterium ceti is diagnosed when there is a C, T, G, C and C at positions 396, 398, 399, 400 and 401 respectively; sepsis resulting from a Group 4 bacterium selected from among the Gram-negative aerobic species Legionella pneumophila, Burkholderia cepacia and Cardiobacterium valvarum is determined when there is an A, T, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from the Group 5 bacterium Stenotrophomonas maltophila is diagnosed when there is a C, T, A, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 6 bacterium selected from among the Gram-negative anaerobic species Prevotella buccae, Prevotella melaninogenica, Bacteroides fragilis, Prevotella intermedia is diagnosed when there is a C, A, G, T and A at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from the Group 7 bacterium Porphyromonas gingivalis is diagnosed when there is a C, A, G, T and C at positions 396, 398, 399, 400 and 401, respectively; and the SNP in the 5.8S rRNA gene is at a position corresponding to position 142, 144, 146, 147, 148, 154, 157, 164, 167, 185, 187, 188, 194, 197, 213, 215, 216, 219, 223, 231, 232, 236, 245, 251, or 256 of the 5.8S rRNA gene set forth in SEQ ID NO:2, and sepsis resulting from a fungal infection is diagnosed when there is a C at position 142; an A at position 144; an A at position 146; an A at position 147; a C at position 148; a T at position 154; a T at position 157; a C or G at position 164; an A at position 167; a G at position 185; an A at position 187; an A at position 188; a T at position 194; a G at position 197; an A at position 213; a T at position 215; a T at position 216; a G at position 219; an A at position 223; a G or A at position 231; a T at position 232; a T at position 236; a C or A at position 245; a C at position 251; or a T at position 256.

[0062] In another aspect, the invention provides a method for diagnosing sepsis in a mammalian (e.g., human) subject, comprising analysing nucleic acid from the blood of the subject for SNPs in a 16S rRNA gene and a SNP in a 5.8s rRNA gene, wherein the presence of the SNP(s) is indicative of sepsis, wherein the SNPs in the 16S rRNA gene are at positions corresponding to positions 396, 398, 399, 400 and 401 of the 16S rRNA gene set forth in SEQ ID NO:1, and wherein sepsis resulting from a Group 1 bacterium selected from among the Gram-positive species Bacillus anthracis, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius, Streptococcus pyogenes, Lactobacillus intestinalis, Clostridium perfringens, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Eubacterium desmolans, Clostridium difficile, Erysipelothrix rhusiopathiae, Streptococcus bovis, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumonia, Streptococcus sanguinis, Streptococcus sobrinus and Peptostreptococcus stomatis or Gram-negative species Helicobacter pylori, Campylobacter coli and Veillonella dispar is diagnosed when there is an A, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 2 bacterium selected from among the Gram-positive species Corynebacterium diphtheria, Dermatophilus congolensis, Micrococcus luteus, Rhodococcus equi, Streptomyces anulatus, Streptomyces somaliensis, Mycobacterium tuberculosis, Corynebacterium jeikeium, Corynebacterium urealyticum, Mobiluncus curtisii, Nocardia asteroids, Nocardia brasiliensis and Actinomyces massiliensis or the Gram-negative species Leptospira interrogans, Chlamydia trachomatis and Chlamydophila pneumoniae is diagnosed when there is a G, C, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 3 bacterium selected from among Gram-negative aerobic bacterium selected from among Actinobacillus hominis, Edwardsiella tarda, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Morganella morganii, Pasteurella multocida, Providencia alcalifaciens, Vibrio cholerae, Moraxella catarrhalis, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Neisseria meningitides, Aeromonas hydrophila, Citrobacter freundii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia, Proteus mirabilis, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Yersinia enterocolitica, Yersinia pestis, Acinetobacter baumannii, Brucella abortus and Flavobacterium ceti is diagnosed when there is a C, T, G, C and C at positions 396, 398, 399, 400 and 401 respectively; sepsis resulting from a Group 4 bacterium selected from among the Gram-negative aerobic species Legionella pneumophila, Burkholderia cepacia and Cardiobacterium valvarum is determined when there is an A, T, G, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from the Group 5 bacterium Stenotrophomonas maltophila is diagnosed when there is a C, T, A, C and C at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from a Group 6 bacterium selected from among the Gram-negative anaerobic species Prevotella buccae, Prevotella melaninogenica, Bacteroides fragilis, Prevotella intermedia is diagnosed when there is a C, A, G, T and A at positions 396, 398, 399, 400 and 401, respectively; sepsis resulting from the Group 7 bacterium Porphyromonas gingivalis is diagnosed when there is a C, A, G, T and C at positions 396, 398, 399, 400 and 401, respectively; and

[0063] the SNPs in the 5.8S rRNA gene are at a position corresponding to position 254 of SEQ ID NO:2; a position corresponding to position 160 or 255 of SEQ ID NO:2; and any two of positions corresponding to positions 163, 164, 165, 196, 202, 223, 224 or 259 of SEQ ID NO:2, and wherein sepsis resulting from an infection by a fungus selected from among Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida glabrata, Ajellomyces capsulatus, Stachybotrys sp., Scedosporium apiospermum, Fusarium sp., Aspergillus fumigatus and Cryptococcus neoformans is diagnosed based on the presence of SNPs set forth in following table:

	SNP position
	160	163	164	165	196	202	223	224	254	255	259
Candida albicans	T	T	C	G	C	A	A	T	T	C	T
Candida tropicalis	T	T	C	G	C	A	A	T	T	T	T
Candida parapsilosis	T	T	C	G	A	A	A	T	T	T	T
Candida krusei	T	T	C	G	C	G	A	T	C	T	C
Candida glabrata	T	T	C	G	C	G	A	T	T	C	T
Ajellomyces capsulatus	T	C	G	A	A	G	A	T	T	C	T
Stachybotrys sp.	C	T	G	G	A	G	A	T	G	C	C
Scedosporium apiospermum	T	T	G	G	A	G	A	T	G	C	T
Fusarium sp.	C	T	G	G	A	G	A	T	G	C	T
Aspergillus fumigatus	T	C	G	G	A	G	A	T	C	C	T
Cryptococcus neoformans	C	C	C	A	A	G	A	T	T	T	T

[0064] In some embodiments of the present methods, if sepsis is determined to result from a bacterium from Group 1, 2, 3, 4, or 6, further grouping of the bacteria into Groups 1a-l, 2a-j, 3a-g, 4a-c and 6a-d, can be performed as described above and herein.

[0065] In some embodiments, the number of bacteria and/or fungi in the sample is also determined. In one example, the nucleic acid is extracted from the sample prior to analysis. In further examples, the analysis comprises amplification of the nucleic acid. In one embodiment, the analysis is performed using sequencing, 5′ nuclease digestion, molecular beacons, oligonucleotide ligation, microarray, or any combination thereof. In further embodiments, the methods of diagnosis further comprise administering a therapeutic agent to the subject, such as an anti-fungal agent or an antibiotic.

[0067]

