Methods and compositions for diagnosing and treating rheumatoid arthritis

[0001] This application claims the benefit of U.S. Provisional Application No. 60/255,861, filed Dec. 15, 2000, the contents of which are specifically incorporated by reference herein.

[0002] Inflammatory reactions are the cause of a significant number of diseases or disorders, some of which lack appropriate methods of treatment. For example, rheumatoid arthritis (R.A.) is a systematic inflammatory disease that commonly affects the joints, particularly those of the hands and feet. The onset of rheumatoid arthritis can occur slowly, ranging from a few weeks to a few months, or the condition can surface rapidly in an acute manner.

[0003] Today, over 2,500,000 individuals are diagnosed with rheumatoid arthritis in the United States alone (1% of population), with some statistics indicating from 6.5 to 8 million potentially afflicted with the disease. Women are affected 2-3 times more often than men. The disease can occur at any age and typically will increase in incidence with age. The classic early symptoms of rheumatoid arthritis include stiffness, tenderness, fever, subcutaneous nodules, achy joints, and fatigue. The joints of the hands, feet, knees and wrists are most commonly affected, with eventual involvement of the hips, elbows and shoulders. As the joints stiffen and swell, any type of motion becomes very painful and difficult. The more severe cases of rheumatoid arthritis can lead to intense pain and eventual joint destruction. Some 300,000 bone and joint replacement surgical procedures are performed annually in an effort to alleviate the pain and mobility loss resultant from arthritis related joint destruction.

[0004] The effective treatment of rheumatoid arthritis has generally comprised a combination of medication, exercise, rest and proper joint protection therapy. The therapy for a particular patient depends on the severity of the disease and the joints that are involved. Aspirin is widely used for pain and to reduce inflammation. In addition to aspirin, non-steroidal anti-inflammatory drugs, corti-costeroids, gold salts, anti-malarials and systemic immunosuppressants are widely used in moderate to advanced cases. The use of steroids and immunosuppressants, however, has significant risks and side effects both in terms of toxicity and vulnerability to potentially lethal conditions.

[0005] There, thus exists a need for methods of diagnosing and treating inflammatory diseases, e.g., rheumatoid arthritis, which do not entail the potentially lethal side effects associated with the treatments described above.

[0006] In one embodiment, the invention provides diagnostic methods, composition and devices for monitoring and/or predicting the existence, development and/or evolution of R.A. in a subject. Preferred methods comprise determining levels of expression of one or more genes characteristic of R.A. in a cell and comparing these to the levels of expression of these genes in other cells.

[0007] Comparison of the expression levels can be performed visually. In a preferred embodiment, the comparison is performed by a computer. In one embodiment, expression levels of genes characteristic of R.A. in cells of subjects having R.A. are stored in a computer. The computer may optionally comprise expression levels of these genes in normal cells. The data representing expression levels of the genes in a patient being diagnosed are then entered into the -computer, and compared with one or more of the expression levels stored in the computer. The computer calculates differences and presents data showing the differences in expression of the genes in the two types of cells.

[0008] Accordingly, in one embodiment, the invention provides computer-readable media comprising a plurality of digitally encoded values representing the levels of expression of a plurality of genes which are up- or down-regulated in R.A. in a cell characteristic of R.A. In one embodiment, a computer-readable medium includes values representing levels of expression of one or more genes encoding kinases, phosphatases or genes which are located on chromosome 6, region p21.3, such as those highligheted in the Tables. In another embodiment, the computer-readable medium comprises values of levels of expression of a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); serum amyloid (SAA) 1-3; HMG-1; S100 A8, A9, and A12; Secretory Leukocyte Protease Inhibitor (SLPI); glucocorticoid leucine zipper (GILZ); PTPN-18; GADD-45A and B; Legumain (PRSC1); follistatin-like 1 (FST1); lipocalin 2 (Lcn2); glucose phosphate isomerase (GPI); Serine Protease Inhibitor (SpiL); and TSG-6. In a preferred embodiment, a computer-readable medium comprises values representing levels of expression of at least 5 of these genes. In another embodiment, a computer-readable medium comprises the levels of expression of at least 10 genes characteristic of R.A. in a cell characteristic of R.A. A computer-readable medium may also comprise values representing levels of expression of at least 50% of the genes set forth in Tables 1-5. Optionally, a computer-readable medium further comprises at least one value representing a level of expression of at least one gene characteristic of R.A. in a normal counterpart cell. The values on a computer-readable medium may represent ratios of, or differences between, a level of expression of a gene characteristic of R.A. in a cell characteristic of R.A. and a level of expression of the gene in a normal counterpart cell. In a preferred embodiment, less than about 50% of the values on the computer-readable medium represent expression levels of genes which are not characteristic of R.A.

[0009] The invention also provides computer systems, comprising a database comprising values representing expression levels of a plurality of genes which are up- or down-regulated in R.A., and including, e.g., one or more genes highlighted or marked with a star in the Tables, e.g., one or a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6, in a cell characteristic of R.A.; and, a processor having instructions to, (i) receive at least one query value representing at least one level of expression of at least one gene represented in the database, and, (ii) compare the at least one query value and the at least one database value. The instructions to receive may include instructions to provide a user interface. The instructions may further include instructions to display at least one comparison and/or to create at least one record based on the comparison. The computer system may further including instructions to display the at least one record.

[0010] Also provided by the invention are computer programs for analyzing levels of expression of a plurality of genes characteristic of R.A. in a cell, the computer program being disposed on a computer readable medium and including instructions for causing a processor to (i) receive query values representing levels of expression of a plurality of genes characteristic of R.A. in a cell, and, (ii) compare the query values with levels of expression of the plurality of genes in a cell characteristic of R.A. The computer program may further comprise instructions to display at least one comparison. The instructions to compare may include instructions to retrieve the at least one level expression value from a computer readable medium and/or from a database. The instructions to receive may include instructions to provide a user interface.

[0011] In another embodiment, the invention provides computer programs for analyzing an expression profile of a cell characteristic of R.A. in a subject, the computer programs being disposed on a computer readable medium and including instructions for causing a processor to (i) receive at least one query expression profiles comprising a plurality of values, each value representing a level of expression of a gene characteristic of R.A. in a cell characteristic of R.A., and, (ii) compare the at least one query expression profile and at least one reference expression profile comprising a plurality of values, each value representing a level of expression of a gene characteristic of R.A. in a particular cell.

[0012] Also within the scope of the invention are compositions, such as compositions comprising a plurality of detection agents of genes which are up- or down-regulated in R.A., e.g., one or more genes highlighted or marked with a star in the Tables, e.g., one or a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S1OO A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6, which are capable of detecting the expression of the genes or the polypeptide encoded by the genes, and wherein less than about 50% of the detection agents are genes which are not characteristic of R.A. The detection agents may be isolated nucleic acids which hybridize specifically to nucleic acids corresponding to the genes. Compositions may comprise isolated nucleic acids which hybridize specifically to at least five genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6. In another embodiment, a composition may comprise isolated nucleic acids which hybridize specifically to at least 10 or 100 different genes characteristic of R.A. The detection agents may also detect the polypeptides encoded by the genes and may be, e.g., antibodies.