TABLE A
BRIEF DESCRIPTION OF THE SEQUENCES
Sequence ID
Number	Sequence
SEQ ID NO: 1	Escherichia coli 16S rRNA gene (Genbank accession NR_074891)
SEQ ID NO: 2	Candida albicans 5.8S rRNA gene (Genbank accession JQ070104.1)
SEQ ID NO: 3	Homo sapiens 5.8S rRNA gene (Genbank accession NR_003285.2)
SEQ ID NO: 4	Gram-positive 396/398 probe GCAACGCCGCGT
SEQ ID NO: 5	Gram-positive 396/398 probe GCGACGCCGCGT
SEQ ID NO: 6	Gram-negative 396/398 probe GCCAAGTAGCGT
SEQ ID NO: 7	Gram-negative 396/398 probe GCCATGCCGCGT
SEQ ID NO: 8	Gram-negative and Gram-positive 396/398 fwd primer
	ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 9	Gram-negative 396/398 rev primer GCCAGCAGCYGCGGTAATACG
SEQ ID NO: 10	Gram-positive 396/398 rev primer GCCAGCAGCCGCGGTAATACG
SEQ ID NO: 11	Gram-negative 278/286 probe GCGATGATCAGTAG
SEQ ID NO: 12	Gram-negative 278/286 probe GCTATGACGCTTAA
SEQ ID NO: 13	Gram-negative 278/286 probe GCTTTGACGCATAA
SEQ ID NO: 14	Gram-negative 278/286 probe GCTATGACGGGTAT
SEQ ID NO: 15	Gram-negative 278/286 probe GCAATGATCAGTAG
SEQ ID NO: 16	Gram-negative 278/286 probe GTTTTGACGTCTAG
SEQ ID NO: 17	Gram-positive 278/286 probe GCAACGATGCATAG
SEQ ID NO: 18	Gram-positive 278/286 probe GCAACGATGCGTAG
SEQ ID NO: 19	Gram-positive 278/286 probe GCCACGATACATAG
SEQ ID NO: 20	Gram-negative 278/286 fwd primer TGWAGGAGGGGATTGCGTC
SEQ ID NO: 21	Gram-negative 278/286 fwd primer TGTAGGATGAGACTATATW
SEQ ID NO: 22	Gram-negative 278/286 fwd primer TAARRGATCAGCCTATGTC
SEQ ID NO: 23	Gram-positive 278/286 fwd primer TTATAGATGGATCCGCGCY
SEQ ID NO: 24	Gram-positive 278/286 fwd primer TGATGGATGGACCCGCGGT
SEQ ID NO: 25	Gram-negative 278/286 rev primer ATGAACGGCCACATTGG
SEQ ID NO: 26	Gram-negative 278/286 rev primer ATGATCAGTCACACTGG
SEQ ID NO: 27	Gram-negative 278/286 rev primer GTGAWCGGACACACTGG
SEQ ID NO: 28	Gram-positive 278/286 rev primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 29	Gram-negative 648 probe CTGCTGATCTAGAG
SEQ ID NO: 30	Gram-positive 648 probe CTGGAAAACTTGAG
SEQ ID NO: 31	Gram-positive 648 probe CTGGGAGACTTGAG
SEQ ID NO: 32	Gram-negative 648 fwd primer TAACCCCGTGAKGGGATGGA
SEQ ID NO: 33	Gram-positive 648 fwd primer CAACCGKGGAGGGTCATTGGA
SEQ ID NO: 34	Gram-negative 648 rev primer TCGGAGAGGAAAGTGGAATTCC
SEQ ID NO: 35	Gram-positive 648 rev primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 36	Fungi 164/165 probe CTCTTGGTTCCGGCATCGA
SEQ ID NO: 37	Fungi 164/165 probe CTCTTGGTTCTCGCATCGA
SEQ ID NO: 38	Fungi 164/165 fwd primer TATGCAGTCTGAGTTGATTATCGTAATC
SEQ ID NO: 39	Fungi 164/165 fwd primer CAGAGGTCTAAACTTACAACCAATTTTTT
SEQ ID NO: 40	Fungi 164/165 rev primer GCATTTCGCTGCGTTCTTC
SEQ ID NO: 41	Forward primer TGTAGGATGAGACTATATW
SEQ ID NO: 42	Probe GCTATGACGCTTAA
SEQ ID NO: 43	Reverse primer ATGATCAGTCACACTGG
SEQ ID NO: 44	Forward primer TGTAGGATGAGACTATATW
SEQ ID NO: 45	Probe GCTTTGACGCATAA
SEQ ID NO: 46	Reverse primer ATGATCAGTCACACTGG
SEQ ID NO: 47	Forward primer TAARRGATCAGCCTATGTC
SEQ ID NO: 48	Probe GCTATGACGGGTAT
SEQ ID NO: 49	Reverse primer GTGAWCGGACACACTGG
SEQ ID NO: 50	Forward primer CATCAGATGTGCCCAGATG
SEQ ID NO: 51	Probe GCGACGATCCCTAG
SEQ ID NO: 52	Reverse primer ATGACCAGCCACACTGG
SEQ ID NO: 53	Forward primer TATCGGATGAACCCATATG
SEQ ID NO: 54	Probe GCGACGATCTCTAG
SEQ ID NO: 55	Reverse primer ATGACCAGCCACACTGG
SEQ ID NO: 56	Forward primer TATTCGAGCGGCCGATATC
SEQ ID NO: 57	Probe CCTGCGATCTCTAG
SEQ ID NO: 58	Reverse primer ATGACCAGCCACACTGG
SEQ ID NO: 59	Forward primer TATCAGATGAGCCTAGGTC
SEQ ID NO: 60	Probe GCGACGATCCGTAA
SEQ ID NO: 61	Reverse primer ATGATCAGTCACACTGG
SEQ ID NO: 62	Forward primer TATTCGAGCGGCCGATATC
SEQ ID NO: 63	Probe GCGACGATCAGTAG
SEQ ID NO: 64	Reverse primer ATGACCAGCCACACTGG
SEQ ID NO: 65	Forward primer TGWAGGAGGGGATTGCGTC
SEQ ID NO: 66	Probe GCGATGATCAGTAG
SEQ ID NO: 67	Reverse primer ATGAACGGCCACATTGG
SEQ ID NO: 68	Forward primer TGWAGGAGGGGATTGCGTC
SEQ ID NO: 69	Probe GCAATGATCAGTAG
SEQ ID NO: 70	Reverse primer ATGAACGGCCACATTGG
SEQ ID NO: 71	Forward primer TTAAGGGAGAGTCTATGGG
SEQ ID NO: 72	Probe GTTTTGACGTCTAG
SEQ ID NO: 73	Reverse primer TTGACCGCCAACACTGG
SEQ ID NO: 74	Forward primer TAAAGGATGGGGATGCGTT
SEQ ID NO: 75	Probe CCTTCGATGGATAG
SEQ ID NO: 76	Reverse primer AAGGTCCCCCACATTGG
SEQ ID NO: 77	Forward primer ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 78	Probe GCAACGCCGCGT
SEQ ID NO: 79	Reverse primer GCCAGCAGCYGCGGTAATACG
SEQ ID NO: 80	Forward primer ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 81	Probe GCCAAGTAGCGT
SEQ ID NO: 82	Reverse primer GCCAGCAGCYGCGGTAATACG
SEQ ID NO: 83	Forward primer ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 84	Probe GCCATGCCGCGT
SEQ ID NO: 85	Reverse primer GCCAGCAGCYGCGGTAATACG
SEQ ID NO: 86	Forward primer TAACCATTAAACTGCTTGAGA
SEQ ID NO: 87	Probe CTGATAATCTAGAG
SEQ ID NO: 88	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 89	Forward primer TAACCGTTGAACTGCTTGGGA
SEQ ID NO: 90	Probe CTGGTAATCTAGAG
SEQ ID NO: 91	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 92	Forward primer TAACTACAGAACTGCATTTGA
SEQ ID NO: 93	Probe CTGACTATCTAGAG
SEQ ID NO: 94	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 95	Forward primer TAACCATAGAACTGCATTTGA
SEQ ID NO: 96	Probe CTACTATTCTAGAG
SEQ ID NO: 97	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 98	Forward primer TAACTACAGAACTGCATTTGA
SEQ ID NO: 99	Probe CTGACTATCTAGAG
SEQ ID NO: 100	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 101	Forward primer TAACTACAGAACTGCATTTGA
SEQ ID NO: 102	Probe CTACTATTCTAGAG
SEQ ID NO: 103	Reverse primer DGGGAGAGGYAGRTGGAATTSG
SEQ ID NO: 104	Forward primer CAACCTGGGAACTGCATTTGA
SEQ ID NO: 105	Probe CTGGCAGGCTGGAG
SEQ ID NO: 106	Reverse primer TYGTAGAGGGGGGTAGAATTCC
SEQ ID NO: 107	Forward primer CAACCTGGGAACTGCATTCGA
SEQ ID NO: 108	Probe CTGGCAGGCTTGAG
SEQ ID NO: 109	Reverse primer TYGTAGAGGGGGGTAGAATTCC
SEQ ID NO: 110	Forward primer CAACCTGGGAACTGCATTTGA
SEQ ID NO: 111	Probe CTGGCAAGCTAGAG
SEQ ID NO: 112	Reverse primer TYGTAGAGGGGGGTAGAATTCC
SEQ ID NO: 113	Forward primer CAACCTGGGAACTGCATCTGA
SEQ ID NO: 114	Probe CTGGCAAGCTTGAG
SEQ ID NO: 115	Reverse primer TYGTAGAGGGGGGTAGAATTCC
SEQ ID NO: 116	Forward primer CAACCTGGGAACTGCATCCAA
SEQ ID NO: 117	Probe CTACTGAGCTAGAG
SEQ ID NO: 118	Reverse primer CGGTAGAGGGTGGTGGAATTTC
SEQ ID NO: 119	Forward primer TAACTTGGGAATTGCATCTGA
SEQ ID NO: 120	Probe CTGGTTGGCTAGAG
SEQ ID NO: 121	Reverse primer TYGTAGAGGGGGGTAGAATTCC
SEQ ID NO: 122	Forward primer TAACCTAGGAATTGCATTTCA
SEQ ID NO: 123	Probe CTGGGTAACTAGAG
SEQ ID NO: 124	Reverse primer CTTTAGGGAGGGGTAGAATTCC
SEQ ID NO: 125	Forward primer CAACCCGGGAACTGCGTTCTG
SEQ ID NO: 126	Probe CTGGGTGACTCGAG
SEQ ID NO: 127	Reverse primer TGTCAGAGGGAGGTAGAATTCC
SEQ ID NO: 128	Forward primer TAACCCCGTGAKGGGATGGA
SEQ ID NO: 129	Probe CTGCTGATCTAGAG
SEQ ID NO: 130	Reverse primer TCGGAGAGGAAAGTGGAATTCC
SEQ ID NO: 131	Forward primer TAACCCCGTGAKGGGATGGA
SEQ ID NO: 132	Probe CTGCCAATCTAGAG
SEQ ID NO: 133	Reverse primer TCGGAGAGGAAAGTGGAATTCC
SEQ ID NO: 134	Forward primer CAACCCCAAGCCAGCATCTAA
SEQ ID NO: 135	Probe CTATCTTTCTAGAG
SEQ ID NO: 136	Reverse primer TAGATGGAGAAAAGGGAATTCC
SEQ ID NO: 137	Forward primer CAACCGTAAAATTGCAGTTGA
SEQ ID NO: 138	Probe CTGTCAGTCTTGAG
SEQ ID NO: 139	Reverse primer CAGTAGAGGTGGGCGGAATTCG
SEQ ID NO: 140	Forward primer TTATAGATGGATCCGCGCY
SEQ ID NO: 141	Probe GCAACGATGCATAG
SEQ ID NO: 142	Reverse primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 143	Forward primer TTATAGATGGATCCGCGCY
SEQ ID NO: 144	Probe GCAACGATGCGTAG
SEQ ID NO: 145	Reverse primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 146	Forward primer TRTGAGATGGACCTGCGTT
SEQ ID NO: 147	Probe GCGACGATACATAG
SEQ ID NO: 148	Reverse primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 149	Forward primer TACCAGATGGACCTGCGTT
SEQ ID NO: 150	Probe GCGACGATACATAG
SEQ ID NO: 151	Reverse primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 152	Forward primer TGATGGATGGACCCGCGGT
SEQ ID NO: 153	Probe GCCACGATGCATAG
SEQ ID NO: 154	Reverse primer GTGATCGGCCACACTGGRACT
SEQ ID NO: 155	Forward primer TGMAGGATGRGCCCGCGGC
SEQ ID NO: 156	Probe GCGACGACGGGTAG
SEQ ID NO: 157	Reverse primer GCGACCGGCCACACTGGGACT
SEQ ID NO: 158	Forward primer TGTGGGATGAGCCCGCGGC
SEQ ID NO: 159	Probe GCGACGACGGGTAG
SEQ ID NO: 160	Reverse primer GTGTCCGGCCACACTGGGACT
SEQ ID NO: 161	Forward primer TATGAGATGGACCCGCGGC
SEQ ID NO: 162	Probe GCGACGATGCTGTAG
SEQ ID NO: 163	Reverse primer GTGATCGGCCACATTGGGACT
SEQ ID NO: 164	Forward primer ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 165	Probe GCAACGCCGCGT
SEQ ID NO: 166	Reverse primer GCCAGCAGCCGCGGTAATACG
SEQ ID NO: 167	Forward primer ACTCCTACGGGAGGCAGCAGT
SEQ ID NO: 168	Probe GCGACGCCGCGT
SEQ ID NO: 169	Reverse primer GCCAGCAGCCGCGGTAATACG
SEQ ID NO: 170	Forward primer CAACCGKGGAGGGTCATTGGA
SEQ ID NO: 171	Probe CTGGAAAACTTGAG
SEQ ID NO: 172	Reverse primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 173	Forward primer CAACCGKGGAGGGTCATTGGA
SEQ ID NO: 174	Probe CTGGGAGACTTGAG
SEQ ID NO: 175	Reverse primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 176	Forward primer TAACCATTGTACGCTTTGGA
SEQ ID NO: 177	Probe CTGGAGGACTTGAG
SEQ ID NO: 178	Reverse primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 179	Forward primer CAACCAATGTACGCTTTGGA
SEQ ID NO: 180	Probe CTGGAGAACTTGAG
SEQ ID NO: 181	Reverse primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 182	Forward primer TAACCATAGTAGGCTTTGGA
SEQ ID NO: 183	Probe CTGTTTAACTTGAG
SEQ ID NO: 184	Reverse primer CARRAGRGGARAGTGGAATTCC
SEQ ID NO: 185	Forward primer TAACCCCGGGTCTGCATTCGA
SEQ ID NO: 186	Probe CGGGCTAGCTAGAG
SEQ ID NO: 187	Reverse primer YGGTAGGGGAGATCGGAATTCC
SEQ ID NO: 188	Forward primer TAACTGTGAGCGTGCGGGCGA
SEQ ID NO: 189	Probe CGGGCAGACTAGAG
SEQ ID NO: 190	Reverse primer CTGCAGGGGAGACTGGAATTCC
SEQ ID NO: 191	Forward primer CAACTTGGGTGCTGCATTCCA
SEQ ID NO: 192	Probe CTGGTTATCTAGAG
SEQ ID NO: 193	Reverse primer CAGGAGAGGAGAGTGGAATTCC
SEQ ID NO: 194	Forward primer TATGCAGTCTGAGTTGATTATCGTAATC
SEQ ID NO: 195	Probe CTCTTGGTTCCGGCATCGA
SEQ ID NO: 196	Reverse primer GCATTTCGCTGCGTTCTTC
SEQ ID NO: 197	Forward primer CAGAGGTCTAAACTTACAACCAATTTTTT
SEQ ID NO: 198	Probe CTCTTGGTTCTCGCATCGA
SEQ ID NO: 199	Reverse primer GCATTTCGCTGCGTTCTTC
SEQ ID NO: 200	Forward primer GGCAAACGCAAAATAAATCAAAA
SEQ ID NO: 201	Probe CTCTTGGCTCTGGCATCGA
SEQ ID NO: 202	Reverse primer GCATTTCGCTGCGTTCTTC
SEQ ID NO: 203	Forward primer AATTAAAACTTTCAACAAC
SEQ ID NO: 204	Probe CTCTTGGCTCTGGCATCGA
SEQ ID NO: 205	Reverse primer ACTTATCGCATTTCG
SEQ ID NO: 206	Forward primer GAAAACAAAAAAAACAAGTTAAAAC
SEQ ID NO: 207	Probe CTCTTGGTTCTGGCATCGA
SEQ ID NO: 208	Reverse primer CACATTACTTATCGCATTTCG
SEQ ID NO: 209	Forward primer TCCAGTCAAAACTTTCAACAAC
SEQ ID NO: 210	Probe CTCTTGGTTCCGACATCGA
SEQ ID NO: 211	Reverse primer GCATTTCGCTGCGTTCT
SEQ ID NO: 212	Forward primer CAATAATAAAACTTTCAACAAC
SEQ ID NO: 213	Probe CTCTTGGCTTCCACATCGA
SEQ ID NO: 214	Reverse primer CGCTGCGTTCTTCA
SEQ ID NO: 215	Forward primer GGTTCCGGCATCGA
SEQ ID NO: 216	Probe CGATAAGTAATGTG
SEQ ID NO: 217	Reverse primer GATTCACTGAATTCTGCAAT
SEQ ID NO: 218	Forward primer TGGTTCTCGCATCGA
SEQ ID NO: 219	Probe CGATACGTAATATG
SEQ ID NO: 220	Reverse primer CACGAATATCTGCACAATT
SEQ ID NO: 221	Forward primer GGCTCTGGCATCGA
SEQ ID NO: 222	Probe CGATAAGTAATGTG
SEQ ID NO: 223	Reverse primer TTCACTGAATTCTGCAAT
SEQ ID NO: 224	Forward primer AACGCAGCGAAAT
SEQ ID NO: 225	Probe CGATAAGTAATGTG
SEQ ID NO: 226	Reverse primer ATGATTCACTGAATTCTG
SEQ ID NO: 227	Forward primer TGGTTCTGGCATCGA
SEQ ID NO: 228	Probe CGATAAGTAATGTG
SEQ ID NO: 229	Reverse primer ATTCACTGAATTCTGCAAT
SEQ ID NO: 230	Forward primer TGGTTCCGACATCGA
SEQ ID NO: 231	Probe CGATAAGTAATGTG
SEQ ID NO: 232	Reverse primer CACGGAATTCTGCAAT
SEQ ID NO: 233	Forward primer AAGAACGCAGCGAAAT
SEQ ID NO: 234	Probe CGATAAGTAATGTG
SEQ ID NO: 235	Reverse primer ATTCACTGAATTCTGCAAT
SEQ ID NO: 236	Forward primer AAGTAATGTGAATTGCAGAA
SEQ ID NO: 237	Probe GTGAATCATCGAG
SEQ ID NO: 238	Reverse primer CCCCCGGAATACCA
SEQ ID NO: 239	Forward primer CGTAATATGAATTGCAGATATTC
SEQ ID NO: 240	Probe GTGAATCATCGAA
SEQ ID NO: 241	Reverse primer GAGGGCGCAATGTG
SEQ ID NO: 242	Forward primer GCGAAATGCGATAAGTAA
SEQ ID NO: 243	Probe GTGAATTGCAGAA
SEQ ID NO: 244	Reverse primer GATTCGATGATTCACTGAA
SEQ ID NO: 245	Forward primer AATGTGAATTGCAGAA
SEQ ID NO: 246	Probe GTGAATCATCGAA
SEQ ID NO: 247	Reverse primer GGGCGCAATGTG
SEQ ID NO: 248	Forward primer AAGTAATGTGAATTGCAGAA
SEQ ID NO: 249	Probe GTGAATCATCGAA
SEQ ID NO: 250	Reverse primer CGGGCGCAATGT
SEQ ID NO: 251	Forward primer AAGTAATGTGAATTGCAGAA
SEQ ID NO: 252	Probe GTGAATCATCGAA
SEQ ID NO: 253	Reverse primer GAGGGCGCAATGTG
SEQ ID NO: 254	Forward primer AAGTAATGTGAATTGCAGAA
SEQ ID NO: 255	Probe GTGAATCATCGAG
SEQ ID NO: 256	Reverse primer CAAGTTGCGTTCAAAGA
SEQ ID NO: 257	Forward primer TCAGTGAATCATCGAGTCTTTGAAC
SEQ ID NO: 258	Probe CCCCCTGGTATTCC
SEQ ID NO: 259	Reverse primer TGCTTGAGGGCAGCAATG
SEQ ID NO: 260	Forward primer TCGTGAATCATCGAATCTTTGAA
SEQ ID NO: 261	Probe CCCTCTGGTATTCC
SEQ ID NO: 262	Reverse primer GGAGAAACGACGCTCAAACAG
SEQ ID NO: 263	Forward primer TTCAGTGAATCATCGAATCTTTGAA
SEQ ID NO: 264	Probe CCCGCCAGGCTCT
SEQ ID NO: 265	Reverse primer GCATTTCGCTGCGTTCTTC
SEQ ID NO: 266	Forward primer TCAGTGAATCATCGAATCTTTGAAC
SEQ ID NO: 267	Probe CCCGCCAGTATTCT
SEQ ID NO: 268	Reverse primer GGTTGTAATGACGCTCGAACAG
SEQ ID NO: 269	Forward primer GCAGAATTCAGTGAATCATCGAAT
SEQ ID NO: 270	Probe CCCGGCAGTAATCT
SEQ ID NO: 271	Reverse primer GAGGTTCGAGGGTTGAAATGAC
SEQ ID NO: 272	Forward primer CCGTGAATCATCGAATCTTTGA
SEQ ID NO: 273	Probe CCCTCTGGTATTCC
SEQ ID NO: 274	Reverse primer GCGCTTGAGGGTTGCAAT
SEQ ID NO: 275	Forward primer TCGAGTCTTTGAACGCAACTTG
SEQ ID NO: 276	Probe CCCTTTGGTATTCC
SEQ ID NO: 277	Reverse primer CGAGGGATTGAGATTTTCATGAC
SEQ ID NO: 278	Gram-negative and Gram-positive reverse primer
	GTATTACCGCGGCTGCTGGCAC
SEQ ID NO: 279	Chlamydia and Chlamydophila forward primer
	ACTCCTACGGGAGGCTGCAGT
SEQ ID NO: 280	Chlamydia and Chlamydophila reverse primer
	GTATTACCGCGGCAGCTGGCAC
SEQ ID NO: 281	Gram-positive probe Group 1 AGCAACGCCGCGT
SEQ ID NO: 282	Gram-positive probe Group 2 AGCGACGCCGCGT
SEQ ID NO: 283	Gram-negative probe Group 3 AGCCATGCCGCGT
SEQ ID NO: 284	Gram-negative probe Group 4 AGCAATGCCGCGT
SEQ ID NO: 285	Gram-negative probe Group 5 AGCCATACCGCGT
SEQ ID NO: 286	Gram-negative probe Group 6 AGCCAAGTAGCGT
SEQ ID NO: 287	Gram-negative probe Group 7 AGCCAAGTCGCGT
SEQ ID NO: 288	Gram-positive probe Group 1a AACCAGAAAGCC
SEQ ID NO: 289	Gram-positive probe Group 1b AACCAGAAAGGG
SEQ ID NO: 290	Gram-positive probe Group 1c AACCAGAAAGTC
SEQ ID NO: 291	Gram-negative probe Group 1d AACGAATAAGCA
SEQ ID NO: 292	Gram-positive probe Group 1e AAGGAGGAAGCC
SEQ ID NO: 293	Gram-positive probe Group 1f AATCAGAAAGCC
SEQ ID NO: 294	Gram-positive probe Group 1g GAAGAATAAGCT
SEQ ID NO: 295	Gram-negative probe Group 1h GAATAGAAAGCC
SEQ ID NO: 296	Gram-positive probe Group 1i GAGGAGGAAGCC
SEQ ID NO: 297	Gram-positive probe Group 1j TACCAGAAAGCC
SEQ ID NO: 298	Gram-positive probe Group 1k TACCAGAAAGGG
SEQ ID NO: 299	Gram-positive probe Group 1l TGTGAGGAAGCC
SEQ ID NO: 300	Gram-positive probe Group 2a AGATAAGAAGCA
SEQ ID NO: 301	Gram-positive probe Group 2b GCAGAAGAAGCA
SEQ ID NO: 302	Gram-positive probe Group 2c GCAGAAGAAGCG
SEQ ID NO: 303	Gram-negative probe Group 2d GCCTAAAGCACC
SEQ ID NO: 304	Gram-positive probe Group 2e GGAGAAGAAGCA
SEQ ID NO: 305	Gram-positive probe Group 2f GGATAAGAAGCA
SEQ ID NO: 306	Gram-positive probe Group 2g GGGGAAGAAGCG
SEQ ID NO: 307	Gram-negative probe Group 2h GGTAAAGAAGCA
SEQ ID NO: 308	Gram-positive probe Group 2i GTAGAAGAAGCA
SEQ ID NO: 309	Gram-positive probe Group 2j GTTGAAGAAGCA
SEQ ID NO: 310	Gram-negative probe Group 3a ACAGAAGAAGCA
SEQ ID NO: 311	Gram-negative probe Group 3b ACAGAATAAGCA
SEQ ID NO: 312	Gram-negative probe Group 3c GAAGAATAAGCA
SEQ ID NO: 313	Gram-negative probe Group 3d GCAGAAGAAGCA
SEQ ID NO: 314	Gram-negative probe Group 3e GCAGAATAAGCA
SEQ ID NO: 315	Gram-negative probe Group 3f GGAGAAGAAGCC
SEQ ID NO: 316	Gram-negative probe Group 3g TAAGAATAAGGA
SEQ ID NO: 317	Gram-negative probe Group 4a ACAGAAGAACCA
SEQ ID NO: 318	Gram-negative probe Group 4b GAAGAATAAGCA
SEQ ID NO: 319	Gram-negative probe Group 4c GCAGAAGAAGCA
SEQ ID NO: 320	Gram-negative probe Group 6a CATGAATAAGGA
SEQ ID NO: 321	Gram-negative probe Group 6b TACGAATAAGGA
SEQ ID NO: 322	Gram-negative probe Group 6c TATGAATAAGGA
SEQ ID NO: 323	Gram-negative probe Group 6d TTAGAATAAGGA
SEQ ID NO: 324	Probe TTCCGGCATCGA
SEQ ID NO: 325	Probe TTCTCGCATCGA
SEQ ID NO: 326	Forward primer CAAAACTTTCAACAACGGATCTC
SEQ ID NO: 327	Forward primer TAAAACTTTCAACAACGGATCTC
SEQ ID NO: 328	Reverse primer GACGCTCGGACAGGCATG
SEQ ID NO: 329	Reverse primer GACGCTCAAACAGGCATG
SEQ ID NO: 330	Forward primer AACTTTCAACAACGGATCTCTTGG
SEQ ID NO: 331	Forward primer AACTTTTAACAACGGATCTCTTGG
SEQ ID NO: 332	Reverse primer GCGTTCAAAGATTCGATGATTCAC
SEQ ID NO: 333	Reverse primer GCGTTCAAAGACTCGATGATTCAC
SEQ ID NO: 334	Probe AAATGCGATACGTAA
SEQ ID NO: 335	Probe ATGCGATAAGTAA

TABLE B
NUCLEOTIDE SYMBOLS
Symbol	Description
A	Adenosine
C	Cytidine
G	Guanosine
T	Thymidine
U	Uridine
M	Amino (adenosine, cytosine)
K	Keto (guanosine, thymidine)
R	Purine (adenosine, guanosine)
Y	Pyrimidine (cytosine, thymidine)
N	Any nucleotide

[0068] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

[0069] The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0070] “Amplification product” refers to a nucleic acid product generated by nucleic acid amplification techniques.

[0071] The term “biological sample” as used herein refers to a sample that may be extracted, untreated, treated, diluted or concentrated from a patient. Suitably, the biological sample is selected from any part of a patient's body, including, but lot limited to hair, skin, nails, tissues or bodily fluids such as saliva and blood.

[0072] Throughout this specification, unless the context requires otherwise, the words “comprise,” “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0073] As used herein, “corresponding” nucleic acid positions or nucleotides refer to positions or nucleotides that occur at aligned loci of two or more nucleic acid molecules. Related or variant polynucleotides can be aligned by any method known to those of skill in the art. Such methods typically maximize matches, and include methods such as using manual alignments and by using the numerous alignment programs available (for example, BLASTN) and others known to those of skill in the art. By aligning the sequences of polynucleotides, one skilled in the art can identify corresponding nucleotides or positions using identical nucleotides as guides. For example, by aligning the sequences of the gene encoding the E. coli 16S rRNA (set forth in SEQ ID NO:1) with a gene encoding a 16S rRNA from another species, one of skill in the art can identify corresponding positions and nucleotides using conserved nucleotides as guides.

[0074] By “gene” is meant a unit of inheritance that occupies a specific locus on a genome and consists of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e., introns, 5′ and 3′ untranslated sequences).

[0075] “Homology” refers to the percentage number of nucleic or amino acids that are identical or constitute conservative substitutions. Homology may be determined using sequence comparison programs such as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395) which is incorporated herein by reference. In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0076] “Hybridization” is used herein to denote the pairing of complementary nucleotide sequences to produce a DNA-DNA hybrid or a DNA-RNA hybrid. Complementary base sequences are those sequences that are related by the base-pairing rules. In DNA, A pairs with T and C pairs with G. In RNA U pairs with A and C pairs with G. In this regard, the terms “match” and “mismatch” as used herein refer to the hybridization potential of paired nucleotides in complementary nucleic acid strands. Matched nucleotides hybridise efficiently, such as the classical A-T and G-C base pair mentioned above. Mismatches are other combinations of nucleotides that do not hybridise efficiently.

[0077] By “isolated” is meant material that is substantially or essentially free from components that normally accompany it in its native state.

[0078] The term “oligonucleotide” as used herein refers to a polymer composed of a multiplicity of nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogues thereof) linked via phosphodiester bonds (or related structural variants or synthetic analogues thereof). Thus, while the term “oligonucleotide” typically refers to a nucleotide polymer in which the nucleotide residues and linkages between them are naturally occurring, it will be understood that the term also includes within its scope various analogues including, but not restricted to, peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methyl phosphonates, 2-O-methyl ribonucleic acids, and the like. The exact size of the molecule can vary depending on the particular application. An oligonucleotide is typically rather short in length, generally from about 10 to 30 nucleotide residues, but the term can refer to molecules of any length, although the term “polynucleotide” or “nucleic acid” is typically used for large oligonucleotides.

[0079] The terms “patient” and “subject” are used interchangeably and refer to patients and subjects of human or other mammal and includes any individual it is desired to examine or treat using the methods of the invention. However, it will be understood that “patient” does not imply that symptoms are present. Suitable mammals that fall within the scope of the invention include, but are not restricted to, primates, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), laboratory test animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs) and captive wild animals (e.g., foxes, deer, dingoes).

[0080] The term “polymorphism”, as used herein, refers to a difference in the nucleotide or amino acid sequence of a given region as compared to a nucleotide or amino acid sequence in a homologous-region of another individual, in particular, a difference in the nucleotide of amino acid sequence of a given region which differs between individuals of the same species. A polymorphism is generally defined in relation to a reference sequence. Polymorphisms include single nucleotide differences, differences in sequence of more than one nucleotide, and single or multiple nucleotide insertions, inversions and deletions; as well as single amino acid differences, differences in sequence of more than one amino acid, and single or multiple amino acid insertions, inversions, and deletions. A “polymorphic site” is the locus at which the variation occurs. It shall be understood that where a polymorphism is present in a nucleic acid sequence, and reference is made to the presence of a particular base or bases at a polymorphic site, the present invention encompasses the complementary base or bases on the complementary strand at that site.

[0081] The term “polynucleotide” or “nucleic acid” as used herein designates mRNA, RNA, rRNA, cRNA, cDNA or DNA. The term typically refers to oligonucleotides greater than 30 nucleotide residues in length.

[0082] By “primer” is meant an oligonucleotide which, when paired with a strand of DNA, is capable of initiating the synthesis of a primer extension product in the presence of a suitable polymerizing agent. The primer is preferably single-stranded for maximum efficiency in amplification but can alternatively be double-stranded. A primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerization agent. The length of the primer depends on many factors, including application, temperature to be employed, template reaction conditions, other reagents, and source of primers. For example, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15 to 35 or more nucleotide residues, although it can contain fewer nucleotide residues. Primers can be large polynucleotides, such as from about 200 nucleotide residues to several kilobases or more. Primers can be selected to be “substantially complementary” to the sequence on the template to which it is designed to hybridize and serve as a site for the initiation of synthesis. By “substantially complementary”, it is meant that the primer is sufficiently complementary to hybridize with a target polynucleotide. In some embodiments, the primer contains no mismatches with the template to which it is designed to hybridize but this is not essential. For example, non-complementary nucleotide residues can be attached to the 5′ end of the primer, with the remainder of the primer sequence being complementary to the template. Alternatively, non-complementary nucleotide residues or a stretch of non-complementary nucleotide residues can be interspersed into a primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize therewith and thereby form a template for synthesis of the extension product of the primer.

[0083] “Probe” refers to a molecule that binds to a specific sequence or sub-sequence or other moiety of another molecule. Unless otherwise indicated, the term “probe” typically refers to a polynucleotide probe that binds to another polynucleotide, often called the “target polynucleotide”, through complementary base pairing. Probes can bind target polynucleotides lacking complete sequence complementarity with the probe, depending on the stringency of the hybridization conditions. Probes can be labeled directly or indirectly.

[0084] The term “sepsis” is used herein in accordance with its normal meaning in clinical medicine, and includes, for example systemic and/or blood-borne infections, such as bacterial or fungal infections.

[0085] The term “sepsis-associated bacteria” refers to bacteria that have been identified as being able to cause sepsis in a subject, or have been identified in the blood of a subject with sepsis. “Mammalian (e.g., human) sepsis-associated bacteria” therefore refers to bacteria that have been identified as being able to cause sepsis in a mammalian (e.g., human) subject, or have been identified in the blood of a mammalian (e.g., human) subject with sepsis. Examples of mammalian (e.g., human) sepsis-associated bacteria include Acinetobacter baumannii, Actinobacillus hominis, Actinomyces massiliensis, Aeromonas hydrophila, Bacillus anthracis, Bacteroides fragilis, Brucella abortus, Burkholderia cepacia, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Campylobacter lari, Cardiobacterium valvarum, Chlamydia trachomatis, Chlamydophila abortus, Chlamydophila pneumoniae, Citrobacter freundii, Clostridium difficile, Clostridium perfringens, Corynebacterium diphtheriae, Corynebacterium jeikeium, Corynebacterium urealyticum, Dermatophilus congolensis, Edwardsiella tarda, Enterobacter aerogenes, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix rhusiopathiae, Escherichia coli, Eubacterium desmolans, Flavobacterium ceti, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Helicobacter cinaedi, Helicobacter pylori, Klebsiella oxytoca, Klebsiella pneumonia, Lactobacillus intestinalis, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Micrococcus luteus, Mobiluncus curtisii, Moraxella catarrhalis, Morganella morganii, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroids, Nocardia brasiliensis, Pasteurella multocida, Peptostreptococcus stomatis, Porphyromonas gingivalis, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Proteus mirabilis, Providencia alcalifaciens, Pseudomonas aeruginosa, Rhodococcus equi, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Stenotrophomonas maltophila, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus bovis, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus sanguinis, Streptococcus sobrinus, Streptomyces anulatus, Streptomyces somaliensis, Veillonella atypica, Veillonella denticariosi, Veillonella dispar, Veillonella parvula, Veillonella rogosae, Vibrio cholerae, Yersinia enterocolitica and Yersinia pestis.

[0086] The term “sepsis-associated fungi” refers to fungi (including yeast) that have been identified as being able to cause sepsis in a subject, or have been identified in the blood of a subject with sepsis. “Mammalian (e.g., human) sepsis-associated fungi” therefore refers to fungi that have been identified as being able to cause sepsis in a mammalian (e.g., human) subject, or have been identified in the blood of a mammalian (e.g., human) subject with sepsis. Examples of mammalian (e.g., human) sepsis associated fungi include Candida albicans, Ajellomyces capsulatus, Stachybotrys species, Scedosporium apiospermum, Fusarium species, Aspergillus fumigatus, and Cryptococcus neoformans.

[0087] As used herein, “sepsis” is defined as SIRS with a presumed or confirmed infectious process. Confirmation of infectious process can be determined using microbiological culture or isolation of the infectious agent. From an immunological perspective, sepsis may be seen as a systemic response to microorganisms or systemic infection.

[0088] The term “sequence identity” as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

[0089] As used herein, the term single nucleotide polymorphism (SNP) refers to nucleotide sequence variations that occur when a single nucleotide (A, T, C or G) in the genome sequence is altered (such as via substitutions, addition or deletion). SNPs can occur in both coding (gene) and noncoding regions of the genome such as the genome of a prokaryotic or eukaryotic microorganism.

[0090] “Systemic Inflammatory Response Syndrome (SIRS),” as used herein, refers to a clinical response arising from a non-specific insult with two or more of the following measureable clinical characteristics; a body temperature greater than 38° C. or less than 36° C., a heart rate greater than 90 beats per minute, a respiratory rate greater than 20 per minute, a white blood cell count (total leukocytes) greater than 12,000 per mm³ or less than 4,000 per mm³, or a band neutrophil percentage greater than 10%. From an immunological perspective, it may be seen as representing a systemic response to insult (e.g., major surgery) or systemic inflammation. As used herein, therefore, “infection-negative SIRS (inSIRS)” includes the clinical response noted above but in the absence of an identifiable infectious process.

[0091] As used herein, the terms “treatment,” “treating,” and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing an infection, condition or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for an infection, condition and/or adverse affect attributable to the infection or condition. “Treatment,” as used herein, covers any treatment of an infection or condition in a mammal (e.g., a human), and includes: (a) preventing the infection or condition from occurring in a subject which may be predisposed to the infection or condition but has not yet been diagnosed as having it; (b) inhibiting the infection or condition, i.e., arresting its development; and (c) relieving the infection or condition, i.e., causing regression of the infection or condition.

[0092] The present invention is based in part on the determination that SNPs within the 16S rRNA gene (and thus within the 16S rRNA molecule) of bacteria can be used to classify the bacteria as Gram-positive or Gram-negative. Particular combinations of SNPs can be used to classify bacteria further, and in particular further classify or identify mammalian (e.g., human) sepsis-associated bacterial pathogens. The present invention is also based in part on the determination that a single SNP within the 5.8S rRNA gene (and thus within the 5.8S rRNA molecule) of eukaryotes can be used to differentiate fungal cells (including yeast cells) from mammalian cells. It has further been determined that a combination of SNPs within the 5.8S rRNA of eukaryotes can be used to differentiate and identify the most common mammalian (e.g., human) fungal pathogens.

[0093] 2.1 Classification of Bacteria Using SNPs in 16S rRNA

[0094] The present invention provides methods for determining the Gram status of bacteria in a sample, i.e. determining whether the bacteria are Gram-positive or Gram-negative. As demonstrated herein, polymorphisms at nucleotide positions of the gene encoding 16S rRNA (and thus of the 16S rRNA molecule itself) that correspond to positions 396 and 398 of the E. coli 16S rRNA gene set forth in SEQ ID NO:1 can be used to determine the Gram status of the vast majority of bacteria, including most mammalian (e.g., human) pathogens (including common bacteria found contaminating red blood cell and platelet preparations, the most common bacteria found in mammalian (e.g., human) faecal samples and many pathogens causing sepsis), the most common soil bacteria, and common bacteria found in work environments. Positions corresponding to positions 396 and 398 of SEQ ID NO:1 in any prokaryotic 16S rRNA gene (or 16S rRNA molecule or DNA copy thereof) are readily identifiable by alignment with the Escherichia coli 16S rRNA gene set forth in SEQ ID NO:1. In some examples, a highly conserved sequence that corresponds to nucleotides 518-537 of SEQ ID NO:1 and that is common to nearly 7000 bacterial species across its entire length, can be used to assist alignment. The general rules for differentiating most Gram-positive and Gram-negative prokaryotes using these two SNPs are depicted in Table 1.

	TABLE 1
	Gram Status	SNP 396	SNP 398
	Negative	C	T/A/C
	Positive	A/T/G	C

[0095] Thus, the present invention provides methods for determining the Gram status of a bacterium in a sample, by analyzing nucleic acid from the sample for SNPs in the 16S rRNA gene (or 16S rRNA or DNA copy thereof) at positions corresponding to positions 396 and 398 of the 16S rRNA gene set forth in SEQ ID NO:1, wherein a C at position 396 and a T, A or C at position 398 indicates that the bacterium in the sample is a Gram-negative bacterium; and an A, T or G at position 396 and a C at position 398 indicates that the bacterium is a Gram-positive bacterium. Bacteria that can be classified as Gram-positive or Gram-negative using SNPs at positions corresponding to 396 and 398 of the E. coli 16S rRNA gene set forth in SEQ ID NO:1 include, for example, Acinetobacter spp.; Actinobaccillus spp.; Actinomadura spp.; Actinomyces spp.; Actinoplanes spp.; Aeromonas spp.; Agrobacterium spp.; Alistipes spp.; Anaerococcus spp.; Arthrobacter spp.; Bacillus spp.; Brucella spp.; Bulleidia spp.; Burkholderia spp.; Cardiobacterium spp.; Citrobacter spp.; Clostridium spp.; Corynebacterium spp.; Dermatophilus spp.; Dorea spp.; Edwardsiella spp.; Enterobacter spp.; Enterococcus spp.; Erysipelothrix spp.; Escherichia spp.; Eubacterium spp.; Faecalibacterium spp.; Filifactor spp.; Finegoldia spp.; Flavobacterium spp.; Gallicola spp.; Haemophilus spp.; Helcococcus spp.; Holdemania spp.; Hyphomicrobium spp.; Klebsiella spp.; Lactobacillus spp.; Legionella spp.; Listeria spp.; Methylobacterium spp.; Micrococcus spp.; Micromonospora spp.; Mobiluncus spp.; Moraxella spp.; Morganella spp.; Mycobacterium spp.; Neisseria spp.; Nocardia spp.; Paenibacillus spp.; Parabacteroides spp.; Pasteurella spp.; Peptoniphilus spp.; Peptostreptococcus spp.; Planococcus spp.; Planomicrobium spp.; Plesiomonas spp.; Porphyromonas spp.; Prevotella spp.; Propionibacterium spp.; Proteus spp.; Providentia spp.; Pseudomonas spp.; Ralstonia spp.; Rhodococcus spp.; Roseburia spp.; Ruminococcus spp.; Salmonella spp.; Sedimentibacter spp.; Serratia spp.; Shigella spp.; Solobacterium spp.; Sphingomonas spp.; Sporanaerobacter spp.; Staphylococcus spp.; Stenotrophomonas spp.; Streptococcus spp.; Streptomyces spp.; Tissierella spp.; Vibrio spp.; and Yersinia spp.

[0096] Particular examples of pathogens that can be classified as Gram-positive or Gram-negative using SNPs at positions 396 and 398 include, but are not limited to, those set forth in Table 2.