[0013] The invention also provides solid surfaces to which are linked a plurality of detection agents of genes which are up- or down-regulated in R.A., e.g., one or more genes highlighted or marked with a star in the Tables, e.g., one or a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6, which detection agents are capable of detecting the expression of the genes or the polypeptide encoded by the genes, and wherein less than about 50% of the detection agents on the solid surface are not detecting genes characteristic of R.A. The detection agents may be isolated nucleic acids which hybridize specifically to the genes. The detection agents may be covalently linked to the solid surface.

[0014] Other compositions provided by the invention include compositions, such as pharmaceutical compositions comprising agonists or antagonists of a plurality of genes characteristic of R.A., such as antagonists of one or a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSCl); FST1; Lcn2; GPI; SpiL; and TSG-6. Agonists may be polypeptides encoded by the genes or functional fragments or equivalents thereof, which may be fused to a transcytosis polypeptide. Agonists may also be genes encoding the polypeptides and the nucleic acids may be in one or more expression vectors. Antagonists may be antisense nucleic acids, siRNAs, ribozymes or dominant negative mutants.

[0015] The invention provides methods for determining the difference between levels of expression of a one or a plurality of genes characteristic of R.A. in a cell and reference levels of expression of the genes, comprising (i) providing RNA from a cell; (ii) determining levels of RNA of a plurality of genes genes which are up- or down-regulated in R.A., e.g., one or more genes highlighted or marked with a star in the Tables, e.g., one or a plurality of genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6 to obtain the levels of expression of the plurality of genes in the cell; and (iii) comparing the levels of expression of the plurality of genes in the cell to a set of reference levels of expression of the genes, to thereby determine the difference between levels of expression of the plurality of genes characteristic of R.A. in the cell and reference levels of expression of the genes. The set of reference levels of expression may include the levels of expression of the genes in a subject having R.A. The set of reference levels of expression may further include the levels of expression of the genes in a subject who does not have R.A. The method may comprise incubating a nucleic acid sample derived from the RNA of the cell of the subject with nucleic acids corresponding to the genes, under conditions wherein two complementary nucleic acids hybridize to each other. The nucleic acids corresponding to the genes may be attached to a solid surface. The method may comprise entering the levels of expression of the plurality of genes into a computer which comprises a memory with values representing the set of reference levels of expression. Comparing the level may comprise providing computer instructions to perform.

[0016] The invention provides methods for determining whether a subject has or is likely to develop R.A., comprising obtaining a cell from the subject and comparing gene expression levels in the cell to those of a set of reference levels of expression, e.g., as described above, wherein similar levels of expression of the plurality of genes indicates that the subject has or is likely to develop R.A. In a preferred embodiment, the cell is a peripheral blood mononuclear cell (PBMC) and the set of reference levels of expression includes the levels of expression of the genes in a PBMC of a subject having R.A. The cell may be a PBMC and the set of reference levels of expression includes the average of levels of expression of the genes in a PBMC of a plurality of subjects having R.A. The method may further comprising iteratively providing RNA from the subject and determining the level of RNA, such as to determine an evolution of the levels of expression of the genes in the subject.

[0017] Also within the scope of the invention are methods for determining whether a therapy for R.A. is effective in a subject having R.A. who is receiving the therapy. In a exemplary embodiment, the method comprises obtaining a cell from the subject and comparing levels of expression in the cell of the subject to those in subjects having R.A. and in subjects who do not have R.A., e.g., as described above, wherein levels of expression in the cell of the subject that are more similar to those of the subject having R.A. than the subject who does not have R.A. indicates that the therapy is not effective, whereas levels of expression in the cell of the subject that are more similar to those of the subject not having R.A. than the subject having R.A. indicates that the therapy is effective. The set of reference levels of expression may be in the form of a database. The database may be included in a computer-readable medium. The database may be in communications with a microprocessor and microprocessor instructions for providing a user interface to receive expression level data of a subject and to compare the expression level data with the database. In a particular embodiment, the method comprises (i) obtaining a patient sample from a caregiver; (ii) identifying expression levels of a plurality of genes characteristic of R.A. from the patient sample; (iii) determining whether the levels of expression of the genes in the patient sample are more similar to those of a subject having R.A. or to those of a subject who does not have R.A.; and (iv) transmitting the results to the caregiver. The results may be transmitted across a network.

[0018] In yet another embodiment, the invention provides methods for identifying a compound for treating R.A. The method comprises, e.g., (i) providing levels of expression of a plurality of genes characteristic of R.A. in a cell characteristic of R.A. incubated with a test compound; (ii) providing levels of expression of a normal counterpart cell; and (iii) comparing the two levels of expression, wherein similar levels of expression in the two cells indicates that the compound is likely to be effective for treating R.A.

[0019] Other methods provided by the invention include methods for selecting a therapy for a patient having R.A. For example, the method may comprise (i) providing at least one query value corresponding to the level of expression of at least one gene characteristic of R.A. from a patient having R.A.; (ii) providing a plurality of sets of reference values corresponding to levels of expression of at least one gene characteristic of R.A., each reference value being associated with a therapy; and (iii) selecting the reference values most similar to the query values, to thereby select a therapy for said patient. Selecting may further include weighing a comparison value for the reference values using a weight value associated with each reference values. The method may further comprise administering the therapy to the patient. The query values and the sets of reference values may be expression profiles. Another exemplary method comprises (i) providing a plurality of reference expression profiles, each associated with a therapy; (ii) providing a labeled target nucleic acid sample prepared from RNA of a diseased cell of the patient; (iii) contacting the labeled target nucleic acid sample with an array comprising probes corresponding to genes which are up- or down-regulated in R.A. to obtain an expression profile of the patient; and selecting the reference profile most similar to the expression profile of the patient, to thereby select a therapy for the patient.

[0020] The invention also provides therapeutic methods for treating R.A., including methods which normalize the expression level of one or more genes characteristic of R.A. in a subject diagnosed with R.A. Normalization of the level of expression of a gene refers to a change in the expression level of the gene such that its level of its expression resembles more that of a non-diseased (i.e., normal) cell than that of a diseased cell. Such methods may include administering to a subject having R.A. a phamarceutically efficient amount of an agonist or antagonist of one or more genes characteristic of R.A.

[0021] Also within the scope of the invention are diagnostic or drug discovery kits, comprising one or more computer-readable media, compositions and/or solid surfaces described herein, and optionally instructions for use.

[0022] The invention is based at least in part on the discovery of gene expression profiles of cells of subjects having R.A. As described in the Examples and in Tables 1-5, cells from R.A. subjects have genes which are expressed at higher levels (i.e., which are up-regulated) and genes which are expressed at lower levels (i.e., which are down-regulated) relative to cells of the same type in subjects which do not have any symptoms of R.A. In particular, as described in the Examples, it has been shown that genes SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6 are expressed at higher levels in the diseased cells relative to the corresponding normal cells. Other genes, e.g., CMAK2B; PLA2G2A; GBAS and SOX15, are down-regulated in the diseased cells relative to the corresponding normal cells.