TABLE 2
Bacterial		16S rRNA Genbank
ID No.	Species	Acc. No.
1	Acinetobacter baumannii ATCC 17978 strain ATCC 17978	NR_074737.1
2	Acinetobacter calcoaceticus NCCB 22016 strain: NCCB 22016	NR_042387.1
3	Actinobacillus arthritidis strain ACCUG 24862	NR_044613.1
4	Actinobacillus capsulatus strain CCUG 12396	NR_042864.1
5	Actinobacillus delphinicola strain NCTC 12870	NR_042865.1
6	Actinobacillus equuli subsp. equuli strain ATCC 19392	NR_041837.1
7	Actinobacillus equuli subsp. haemolyticus strain F 154	NR_036871.1
8	Actinobacillus hominis strain NCTC 11529	NR_042866.1
9	Actinobacillus indolicus strain 46KC2	NR_042867.1
10	Actinobacillus lignieresii strain NCTC 4189	NR_042868.1
11	Actinobacillus minor NM305 strain NM305	NR_042869.1
12	Actinobacillus muris strain NCTC 12432	NR_042870.1
13	Actinobacillus pleuropneumoniae	NR_044752.1
14	Actinobacillus pleuropneumoniae serovar 5b str. L20 strain L20	NR_074857.1
15	Actinobacillus porcinus strain NM319	NR_026030.1
16	Actinobacillus rossii strain ATCC 27072	NR_042871.1
17	Actinobacillus scotiae strain M2000/95/1	NR_027207.1
18	Actinobacillus seminis strain CCUG 27187	NR_042872.1
19	Actinobacillus succinogenes 130Z strain 130Z	NR_074818.1
20	Actinobacillus succinogenes strain 130Z	NR_024860.1
21	Actinobacillus suis ATCC 33415 strain ATCC 33415	NR_042873.1
22	Actinobacillus suis H91-0380 strain H91-0380	NR_074909.1
23	Actinobacillus ureae ATCC 25976 strain CCUG 2139	NR_042874.1
24	Actinomyces bovis strain NCTC 11535	NR_044862.1
25	Actinomyces bowdenii strain M1956/95/1	NR_041982.1
26	Actinomyces canis strain CCUG 41706	NR_025366.1
27	Actinomyces cardiffensis strain CCUG 44997	NR_025521.1
28	Actinomyces catuli strain CCUG 41709	NR_025397.1
29	Actinomyces coleocanis strain M343/98/2	NR_028905.1
30	Actinomyces dentalis strain R18165	NR_025633.1
31	Actinomyces denticolens strain NCTC 11490	NR_026181.1
32	Actinomyces europaeus strain CCUG 32789A	NR_026363.1
33	Actinomyces funkei strain CCUG 42773	NR_028960.1
34	Actinomyces georgiae strain 6843 DSM	NR_026182.1
35	Actinomyces graevenitzii strain: CCUG 27294	NR_042167.1
36	Actinomyces hongkongensis strain HKU8	NR_025200.1
37	Actinomyces hordeovulneris strain CIP 103149	NR_026225.1
38	Actinomyces howellii strain NCTC 11636	NR_026180.1
39	Actinomyces hyovaginalis strain BM 1192/5	NR_026097.1
40	Actinomyces marimammalium strain CCUG 41710	NR_025395.1
41	Actinomyces massiliensis strain 4401292	NR_044288.1
42	Actinomyces meyeri strain Prevot 2477B	NR_029286.1
43	Actinomyces naeslundii strain CDC W826	NR_037033.1
44	Actinomyces nasicola strain R2014	NR_025568.1
45	Actinomyces odontolyticus strain CCUG 20536	NR_041983.1
46	Actinomyces radicidentis strain CCUG 36733	NR_025379.1
47	Actinomyces radingae strain ATCC 51856	NR_026169.1
48	Actinomyces ruminicola strain B71	NR_043523.1
49	Actinomyces slackii strain CCUG 32792	NR_041984.1
50	Actinomyces suimastitidis strain CCUG 39276	NR_025401.1
51	Actinomyces turicensis strain APL10	NR_037020.1
52	Actinomyces urogenitalis strain CCUG 38702	NR_025364.1
53	Actinomyces vaccimaxillae strain R10176	NR_025523.1
54	Actinomyces viscosus strain NCTC 10951	NR_026228.1
55	Aeromonas hydrophila strain CCM 7232; ATCC 7966	NR_043638.1
56	Aeromonas hydrophila subsp. dhakensis strain: LMG 19562	NR_042155.1
57	Aeromonas hydrophila subsp. hydrophila ATCC 7966 strain ATCC 7966	NR_074841.1
58	Aeromonas hydrophila subsp. ranae strain: CIP 107985	NR_042518.1
59	Aeromonas veronii	NR_044845.1
60	Bacillus acidiceler strain CBD 119	NR_043774.1
61	Bacillus acidicola strain 105-2	NR_041942.1
62	Bacillus aeolius strain 4-1	NR_025557.1
63	Bacillus aerius strain: 24K	NR_042338.1
64	Bacillus aerophiles strain: 28K	NR_042339.1
65	Bacillus agaradhaerens strain DSM 8721	NR_026142.1
66	Bacillus akibai strain 1139	NR_028620.1
67	Bacillus alcalophilus strain 1	NR_036889.1
68	Bacillus algicola strain F12	NR_029077.1
69	Bacillus alkalidiazotrophicus strain MS 6	NR_044420.1
70	Bacillus alkalinitrilicus strain ANL-iso4	NR_044204.1
71	Bacillus alkalitelluris strain BA288	NR_043210.1
72	Bacillus altitudinis strain: 41KF2b	NR_042337.1
73	Bacillus alveayuensis strain TM 1	NR_043013.1
74	Bacillus amyloliquefaciens FZB42 strain FZB42	NR_075005.1
75	Bacillus amyloliquefaciens strain NBRC 15535	NR_041455.1
76	Bacillus anthracis str. Ames strain Ames	NR_074453.1
77	Bacillus anthracis strain ATCC 14578	NR_041248.1
78	Bacillus aquimaris strain TF-12	NR_025241.1
79	Bacillus arseniciselenatis strain E1H	NR_036852.1
80	Bacillus asahii strain MA001	NR_024817.1
81	Bacillus atrophaeus 1942 strain 1942	NR_075016.1
82	Bacillus atrophaeus strain JCM9070	NR_024689.1
83	Bacillus aurantiacus strain: K1-5	NR_042213.1
84	Bacillus azotoformans strain NBRC 15712	NR_041641.1
85	Bacillus badius strain 110	NR_036893.1
86	Bacillus barbaricus strain V2-BIII-A2	NR_028967.1
87	Bacillus bataviensis strain IDA1115	NR_036766.1
88	Bacillus benzoevorans strain NCIMB 12555	NR_044828.1
89	Bacillus bogoriensis strain LBB3	NR_042894.1
90	Bacillus boroniphilus strain T-15Z	NR_041275.1
91	Bacillus butanolivorans strain K9	NR_044170.1
92	Bacillus carboniphilus strain JCM9731	NR_024690.1
93	Bacillus cecembensis	NR_042648.1
94	Bacillus cellulosilyticus DSM 2522 strain DSM 2522	NR_074904.1
95	Bacillus cellulosilyticus DSM 2522 strain N-4	NR_040850.1
96	Bacillus cereus ATCC 14579 strain ATCC 14579	NR_074540.1
97	Bacillus cibi strain JG-30	NR_042974.1
98	Bacillus circulans	NR_042726.1
99	Bacillus clarkii strain DSM 8720	NR_026141.1
100	Bacillus clausii KSM-K16 strain KSM-K16	NR_074988.1
101	Bacillus coagulans strain NBRC 12583	NR_041523.1
102	Bacillus coahuilensis m4-4 strain m4-4	NR_044037.1
103	Bacillus cohnii strain DSM 6307	NR_026138.1
104	Bacillus cytotoxicus NVH 391-98 strain NVH 391-98	NR_074914.1
105	Bacillus decolorationis strain LMG 19507	NR_025473.1
106	Bacillus drentensis strain IDA1967	NR_029002.1
107	Bacillus edaphicus strain T7	NR_028674.1
108	Bacillus endophyticus strain 2DT	NR_025122.1
109	Bacillus farraginis strain R-6540	NR_025785.1
110	Bacillus fastidiosus strain DSM 91	NR_044829.1
111	Bacillus firmus strain IAM 12464	NR_025842.1
112	Bacillus firmus strain KSC_SF8b	NR_043991.1
113	Bacillus flexus strain IFO15715	NR_024691.1
114	Bacillus foraminis strain: CV53	NR_042274.1
115	Bacillus fordii strain R-7190	NR_025786.1
116	Bacillus fortis strain R-6514	NR_042905.1
117	Bacillus fumarioli strain LMG 17489	NR_025370.1
118	Bacillus funiculus strain NAF001	NR_028624.1
119	Bacillus galactosidilyticus strain LMG 17892	NR_025580.1
120	Bacillus gelatini strain LMG 21880	NR_025595.1
121	Bacillus ginsengi strain ge14	NR_044193.1
122	Bacillus ginsengihumi strain Gsoil 114	NR_041378.1
123	Bacillus halmapalus strain DSM 8723	NR_026144.1
124	Bacillus halodurans C-125 strain C-125	NR_074984.1
125	Bacillus halodurans strain DSM 497	NR_025446.1
126	Bacillus hemicellulosilyticus strain C-11	NR_040848.1
127	Bacillus herbersteinensis strain: D-1,5a	NR_042286.1
128	Bacillus horikoshii strain DSM8719	NR_040852.1
129	Bacillus horti strain K13	NR_036860.1
130	Bacillus humi strain LMG 22167	NR_025626.1
131	Bacillus hwajinpoensis strain SW-72	NR_025264.1
132	Bacillus idriensis strain SMC 4352-2	NR_043268.1
133	Bacillus indicus strain Sd/3	NR_029022.1
134	Bacillus infantis strain SMC 4352-1	NR_043267.1
135	Bacillus infernus strain TH-23	NR_027227.1
136	Bacillus isabeliae strain: CVS-8	NR_042619.1
137	Bacillus jeotgali strain YKJ-10	NR_025060.1
138	Bacillus koreensis strain BR030	NR_043084.1
139	Bacillus korlensis strain ZLC-26	NR_044538.1
140	Bacillus kribbensis strain BT080	NR_043682.1
141	Bacillus krulwichiae strain AM31D	NR_024798.1
142	Bacillus lehensis strain MLB2	NR_036940.1
143	Bacillus lentus strain NCIMB8773	NR_040792.1
144	Bacillus licheniformis DSM 13 = ATCC 14580 strain ATCC 14580;	NR_074923.1
	DSM 13
145	Bacillus litoralis strain SW-211	NR_043015.1
146	Bacillus luciferensis strain LMG 18422	NR_025511.1
147	Bacillus macauensis strain ZFHKF-1	NR_042892.1
148	Bacillus macyae strain JMM-4	NR_025650.1
149	Bacillus mannanilyticus strain AM-001	NR_040851.1
150	Bacillus marisflavi strain TF-11	NR_025240.1
151	Bacillus massiliensis strain 4400831	NR_043092.1
152	Bacillus megaterium QM B1551 strain QM B1551	NR_074290.1
153	Bacillus megaterium strain IAM 13418	NR_043401.1
154	Bacillus methanolicus strain NCIMB 13113	NR_040985.1
155	Bacillus mojavensis strain IFO15718	NR_024693.1
156	Bacillus mucilaginosus strain 1480D	NR_028675.1
157	Bacillus murimartini strain LMG 21005	NR_042084.1
158	Bacillus mycoides strain 273	NR_036880.1
159	Bacillus nealsonii strain DSM 15077	NR_044546.1
160	Bacillus niabensis strain 4T19	NR_043334.1
161	Bacillus niacini strain IFO15566	NR_024695.1
162	Bacillus novalis strain: LMG 21837	NR_042168.1
163	Bacillus odysseyi strain 34hs1	NR_025258.1
164	Bacillus okhensis strain Kh10-101	NR_043484.1
165	Bacillus okuhidensis strain GTC 854	NR_024766.1
166	Bacillus oleronius strain ATCC 700005	NR_043325.1
167	Bacillus oshimensis strain K11	NR_041241.1
168	Bacillus panaciterrae strain Gsoil 1517	NR_041379.1
169	Bacillus plakortidis strain: P203	NR_042383.1
170	Bacillus pocheonensis strain Gsoil 420	NR_041377.1
171	Bacillus polygoni strain YN-1	NR_041571.1
172	Bacillus pseudalcaliphilus DSM 8725	NR_026145.1
173	Bacillus pseudofirmus strain DSM 8715	NR_026139.1
174	Bacillus psychrosaccharolyticus strain ATCC23296	NR_040793.1
175	Bacillus pumilus SAFR-032 strain SAFR-032	NR_074977.1
176	Bacillus pumilus strain ATCC 7061	NR_043242.1
177	Bacillus ruris strain: R-6760 = LMG 22866	NR_042161.1
178	Bacillus safensis strain FO-036b	NR_041794.1
179	Bacillus schlegelii strain ATCC 43741	NR_040845.1
180	Bacillus selenatarsenatis strain SF-1	NR_041465.1
181	Bacillus seohaeanensis strain BH724	NR_043083.1
182	Bacillus shackletonii strain LMG 18435	NR_025373.1
183	Bacillus simplex strain DSM 1321	NR_042136.1
184	Bacillus siralis strain 171544	NR_028709.1
185	Bacillus smithii strain NRS-173	NR_036987.1
186	Bacillus soli strain R-16300	NR_025591.1
187	Bacillus solisalsi strain YC1	NR_044387.1
188	Bacillus sonorensis strain NRRL B-23154	NR_025130.1
189	Bacillus sp. LMG 20238 strain LMG 20238	NR_042083.1
190	Bacillus sporothermodurans strain M215	NR_026010.1
191	Bacillus stratosphericus strain: 41KF2a	NR_042336.1
192	Bacillus subtilis subsp. spizizenii strain NRRL B-23049	NR_024931.1
193	Bacillus subtilis subsp. subtilis strain DSM 10	NR_027552.1
194	Bacillus taeanensis strain BH030017	NR_043012.1
195	Bacillus thermoamylovorans strain DKP	NR_029151.1
196	Bacillus thermocloaceae strain S 6025	NR_036986.1
197	Bacillus thioparans strain BMP-1	NR_043762.1
198	Bacillus thuringiensis strain IAM 12077	NR_043403.1
199	Bacillus vallismortis strain DSM11031	NR_024696.1
200	Bacillus vedderi strain JaH	NR_026526.1
201	Bacillus vietnamensis strain 15-1	NR_024808.1
202	Bacillus vireti strain R-15447	NR_025590.1
203	Bacillus wakoensis strain N-1	NR_040849.1
204	Bacillus weihenstephanensis KBAB4 strain KBAB4	NR_074926.1
205	Bacillus weihenstephanensis strain DSM11821	NR_024697.1
206	Bacteroides acidifaciens strain A40	NR_028607.1
207	Bacteroides barnesiae strain JCM 13652	NR_041446.1
208	Bacteroides caccae strain ATCC 43185	NR_026242.1
209	Bacteroides cellulosilyticus DSM 14838 strain: CRE21	NR_042203.1
210	Bacteroides cellulosolvens strain ATCC 35603	NR_025918.1
211	Bacteroides coprocola DSM 17136 strain M16	NR_041278.1
212	Bacteroides coprophilus DSM 18228 strain CB42 (=JCM 13818,	NR_041461.1
	=DSM 18228)
213	Bacteroides coprosuis DSM 18011 strain PC139	NR_041818.1
214	Bacteroides dorei DSM 17855 strain JCM 13471	NR_041351.1
215	Bacteroides eggerthii DSM 20697 strain DSM 20697	NR_040864.1
216	Bacteroides finegoldii DSM 17565 strain JCM 13345	NR_041313.1
217	Bacteroides fragilis NCTC 9343 strain ATCC 25285 = NCTC 9343	NR_074784.1
218	Bacteroides fragilis YCH46 strain YCH46	NR_074839.1
219	Bacteroides gallinarum strain JCM 13658	NR_041448.1
220	Bacteroides graminisolvens strain XDT-1	NR_041642.1
221	Bacteroides helcogenes P 36-108 strain P 36-108	NR_074546.1
222	Bacteroides helcogenes strain JCM 6297	NR_041279.1
223	Bacteroides heparinolyticus	NR_044633.1
224	Bacteroides intestinalis DSM 17393 strain JCM 13265	NR_041307.1
225	Bacteroides massiliensis strain B84634	NR_042745.1
226	Bacteroides nordii strain WAL 11050	NR_043017.1
227	Bacteroides ovatus strain JCM 5824	NR_040865.1
228	Bacteroides plebeius DSM 17135 strain M12	NR_041277.1
229	Bacteroides propionicifaciens strain SV434	NR_041485.1
230	Bacteroides pyogenes strain JCM 10003	NR_041280.1
231	Bacteroides pyogenes strain JCM 6294	NR_041281.1
232	Bacteroides salanitronis DSM 18170 strain DSM 18170	NR_074616.1
233	Bacteroides salanitronis DSM 18170 strain JCM 13657	NR_041447.1
234	Bacteroides salyersiae strain WAL 10018	NR_043016.1
235	Bacteroides stercoris ATCC 43183	NR_027196.1
236	Bacteroides thetaiotaomicron VPI-5482 strain VPI-5482	NR_074277.1
237	Bacteroides uniformis strain JCM 5828	NR_040866.1
238	Bacteroides vulgatus ATCC 8482 strain ATCC 8482	NR_074515.1
239	Bacteroides xylanisolvens strain: XB1A	NR_042499.1
240	Brucella abortus strain: NCTC 10093	NR_042460.1
241	Brucella canis	NR_044652.1
242	Brucella canis ATCC 23365	NR_074286.1
243	Brucella ceti strain NCTC 12891	NR_042463.1
244	Brucella melitensis biovar Melitensis strain 2000031283; ATCC 23456	NR_043003.1
245	Brucella microti CCM 4915 strain CCM 4915	NR_074336.1
246	Brucella microti CCM 4915 strain CCM 4915	NR_042549.1
247	Brucella neotomae 5K33 strain 2002721533; ATCC 23459	NR_043004.1
248	Brucella ovis strain 63/290	NR_036772.1
249	Brucella pinnipedialis B2/94 strain B2/94	NR_074332.1
250	Brucella pinnipedialis strain NCTC 12890	NR_042462.1
251	Brucella suis 1330 strain: NCTC 10316	NR_042461.1
252	Burkholderia cepacia strain 717	NR_029209.1
253	Burkholderia cepacia strain LMG 14294	NR_041719.1
254	Burkholderia pseudomallei K96243 strain K96243	NR_074340.1
255	Burkholderia pseudomallei strain ATCC 23343	NR_043553.1
256	Cardiobacterium valvarum strain MDA3079	NR_028847.1
257	Citrobacter braakii strain 167	NR_028687.1
258	Citrobacter farmeri strain CDC 2991-81	NR_024861.1
259	Citrobacter freundii strain DSM 30039	NR_028894.1
260	Citrobacter gillenii strain CDC 4693-86	NR_041697.1
261	Citrobacter murliniae strain CDC 2970-59	NR_028688.1
262	Citrobacter rodentium ICC168 strain ICC168	NR_074903.1
263	Citrobacter rodentium strain DO 14784	NR_028685.1
264	Citrobacter sedlakii strain I-75	NR_028686.1
265	Citrobacter werkmanii strain CDC 0876-58	NR_024862.1
266	Citrobacter youngae strain GTC 1314	NR_041527.1
267	Clostridium botulinum A strain ELTDK 103	NR_029157.1
268	Clostridium botulinum strain 2318	NR_036786.1
269	Clostridium difficile 630 strain 630	NR_074454.1
270	Clostridium perfringens strain 13	NR_074482.1
271	Corynebacterium accolens strain CIP104783T, (ATCC49724T)	NR_042139.1
272	Corynebacterium afermentans strain CIP 103500	NR_044865.1
273	Corynebacterium afermentans subsp. afermentans strain CIP 103499	NR_026214.1
274	Corynebacterium ammoniagenes strain Cooke J.V 9.6	NR_037039.1
275	Corynebacterium amycolatum strain CIP 103452	NR_026215.1
276	Corynebacterium appendicis strain IMMIB R-3491	NR_028951.1
277	Corynebacterium aquilae strain S-613	NR_028989.1
278	Corynebacterium atypicum strain R2070	NR_025540.1
279	Corynebacterium aurimucosum strain IMMIB D-1488	NR_028941.1
280	Corynebacterium auris strain DZZM 328	NR_026211.1
281	Corynebacterium auriscanis strain CCUG 39784	NR_025365.1
282	Corynebacterium bovis strain ATCC13722	NR_041812.1
283	Corynebacterium bovis strain Evans	NR_037042.1
284	Corynebacterium callunae strain NCIMB 10338	NR_037036.1
285	Corynebacterium camporealensis strain CRS-51	NR_029326.1
286	Corynebacterium capitovis strain CCUG 39779	NR_025436.1
287	Corynebacterium casei strain LMG S-19264	NR_025101.1
288	Corynebacterium caspium strain M/106/00/5	NR_029017.1
289	Corynebacterium ciconiae strain BS13	NR_029007.1
290	Corynebacterium confusum strain DMMZ 2439	NR_026449.1
291	Corynebacterium coyleae strain: DSM 44184 = CCUG 35014 = DMMZ	NR_044905.1
	214
292	Corynebacterium cystitidis strain 42 Fukuya	NR_037037.1
293	Corynebacterium diphtheriae strain C7 s (—) tox	NR_037079.1
294	Corynebacterium durum strain IBS G15036	NR_026539.1
295	Corynebacterium efficiens YS-314	NR_024772.1
296	Corynebacterium falsenii CCUG 33651	NR_026415.1
297	Corynebacterium felinum strain CCUG 39943	NR_025496.1
298	Corynebacterium flavescens strain NCDO 1320	NR_037040.1
299	Corynebacterium freiburgense strain 1045	NR_044584.1
300	Corynebacterium freneyi strain 20695110	NR_042025.1
301	Corynebacterium glaucum strain IMMIB R-5091	NR_028971.1
302	Corynebacterium glutamicum strain ATCC 13032	NR_074663.1
303	Corynebacterium glutamicum strain ATCC13032	NR_041817.1
304	Corynebacterium halotolerans strain YIM70093	NR_029074.1
305	Corynebacterium hansenii strain: DSM 45109	NR_042703.1
306	Corynebacterium imitans strain 2023	NR_026369.1
307	Corynebacterium jeikeium K411 strain K411 = NCTC 11915	NR_074706.1
308	Corynebacterium jeikeium strain A376/84	NR_037035.1
309	Corynebacterium kroppenstedtii strain DSM 44385	NR_074408.1
310	Corynebacterium kroppenstedtii strain CCUG 35717	NR_026380.1
311	Corynebacterium kutscheri strain CIP 103423	NR_037034.1
312	Corynebacterium lipophiloflavum strain DSM 44291	NR_026370.1
313	Corynebacterium lubricantis strain: KSS-3Se	NR_044603.1
314	Corynebacterium macginleyi strain CIP104099T, (ATCC51787T)	NR_042138.1
315	Corynebacterium massiliense strain 5402485	NR_044182.1
316	Corynebacterium mastitidis strain S-8	NR_026376.1
317	Corynebacterium matruchotii strain CIP 81.82	NR_026216.1
318	Corynebacterium minutissimum strain NCTC 10288	NR_037124.1
319	Corynebacterium mucifaciens strain DMMZ 2278	NR_026396.1
320	Corynebacterium mycetoides strain NCTC 9864	NR_037078.1
321	Corynebacterium phocae strain M408/89/1	NR_026379.1
322	Corynebacterium pilosum strain ATCC 29592	NR_026212.1
323	Corynebacterium propinquum strain B 77159	NR_037038.1
324	Corynebacterium pseudodiphtheriticum strain CIP103420T,	NR_042137.1
	(ATCC10700)
325	Corynebacterium pseudotuberculosis strain E 23	NR_037070.1
326	Corynebacterium renale strain Charita a	NR_037069.1
327	Corynebacterium resistens strain DSM 45100	NR_074826.1
328	Corynebacterium resistens strain GTC 2026	NR_040999.1
329	Corynebacterium riegelii strain DMMZ 2415	NR_026434.1
330	Corynebacterium simulans strain UCL553	NR_025309.1
331	Corynebacterium singulare strain IBS B52218	NR_026394.1
332	Corynebacterium sphenisci strain CECT 5990	NR_028015.1
333	Corynebacterium spheniscorum strain PG 39	NR_027201.1
334	Corynebacterium sputi strain: IMMIB L-999	NR_042686.1
335	Corynebacterium striatum strain Minnett	NR_037041.1
336	Corynebacterium suicordis strain S-81/02	NR_042151.1
337	Corynebacterium sundsvallense strain CCUG 36622	NR_026375.1
338	Corynebacterium terpenotabidum strain IFO 14764	NR_040775.1
339	Corynebacterium testudinoris strain CCUG 41823	NR_025434.1
340	Corynebacterium thomssenii strain DSM 44276	NR_024849.1
341	Corynebacterium timonense strain 5401744	NR_044181.1
342	Corynebacterium tuberculostearicum strain Medalle X	NR_028975.1
343	Corynebacterium tuscaniense strain ISS-5309; ATCC BAA-1141;	NR_043093.1
	CCUG 51321
344	Corynebacterium ulcerans BR-AD22 strain BR-AD22	NR_074467.1
345	Corynebacterium ulcerans strain NCTC 7910	NR_029292.1
346	Corynebacterium ulceribovis strain: IMMIB L-1395	NR_042681.1
347	Corynebacterium urealyticum	NR_027597.1
348	Corynebacterium urealyticum strain DSM 7109	NR_074344.1
349	Corynebacterium ureicelerivorans strain: IMMIB RIV-2301	NR_042558.1
350	Corynebacterium variabile strain DSM 20132	NR_025314.1
351	Corynebacterium xerosis strain ATCC 373	NR_026213.1
352	Dermatophilus congolensis strain DSM 44180	NR_041990.1
353	Edwardsiella tarda strain ATCC15947	NR_024770.1
354	Enterobacter aerogenes strain JCM1235	NR_024643.1
355	Enterobacter cloacae strain 279-56	NR_028912.1
356	Enterobacter cloacae subsp. dissolvens strain LMG 2683	NR_044978.1
357	Enterococcus faecalis strain JCM 5803	NR_040789.1
358	Enterococcus faecalis V583 strain V583	NR_074637.1
359	Enterococcus faecium strain LMG 11423	NR_042054.1
360	Erysipelothrix rhusiopathiae str. Fujisawa strain Fujisawa	NR_074878.1
361	Erysipelothrix rhusiopathiae strain ATCC 19414	NR_040837.1
362	Eubacterium acidaminophilum strain DSM 3953	NR_024922.1
363	Eubacterium angustum	NR_044642.1
364	Eubacterium brachy strain BR-179	NR_036993.1
365	Eubacterium budayi strain JCM 9989	NR_024682.1
366	Eubacterium cellulosolvens 6	NR_026106.1
367	Eubacterium combesii strain ATCC 25545	NR_042951.1
368	Eubacterium desmolans	NR_044644.1
369	Eubacterium eligens strain ATCC 27750	NR_074613.1
370	Eubacterium infirmum strain W 1471	NR_029178.1
371	Eubacterium minutum strain SC 87K	NR_036949.1
372	Eubacterium multiforme strain JCM 6484	NR_024683.1
373	Eubacterium nitritogenes strain JCM 6485	NR_024684.1
374	Eubacterium nodatum strain AK-5	NR_036994.1
375	Eubacterium pyruvativorans	NR_042074.1
376	Eubacterium rectale strain ATCC 33656	NR_074634.1
377	Eubacterium ruminantium strain GA195	NR_024661.1
378	Eubacterium saphenum ATCC 49989 strain 164-47	NR_026031.1
379	Eubacterium sulci strain ATCC 35585	NR_025289.1
380	Flavobacterium anhuiense strain D3	NR_044388.1
381	Flavobacterium antarcticum strain AT1026	NR_042998.2
382	Flavobacterium aquatile strain: DSM 1132	NR_042495.1
383	Flavobacterium aquidurense strain: WB 1.1-56	NR_042470.1
384	Flavobacterium ceti strain: 454-2	NR_042540.1
385	Flavobacterium cheniae strain NJ-26	NR_044198.1
386	Flavobacterium chungangense strain CJ7	NR_044581.1
387	Flavobacterium columnare strain ATCC 49512	NR_074580.1
388	Flavobacterium columnare strain IFO 15943	NR_040907.1
389	Flavobacterium croceum strain EMB47	NR_043768.1
390	Flavobacterium cucumis strain R2A45-3	NR_044107.1
391	Flavobacterium daejeonense strain GH1-10	NR_043654.1
392	Flavobacterium defluvii strain EMB117	NR_043772.1
393	Flavobacterium degerlachei strain R-9106	NR_029009.1
394	Flavobacterium denitrificans strain: ED5	NR_042088.1
395	Flavobacterium filum strain EMB34	NR_043767.1
396	Flavobacterium frigidarium strain A2i	NR_025020.1
397	Flavobacterium frigidimaris strain KUC-1	NR_041057.1
398	Flavobacterium frigoris strain R-9014	NR_025597.1
399	Flavobacterium fryxellicola strain: LMG 22022	NR_042332.1
400	Flavobacterium gelidilacus strain R-8899	NR_025538.1
401	Flavobacterium glaciei strain 0499	NR_043891.1
402	Flavobacterium granuli strain Kw05	NR_041052.1
403	Flavobacterium hercynium strain: WB 4.2-33	NR_042520.1
404	Flavobacterium hibernum strain ATCC 51468	NR_025923.1
405	Flavobacterium hydatis	NR_044695.1
406	Flavobacterium indicum strain GPTSA100-9	NR_074422.1
407	Flavobacterium indicum strain GPTSA100-9	NR_043269.1
408	Flavobacterium johnsoniae	NR_044738.1
409	Flavobacterium johnsoniae strain: DSM 2064	NR_042496.1
410	Flavobacterium johnsoniae strain UW101; ATCC 17061	NR_074455.1
411	Flavobacterium limicola strain ST-82	NR_024787.1
412	Flavobacterium lindanitolerans strain IP10	NR_044208.1
413	Flavobacterium micromati strain R-9192	NR_029010.1
414	Flavobacterium omnivorum strain AS 1.2747	NR_025202.1
415	Flavobacterium psychrolimnae strain: LMG 22018	NR_042207.1
416	Flavobacterium psychrophilum JIP02/86 strain JIP02/86	NR_074630.1
417	Flavobacterium psychrophilum strain IFO 15942	NR_040914.1
418	Flavobacterium resistens strain BD-b365	NR_044292.1
419	Flavobacterium saccharophilum strain: DSM 1811	NR_042497.1
420	Flavobacterium saliperosum strain AS 1.3801	NR_043481.1
421	Flavobacterium sasangense strain YC6274	NR_044492.1
422	Flavobacterium segetis strain AT1048; IMSNU 14050; KCTC 12224	NR_043000.1
423	Flavobacterium soli strain DS-6	NR_043613.1
424	Flavobacterium sp. strain A103	NR_044804.1
425	Flavobacterium sp. strain IC001	NR_044805.1
426	Flavobacterium succinicans strain: DSM 4002	NR_042498.1
427	Flavobacterium suncheonense strain GH29-5	NR_043655.1
428	Flavobacterium terrae strain R2A1-13	NR_044096.1
429	Flavobacterium terrigena strain DS-20	NR_044006.1
430	Flavobacterium weaverense strain AT1042; IMSNU 14048; KCTC	NR_042999.1
	12223
431	Flavobacterium xanthum strain ACAM 81	NR_024865.1
432	Flavobacterium xinjiangense strain AS 1.2749	NR_025201.1
433	Haemophilus aegyptius strain CCUG 25716	NR_042875.1
434	Haemophilus ducreyi 35000HP strain 35000HP	NR_074837.1
435	Haemophilus ducreyi strain CIP 542	NR_044741.1
436	Haemophilus felis strain ATCC49733	NR_025073.1
437	Haemophilus haemoglobinophilus strain CCUG 3714	NR_042877.1
438	Haemophilus influenzae	NR_044682.1
439	Haemophilus influenzae Rd KW20	NR_074863.1
440	Haemophilus paracuniculus	NR_044751.1
441	Haemophilus parahaemolyticus strain 536	NR_025938.1
442	Haemophilus parainfluenzae strain CCUG 12836	NR_042878.1
443	Haemophilus paraphrohaemolyticus	NR_044753.1
444	Haemophilus parasuis strain CCUG 3712	NR_042879.1
445	Haemophilus pittmaniae strain HK85	NR_025423.1
446	Haemophilus somnus strain 129P	NR_074278.1
447	Klebsiella oxytoca strain ATCC 13182	NR_041749.1
448	Klebsiella pneumoniae strain DSM 30104	NR_036794.1
449	Klebsiella pneumoniae subsp. ozaenae strain ATCC11296	NR_041750.1
450	Klebsiella pneumoniae subsp. pneumoniae strain ATCC 700721; MGH	NR_074913.1
	78578
451	Klebsiella pneumoniae subsp. rhinoscleromatis strain R-70	NR_037084.1
452	Lactobacillus acetotolerans strain DSM 20749	NR_044699.1
453	Lactobacillus acidipiscis strain FS60-1	NR_024718.1
454	Lactobacillus acidophilus 30SC strain 30SC	NR_075049.1
455	Lactobacillus acidophilus strain NCFM	NR_075045.1
456	Lactobacillus acidophilus strain BCRC10695	NR_043182.1
457	Lactobacillus algidus strain M 6 A9	NR_028617.1
458	Lactobacillus amylolyticus strain LA 5	NR_029352.1
459	Lactobacillus amylophilus	NR_044702.1
460	Lactobacillus amylotrophicus strain: LMG 11400	NR_042511.1
461	Lactobacillus amylovorus strain GRL 1112	NR_075048.1
462	Lactobacillus amylovorus strain DSM 20531	NR_043287.1
463	Lactobacillus animalis strain NBRC 15882	NR_041610.1
464	Lactobacillus apodemi strain: ASB1	NR_042367.1
465	Lactobacillus aviarius	NR_044703.1
466	Lactobacillus bobalius strain 203	NR_043096.1
467	Lactobacillus brevis	NR_044704.1
468	Lactobacillus brevis strain ATCC 367	NR_075024.1
469	Lactobacillus buchneri strain JCM1115	NR_041293.1
470	Lactobacillus cacaonum strain: LMG 24285	NR_042677.1
471	Lactobacillus camelliae strain MCH3-1	NR_041457.1
472	Lactobacillus capillatus strain YIT 11306 (=JCM 15044, =DSM 19910	NR_041655.1
	=BCRC 17811)
473	Lactobacillus casei strain ATCC 334	NR_075032.1
474	Lactobacillus casei strain JCM 1136	NR_043408.1
475	Lactobacillus casei subsp. casei strain ATCC 393	NR_041893.1
476	Lactobacillus catenaformis strain: DSM 20559	NR_042228.1
477	Lactobacillus ceti strain: 142-2	NR_042539.1
478	Lactobacillus collinoides strain JCM1123	NR_024645.1
479	Lactobacillus composti strain NRIC 0689	NR_041509.1
480	Lactobacillus concavus strain AS 1.5017	NR_043105.1
481	Lactobacillus coryniformis	NR_044705.1
482	Lactobacillus coryniformis subsp. torquens strain 30	NR_029018.1
483	Lactobacillus crispatus ST1 strain ST1	NR_074986.1
484	Lactobacillus crispatus strain ATCC33820	NR_041800.1
485	Lactobacillus crustorum strain: LMG 23699	NR_042533.1
486	Lactobacillus curvatus strain: DSM 20019	NR_042437.1
487	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 strain ATCC	NR_075019.1
	11842
488	Lactobacillus delbrueckii subsp. delbrueckii strain BCRC12195	NR_043183.1
489	Lactobacillus delbrueckii subsp. indicus strain NCC725	NR_029106.1
490	Lactobacillus delbrueckii subsp. lactis DSM 20072 strain ATCC 12315	NR_042728.1
491	Lactobacillus dextrinicus strain JCM 5887	NR_036861.1
492	Lactobacillus diolivorans strain JKD6	NR_037004.1
493	Lactobacillus equi strain YIT 0455	NR_028623.1
494	Lactobacillus fabifermentans strain: LMG 24284	NR_042676.1
495	Lactobacillus farraginis strain NRIC 0676	NR_041467.1
496	Lactobacillus fornicalis strain TV1018	NR_026509.1
497	Lactobacillus gallinarum strain ATCC 33199	NR_042111.1
498	Lactobacillus gasseri	NR_041920.1
499	Lactobacillus gasseri strain ATCC 33323	NR_075051.1
500	Lactobacillus ghanensis strain L489	NR_043896.1
501	Lactobacillus graminis strain: DSM 20719	NR_042438.1
502	Lactobacillus hammesii strain: TMW 1.1236	NR_042243.1
503	Lactobacillus hamsteri strain DSM 5661	NR_025448.1
504	Lactobacillus harbinensis strain SBT10908	NR_041263.1
505	Lactobacillus hayakitensis	NR_041498.1
506	Lactobacillus helveticus strain DPC 4571	NR_075047.1
507	Lactobacillus helveticus DSM 20075	NR_042439.1
508	Lactobacillus hilgardii	NR_044708.1
509	Lactobacillus hordei strain UCC128; DSM19519; LMG24241	NR_044394.1
510	Lactobacillus iners strain DSM 13335	NR_036982.1
511	Lactobacillus intestinalis strain DSM 6629	NR_025449.1
512	Lactobacillus jensenii strain ATCC 25258	NR_025087.1
513	Lactobacillus johnsonii NCC 533 strain NCC 533	NR_075064.1
514	Lactobacillus johnsonii strain ATCC 33200	NR_025273.1
515	Lactobacillus kalixensis strain Kx127A2	NR_029083.1
516	Lactobacillus kefiranofaciens subsp. kefiranofaciens strain: DSM 5016	NR_042440.1
517	Lactobacillus kefiranofaciens subsp. kefirgranum strain: DSM 10550	NR_042441.1
518	Lactobacillus kefiri strain: LMG 9480	NR_042230.1
519	Lactobacillus kimchii strain MT-1077	NR_025045.1
520	Lactobacillus kisonensis strain YIT 11168 (=NRIC 0741, =JCM 15041,	NR_041658.1
	=DSM 19906)
521	Lactobacillus kitasatonis strain JCM 1039	NR_024813.1
522	Lactobacillus kunkeei strain YH-15	NR_026404.1
523	Lactobacillus lindneri strain KPA	NR_029308.1
524	Lactobacillus malefermentans strain DSM 5705	NR_042442.1
525	Lactobacillus manihotivorans strain OND 32	NR_024835.1
526	Lactobacillus mindensis strain TMW 1.80	NR_028949.1
527	Lactobacillus nagelii strain NRIC 0559	NR_041007.1
528	Lactobacillus nantensis strain LP33	NR_043114.1
529	Lactobacillus nodensis strain iz4b-1	NR_041629.1
530	Lactobacillus oeni strain 59b	NR_043095.1
531	Lactobacillus oligofermentans strain AMKR18	NR_043148.1
532	Lactobacillus otakiensis strain YIT 11163 (=NRIC 0742, =JCM 15040,	NR_041657.1
	=DSM 19908)
533	Lactobacillus pantheris strain LMG 21017	NR_025189.1
534	Lactobacillus parabrevis strain: LMG 11984	NR_042456.1
535	Lactobacillus parabuchneri strain JCM 12493	NR_041294.1
536	Lactobacillus paracasei subsp. paracasei strain R094	NR_025880.1
537	Lactobacillus paracasei subsp. tolerans strain NBRC 15906	NR_041054.1
538	Lactobacillus paracollinoides strain: DSM 15502	NR_042322.1
539	Lactobacillus parafarraginis strain NRIC 0677	NR_041468.1
540	Lactobacillus parakefiri strain GCL 1731	NR_029039.1
541	Lactobacillus paralimentarius strain TB 1	NR_036879.1
542	Lactobacillus paraplantarum strain DSM 10667	NR_025447.1
543	Lactobacillus pentosus strain 124-2	NR_029133.1
544	Lactobacillus perolens strain L532	NR_029360.1
545	Lactobacillus plantarum strain NRRL B-14768	NR_042394.1
546	Lactobacillus plantarum subsp. argentoratensis strain: DK0 22	NR_042254.1
547	Lactobacillus plantarum WCFS1 strain WCFS1	NR_075041.1
548	Lactobacillus rapi strain YIT 11204 (=NRIC 0743, =JCM 15042,	NR_041659.1
	=DSM 19907)
549	Lactobacillus rennini strain CECT 5922	NR_042195.1
550	Lactobacillus rossiae strain CS1	NR_029014.1
551	Lactobacillus ruminis strain NBRC 102161	NR_041611.1
552	Lactobacillus saerimneri strain GDA154	NR_029085.1
553	Lactobacillus sakei strain: DSM 20017	NR_042443.1
554	Lactobacillus sakei subsp. carnosus strain CCUG 34545	NR_025719.1
555	Lactobacillus sakei subsp. sakei 23K strain 23K	NR_075042.1
556	Lactobacillus salivarius strain HO 66	NR_028725.1
557	Lactobacillus salivarius strain UCC118	NR_074589.1
558	Lactobacillus sanfranciscensis strain L-12	NR_029261.1
559	Lactobacillus sanfranciscensis strain TMW 1.1304	NR_075038.1
560	Lactobacillus satsumensis strain NRIC 0604	NR_028658.1
561	Lactobacillus senmaizukei strain L13	NR_041584.1
562	Lactobacillus sharpeae	NR_044711.1
563	Lactobacillus spicheri strain LTH 5753	NR_025579.1
564	Lactobacillus suebicus strain CECT 5917	NR_042190.1
565	Lactobacillus sunkii strain YIT 11161 (=NRIC 0744, =JCM 15039,	NR_041656.1
	=DSM 19904)
566	Lactobacillus taiwanensis strain BCRC 17755	NR_044507.1
567	Lactobacillus thailandensis strain MCH5-2	NR_041456.1
568	Lactobacillus tucceti strain CECT 5920	NR_042194.1
569	Lactobacillus ultunensis strain Kx146C1; LMG 22117T; DSM 16047T;	NR_042802.1
	CCUG 48460
570	Lactobacillus vaginalis strain ATCC49540	NR_041796.1
571	Lactobacillus versmoldensis strain KU-3	NR_028990.1
572	Lactobacillus vini strain: CECT 5924	NR_042196.1
573	Lactobacillus vitulinus strain JCM 1143	NR_041305.1
574	Lactobacillus zeae strain RIA 482	NR_037122.1
575	Legionella pneumophila subsp. pneumophila str. Philadelphia 1 strain	NR_074231.1
	Philadelphia 1
576	Listeria monocytogenes strain NCTC10357	NR_044823.1
577	Micrococcus antarcticus strain T2	NR_025285.1
578	Micrococcus endophyticus strain YIM 56238	NR_044365.1
579	Micrococcus flavus strain LW4	NR_043881.1
580	Micrococcus luteus NCTC 2665 strain NCTC 2665	NR_075062.1
581	Micrococcus luteus strain DSM 20030	NR_037113.1
582	Micrococcus lylae strain DSM 20315	NR_026200.1
583	Mobiluncus curtisii ATCC 43063 strain ATCC 43063	NR_074732.1
584	Mobiluncus curtisii subsp. curtisii ATCC 35241 strain CCUG 21018	NR_042085.1