[0023] 1. Definitions:

[0024] As used herein, the following terms and phrases shall have the meanings set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.

[0025] The singular forms a, an, and the include plural reference unless the context clearly dictates otherwise.

[0026] The phrase a corresponding normal cell of or normal cell corresponding to or normal counterpart cell of a diseased cell refers to a normal cell of the same type as that of the diseased cell. For example, a corresponding normal PBMC of a subject having R.A. is a PBMC of a subject not having R.A.

[0027] An address on an array, e.g., a microarray, refers to a location at which an element, e.g., an oligonucleotide, is attached to the solid surface of the array.

[0028] The term agonist, as used herein, is meant to refer to an agent that mimics or up-regulates (e.g., potentiates or supplements) the bioactivity of a protein. An agonist can be a wild-type protein or derivative thereof having at least one bioactivity of the wild-type protein. An agonist can also be a compound that upregulates expression of a gene or which increases at least one bioactivity of a protein. An agonist can also be a compound which increases the interaction of a polypeptide with another molecule, e.g., a target peptide or nucleic acid.

[0029] Amplification, as used herein, relates to the production of additional copies of a nucleic acid sequence. Amplification is generally carried out using polymerase chain reaction (PCR) technologies well known in the art. (Dieffenbach, C. W. and G. S. Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.)

[0030] Antagonist as used herein is meant to refer to an agent that downregulates (e.g., suppresses or inhibits) at least one bioactivity of a protein. An antagonist can be a compound which inhibits or decreases the interaction between a protein and another molecule, e.g., a target peptide or enzyme substrate. An antagonist can also be a compound that downregulates expression of a gene or which reduces the amount of expressed protein present.

[0031] The term antibody as used herein is intended to include whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, etc), and includes fragments thereof which are also specifically reactive with a vertebrate, e.g., mammalian, protein. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. Thus, the term includes segments of proteolytically-cleaved or recombinantly-prepared portions of an antibody molecule that are capable of selectively reacting with a certain protein. Nonlimiting examples of such proteolytic and/or recombinant fragments include Fab, F(ab)2, Fab, Fv, and single chain antibodies (scFv) containing a VL and/or VH domain joined by a peptide linker. The scFv's may be covalently or non-covalently linked to form antibodies having two or more binding sites. The subject invention includes polyclonal, monoclonal, or other purified preparations of antibodies and recombinant antibodies.

[0032] By array or matrix is meant an arrangement of addressable locations or addresses on a device. The locations can be arranged in two dimensional arrays, three dimensional arrays, or other matrix formats. The number of locations can range from several to at least hundreds of thousands. Most importantly, each location represents a totally independent reaction site. A nucleic acid array refers to an array containing nucleic acid probes, such as oligonucleotides or larger portions of genes. The nucleic acid on the array is preferably single stranded. Arrays wherein the probes are oligonucleotides are referred to as oligonucleotide arrays or oligonucleotide chips. A microarray, also referred to herein as a biochip or biological chip is an array of regions having a density of discrete regions of at least about 100/cm², and preferably at least about 1000/cm². The regions in a microarray have typical dimensions, e.g., diameters, in the range of between about 10-250 m, and are separated from other regions in the array by about the same distance.

[0033] The term biological sample, as used herein, refers to a sample obtained from a subject, e.g., a human or from components (e.g., tissues) of a subject. The sample may be of any biological tissue or fluid. Frequently the sample will be a clinical sample which is a sample derived from a patient. Such samples include, but are not limited to, sputum, blood, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells therefrom. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. A preferred biological sample is a PBMC sample or a sample from a joint, e.g., synovial fluid or synovial tissue.

[0034] The term biomarker of a disease refers to a gene which is up- or down-regulated in a diseased cell of a subject having R.A. relative to a counterpart normal cell, which gene is sufficiently specific to the diseased cell that it can be used, optionally with other genes, to identify or detect the disease. Generally, a biomarker is a gene that is characteristic of the disease.

[0035] A nucleotide sequence is complementary to another nucleotide sequence if each of the bases of the two sequences match, i.e., are capable of forming Watson-Crick base pairs. The term complementary strand is used herein interchangeably with the term complement. The complement of a nucleic acid strand can be the complement of a coding strand or the complement of a non-coding strand.

[0036] A computer readable medium is any medium that can be used to store data which can be accessed by a computer. Exemplary media include: magnetic storage media, such as a diskettes, hard drives, and magnetic tape; optical storage media such as CD-ROMs; electrical storage media such as RAM and ROM; and hybrids of these media, such as magnetic/optical storage medium.

[0037] A cell characteristic of R.A. refers to a cell present in subjects having R.A., which cell is a modified form of a normal cell and is not present in a subject not having R.A., or which cell is present in significantly higher or lower numbers in subjects having R.A. relative to subjects not having R.A. A modified form of a normal cell can be a form of the normal cell in which the expression of at least one gene is higher or lower (e.g., by 50%, 2 fold, 5 fold, or over 10 fold) relative to the normal cell. A cell characteristic of R.A. is also referred to herein as a diseased cell of R.A. Exemplary diseased cells of R.A. include PBMCs, e.g., monocytes and macrophages, and inflammatory cells present in joints of patients, in particular, in synovial fluid and synovium. Inflammatory cells can be lymphocytes, e.g., T lymphocytes, B lymphocytes, monocytes and macrophages. Other diseased cells of R.A. include neutrophils, fibroblasts, endothelial cells, osteoclasts, osteoblasts, osteocytes, chondrocytes, and cells present in cartilage.

[0038] A cell corresponding to a cell characteristic of R.A. refers to a cell which has essentially the same phenotype as that of a cell characteristic of R.A. For example, a cell corresponding to a PBMC or a subject having R.A. is a PBMC of a subject who does not have R.A.

[0039] A cell sample characteristic of R.A. or a tissue sample characteristic of R.A. refers to a sample of cells, such as a tissue, that contains at least one cell characteristic of R.A. Such a sample may be a sample of blood, PBMCs, synovial fluid, synovium, cartilage or bone.

[0040] The term derivative refers to the chemical modification of a compound, e.g., a polypeptide, or a polynucleotide. Chemical modifications of a polynucleotide can include, for example, replacement of hydrogen by an alkyl, acyl, or amino group. A derivative polynucleotide encodes a polypeptide which retains at least one biological or immunological function of the natural molecule. A derivative polypeptide can be one modified by glycosylation, pegylation, or any similar process that retains at least one biological or immunological function of the polypeptide from which it was derived.

[0041] A detection agent of a gene refers to an agent that can be used to specifically detect a gene or other biological molecule relating to it, e.g., RNA transcribed from the gene and polypeptides encoded by the gene. Exemplary detection agents are nucleic acid probes which hybridize to nucleic acids corresponding to the gene and antibodies.

[0042] The term equivalent is understood to include nucleotide sequences encoding functionally equivalent polypeptides. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and will, therefore, include sequences that differ from the nucleotide sequence of the nucleic acids referred to in Any of Tables 1-5 due to the degeneracy of the genetic code.

[0043] The term essentially all the genes of any of Tables 1-5 refers to at least 90%, preferably at least 95% and most preferably at least 98% of the genes of any of Tables 1-5.

[0044] The term expression profile, which is used interchangeably herein with gene expression profile and finger print refers to a set of values representing the activity of about 10 or more genes. An expression profile preferably comprises values representing expression levels of at least about 20 genes, preferably at least about 30, 50, 100, 200 or more genes. An expression profile can be a set of values obtained from one or more cells or from a tissue sample, e.g., a clinical sample. An expression profile of a cell characteristic of R.A. may refer to a set of values representing mRNA levels of about 10 or more genes in a cell characteristic of R.A. An expression profile of R.A. refers to an expression profile of a cell characteristic of R.A. Thus, since there are different cells characteristic of R.A., there may be different expression profiles of R.A.

[0045] Genes which are up- or down-regulated in R.A. refers to genes which are up- or down-regulated in cells characteristic of R.A. relative to normal counterpart cells.

[0046] Genes characteristic of R.A. refers to genes which are up- or down-regulated by a significant factor, e.g., at least about 1.1 fold, 1.25 fold, 1.5 fold, 2 fold, 5 fold, 10 fold or more in at least about 50%, preferably 60%, 70%, 80%, or 90% of subjects having R.A., as determined, e.g., by methods described herein. Preferred genes characteristic of R.A. are those described in Tables 1-5. Even more preferred genes are those which are highlighted or marked with a star in the Tables, those which encode kinases or phosphatases and those wich are located on human chromosome 6, preferably at 6p21.3.

[0047] Hybridization refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing. Two single-stranded nucleic acids hybridize when they form a double-stranded duplex. The region of double-strandedness can include the full-length of one or both of the single-stranded nucleic acids, or all of one single stranded nucleic acid and a subsequence of the other single stranded nucleic acid, or the region of double-strandedness can include a subsequence of each nucleic acid. Hybridization also includes the formation of duplexes which contain certain mismatches, provided that the two strands are still forming a double stranded helix. Stringent hybridization conditions refers to hybridization conditions resulting in essentially specific hybridization.

[0048] The term isolated as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs, or RNAs, respectively, that are present in the natural source of the macromolecule. The term isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.

[0049] As used herein, the terms label and detectable label refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or haptens) and the like. The term fluorescer refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range. Particular examples of labels which may be used under the invention include fluorescein, rhodamine, dansyl, umbelliferone, Texas red, luminol, NADPH, alpha - beta -galactosidase and horseradish peroxidase.

[0050] The level of expression of a gene in a cell refers to the activity of a gene in the cell, which can be indicated by the level of mRNA, as well as pre-mRNA nascent transcript(s), transcript processing intermediates, mature mRNA(s) and degradation products, encoded by the gene in the cell.

[0051] The phrase normalizing expression of a gene in a diseased cell refers to an action to compensate for the altered expression of the gene in the diseased cell, so that it is essentially expressed at the same level as in the corresponding non diseased cell. For example, where the gene is over-expressed in the diseased cell, normalization of its expression in the diseased cell refers to treating the diseased cell in such a way that its expression becomes essentially the same as the expression in the counterpart normal cell. Normalization preferably brings the level of expression to within approximately a 50% difference in expression, more preferably to within approximately a 25%, and even more preferably 10% difference in expression. The required level of closeness in expression will depend on the particular gene, and can be determined as described herein. The phrase normalizing gene expression in a diseased cell refers to an action to normalize the expression of essentially all genes in the diseased cell.

[0052] As used herein, the term nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. ESTs, chromosomes, cDNAs, mRNAs, and rRNAs are representative examples of molecules that may be referred to as nucleic acids.

[0053] The phrase nucleic acid corresponding to a gene refers to a nucleic acid that can be used for detecting the gene, e.g., a nucleic acid which is capable of hybridizing specifically to the gene.

[0054] The phrase nucleic acid sample derived from RNA refers to one or more nucleic acid molecule, e.g., RNA or DNA, that was synthesized from the RNA, and includes DNA resulting from methods using PCR, e.g., RT-PCR.

[0055] The term percent identical refers to sequence identity between two amino acid sequences or between two nucleotide sequences. Identity can each be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar amino acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology, similarity, or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. Various alignment algorithms and/or programs may be used, including FASTA, BLAST, or ENTREZ. FASTA and BLAST are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default settings. ENTREZ is available through the National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Md. In one embodiment, the percent identity of two sequences can be determined by the GCG program with a gap weight of 1, e.g., each amino acid gap is weighted as if it were a single amino acid or nucleotide mismatch between the two sequences. Other techniques for alignment are described in Methods in Enzymology, vol. 266: Computer Methods for Macromolecular Sequence Analysis (1996), ed. Doolittle, Academic Press, Inc., a division of Harcourt Brace & Co., San Diego, Calif., USA. Preferably, an alignment program that permits gaps in the sequence is utilized to align the sequences. The Smith-Waterman is one type of algorithm that permits gaps in sequence alignments. See Meth. Mol. Biol. 70: 173-187 (1997). Also, the GAP program using the Needleman and Wunsch alignment method can be utilized to align sequences. An alternative search strategy uses MPSRCH software, which runs on a MASPAR computer. MPSRCH uses a Smith-Waterman algorithm to score sequences on a massively parallel computer. This approach improves ability to pick up distantly related matches, and is especially tolerant of small gaps and nucleotide sequence errors. Nucleic acid-encoded amino acid sequences can be used to search both protein and DNA databases. Databases with individual sequences are described in Methods in Enzymology, ed. Doolittle, supra. Databases include Genbank, EMBL, and DNA Database of Japan (DDBJ).

[0056] Perfectly matched in reference to a duplex means that the poly- or oligonucleotide strands making up the duplex form a double stranded structure with one other such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand. The term also comprehends the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2-aminopurine bases, and the like, that may be employed. A mismatch in a duplex between a target polynucleotide and an oligonucleotide or olynucleotide means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding. In reference to a triplex, the term means that the triplex consists of a perfectly matched duplex and a third strand in which every nucleotide undergoes Hoogsteen or reverse Hoogsteen association with a basepair of the perfectly matched duplex.

[0057] A plurality refers to two or more.

[0058] As used herein, a nucleic acid or other molecule attached to an array, is referred to as a probe or capture probe. When an array contains several probes corresponding to one gene, these probes are referred to as gene-probe set. A gene-probe set can consist of, e.g., 2 to 10 probes, preferably from 2 to 5 probes and most preferably about 5 probes.

[0059] The profile of a cell's biological state refers to the levels of various constituents of a cell that are known to change in response to drug treatments and other perturbations of the cell's biological state. Constituents of a cell include levels of RNA, levels of protein abundances, or protein activity levels.