585	Mobiluncus curtisii subsp. holmesii ATCC 35242 strain: CCUG 17762	NR_042124.1
586	Mobiluncus mulieris strain CCUG 20071	NR_042086.1
587	Moraxella boevrei strain ATCC 700022	NR_043585.1
588	Moraxella bovis strain L-3	NR_028668.1
589	Moraxella bovoculi 237 strain 237	NR_043583.1
590	Moraxella canis strain N7	NR_028914.1
591	Moraxella caprae strain ATCC 700019	NR_043586.1
592	Moraxella catarrhalis strain Ne 11	NR_028669.1
593	Moraxella caviae strain GP11	NR_028671.1
594	Moraxella cuniculi strain CCUG 2154	NR_041695.1
595	Moraxella equi strain 327/72	NR_041694.1
596	Moraxella lacunata strain Morax 260	NR_036825.1
597	Moraxella ovis strain 199/55	NR_028670.1
598	Moraxella pluranimalium strain: 248-01	NR_042666.1
599	Morganella morganii strain DSM 14850	NR_043751.1
600	Morganella morganii strain M11	NR_028938.1
601	Morganella psychrotolerans strain U2/3	NR_043750.1
602	Mycobacterium massiliense str. strain GO 06	NR_074421.1
603	Mycobacterium tuberculosis strain NCTC 7416 H37Rv	NR_044826.1
604	Neisseria animalis strain NA 1	NR_028900.1
605	Neisseria animaloris strain LMG 23011	NR_043458.1
606	Neisseria bacilliformis ATCC BAA-1200 strain MDA2833	NR_042978.1
607	Neisseria canis	NR_044614.1
608	Neisseria dentiae strain V33	NR_028843.1
609	Neisseria elongata subsp. elongata strain ATCC 25295	NR_025893.1
610	Neisseria flavescens strain N 155	NR_025892.1
611	Neisseria gonorrhoeae strain NCTC 83785	NR_026079.1
612	Neisseria lactamica strain NCTC 10617	NR_028899.1
613	Neisseria meningitidis strain N.934/01	AY238932.1
614	Neisseria polysaccharea strain NCTC11858	NR_041988.1
615	Neisseria subflava strain U37	NR_041989.1
616	Neisseria weaveri strain CDC 8142	NR_025902.1
617	Neisseria zoodegmatis strain LMG 23012	NR_043459.1
618	Nocardia abscessus strain IMMIB D-1592	NR_025059.1
619	Nocardia acidivorans strain: GW4-1778	NR_042566.1
620	Nocardia africana strain DSM 44491	NR_041872.1
621	Nocardia alba strain YIM 30243	NR_025726.1
622	Nocardia altamirensis strain DSM 44997	NR_044366.1
623	Nocardia amamiensis strain TT 00-78	NR_041531.1
624	Nocardia anaemiae strain IFM 0323	NR_041010.1
625	Nocardia aobensis strain IFM 0372	NR_040995.1
626	Nocardia araoensis strain IFM 0575	NR_028652.1
627	Nocardia arthritidis strain IFM 10035	NR_028654.1
628	Nocardia asiatica strain IFM 0245	NR_028644.1
629	Nocardia asteroides strain DSM 43757	NR_041856.1
630	Nocardia beijingensis strain AS4.1521	NR_025017.1
631	Nocardia blacklockiae strain ATCC 700035	NR_044402.1
632	Nocardia brasiliensis ATCC 700358 strain HUJEG-1	NR_074743.1
633	Nocardia brasiliensis strain DSM 43758	NR_041860.1
634	Nocardia brevicatena strain DSM 43024	NR_041862.1
635	Nocardia caishijiensis strain F829	NR_025216.1
636	Nocardia carnea strain DSM 43397	NR_041859.1
637	Nocardia cerradoensis strain Y9	NR_028704.1
638	Nocardia concava strain IFM 0354	NR_040996.1
639	Nocardia coubleae strain OFN N11	NR_043669.1
640	Nocardia crassostreae strain JCM 10500	NR_041868.1
641	Nocardia cummidelens strain DSM 44490	NR_041871.1
642	Nocardia cyriacigeorgica strain GUH-2	NR_074699.1
643	Nocardia cyriacigeorgica strain DSM 44484	NR_041857.1
644	Nocardia elegans strain: IMMIB N-402	NR_042353.1
645	Nocardia exalbida strain IFM 0803	NR_041237.1
646	Nocardia farcinica IFM 10152 strain IFM 10152	NR_074702.1
647	Nocardia farcinica strain Goodfellow N898	NR_036996.1
648	Nocardia flavorosea strain 10.268-1	NR_026525.1
649	Nocardia fluminea strain S1	NR_028791.1
650	Nocardia gamkensis strain CZH20	NR_043667.1
651	Nocardia harenae strain WS-26	NR_043686.1
652	Nocardia higoensis strain IFM 10084	NR_028651.1
653	Nocardia ignorata strain IMMIB R-1434	NR_028006.1
654	Nocardia inohanensis strain IFM 0092	NR_037051.1
655	Nocardia jejuensis strain N3-2	NR_043305.1
656	Nocardia jiangxiensis strain 43401	NR_043060.1
657	Nocardia jinanensis strain 04-5195	NR_043870.1
658	Nocardia kruczakiae strain MB2876; ATCC BAA-948	NR_042902.1
659	Nocardia lijiangensis strain YIM 33378	NR_043185.1
660	Nocardia miyunensis strain 117	NR_043059.1
661	Nocardia neocaledoniensis strain SBHR OA6	NR_029094.1
662	Nocardia niigatensis strain DSM 44670	NR_043916.1
663	Nocardia ninae strain OFN 02.72	NR_043668.1
664	Nocardia nova strain JCM 6044	NR_041858.1
665	Nocardia otitidiscaviarum strain DSM 43242	NR_041874.1
666	Nocardia paucivorans strain DSM 44386	NR_041863.1
667	Nocardia pneumoniae strain IFM 0784	NR_028653.1
668	Nocardia pseudobrasiliensis strain DSM 44290	NR_041864.1
669	Nocardia pseudovaccinii strain DSM 43406	NR_025199.1
670	Nocardia puris strain IMMIB R-145	NR_028994.1
671	Nocardia salmonicida strain DSM 40472	NR_041869.1
672	Nocardia seriolae strain DSM 44129	NR_041861.1
673	Nocardia shimofusensis strain YZ-96	NR_028650.1
674	Nocardia sienata strain IFM 10088	NR_024825.1
675	Nocardia soli strain DSM 44488	NR_041870.1
676	Nocardia speluncae strain: N2-11	NR_042591.1
677	Nocardia takedensis strain MS1-3	NR_024832.1
678	Nocardia tenerifensis	NR_042176.1
679	Nocardia terpenica strain IFM 0706	NR_041289.1
680	Nocardia testacea strain JCM 12235	NR_041251.1
681	Nocardia thailandica strain IFM 10145	NR_040994.1
682	Nocardia transvalensis strain DSM 43405	NR_041867.1
683	Nocardia uniformis strain DSM 43136	NR_041865.1
684	Nocardia vaccinii strain DSM 43285	NR_041866.1
685	Nocardia vermiculata strain IFM 0391	NR_040993.1
686	Nocardia veterana strain M157222	NR_037097.1
687	Nocardia vinacea strain MK703-102F1	NR_024722.1
688	Nocardia wallacei strain ATCC 49873	NR_044401.1
689	Nocardia xishanensis strain AS 4.1860	NR_025759.1
690	Nocardia yamanashiensis strain IFM 0265	NR_024803.1
691	Pasteurella multocida subsp. gallicida strain CCUG 17978	NR_041811.1
692	Pasteurella multocida subsp. multocida strain CCUG 17976	NR_041809.1
693	Peptostreptococcus anaerobius strain NCTC 11460	NR_042847.1
694	Peptostreptococcus stomatis strain W2278	NR_043589.1
695	Plesiomonas shigelloides strain: NCIMB9242	NR_044827.1
696	Porphyromonas asaccharolytica	NR_044635.1
697	Porphyromonas asaccharolytica strain DSM 20707	NR_074588.1
698	Porphyromonas bennonis strain WAL 1926C	NR_044491.1
699	Porphyromonas cangingivalis strain VPB 4874	NR_026136.1
700	Porphyromonas cansulci strain VPB 4875	NR_026137.1
701	Porphyromonas catoniae strain ATCC 51270	NR_026230.1
702	Porphyromonas circumdentaria	NR_044639.1
703	Porphyromonas endodontalis strain ATCC 35406	NR_042803.1
704	Porphyromonas gingivalis strain ATCC 33277	NR_074234.1
705	Porphyromonas gingivalis strain ATCC33277	NR_040838.1
706	Porphyromonas gingivalis W83 strain W83	NR_074230.1
707	Porphyromonas gulae strain Loup-1	NR_025052.1
708	Porphyromonas levii strain ATCC 29147	NR_025907.1
709	Porphyromonas somerae strain WAL 6690	NR_043312.1
710	Porphyromonas uenonis strain WAL 9902; ATCC BAA-906; CCUG	NR_042986.1
	48615
711	Prevotella albensis strain M384	NR_025300.1
712	Prevotella amnii strain: CCUG 53648	NR_042587.1
713	Prevotella baroniae	NR_043224.1
714	Prevotella bergensis strain 94067913	NR_042857.1
715	Prevotella bivia	NR_044629.1
716	Prevotella brevis strain GA33	NR_041954.1
717	Prevotella bryantii B14	NR_028866.1
718	Prevotella buccae	NR_044631.1
719	Prevotella buccalis	NR_044630.1
720	Prevotella copri strain CB7	NR_040877.1
721	Prevotella corporis	NR_044627.1
722	Prevotella dentalis strain ES2772	NR_029284.1
723	Prevotella denticola strain ATCC 35308	NR_042842.1
724	Prevotella disiens strain EUH N 1304-72B	NR_029149.1
725	Prevotella enoeca strain ATCC 51261	NR_025281.1
726	Prevotella falsenii strain 04052 (= JCM 15124)	NR_041684.1
727	Prevotella histicola strain T05-04	NR_044407.1
728	Prevotella intermedia strain B422	NR_026119.1
729	Prevotella loescheii strain NCTC 11321	NR_043216.1
730	Prevotella maculosa strain W1609	NR_044270.1
731	Prevotella marshii strain E9.34	NR_041907.1
732	Prevotella melaninogenica strain ATCC 25845	NR_042843.1
733	Prevotella micans strain E7.56	NR_041908.1
734	Prevotella multiformis strain PPPA21	NR_041056.1
735	Prevotella multisaccharivorax strain JCM 12954	NR_041285.1
736	Prevotella nanceiensis strain AIP 261.03	NR_043292.1
737	Prevotella nigrescens strain NCTC 9336	NR_044850.1
738	Prevotella oralis strain ATCC 33269	NR_042841.1
739	Prevotella oris	NR_044628.1
740	Prevotella oulorum strain WPH 179	NR_029147.1
741	Prevotella pollens strain 10371	NR_026417.1
742	Prevotella paludivivens strain KB7	NR_040924.1
743	Prevotella pleuritidis strain JCM 14110	NR_041541.1
744	Prevotella ruminicola	NR_044632.1
745	Prevotella salivae strain EPSA11	NR_024816.1
746	Prevotella shahii strain EHS11	NR_024815.1
747	Prevotella stercorea strain CB35	NR_041364.1
748	Prevotella tannerae strain VPI N14B-15	NR_037088.1
749	Prevotella timonensis strain 4401737	NR_043894.1
750	Prevotella veroralis strain ATCC 33779	NR_029148.1
751	Propionibacterium acidipropionici strain NCFB 570	NR_042268.1
752	Propionibacterium acnes	NR_040847.1
753	Propionibacterium acnes KPA171202 strain KPA171202	NR_074675.1
754	Propionibacterium australiense strain LCDC-98A072	NR_025076.1
755	Propionibacterium avidum strain DSM 4901	NR_025274.1
756	Propionibacterium cyclohexanicum strain TA-12	NR_036827.1
757	Propionibacterium freudenreichii strain DSM 20271	NR_044816.1
758	Propionibacterium freudenreichil subsp. shermanii strain E11	NR_036972.1
759	Propionibacterium granulosum strain DSM 20700	NR_025276.1
760	Propionibacterium jensenii strain: DSM 20535	NR_042269.1
761	Propionibacterium microaerophilum strain M 5	NR_028778.1
762	Propionibacterium propionicum strain DSM 43307	NR_025277.1
763	Propionibacterium thoenii strain: NCFB 568	NR_042270.1
764	Proteus mirabilis HI4320 strain HI4320	NR_074898.1
765	Proteus mirabilis strain NCTC 11938	NR_043997.1
766	Proteus vulgaris strain DSM 30118	NR_025336.1
767	Providencia alcalifaciens strain CIP8290T (ATCC9886T)	NR_042053.1
768	Providencia heimbachae strain: DSM 3591	NR_042412.1
769	Providencia rettgeri strain: DSM 4542	NR_042413.1
770	Providencia rustigianii strain: DSM 4541	NR_042411.1
771	Providencia stuartii strain ATCC 29914	NR_024848.1
772	Providencia vermicola strain: OP1	NR_042415.1
773	Pseudomonas aeruginosa PAO1 strain PAO1	NR_074828.1
774	Pseudomonas aeruginosa strain DSM 50071	NR_026078.1
775	Rhodococcus aetherivorans strain 10bc312	NR_025208.1
776	Rhodococcus baikonurensis strain A1-22	NR_024784.1
777	Rhodococcus coprophilus strain CUB 687	NR_029206.1
778	Rhodococcus corynebacterioides strain DSM 20151	NR_041873.1
779	Rhodococcus equi strain DSM 20307	NR_041910.1
780	Rhodococcus erythropolis PR4 strain PR4 (=NBRC 100887)	NR_074622.1
781	Rhodococcus erythropolis strain N11	NR_037024.1
782	Rhodococcus fascians strain CF17	NR_037021.1
783	Rhodococcus globerulus strain DSM 4954	NR_026184.1
784	Rhodococcus gordoniae strain W4937	NR_025730.1
785	Rhodococcus intechensis strain RKJ300	NR_042946.1
786	Rhodococcus jostii RHA1 strain RHA1	NR_074610.1
787	Rhodococcus jostii strain IFO 16295	NR_024765.1
788	Rhodococcus koreensis strain DNP505	NR_024973.1
789	Rhodococcus kroppenstedtii strain K07-23	NR_043144.1
790	Rhodococcus kunmingensis strain YIM 45607	NR_044034.1
791	Rhodococcus kyotonensis strain DS472	NR_041512.1
792	Rhodococcus maanshanensis strain M712	NR_025190.1
793	Rhodococcus marinonascens strain DSM 43752	NR_026183.1
794	Rhodococcus opacus B4 strain B4	NR_074632.1
795	Rhodococcus opacus strain DSM 43205	NR_026186.1
796	Rhodococcus percolatus strain MBS1	NR_044878.1
797	Rhodococcus phenolicus strain G2P	NR_042950.1
798	Rhodococcus pyridinivorans strain PDB9	NR_025033.1
799	Rhodococcus qingshengii strain djl-6	NR_043535.1
800	Rhodococcus rhodnii strain B/O	NR_037029.1
801	Rhodococcus rhodochrous strain 372	NR_037023.1
802	Rhodococcus ruber strain: DSM43338	NR_026185.1
803	Rhodococcus triatomae strain: IMMIB RIV-085	NR_042352.1
804	Rhodococcus tukisamuensis strain Mb8	NR_028629.1
805	Rhodococcus wratislaviensis strain NCIMB 13082	NR_026524.1
806	Rhodococcus yunnanensis strain YIM 70056	NR_043009.1
807	Rhodococcus zopfii strain DSM 44108	NR_041775.1
808	Salmonella bongori strain NCTC 12419	NR_074888.1
809	Salmonella bongori strain BR 1859	NR_041699.1
810	Salmonella enterica subsp. arizonae strain ATCC 13314	NR_041696.1
811	Salmonella enterica subsp. diarizonae strain DSM 14847	NR_044373.1
812	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67	NR_074800.1
	strain SC-B67
813	Salmonella enterica subsp. enterica serovar Enteritidis str. P125109	NR_074985.1
	strain P125109
814	Salmonella enterica subsp. enterica serovar Paratyphi A str.	NR_074935.1
	AKU_12601 strain AKU12601
815	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150	NR_074934.1
	strain ATCC 9150
816	Salmonella enterica subsp. enterica serovar Paratyphi C strain	NR_074899.1
	RKS4594 strain RKS4594
817	Salmonella enterica subsp. enterica serovar Typhi str. Ty2 strain Ty2	NR_074799.1
818	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 strain	NR_074910.1
	LT2; SGSC 1412; ATCC 700720
819	Salmonella enterica subsp. houtenae strain DSM 9221	NR_044371.1
820	Salmonella enterica subsp. indica strain DSM 14848	NR_044370.1
821	Salmonella enterica subsp. salamae strain DSM 9220	NR_044372.1
822	Serratia liquefaciens strain CIP 103238	NR_042062.1
823	Serratia marcescens subsp. marcescens ATCC 13880 strain DSM 30121	NR_041980.1
824	Serratia marcescens subsp. sakuensis strain KRED	NR_036886.1
825	Shigella boydii Sb227 strain Sb227	NR_074893.1
826	Shigella dysenteriae Sd197 strain Sd197	NR_074892.1
827	Shigella dysenteriae strain ATCC 13313	NR_026332.1
828	Shigella flexneri 2a str. 301 strain 301	NR_074882.1
829	Shigella flexneri strain ATCC 29903	NR_026331.1
830	Shigella sonnei Ss046 strain Ss046	NR_074894.1
831	Staphylococcus aureus subsp. anaerobius strain MVF-7	NR_036828.1
832	Staphylococcus aureus subsp. aureus JH1 strain JH1	NR_074925.1
833	Staphylococcus aureus subsp. aureus N315 strain N315	NR_075000.1
834	Staphylococcus aureus subsp. aureus strain S33 R	NR_037007.1
835	Staphylococcus epidermidis RP62A strain RP62A	NR_074995.1
836	Staphylococcus epidermidis strain Fussel	NR_036904.1
837	Staphylococcus saprophyticus subsp. bovis strain GTC 843	NR_041324.1
838	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 strain	NR_074999.1
	ATCC 15305
839	Streptococcus agalactiae strain JCM 5671	NR_040821.1
840	Streptococcus alactolyticus strain ATCC 43077; DSM 20728	NR_041781.1
841	Streptococcus anginosus strain ATCC33397	NR_041722.1
842	Streptococcus australis strain AI-1	NR_036936.1
843	Streptococcus bovis strain ATCC 33317, NCDO 597	AB002482.1
844	Streptococcus caballi strain 151	NR_044190.1
845	Streptococcus canis strain STR T1	NR_024633.1
846	Streptococcus castoreus strain: M605815/03/2	NR_042215.1
847	Streptococcus constellatus strain ATCC27823	NR_041721.1
848	Streptococcus constellatus subsp. pharyngis strain MM9889a	NR_042833.1
849	Streptococcus criceti strain ATCC19642	NR_042119.1
850	Streptococcus cristatus strain ATCC 51100	NR_042771.1
851	Streptococcus dentirousetti strain NUM 1303	NR_041460.1
852	Streptococcus devriesei strain CCUG 47156	NR_029015.1
853	Streptococcus didelphis strain W94-11374-1	NR_025036.1
854	Streptococcus downei strain ATCC 33748	NR_042774.1
855	Streptococcus dysgalactiae subsp. dysgalactiae strain ATCC 43078	NR_027517.1
856	Streptococcus dysgalactiae subsp. equisimilis strain CIP 105120	NR_043661.1
857	Streptococcus entericus strain CECT 5353	NR_025500.1
858	Streptococcus equi subsp. equi strain ATCC 33398	NR_043703.1
859	Streptococcus equi subsp. ruminatorum strain CECT 5772	NR_025609.1
860	Streptococcus equi subsp. zooepidemicus strain ATCC 43079	NR_036758.1
861	Streptococcus equinus strain ATCC 9812	NR_042052.1
862	Streptococcus ferus strain 8S1	NR_036845.1
863	Streptococcus gallinaceus strain CCUG 42692	NR_025453.1
864	Streptococcus gallolyticus subsp. gallolyticus strain ACM 3611	NR_044904.1
865	Streptococcus gallolyticus UCN34 strain UCN34	NR_074849.1
866	Streptococcus gordonii str. Challis substr. CH1 strain Challis	NR_074516.1
867	Streptococcus gordonii strain SK3	NR_028666.1
868	Streptococcus halichoeri strain M512/02/1	NR_029025.1
869	Streptococcus henryi strain 126	NR_044189.1
870	Streptococcus hyointestinalis strain ATCC 49169; DSM 20770	NR_041780.1
871	Streptococcus infantarius strain HDP90104; SLB	NR_028761.1
872	Streptococcus infantis strain ATCC 700779	NR_042928.1
873	Streptococcus iniae strain ATCC 29178	NR_025148.1
874	Streptococcus intermedius strain 1877	NR_028736.1
875	Streptococcus luteciae strain NEM 782	NR_042051.1
876	Streptococcus lutetiensis strain HDP90246	NR_037096.1
877	Streptococcus macacae strain ATCC 35911	NR_042775.1
878	Streptococcus macedonicus strain ACA-DC 198	NR_074404.1
879	Streptococcus macedonicus strain LAB617	NR_037002.1