[0060] The term protein is used interchangeably herein with the terms peptide and polypeptide.

[0061] Rheumatoid arthritis or R.A. refers to a systemic chronic inflammatory disease involving primarily the joints of the extremities. It is characterized by destruction of the joint cartilage and inflammation of the synovium, with a morphologic picture suggestive of a local immune response. CD4 T cells, activated B lymphocytes and plasma cells are found in the inflamed synovium, and in severe cases, well formed lymphoid follicles with germinal centers may be present. The synovial fluid and serum contain rheumatoid factors, i.e., complexes containing auto-antibodies, and may cytokines, e.g., interleukin-1 (IL-1), tumor necrosis factor (TNF) and interferon gamma (IFN-). T cells expressing the antigen receptor are also present in the synovial fluid of patients. R.A. is described, e.g., in Cecil Essentials of Medicine, Third Edition, Andreoli et al., W.B. Saunders Company (1993) at pages 564 to 568. This reference describes in particular symptoms that are the basis of a diagnosis of R.A. This reference also describes the different stages of the disease. Briefly, the first stage is characterized by presentation of antigen to T cells and is not associated with any symptoms. The second stage is characterized by T- and B-cell proliferation and angiogenesis in synovial membrane. The symptoms of the second stage are malaise, mild joint stiffness and swelling. The third stage is characterized by accumulation of neutrophils in synovial fluid; synovial cell proliferation without polarization or invasion or cartilage. The symptoms in this stage are joint pain and swelling; morning stiffness, malaise and weakness. The fourth stage is characterized by polarization of synovitis into a centripetally invasive pannus; activation of chondrocytes; initiation of enzyme (proteinase) degradation of cartilage. The symptoms in this stage are the same as those associated with stage three. The fifth stage is characterized by erosion of subchondral bone; invasion of cartilage by pannus; chrondrocyte proliferation; and stretched ligaments around joints. The symptoms in this stage are the same as those associated with stage 3, and in addition, loss of function and early deformity (e.g., ulnar deviation at metacarpophalangeal joint). Therapeutics used for treating R.A. include aspirin or other non-steroidal anti-inflammatory drug (NSAID); immunosuppressive agents, e.g., azathioprine, cyclophosphamide, chlorambucil and methotrexate; corticosteroids; gold salts; penicillamine; Infliximab (anti-TNF antibody); Etanercept or Enbrel (a soluble TNF receptor); Leflunomide; Anakinra (IL-I antagonist); and Kinaret (IL-I antagonist).

[0062] A similarity between the level of expression of a gene in two cells or tissues refers to a difference in expression levels of a factor of at least about 10% (i.e., 1.1 fold), 25% (i.e., 1.25 fold), 50% (i.e., 1.5 fold), 75% (i.e., 1.75 fold), 90% (i.e., 1.9 fold), 2 fold, 2.5 fold, 3 fold, 5 fold, 10 fold, 50 fold, or 100 fold. Expression levels can be raw data or they can averaged or normalized data, e.g., normalized relative to normal controls.

[0063] An expression profile in one cell or tissue is similar to an expression profile in another cell or tissue when the level of expression of the genes in the two expression profiles are sufficiently similar that the similarity is indicative of a common characteristic, e.g., being of the same cell type, or being characteristic of R.A. Similarity between an expression profile of a cell or tissue, e.g., of a subject, and a set of data representing an expression profile characteristic of a disease can be based on the presence or absence in the cell or tissue of certain RNAs and/or certain levels of certain RNAs of genes having a high probability of being associated with the disease. A high probability of being associated with a disease can be, e.g., the presence of RNA or of certain levels of RNA of particular genes which are over-expressed or under-expressed, in at least about 50%, 60%, 70%, 80%, 90%, or 100% of patients having the disease. A similarity -with an expression profile of a patient can also be based on higher or lower expression levels of a factor of at least about 10%, 25%, 50%, 75%, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 5 fold, 10 fold, 50 fold, 100 fold of at least about 50%, 60%, 70%, 80%, 90%, or 100% of genes, or at least about 10, 50, 100, 200, 300 genes, which are up- or down-regulated in at least about 50%, 60%, 70%, 80%, 90%, or 100% of patients. For example, the expression profile of PBMCs of a subject is similar to a reference expression profile fo an R.A. patient, e.g., determined herein, if at least about 50 genes which are over-expressed or repressed (i.e., under-expressed), e.g., at least about 1.1 fold, in at least about 60% of the patients studied are over-expressed or repressed, e.g., about at least 1.1 fold, in the expression profile of the subject. A similarity in expression profiles may also include similar expression levels of genes which are not up- or down-regulated in R.A.

[0064] Small molecule as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5 kD and most preferably less than about 4 kD. Small molecules can be nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic (carbon-containing) or inorganic molecules. Many pharmaceutical companies have extensive libraries of chemical and/or biological mixtures, often fungal, bacterial, or algal extracts, which can be screened with any of the assays of the invention to identify compounds that modulate a bioactivity.

[0065] The term specific hybridization of a probe to a target site of a template nucleic acid refers to hybridization of the probe predominantly to the target, such that the hybridization signal can be clearly interpreted. As further described herein, such conditions resulting in specific hybridization vary depending on the length of the region of homology, the GC content of the region, the melting temperature Tm of the hybrid. Hybridization conditions will thus vary in the salt content, acidity, and temperature of the hybridization solution and the washes.

[0066] A subject can be a mammal, e.g., a human, primate, ovine, bovine, porcine, equine, feline, and canine.

[0067] The term treating a disease in a subject or treating a subject having a disease refers to providing the subject with a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased. Treating a disease can be preventing the disease, improving the disease or curing the disease. Treatment of R.A. includes inhibition of erosion, e.g., cartilage or bone erosion, and/or inhibition of inflammation.

[0068] The phrase value representing the level of expression of a gene refers to a raw number which reflects the mRNA level of a particular gene in a cell or biological sample, e.g., obtained from analytical tools for measuring RNA levels.

[0069] A variant of a polypeptide refers to a polypeptide having the amino acid sequence of the polypeptide, in which one or more amino acid residues are altered. The variant may have conservative changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have non-conservative changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR). The term variant, when used in the context of a polynucleotide sequence, encompasses a polynucleotide sequence related to that of a gene of interest or the coding sequence thereof. This definition may also include, for example, allelic, splice, species, or polymorphic variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species. Polymorphic variants also may encompass single nucleotide polymorphisms (SNPs) in which the polynucleotide sequence varies by one base. The presence of SNPs may be indicative of, for example, a certain population, a disease state, or a propensity for a disease state.

[0070] 2. R.A. Diagnostic and Prognostic Methods of Use

[0071] The invention provides gene expression profiles of R.A. As further described herein, the gene expression profiles of the diseased cells of subjects having R.A., indicates that genes certain genes, e.g., SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6, are significantly up-regulated in these cells relative to their normal counterparts. The expression data also show that certain genes, e.g., CAMK2B, PLA2G2A, GBAS and SOX15, are significantly down-regulated in the diseased cells relative to their normal counterpart cells. Other preferred genes include those that are highlighted or marked with a star in Tables 1-5. Yet other genes of particular interest are those that have a fold induction indicated as DIV/0 in the Tables; those that encode kinases and phosphatases; those that are localized to human chromosome 6p21.3; and those which are highlighted or marked with a star in the Tables. Accordingly, the expression profile can be used diagnostically and prognostically for R.A. Exemplary diagnostic tools and assays are set forth below, under (i) to (vi), followed by exemplary methods for conducting these assays.

[0072] Preferred methods of the invention involve measuring the level of expression of one or more genes that are up- or down-regulated in R.A. in a cell of a patient, and comparing these levels of expression to the level of expression of the genes in other samples, which levels of expression may be present in a computer readable medium and analyzed with a computer.

[0073] (i) In one embodiment, the invention provides a method for determining whether a subject has or is likely to develop R.A., comprising determining the level of expression of one or more genes which are up- or down-regulated in R.A. in a cell of the subject and comparing these levels of expression with the levels of expression of the genes in a diseased cell of a subject known to have R.A. A similar level of expression of the genes in the two cells is indicative that the subject has or is likely to develop R.A. or at least a symptom thereof. In a preferred embodiment, the cell of the subject is essentially of the same type as that which is diseased in R.A.

[0074] (ii) In another embodiment the expression profile data of the invention can be used to confirm that a subject has R.A., and in particular, that the subject does not have a disease that is merely related R.A. This can be important, in particular, in designing an optimal therapeutic regimen for the subject. It has been described in the art that expression profiles can be used to distinguish one type of disease from a similar disease. For example, two subtypes of non-Hodgkin's lymphomas, one of which responds to current therapeutic methods and the other one which does not, could be differentiated by investigating 17,856 genes in specimens of patients suffering from diffuse large B-cell lymphoma (Alizadeh et al. (2000) Nature 405:503). Similarly, subtypes of cutaneous melanoma were predicted based on profiling 8150 genes (Bittner et al. (2000) Nature 406:536). In this case, features of the highly aggressive metastatic melanomas could be recognized. Numerous other studies comparing expression profiles of cancer cells and normal cells have been described, including studies describing expression profiles distinguishing between highly and less metastatic cancers and studies describing new subtypes of diseases, e.g., new tumor types (see, e.g., Perou et al. (1999) PNAS 96: 9212; Perou et al. (2000) Nature 606:747; Clark et al. (2000) Nature 406:532; Alon et al. (1999) PNAS 96:6745; Golub et al. (1999) Science 286:531).

[0075] Accordingly, the expression profiles of the invention allow the distinction of R.A. from related diseases. In a preferred embodiment, the level of expression of one or more genes which are up- or down-regulated in R.A. is determined in a cell of the subject, preferably a cell which corresponds to a diseased cell in R.A. A level of expression of one or more genes that is more similar to that in a cell characteristic of R.A. than to that of cells of related diseases indicates that the subject has R.A., rather than a disease related to R.A.

[0076] Prior to using this method for determining whether the subject has R.A. or a related disease, it may be necessary to first determine the expression profile of cells of diseases that are similar to R.A. This can be undertaken using the same microarray as the one that was used to identify the genes characteristic of R.A., and according to methods further described herein.

[0077] (iii) In yet another embodiment, the invention provides methods for determining the stage of R.A. in the subject. In one embodiment, the level of expression of one or more genes that are up- or down-regulated in R.A., in particular, whose level of expression varies with the stage of the disease is determined in a cell of a subject. A level of expression of one or more genes that is more similar to that of one stage of the disease (stage a) relative to that in other stages of the disease indicates that the disease of the subject is in stage a.

[0078] This assay may require the preliminary determination of expression profiles in different stages of R.A. Such expression data can be obtained by, e.g., using microarrays with target nucleic acids made from RNA of patients at different stages of the disease.

[0079] (iv) The method can also be used to determine the efficacy of a therapy in a subject. Accordingly, in one embodiment, the level of expression of one or more genes which are up- or down-regulated in R.A. is determined in a subject before the treatment and one or more times during the treatment. For example, a sample of RNA can be obtained from the subject before the beginning of the therapy and every 12, 24 or 72 hours during the therapy. Samples can also be analyzed once a week or once a month. Changes in expression levels of the genes over time and relative to diseased cells and normal cells will indicate whether the therapy is effective. For example, expression levels that are more similar to those in normal cells or in less advanced stages of the disease relative to the stage the subject was in, indicates that the therapy is effective.

[0080] (v) In yet another embodiment, the invention provides a method for determining the likelihood of success of a particular therapy in a subject having R.A. In one embodiment, a subject is started on a particular therapy, and the effectiveness of the therapy is determined, e.g., by determining the level of expression of one or more genes characteristic of R.A. in a cell of the subject. A normalization of the level of expression of these genes, i.e., a change in the expression level of the genes such that their level of expression resembles more that of a non diseased cell, indicates that the treatment should be effective in the subject. On the other hand, the absence of normalization of the level of expression of the genes characteristic of R.A. indicates that the treatment is not likely to be effective in the subject. This method may be able to predict that a treatment is effective before any alleviation of symptoms becomes apparent.

[0081] Prediction of the outcome of a treatment of R.A. in a subject can also be undertaken in vitro. In one embodiment, cells are obtained from a subject to be evaluated for responsiveness to the treatment, and incubated in vitro with the therapeutic drug or metabolized form thereof. The level of expression of one or more genes which are up- or down-regulated in R.A. is measured in the cells and these values are compared to the level of expression of these one or more genes in a cell which is a normal counterpart cell of a cell characteristic of R.A. The level of expression can also be compared to that in other diseased cells. A level of expression of one or more genes in the cells of the subject after incubation with the drug that is similar to their level of expression in a normal cell and different from that in a diseased cell is indicative that it is likely that the subject will respond positively to a treatment with the drug. On the contrary, levels of expressions that are more similar to levels of expression in a diseased cell than that in a normal cell is indicative that it is likely that the subject will not respond positively to a treatment with the drug.

[0082] Since it is possible that a drug for treating R.A. does not act directly on the diseased cells, but is, e.g., metabolized, or acts on another cell which then secretes a factor that will effect the diseased cells, the above assay can also be conducted in a tissue sample of a subject, which contains cells other than the diseased cells. For example, a tissue sample comprising diseased cells is obtained from a subject; the tissue sample is incubated with the potential drug; optionally one or more diseased cells are isolated from the tissue sample, e.g., by microdissection or Laser Capture Microdissection (LCM, see infra); and the expression level of one or more genes characteristic of R.A. is examined.