880	Streptococcus marimammalium strain M54/01/1	NR_025630.1
881	Streptococcus massiliensis strain 4401825	NR_043173.1
882	Streptococcus merionis strain: WUE3771 = DSM 19192	NR_042553.1
883	Streptococcus minor strain ON59	NR_025729.1
884	Streptococcus mitis strain NS51	NR_028664.1
885	Streptococcus mutans strain ATCC 25175	NR_042772.1
886	Streptococcus mutans UA159 strain UA159	NR_074983.1
887	Streptococcus oligofermentans strain 2-4	NR_029052.1
888	Streptococcus oralis strain ATCC 35037	NR_042927.1
889	Streptococcus orisratti strain ATCC 700640	NR_024974.1
890	Streptococcus orisuis strain NUM 1001	NR_041055.1
891	Streptococcus ovis strain S369-98-1	NR_026471.1
892	Streptococcus parasanguinis strain ATCC 15912	NR_024842.1
893	Streptococcus parauberis strain DSM 6631	NR_043001.1
894	Streptococcus pasteurianus strain CIP 107122	NR_043660.1
895	Streptococcus peroris strain GTC848	NR_024659.1
896	Streptococcus phocae strain CCUG 35103	NR_042227.1
897	Streptococcus plurextorum strain: 1956-02	NR_042649.1
898	Streptococcus pneumoniae R6 strain R6	NR_074564.1
899	Streptococcus pneumoniae strain ATCC 33400	NR_028665.1
900	Streptococcus porcinus strain 176	NR_024634.1
901	Streptococcus pseudopneumoniae strain IS7493	NR_074987.1
902	Streptococcus pseudopneumoniae strain 108	NR_027214.1
903	Streptococcus pseudoporcinus strain LQ 940-04	NR_043704.1
904	Streptococcus pyogenes strain SF370	NR_074091.1
905	Streptococcus pyogenes strain I-273	NR_028598.1
906	Streptococcus ratti strain ATCC 19645	NR_025516.1
907	Streptococcus salivarius strain ATCC 7073	NR_042776.1
908	Streptococcus sanguinis SK36 strain SK36	NR_074974.1
909	Streptococcus sanguinis strain ATCC 10556	NR_024841.1
910	Streptococcus sinensis strain HKU4	NR_028833.1
911	Streptococcus sobrinus strain ATCC 33478	NR_042773.1
912	Streptococcus sp. strain SHV515	NR_044912.1
913	Streptococcus suis strain BM407	NR_074918.1
914	Streptococcus suis strain S735	NR_036918.1
915	Streptococcus thermophilus strain MN-ZLW-002	NR_074827.1
916	Streptococcus thermophilus strain ATCC 19258	NR_042778.1
917	Streptococcus thoraltensis strain S69	NR_026368.1
918	Streptococcus uberis strain 0140J	NR_074912.1
919	Streptococcus uberis strain JCM 5709	NR_040820.1
920	Streptococcus urinalis strain 2285-97	NR_037101.1
921	Streptococcus vestibularis strain ATCC 49124	NR_042777.1
922	Streptococcus viridans	AF076036.1
923	Streptomyces aburaviensis strain AS 4.1869	NR_043375.1
924	Streptomyces achromogenes subsp. rubradiris strain KCTC 9742	NR_043365.1
925	Streptomyces acidiscabies strain RL-110	NR_025866.1
926	Streptomyces aculeolatus strain NBRC 14824	NR_041166.1
927	Streptomyces africanus strain CPJVR-H	NR_025722.1
928	Streptomyces alanosinicus strain NBRC 13493	NR_041148.1
929	Streptomyces albaduncus strain JCM 4715	NR_043343.1
930	Streptomyces albiaxialis strain NRRL B-24327	NR_043378.1
931	Streptomyces albidochromogenes strain NBRC 101003	NR_041422.1
932	Streptomyces albidoflavus strain NBRC 13010	NR_041095.1
933	Streptomyces albiflaviniger strain: NRRL B-1356	NR_042094.1
934	Streptomyces albofaciens strain JCM 4342	NR_024760.1
935	Streptomyces alboflavus strain NRRL B-2373	NR_044151.1
936	Streptomyces albolongus strain NBRC 13465	NR_041144.1
937	Streptomyces alboniger strain DSM 40043; ATCC 12461; KCTC 9014	NR_043228.1
938	Streptomyces albospinus strain JCM 3399	NR_043342.1
939	Streptomyces albosporeus subsp. labilomyceticus strain NBRC 15387	NR_041170.1
940	Streptomyces albovinaceus strain NBRC 12739	NR_041425.1
941	Streptomyces albulus strain IMC S-0802	NR_024723.1
942	Streptomyces albus subsp. albus strain DSM 40313	NR_025615.1
943	Streptomyces albus subsp. albus strain NBRC 3418	NR_041208.1
944	Streptomyces albus subsp. pathocidicus strain NBRC 13812	NR_041152.1
945	Streptomyces alni strain D65	NR_043866.1
946	Streptomyces althioticus strain KCTC 9752	NR_043359.1
947	Streptomyces amakusaensis strain NRRL B-3351	NR_043349.1
948	Streptomyces ambofaciens strain NBRC 12836	NR_041079.1
949	Streptomyces anandii strain NBRC 13438	NR_041135.1
950	Streptomyces anthocyanicus strain NBRC 14892	NR_041168.1
951	Streptomyces antibioticus strain NRRL B-1701	NR_043348.1
952	Streptomyces antimycoticus strain NBRC 12839	NR_041080.1
953	Streptomyces anulatus strain NBRC 12755	NR_041062.1
954	Streptomyces anulatus strain NRRL B-2000	NR_043489.1
955	Streptomyces ardus strain NBRC 13430	NR_041227.1
956	Streptomyces arenae strain ISP 5293	NR_025494.1
957	Streptomyces armeniacus strain 26A-32	NR_036815.1
958	Streptomyces asiaticus strain NBRC 100774	NR_041418.1
959	Streptomyces asterosporus strain NBRC 15872	NR_041193.1
960	Streptomyces atratus strain NRRL B-16927	NR_043490.1
961	Streptomyces atroaurantiacus strain NRRL B-24282	NR_043493.1
962	Streptomyces atroolivaceus strain: LMG 19306	NR_042289.1
963	Streptomyces atrovirens strain NRRL B-16357	NR_043508.1
964	Streptomyces aurantiacus strain: LMG 19358	NR_042310.1
965	Streptomyces aurantiogriseus strain NBRC 12842	NR_041081.1
966	Streptomyces auratus strain: NRRL 8097	NR_042098.1
967	Streptomyces aureocirculatus strain IFO 13018	NR_043371.1
968	Streptomyces aureofaciens strain KACC 20180	NR_042792.1
969	Streptomyces aureorectus strain NBRC 15896	NR_041195.1
970	Streptomyces aureoverticillatus strain NRRL B-3326	NR_043346.1
971	Streptomyces aureus strain B7319	NR_025663.1
972	Streptomyces avellaneus strain NBRC 13451	NR_041138.1
973	Streptomyces avermitilis strain MA-4680	NR_074747.1
974	Streptomyces avidinii strain NBRC 13429	NR_041132.1
975	Streptomyces axinellae strain Pol001	NR_044553.1
976	Streptomyces azureus strain NRRL B-2655	NR_044136.1
977	Streptomyces bacillaris strain NBRC 13487	NR_041146.1
978	Streptomyces badius strain NRRL B-2567	NR_043350.1
979	Streptomyces bambergiensis strain NBRC 13479	NR_041230.1
980	Streptomyces bangladeshensis strain AAB-4	NR_043164.1
981	Streptomyces beijiangensis strain YIM6	NR_028825.1
982	Streptomyces bikiniensis strain DSM 40581	NR_026177.1
983	Streptomyces bingchenggensis strain BCW-1	NR_074824.1
984	Streptomyces blastmyceticus strain NRRL B-5480	NR_043357.1
985	Streptomyces bluensis strain NBRC 13460	NR_041142.1
986	Streptomyces bobili strain NBRC 13199	NR_041121.1
987	Streptomyces bottropensis strain NBRC 13023	NR_041096.1
988	Streptomyces brasiliensis strain NBRC 101283	NR_041435.1
989	Streptomyces bungoensis strain NBRC 15711	NR_041191.1
990	Streptomyces cacaoi subsp. asoensis strain NRRL B-16592	NR_043492.1
991	Streptomyces cacaoi subsp. cacaoi strain NBRC 12748	NR_041061.1
992	Streptomyces caelestis strain NRRL 2418	NR_026202.1
993	Streptomyces caeruleus strain NRRL B-2194	NR_044137.1
994	Streptomyces calvus strain NBRC 13200	NR_041122.1
995	Streptomyces canarius strain NBRC 13431	NR_041133.1
996	Streptomyces candidus strain NRRL ISP-5141	NR_043504.1
997	Streptomyces cangkringensis strain D13P3	NR_028957.1
998	Streptomyces caniferus strain NBRC 15389	NR_041171.1
999	Streptomyces canus strain NRRL B-1989	NR_043347.1
1000	Streptomyces capillispiralis strain NBRC 14222	NR_041158.1
1001	Streptomyces capoamus strain JCM 4734	NR_040856.1
1002	Streptomyces carpaticus strain NRRL B-16359	NR_043814.1
1003	Streptomyces carpinensis strain NBRC 14214	NR_041157.1
1004	Streptomyces castelarensis strain BJ-608	NR_029114.1
1005	Streptomyces catenulae strain DSM 40258	NR_025624.1
1006	Streptomyces cavourensis subsp. cavourensis strain NRRL 2740	NR_043851.1
1007	Streptomyces cellostaticus strain ISP 5189	NR_043339.1
1008	Streptomyces celluloflavus strain NBRC 13780	NR_041150.1
1009	Streptomyces cellulosae strain NRRL B-2889	NR_043815.1
1010	Streptomyces chartreusis strain NBRC 12753	NR_041216.1
1011	Streptomyces cheonanensis strain VC-A46	NR_043208.1
1012	Streptomyces chrestomyceticus strain DSM 40545	NR_025621.1
1013	Streptomyces chromofuscus strain NBRC 12851	NR_041082.1
1014	Streptomyces chryseus strain NRRL B-12347	NR_043353.1
1015	Streptomyces chrysomallus subsp. fumigatus strain NBRC 15394	NR_041172.1
1016	Streptomyces cinereorectus strain M-5	NR_037062.1
1017	Streptomyces cinereorectus strain NBRC 15395	NR_041173.1
1018	Streptomyces cinereoruber subsp. cinereoruber strain JCM 4205	NR_043345.1
1019	Streptomyces cinereoruber subsp. fructofermentans strain JCM 4956	NR_043344.1
1020	Streptomyces cinereospinus strain NBRC 15397	NR_041174.1
1021	Streptomyces cinereus strain NBRC 12247	NR_041058.1
1022	Streptomyces cinerochromogenes strain NBRC 13822	NR_041153.1
1023	Streptomyces cinnabarinus strain NBRC 13028	NR_041097.1
1024	Streptomyces cinnamonensis strain NBRC 15873	NR_041194.1
1025	Streptomyces cinnamoneus strain NBRC 12852	NR_041223.1
1026	Streptomyces cirratus strain NRRL B-3250	NR_043356.1
1027	Streptomyces ciscaucasicus strain NBRC 12872	NR_041085.1
1028	Streptomyces clavifer strain NRRL B-2557	NR_043507.1
1029	Streptomyces clavuligerus strain NRRL 3585	NR_043335.1
1030	Streptomyces coelescens strain AS 4.1594	NR_027222.1
1031	Streptomyces coelicoflavus strain NBRC 15399	NR_041175.1
1032	Streptomyces coeruleofuscus strain NRRL B-5417	NR_043506.1
1033	Streptomyces coeruleoprunus strain NBRC 15400	NR_041176.1
1034	Streptomyces coeruleorubidus strain ISP 5145	NR_043336.1
1035	Streptomyces coeruleorubidus strain NBRC 12761	NR_041217.1
1036	Streptomyces coeruleorubidus strain NBRC 12844	NR_041222.1
1037	Streptomyces coerulescens strain ISP 5146	NR_043337.1
1038	Streptomyces collinus strain NBRC 12759	NR_041063.1
1039	Streptomyces colombiensis strain NRRL B-1990	NR_043494.1
1040	Streptomyces corchorusii strain NBRC 13032	NR_041098.1
1041	Streptomyces costaricanus strain NBRC 100773	NR_041414.1
1042	Streptomyces cremeus strain JCM 4362	NR_043340.1
1043	Streptomyces crystallinus strain NBRC 15401	NR_041177.1
1044	Streptomyces cuspidosporus strain NBRC 12378	NR_041059.1
1045	Streptomyces cyaneofuscatus strain NBRC 13190	NR_041226.1
1046	Streptomyces cyaneus strain H-112	NR_037094.1
1047	Streptomyces cyanoalbus strain NBRC 12857	NR_041232.1
1048	Streptomyces daghestanicus strain NRRL B-5418	NR_043816.1
1049	Streptomyces deccanensis	NR_044183.1
1050	Streptomyces demainii strain NRRL B-1478	NR_043723.1
1051	Streptomyces diastaticus subsp. ardesiacus strain NRRL B-1773	NR_043486.1
1052	Streptomyces diastaticus subsp. diastaticus strain NBRC 3714	NR_041209.1
1053	Streptomyces diastatochromogenes strain ATCC 12309	NR_025867.1
1054	Streptomyces djakartensis strain NBRC 15409	NR_041178.1
1055	Streptomyces drozdowiczii strain NBRC 101007	NR_041424.1
1056	Streptomyces durhamensis strain NRRL B-3309	NR_043352.1
1057	Streptomyces durmitorensis strain MS405	NR_043520.1
1058	Streptomyces ederensis strain KCTC 9726	NR_043362.1
1059	Streptomyces ehimensis strain KCTC 9727	NR_043363.1
1060	Streptomyces emeiensis strain 4776	NR_043869.1
1061	Streptomyces endus strain NRRL 2339	NR_043379.1
1062	Streptomyces enissocaesilis strain NBRC 100763	NR_041411.1
1063	Streptomyces erythrogriseus strain: LMG 19406	NR_042294.1
1064	Streptomyces eurocidicus strain NRRL B-1676	NR_043355.1
1065	Streptomyces europaeiscabiei strain KACC 20186	NR_042790.1
1066	Streptomyces eurythermus strain ATCC 14975	NR_025869.1
1067	Streptomyces exfoliatus strain NBRC 13191	NR_041117.1
1068	Streptomyces exfoliatus strain NBRC 13475	NR_041229.1
1069	Streptomyces ferralitis strain SFOp68	NR_029087.1
1070	Streptomyces filamentosus strain NBRC 12767	NR_041064.1
1071	Streptomyces filipinensis strain NBRC 12860	NR_041083.1
1072	Streptomyces fimbriatus strain DSM 40942	NR_043364.1
1073	Streptomyces fimicarius strain ISP 5322	NR_043351.1
1074	Streptomyces finlayi strain NRRL B-12114	NR_043354.1
1075	Streptomyces flaveolus strain NBRC 3408	NR_041206.1
1076	Streptomyces flaveus strain NRRL B-16074	NR_043491.1
1077	Streptomyces flavidovirens strain NBRC 13039	NR_041099.1
1078	Streptomyces flavofungini strain NBRC 13371	NR_041125.1
1079	Streptomyces flavogriseus strain ATCC 33331	NR_074559.1
1080	Streptomyces flavogriseus strain CBS 101.34	NR_028988.1
1081	Streptomyces flavotricini strain NRRL B-5419	NR_043380.1
1082	Streptomyces flavovariabilis strain NRRL B-16367	NR_044146.1
1083	Streptomyces flavovirens strain NRRL B-2685	NR_043487.1
1084	Streptomyces flavoviridis strain NBRC 12772	NR_041218.1
1085	Streptomyces flocculus strain NBRC 13041	NR_041100.1
1086	Streptomyces fradiae strain NRRL B-1195	NR_043485.1
1087	Streptomyces fragilis strain NRRL 2424	NR_043381.1
1088	Streptomyces fulvissimus strain NBRC 3717	NR_041210.1
1089	Streptomyces fulvorobeus strain NBRC 15897	NR_041196.1
1090	Streptomyces fumanus strain NBRC 13042	NR_041101.1
1091	Streptomyces fumigatiscleroticus strain NRRL B-3856	NR_043817.1
1092	Streptomyces galbus strain DSM 40089	NR_026178.1
1093	Streptomyces galilaeus strain JCM 4757	NR_040857.1
1094	Streptomyces gancidicus strain NBRC 15412	NR_041179.1
1095	Streptomyces gardneri strain NBRC 3385	NR_041204.1
1096	Streptomyces gelaticus strain NRRL B-2928	NR_043488.1
1097	Streptomyces geldanamycininus strain NRRL 3602	NR_043722.1
1098	Streptomyces geysiriensis strain NRRL B-12102	NR_043818.1
1099	Streptomyces ghanaensis strain KCTC 9882	NR_043366.1
1100	Streptomyces gibsonii strain NBRC 15415	NR_041180.1
1101	Streptomyces glaucescens strain NBRC 12774	NR_041219.1
1102	Streptomyces glauciniger strain NBRC 100913	NR_041428.1
1103	Streptomyces glaucosporus strain NBRC 15416	NR_041181.1
1104	Streptomyces glaucus strain NBRC 15417	NR_041182.1
1105	Streptomyces globisporus subsp. globisporus strain NRRL B-2872	NR_044145.1
1106	Streptomyces globosus strain: LMG 19896	NR_042295.1
1107	Streptomyces glomeratus strain NBRC 15898	NR_041409.1
1108	Streptomyces glomeroaurantiacus strain NBRC 15418	NR_041436.1
1109	Streptomyces gobitricini strain NBRC 15419	NR_041183.1
1110	Streptomyces goshikiensis strain NRRL B-5428	NR_044147.1
1111	Streptomyces gougerotii strain NBRC 3198	NR_041201.1
1112	Streptomyces graminearus strain: LMG 19904	NR_042296.1
1113	Streptomyces griseiniger strain: NRRL B-1865	NR_042099.1
1114	Streptomyces griseoaurantiacus strain NBRC 15440	NR_041186.1
1115	Streptomyces griseoflavus strain: LMG 19344	NR_042291.1
1116	Streptomyces griseofuscus strain NBRC 12870	NR_041084.1
1117	Streptomyces griseoincarnatus strain: LMG 19316	NR_042290.1
1118	Streptomyces griseoloalbus strain NBRC 13046	NR_041102.1
1119	Streptomyces griseolus strain NBRC 3415	NR_041207.1
1120	Streptomyces griseoluteus strain JCM 4765	NR_043341.1
1121	Streptomyces griseomycini strain NBRC 12778	NR_041065.1
1122	Streptomyces griseoplanus strain AS 4.1868	NR_043377.1
1123	Streptomyces griseorubens strain NBRC 12780	NR_041066.1
1124	Streptomyces griseoruber strain NBRC 12873	NR_041086.1
1125	Streptomyces griseorubiginosus strain: LMG 19941	NR_042298.1
1126	Streptomyces griseosporeus strain NBRC 13458	NR_041140.1
1127	Streptomyces griseostramineus strain NBRC 12781	NR_041067.1
1128	Streptomyces griseoviridis strain KCTC 9780	NR_043358.1
1129	Streptomyces griseus strain KACC 20084	NR_042791.1
1130	Streptomyces griseus subsp. griseus strain NBRC 13350	NR_074787.1
1131	Streptomyces guanduensis strain 701	NR_043246.1
1132	Streptomyces gulbargensis strain DAS131	NR_043714.1
1133	Streptomyces hainanensis strain: YIM 47672	NR_042561.1
1134	Streptomyces halstedii strain NRRL B-1238	NR_044148.1
1135	Streptomyces hawaiiensis strain NBRC 12784	NR_041068.1
1136	Streptomyces hebeiensis strain YIM 001	NR_029091.1
1137	Streptomyces heliomycini strain NBRC 15899	NR_041197.1
1138	Streptomyces helvaticus strain NBRC 13382	NR_041127.1
1139	Streptomyces herbaricolor strain NBRC 3838	NR_041212.1
1140	Streptomyces himastatinicus strain ATCC 53653	NR_044201.1
1141	Streptomyces hiroshimensis strain NBRC 3720	NR_041211.1
1142	Streptomyces hirsutus strain NRRL B-2713	NR_043819.1
1143	Streptomyces humidus strain NRRL B-3172	NR_043820.1
1144	Streptomyces humiferus strain DSM 43030	NR_025250.1
1145	Streptomyces hygroscopicus strain NRRL 1346	NR_044200.1
1146	Streptomyces hygroscopicus strain NRRL B-5491	NR_044199.1
1147	Streptomyces hygroscopicus subsp. angustmyceticus strain NRRL B-	NR_043821.1
	2347
1148	Streptomyces hygroscopicus subsp. decoyicus strain AS 4.1861	NR_043374.1
1149	Streptomyces hygroscopicus subsp. glebosus strain NBRC 13786	NR_041151.1
1150	Streptomyces hygroscopicus subsp. hygroscopicus strain NBRC 13472	NR_041145.1
1151	Streptomyces hygroscopicus subsp. jinggangensis strain 5008	NR_074563.1
1152	Streptomyces hygroscopicus subsp. ossamyceticus strain NBRC 13983	NR_041156.1
1153	Streptomyces hypolithicus strain HSM#10	NR_044431.1
1154	Streptomyces iakyrus strain NBRC 13401	NR_041231.1
1155	Streptomyces indiaensis strain NBRC 13964	NR_041155.1