[0083] (vi) The invention also provides methods for selecting a particular therapy for an R.A. patient from a selection of several different therapies. Certain subjects having R.A. may respond better to one type of therapy than to another type of therapy. In a preferred embodiment, the method comprises comparing the expression level of at least one gene that is up- or down-regulated in R.A. in the patient with that in cells of R.A. subjects that were treated in vitro or in vivo with one of several therapeutic drugs, which subjects are responders or non responders to one of the therapeutic drugs, and identifying the cell which has the most similar level of expression of that in the patient, to thereby identify a therapy for the patient. The method may further comprise administering the therapy to the subject.

[0084] A person of skill in the art will recognize that in certain diagnostic and prognostic assays, it will be sufficient to assess the level of expression of a single gene that is up- or down-regulated in R.A., and that in others, the expression of a plurality, e.g., two or more genes, is preferred. In certain embodiments, it is preferable to assess the expression of at least about 10%, or at least about 20%, 30%, 50%, 70%, 90% or 95% of the genes listed in one or more of Tables 1-5 or of the genes characteristic of R.A.

[0085] A person of skill in the art will also recognize that expression levels can be measured in a single cell or in a plurality of cells, e.g., two or more cells. In one embodiment, the method comprises determined expression levels in a cell or tissue sample, e.g., a blood sample, a PBMC sample, a synovial fluid sample or a synovium sample.

[0086] Set forth below are exemplary methods which can be used to determine the level of expression of one or more genes. In a preferred embodiment for determining the level of expression of a plurality of genes, arrays, e.g., microarrays, can be used.

[0087] 2.1. Use of Arrays for Determining the Level of Expression of Genes

[0088] Generally, determining expression profiles with arrays involves the following steps: (a) obtaining a mRNA sample from a subject and preparing labeled nucleic acids therefrom (the target nucleic acids or targets); (b) contacting the target nucleic acids with the array under conditions sufficient for target nucleic acids to bind with corresponding probes on the array, e.g. by hybridization or specific binding; (c) optionally removing unbound targets from the array; (d) detecting bound targets, and (e) analyzing the results. As used herein, nucleic acid probes or probes are nucleic acids attached to the array, whereas target nucleic acids are nucleic acids that are hybridized to the array. Each of these steps is described in more detail below.

[0089] (i) Obtaining a mRNA Sample of a Subject

[0090] In one embodiment, one or more cells from the subject to be tested are obtained and RNA is isolated from the cells. In a preferred embodiment, PBMCs, synovial fluid, synovium or cartilage are obtained from the subject according to methods known in the art. Examples of such methods are set forth in the Examples and is discussed by Kim, C. H. et al. (J. Virol. 66:3879-3882 (1992)); Biswas, B. et al. (Annals NY Acad. Sci. 590:582-583 (1990)); Biswas, B. et al. (J. Clin. Microbiol. 29:2228-2233 (1991)). When obtaining the cells, it is preferable to obtain a sample containing predominantly cells of the desired type, e.g., a sample of cells in which at least about 50%, preferably at least about 60%, even more preferably at least about 70%, 80% and even more preferably, at least about 90% of the cells are of the desired type. A higher percentage of cells of the desired type is preferable, since such a sample is more likely to provide clear gene expression data.

[0091] It is also possible to obtain a cell sample from a subject, and then to enrich it for a desired cell type. For example, PBMCs can be isolated from blood as described herein. Counter-flow centrifugation (elutriation) can also be used to enrich for various cell types, such as T cells, B cells and monocytes, from PBMCs. Cells can also be isolated from other cells using a variety of techniques, such as isolation with an antibody binding to an epitope on the cell surface of the desired cell type. Another method that can be used includes negative selection using antibodies to cell surface markers to selectively enrich for a specific cell type without activating the cell by receptor engagement. Where the desired cells are in a solid tissue, particular cells can be dissected out, e.g., by microdissection. Exemplary cells that one may want to enrich for include monocytes, macrophages, T and B cells, osteocytes, osteoblasts, osteoclasts, chondrocytes, fibroblasts, neutrophils, endothelial cells and other cartilage cells.

[0092] In one embodiment, RNA is obtained from a single cell. For example, a cell can be isolated from a tissue sample by laser capture microdissection (LCM). Using this technique, a cell can be isolated from a tissue section, including a stained tissue section, thereby assuring that the desired cell is isolated (see, e.g., Bonner et al. (1997) Science 278: 1481; Emmert-Buck et al. (1996) Science 274:998; Fend et al. (1999) Am. J. Path. 154: 61 and Murakami et al. (2000) Kidney Int. 58:1346). For example, Murakami et al., supra, describe isolation of a cell from a previously immunostained tissue section.

[0093] It is also be possible to obtain cells from a subject and culture the cells in vitro, such as to obtain a larger population of cells from which RNA can be extracted. Methods for establishing cultures of non-transformed cells, i.e., primary cell cultures, are known in the art.

[0094] When isolating RNA from tissue samples or cells from individuals, it may be important to prevent any further changes in gene expression after the tissue or cells has been removed from the subject. Changes in expression levels are known to change rapidly following perturbations, e.g., heat shock or activation with lipopolysaccharide (LPS) or other reagents. In addition, the RNA in the tissue and cells may quickly become degraded. Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is snap frozen as soon as possible.

[0095] RNA can be extracted from the tissue sample by a variety of methods, e.g., those described in the Examples or guanidium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al., 1979, Biochemistry 18:5294-5299). RNA from single cells can be obtained as described in methods for preparing cDNA libraries from single cells, such as those described in Dulac, C. (1998) Curr. Top. Dev. Biol. 36, 245 and Jena et al. (1996) J. Immunol. Methods 190:199. Care to avoid RNA degradation must be taken, e.g., by inclusion of RNAsin.

[0096] The RNA sample can then be enriched in particular species. In one embodiment, poly(A) RNA is isolated from the RNA sample. In general, such purification takes advantage of the poly-A tails on mRNA. In particular and as noted above, poly-T oligonucleotides may be immobilized within on a solid support to serve as affinity ligands for mRNA. Kits for this purpose are commercially available, e.g., the MessageMaker kit (Life Technologies, Grand Island, N.Y.).

[0097] In a preferred embodiment, the RNA population is enriched in sequences of interest, such as those of genes characteristic of R.A. Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds of linear amplification based on cDNA synthesis and template-directed in vitro transcription (see, e.g., Wang et al. (1989) PNAS 86, 9717; Dulac et al., supra, and Jena et al., supra).

[0098] The population of RNA, enriched or not in particular species or sequences, can further be amplified. Such amplification is particularly important when using RNA from a single or a few cells. A variety of amplification methods are suitable for use in the methods of the invention, including, e.g., PCR; ligase chain reaction (LCR) (see, e.g., Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)); self-sustained sequence replication (SSR) (see, e.g., Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)); nucleic acid based sequence amplification (NASBA) and transcription amplification (see, e.g. Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)). For PCR technology, see, e.g., PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, N.Y., N.Y., 1992); PCR Protocols: A Guide to Methods and applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202. Methods of amplification are described, e.g., in Ohyama et al. (2000) BioTechniques 29:530; Luo et al. (1999) Nat. Med. 5, 117; Hegde et al. (2000) BioTechniques 29:548; Kacharmina et al. (1999) Meth. Enzymol. 303:3; Livesey et al. (2000) Curr. Biol. 10:301; Spirin et al. (1999) Invest. Ophtalmol. Vis. Sci. 40:3108; and Sakai et al. (2000) Anal. Biochem. 287:32. RNA amplification and cDNA synthesis can also be conducted in cells in situ (see, e.g., Eberwine et al. (1992) PNAS 89:3010).