1156	Streptomyces indigoferus strain NBRC 12878	NR_041087.1
1157	Streptomyces indonesiensis strain DSM 41759; A4R2	NR_043724.1
1158	Streptomyces intermedius strain NBRC 13049	NR_041103.1
1159	Streptomyces inusitatus strain NBRC 13601	NR_041149.1
1160	Streptomyces ipomoeae strain NBRC 13050	NR_041225.1
1161	Streptomyces javensis strain B22P3	NR_028958.1
1162	Streptomyces jietaisiensis strain FXJ46	NR_042836.1
1163	Streptomyces kanamyceticus strain NRRL B-2535	NR_043822.1
1164	Streptomyces kasugaensis strain M338-M1	NR_024724.1
1165	Streptomyces katrae strain NBRC 13447	NR_041136.1
1166	Streptomyces koyangensis strain VK-A60	NR_025662.1
1167	Streptomyces kunmingensis strain NRRL B-16240	NR_043823.1
1168	Streptomyces kurssanovii strain NBRC 13192	NR_041118.1
1169	Streptomyces labedae strain NBRC 15864	NR_041192.1
1170	Streptomyces lanatus strain NBRC 12787	NR_041220.1
1171	Streptomyces lateritius strain: LMG 19372	NR_042293.1
1172	Streptomyces laurentii strain: LMG 19959	NR_042299.1
1173	Streptomyces lavendofoliae strain: LMG 19935	NR_042297.1
1174	Streptomyces lavenduligriseus strain NRRL B-3173	NR_043824.1
1175	Streptomyces lavendulocolor strain NRRL B-3367	NR_043825.1
1176	Streptomyces levis strain NBRC 15423	NR_041184.1
1177	Streptomyces libani subsp. libani strain NBRC 13452	NR_041139.1
1178	Streptomyces libani subsp. rufus strain: LMG 20087	NR_042301.1
1179	Streptomyces lienomycini strain: LMG 20091	NR_042302.1
1180	Streptomyces lilacinus strain NBRC 3944	NR_041215.1
1181	Streptomyces lincolnensis strain NBRC 13054	NR_041104.1
1182	Streptomyces litmocidini strain NBRC 12792	NR_041069.1
1183	Streptomyces lomondensis strain NBRC 15426	NR_041185.1
1184	Streptomyces longispororuber strain NBRC 13488	NR_041147.1
1185	Streptomyces longisporus strain ISP 5166	NR_025492.1
1186	Streptomyces longwoodensis strain NBRC 14251	NR_041161.1
1187	Streptomyces lucensis strain NRRL B-5626	NR_043827.1
1188	Streptomyces lunalinharesii strain RCQ1071	NR_043541.1
1189	Streptomyces luridiscabiei strain S63	NR_025155.1
1190	Streptomyces luridus strain NRRL B-5409	NR_043828.1
1191	Streptomyces lusitanus strain NBRC 13464	NR_041143.1
1192	Streptomyces luteireticuli strain NBRC 13422	NR_041431.1
1193	Streptomyces luteogriseus strain NBRC 13402	NR_041128.1
1194	Streptomyces luteosporeus strain NRRL 2401	NR_043829.1
1195	Streptomyces lydicus strain ATCC 25470	NR_026444.1
1196	Streptomyces macrosporus strain A1201	NR_026530.1
1197	Streptomyces malachitofuscus strain NBRC 13059	NR_041105.1
1198	Streptomyces malachitospinus strain NBRC 101004	NR_041423.1
1199	Streptomyces malaysiensis strain NBRC 16446	NR_041410.1
1200	Streptomyces mashuensis strain DSM40221	NR_026174.1
1201	Streptomyces massasporeus strain NBRC 12796	NR_041070.1
1202	Streptomyces matensis strain NBRC 12889	NR_041088.1
1203	Streptomyces mauvecolor strain NBRC 13854	NR_041154.1
1204	Streptomyces mayteni strain YIM 60475	NR_044434.1
1205	Streptomyces megasporus strain NBRC 14749	NR_041165.1
1206	Streptomyces melanogenes strain NBRC 12890	NR_041089.1
1207	Streptomyces melanosporofaciens strain NRRL B-12234	NR_028917.1
1208	Streptomyces mexicanus strain NBRC 100915	NR_041429.1
1209	Streptomyces michiganensis strain NBRC 12797	NR_041071.1
1210	Streptomyces microflavus strain NRRL B-2156	NR_043854.1
1211	Streptomyces minutiscleroticus strain NRRL B-12202	NR_044149.1
1212	Streptomyces mirabilis strain NBRC 13450	NR_041137.1
1213	Streptomyces misakiensis strain IFO 12891	NR_041308.1
1214	Streptomyces misionensis strain NRRL B-3230	NR_044138.1
1215	Streptomyces mobaraensis strain NRRL B-3729	NR_043830.1
1216	Streptomyces monomycini strain NRRL B-24309	NR_043850.1
1217	Streptomyces morookaensis strain: LMG 20074	NR_042300.1
1218	Streptomyces murinus strain NBRC 12799	NR_041072.1
1219	Streptomyces mutabilis strain NRRL ISP-5169	NR_044139.1
1220	Streptomyces mutomycini strain NBRC 100999	NR_041421.1
1221	Streptomyces naganishii strain NRRL B-1816	NR_043831.1
1222	Streptomyces nanshensis strain SCSIO 01066	NR_044534.1
1223	Streptomyces narbonensis strain NRRL B-1680	NR_043853.1
1224	Streptomyces nashvillensis strain NBRC 13064	NR_041106.1
1225	Streptomyces neyagawaensis strain ATCC 27449	NR_025868.1
1226	Streptomyces niger strain DSM 43049	NR_025619.1
1227	Streptomyces nigrescens strain NRRL B-12176	NR_043832.1
1228	Streptomyces nitrosporeus strain NRRL B-1316	NR_044140.1
1229	Streptomyces niveiscabiei strain S78	NR_037095.1
1230	Streptomyces niveoruber strain NRRL B-2724	NR_043855.1
1231	Streptomyces noboritoensis strain NBRC 13065	NR_041107.1
1232	Streptomyces nodosus strain ATCC14899	NR_041730.1
1233	Streptomyces nogalater strain TT2-9	NR_041316.1
1234	Streptomyces nojiriensis strain: LMG 20094	NR_042303.1
1235	Streptomyces noursei strain NBRC 15452	NR_041187.1
1236	Streptomyces novaecaesareae strain NBRC 13368	NR_041124.1
1237	Streptomyces ochraceiscleroticus strain NBRC 12394	NR_041060.1
1238	Streptomyces odorifer strain DSM 40347	NR_026535.1
1239	Streptomyces olivaceiscleroticus strain DSM 40595	NR_025618.1
1240	Streptomyces olivaceoviridis strain NBRC 13066	NR_041108.1
1241	Streptomyces olivaceus strain NBRC 3200	NR_041202.1
1242	Streptomyces olivochromogenes strain DSM 40451	NR_025664.1
1243	Streptomyces olivoverticillatus strain NBRC 15273	NR_041169.1
1244	Streptomyces omiyaensis strain NRRL B-1587	NR_044150.1
1245	Streptomyces orinoci strain NBRC 13466	NR_041228.1
1246	Streptomyces pactum strain NBRC 13433	NR_041134.1
1247	Streptomyces paradoxus strain NBRC 14887	NR_041167.1
1248	Streptomyces parvulus strain NBRC 13193	NR_041119.1
1249	Streptomyces parvus strain NRRL B-1455	NR_043833.1
1250	Streptomyces paucisporeus strain 1413	NR_043247.1
1251	Streptomyces peucetius strain JCM 9920	NR_024763.1
1252	Streptomyces phaeochromogenes strain NBRC 3180	NR_041200.1
1253	Streptomyces phaeofaciens strain NBRC 13372	NR_041126.1
1254	Streptomyces phaeogriseichromatogenes strain: NRRL 2834	NR_042095.1
1255	Streptomyces phaeoluteichromatogenes strain: NRRL B-5799	NR_042096.1
1256	Streptomyces phaeoluteigriseus strain: ISP 5182	NR_042097.1
1257	Streptomyces phaeopurpureus strain NRRL B-2260	NR_043505.1
1258	Streptomyces pharetrae strain CZA14	NR_043130.1
1259	Streptomyces pilosus strain NBRC 12807	NR_041073.1
1260	Streptomyces platensis strain JCM 4662	NR_024761.1
1261	Streptomyces plicatus strain NRRL 2428	NR_043382.1
1262	Streptomyces plumbiresistens strain CCNWHX 13-160	NR_044518.1
1263	Streptomyces pluricolorescens strain NRRL B-2121	NR_043834.1
1264	Streptomyces polyantibioticus strain SPR; DSM 44925	NR_043573.1
1265	Streptomyces polychromogenes strain NBRC 13072	NR_041109.1
1266	Streptomyces poonensis strain NRRL B-2319	NR_043852.1
1267	Streptomyces prasinopilosus strain NBRC 12809	NR_041430.1
1268	Streptomyces prasinosporus strain NBRC 13419	NR_041130.1
1269	Streptomyces prasinus strain NRRL B-2712	NR_043500.1
1270	Streptomyces prunicolor strain NRRL B-12281	NR_043501.1
1271	Streptomyces psammoticus strain IFO 13971	NR_043372.1
1272	Streptomyces pseudogriseolus strain NRRL B-3288	NR_043835.1
1273	Streptomyces pseudovenezuelae strain NBRC 12904	NR_041090.1
1274	Streptomyces pulveraceus strain NBRC 3855	NR_041213.1
1275	Streptomyces puniceus strain NRRL B-2895	NR_043836.1
1276	Streptomyces puniciscabiei strain S77	NR_025156.1
1277	Streptomyces purpeofuscus strain: LMG 20283	NR_042304.1
1278	Streptomyces purpurascens strain NBRC 12831	NR_041221.1
1279	Streptomyces purpurascens strain NBRC 12879	NR_041224.1
1280	Streptomyces purpureus strain: LMG 19368	NR_042292.1
1281	Streptomyces purpurogeneiscleroticus strain DSM 43156	NR_025616.1
1282	Streptomyces racemochromogenes strain NRRL B-5430	NR_043499.1
1283	Streptomyces radiopugnans strain R97	NR_044013.1
1284	Streptomyces rameus strain KCTC 9767	NR_043361.1
1285	Streptomyces ramulosus strain NRRL B-2714	NR_043503.1
1286	Streptomyces rangoonensis strain NBRC 13078	NR_041110.1
1287	Streptomyces recifensis strain NBRC 12813	NR_041074.1
1288	Streptomyces rectiviolaceus strain NRRL B-16374	NR_043502.1
1289	Streptomyces regensis strain NRRL B-11479	NR_043495.1
1290	Streptomyces reticuliscabiei strain CFBP 4531	NR_025293.1
1291	Streptomyces rhizosphaericus strain NBRC 100778	NR_041415.1
1292	Streptomyces rimosus subsp. paromomycinus strain DSM 41429	NR_025622.1
1293	Streptomyces rimosus subsp. rimosus strain JCM 4667	NR_024762.1
1294	Streptomyces rishiriensis strain NRRL B-3239	NR_044141.1
1295	Streptomyces rochei strain NBRC 12908	NR_041091.1
1296	Streptomyces roseiscleroticus strain NBRC 13002	NR_041094.1
1297	Streptomyces roseofulvus strain NBRC 13194	NR_041120.1
1298	Streptomyces roseolilacinus strain NBRC 12815	NR_041075.1
1299	Streptomyces roseolus strain NBRC 12816	NR_041076.1
1300	Streptomyces roseoviolaceus strain ISP 5277	NR_025493.1
1301	Streptomyces roseoviridis strain NBRC 12911	NR_041092.1
1302	Streptomyces ruber strain NBRC 14600	NR_041163.1
1303	Streptomyces rubidus strain 13C15	NR_043245.1
1304	Streptomyces rubiginosohelvolus strain NBRC 12912	NR_041093.1
1305	Streptomyces rubiginosus strain KCTC 9042	NR_043360.1
1306	Streptomyces rubrogriseus strain NBRC 15455	NR_041188.1
1307	Streptomyces rutgersensis strain NBRC 12819	NR_041077.1
1308	Streptomyces sampsonii strain ATCC 25495	NR_025870.1
1309	Streptomyces sanglieri strain NBRC 100784	NR_041417.1
1310	Streptomyces sannanensis strain NBRC 14239	NR_041160.1
1311	Streptomyces scabiei 87.22 strain 87.22	NR_074848.1
1312	Streptomyces scabiei strain RL-34	NR_025865.1
1313	Streptomyces scabrisporus strain KM-4927	NR_028613.1
1314	Streptomyces sclerotialus strain DSM 43032	NR_025620.1
1315	Streptomyces scopiformis strain A25	NR_028764.1
1316	Streptomyces sedi strain YIM 65188	NR_044582.1
1317	Streptomyces seoulensis strain NBRC 16668	NR_041432.1
1318	Streptomyces showdoensis strain NBRC 13417	NR_041129.1
1319	Streptomyces sindenensis strain NBRC 3399	NR_041205.1
1320	Streptomyces sioyaensis strain NRRL B-5408	NR_043498.1
1321	Streptomyces sodiiphilus strain YIM 80305	NR_042799.1
1322	Streptomyces somaliensis strain DSM 40738	NR_025292.1
1323	Streptomyces sp. 40003 strain 40003	NR_042760.1
1324	Streptomyces sp. SirexAA-E strain SirexAA-E	NR_074561.1
1325	Streptomyces sp. strain ISP 5133	NR_042100.1
1326	Streptomyces sp. strain ISP 5310	NR_042101.1
1327	Streptomyces sp. strain ISP 5499	NR_042102.1
1328	Streptomyces sparsogenes strain NBRC 13086	NR_041111.1
1329	Streptomyces specialis strain: GW41-1564	NR_042689.1
1330	Streptomyces speibonae strain PK-Blue	NR_025212.1
1331	Streptomyces spinoverrucosus strain NBRC 14228	NR_041159.1
1332	Streptomyces spiralis strain NRRL B-16922	NR_044142.1
1333	Streptomyces spiroverticillatus strain NBRC 3931	NR_041214.1
1334	Streptomyces sporocinereus strain NBRC 100766	NR_041412.1
1335	Streptomyces sporoclivatus strain NBRC 100767	NR_041413.1
1336	Streptomyces spororaveus strain: LMG 20313	NR_042306.1
1337	Streptomyces sporoverrucosus strain NRRL B-16379	NR_043837.1
1338	Streptomyces stelliscabiei strain CFBP 4521	NR_025294.1
1339	Streptomyces stramineus strain NBRC 16131	NR_041198.1
1340	Streptomyces subrutilus strain DSM 40445	NR_026203.1
1341	Streptomyces sulfonofaciens strain NBRC 14260	NR_041433.1
1342	Streptomyces sulphureus strain NRRL B-1627	NR_043838.1
1343	Streptomyces synnematoformans strain S155	NR_044098.1
1344	Streptomyces tanashiensis strain IFO 12919	NR_043369.1
1345	Streptomyces tauricus strain JCM 4837	NR_028621.1
1346	Streptomyces tendae strain ATCC 19812	NR_025871.1
1347	Streptomyces termitum strain NBRC 13087	NR_041112.1
1348	Streptomyces thermoalcalitolerans strain NBRC 16322	NR_041408.1
1349	Streptomyces thermocarboxydovorans strain AT52	NR_026071.1
1350	Streptomyces thermocarboxydus strain AT37	NR_026072.1
1351	Streptomyces thermocoprophilus strain B19	NR_025291.1
1352	Streptomyces thermodiastaticus strain JCM 4840	NR_036816.1
1353	Streptomyces thermogriseus strain NBRC 100772	NR_041434.1
1354	Streptomyces thermolineatus strain A1484	NR_026529.1
1355	Streptomyces thermospinosisporus strain AT10	NR_025147.1
1356	Streptomyces thermoviolaceus subsp. thermoviolaceus strain DSM 40443	NR_027616.1
1357	Streptomyces thermovulgaris strain R10	NR_026528.1
1358	Streptomyces thioluteus strain NBRC 3364	NR_041203.1
1359	Streptomyces torulosus strain: LMG 20305	NR_042305.1
1360	Streptomyces toxytricini strain NRRL B-5426	NR_043839.1
1361	Streptomyces tricolor strain NBRC 15461	NR_041189.1
1362	Streptomyces tritolerans strain DAS 165	NR_043745.1
1363	Streptomyces tubercidicus strain DSM 40261	NR_025623.1
1364	Streptomyces tuirus strain NBRC 15617	NR_041190.1
1365	Streptomyces turgidiscabies strain ATCC 700248	NR_040828.1
1366	Streptomyces umbrinus strain NBRC 13091	NR_041113.1
1367	Streptomyces variabilis strain NRRL B-3984	NR_043840.1
1368	Streptomyces variegatus strain: LMG 20315	NR_042307.1
1369	Streptomyces varsoviensis strain NRRL B-3589	NR_043497.1
1370	Streptomyces vastus strain NRRL B-12232	NR_043841.1
1371	Streptomyces venezuelae strain JCM 4526	NR_024764.1
1372	Streptomyces vietnamensis strain GIMV4.0001	NR_043710.1
1373	Streptomyces vinaceus strain NBRC 13425	NR_041131.1
1374	Streptomyces vinaceusdrappus strain NRRL 2363	NR_043383.1
1375	Streptomyces violaceochromogenes strain IFO 13100	NR_043373.1
1376	Streptomyces violaceolatus strain DSM 40438	NR_027223.1
1377	Streptomyces violaceorectus strain NBRC 13102	NR_041114.1
1378	Streptomyces violaceoruber strain DSM 40049	NR_041914.1
1379	Streptomyces violaceorubidus strain: LMG 20319	NR_042309.1
1380	Streptomyces violaceus strain NBRC 13103	NR_041115.1
1381	Streptomyces violaceusniger strain NBRC 13459	NR_041141.1
1382	Streptomyces violaceusniger strain Tu 4113	NR_074570.1
1383	Streptomyces violarus strain NBRC 13104	NR_041116.1
1384	Streptomyces violascens strain ISP 5183	NR_043338.1
1385	Streptomyces violens strain DSM 40597	NR_025617.1
1386	Streptomyces virens strain NRRL B-24331	NR_043842.1
1387	Streptomyces virginiae strain NBRC 12827	NR_041078.1
1388	Streptomyces viridiviolaceus strain IFO 13359	NR_043368.1
1389	Streptomyces viridobrunneus strain: LMG 20317	NR_042308.1
1390	Streptomyces viridochromogenes strain NRRL B-1511	NR_043843.1
1391	Streptomyces viridodiastaticus strain IFO 13106	NR_043367.1
1392	Streptomyces viridosporus strain NRRL 2414	NR_043844.1
1393	Streptomyces vitaminophilus strain NBRC 14294	NR_041162.1
1394	Streptomyces wedmorensis strain NRRL 3426	NR_043845.1
1395	Streptomyces werraensis strain NRRL B-5317	NR_043846.1
1396	Streptomyces xanthochromogenes strain NRRL B-5410	NR_043847.1
1397	Streptomyces xanthocidicus strain IFO 13469	NR_043370.1
1398	Streptomyces xantholiticus strain NBRC 13354	NR_041123.1
1399	Streptomyces xanthophaeus strain NRRL B-5414	NR_043848.1
1400	Streptomyces xiamenensis strain MCCC 1A01550	NR_044035.1
1401	Streptomyces yanglinensis strain 1307	NR_043244.1
1402	Streptomyces yanii strain IFO 14669	NR_040781.1
1403	Streptomyces yatensis strain NBRC 101000	NR_041427.1
1404	Streptomyces yeochonensis strain CN 732	NR_024953.1
1405	Streptomyces yerevanensis strain NRRL B-16943	NR_044143.1
1406	Streptomyces yogyakartensis strain NBRC 100779	NR_041416.1
1407	Streptomyces yokosukanensis strain NRRL B-3353	NR_043496.1
1408	Streptomyces yunnanensis strain YIM 41004	NR_025149.1
1409	Streptomyces zaomyceticus strain NRRL B-2038	NR_044144.1
1410	Vibrio alginolyticus strain ATCC 17749	NR_044825.1
1411	Vibrio cholerae bv. albensis strain ATCC 14547; RC782	NR_044050.1
1412	Vibrio cholerae O1 biovar El Tor strain N16961	NR_074810.1
1413	Vibrio cholerae strain O395	NR_074816.1
1414	Vibrio cholerae strain CECT 514	NR_044853.1
1415	Vibrio fluvialis strain VL 5125	NR_036790.1
1416	Vibrio metschnikovii strain Fowl	NR_029258.1
1417	Vibrio mimicus strain 1721-77	NR_029259.1
1418	Vibrio parahaemolyticus strain ATCC 17802	NR_041838.1
1419	Vibrio vulnificus CMCP6 strain CMCP6	NR_074889.1
1420	Vibrio vulnificus strain 324	NR_036888.1
1421	Yersinia enterocolitica strain ATCC 9610	NR_041832.1
1422	Yersinia enterocolitica subsp. enterocolitica strain 8081	NR_074308.1
1423	Yersinia pestis KIM10+ strain KIM	NR_075053.1
1424	Yersinia pestis strain NCTC 5923	NR_025160.1
1425	Yersinia pseudotuberculosis strain IP 32953	NR_074202.1
1426	Yersinia pseudotuberculosis strain ATCC 29833	NR_025158.1
1427	Escherichia coli	NR_074891.1
1428	Staphylococcus epidermidis RP62A strain RP62A	NR_074995.1
1429	Staphylococcus haemolyticus	NR_074994.1
1430	Stenotrophomonas maltophila	NR_074875.1

2.2 Further Classification of Mammalian (e.g., Human) Sepsis-Causing Bacteria Using SNPs in 16S rRNA