[0099] One of skill in the art will appreciate that whatever amplification method is used, if a quantitative result is desired, care must be taken to use a method that maintains or controls for the relative frequencies of the amplified nucleic acids to achieve quantitative amplification. Methods of quantitative amplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction. A high density array may then include probes specific to the internal standard for quantification of the amplified nucleic acid.

[0100] One preferred internal standard is a synthetic AW106 cRNA. The AW106 ERNA is combined with RNA isolated from the sample according to standard techniques known to those of skilled in the art. The RNA is then reverse transcribed using a reverse transcriptase to provide copy DNA. The cDNA sequences are then amplified (e.g., by PCR) using labeled primers. The amplification products are separated, typically by electrophoresis, and the amount of radioactivity (proportional to the amount of amplified product) is determined. The amount of mRNA in the sample is then calculated by comparison with the signal produced by the known AW106 RNA standard. Detailed protocols for quantitative PCR are provided in PCR Protocols, A Guide to Methods and Applications, Innis et al., Academic Press, Inc. N.Y., (1990).

[0101] In a preferred embodiment, a sample mRNA is reverse transcribed with a reverse transcriptase and a primer consisting of oligo(dT) and a sequence encoding the phage T7 promoter to provide single stranded DNA template. The second DNA strand is polymerized using a DNA polymerase. After synthesis of double-stranded cDNA, T7 RNA polymerase is added and RNA is transcribed from the cDNA template. Successive rounds of transcription from each single cDNA template results in amplified RNA. Methods of in vitro polymerization are well known to those of skill in the art (see, e.g., Sambrook, (supra) and this particular method is described in detail by Van Gelder, et al., Proc. Natl. Acad. Sci. USA, 87: 1663-1667 (1990) who demonstrate that in vitro amplification according to this method preserves the relative frequencies of the various RNA transcripts). Moreover, Eberwine et al. Proc. Natl. Acad. Sci. USA, 89: 3010-3014 provide a protocol that uses two rounds of amplification via in vitro transcription to achieve greater than 106 fold amplification of the original starting material, thereby permitting expression monitoring even where biological samples are limited.

[0102] It will be appreciated by one of skill in the art that the direct transcription method described above provides an antisense (aRNA) pool. Where antisense RNA is used as the target nucleic acid, the oligonucleotide probes provided in the array are chosen to be complementary to subsequences of the antisense nucleic acids. Conversely, where the target nucleic acid pool is a pool of sense nucleic acids, the oligonucleotide probes are selected to be complementary to subsequences of the sense nucleic acids. Finally, where the nucleic acid pool is double stranded, the probes may be of either sense as the target nucleic acids include both sense and antisense strands.

[0103] (ii) Labeling of the Nucleic Acids to be Analyzed

[0104] Generally, the target molecules will be labeled to permit detection of hybridization of target molecules to a microarray. By labeled is meant that the probe comprises a member of a signal producing system and is thus detectable, either directly or through combined action with one or more additional members of a signal producing system. Examples of directly detectable labels include isotopic and fluorescent moieties incorporated into, usually covalently bonded to, a moiety of the probe, such as a nucleotide monomeric unit, e.g. dNMP of the primer, or a photoactive or chemically active derivative of a detectable label which can be bound to a functional moiety of the probe molecule.

[0105] Nucleic acids can be labeled after or during enrichment and/or amplification of RNAs. For example, labeled cDNA can be prepared from mRNA by oligo dT-primed or random-primed reverse transcription, both of which are well known in the art (see, e.g., Klug and Berger, 1987, Methods Enzymol. 152:316-325). Reverse transcription may be carried out in the presence of a dNTP conjugated to a detectable label, most preferably a fluorescently labeled dNTP. Alternatively, isolated mRNA can be converted to labeled antisense RNA synthesized by in vitro transcription of double-stranded cDNA in the presence of labeled dNTPs (Lockhart et al., 1996, Expression monitoring by hybridization to high-density oligonucleotide arrays, Nature Biotech. 14:1675). In alternative embodiments, the cDNA or RNA probe can be synthesized in the absence of detectable label and may be labeled subsequently, e.g., by incorporating biotinylated dNTPs or rNTP, or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs), followed by addition of labeled streptavidin (e.g., phycoerythrin-conjugated streptavidin) or the equivalent.

[0106] In one embodiment, labeled cDNA is synthesized by incubating a mixture containing RNA and 0.5 mM dGTP, dATP and dCTP plus 0.1 mM dTTP plus fluorescent deoxyribonucleotides (e.g., 0.1 mM Rhodamine 110 UTP (Perken Elmer Cetus) or 0.1 mM Cy3 dUTP (Amersham)) with reverse transcriptase (e.g., SuperScript..II, LTI Inc.) at 42 C. for 60 mm.

[0107] Fluorescent moieties or labels of interest include coumarin and its derivatives, e.g. 7-amino-4-methylcoumarin, aminocoumarin, bodipy dyes, such as Bodipy Fla., cascade blue, fluorescein and its derivatives, e.g. fluorescein isothiocyanate, Oregon green, rhodamine dyes, e.g. Texas red, tetramethylrhodamine, eosins and erythrosins, cyanine dyes, e.g. Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX, macrocyclic chelates of lanthanide ions, e.g. quantum dye, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, TOTAB, dansyl, etc. Individual fluorescent compounds which have functionalities for linking to an element desirably detected in an apparatus or assay of the invention, or which can be modified to incorporate such functionalities include, e.g., dansyl chloride; fluoresceins such as 3,6-dihydroxy-9-phenylxanthydrol; rhodamineisothiocyanate; N-phenyl 1-amino-8-sulfonatonaphthalene; N-phenyl 2-amino-6-sulfonatonaphthalene; 4-acetamido-4-isothiocyanatostilbene-2,2-disulfonic acid; pyrene-3-sulfonic acid; 2-toluidinonaphthalene-6-sulfonate; N-phenyl-N-methyl-2-aminoaphthalene-6-sulfonate; ethidium bromide; stebrine; auromine-0,2-(9-anthroyl)palmitate; dansyl phosphatidylethanolamine; N,N-dioctadecyl oxacarbocyanine: N,N-dihexyl oxacarbocyanine; merocyanine, 4-(3-pyrenyl)stearate; d-3-aminodesoxy-equilenin; 12-(9-anthroyl)stearate; 2-methylanthracene; 9-vinylanthracene; 2,2(vinylene-p-phenylene)bisbenzoxazole; p-bis(2-methyl-5-phenyl-oxazolyl))benzene; 6-dimethylamino-1,2-benzophenazin; retinol; bis(3-aminopyridinium) 1,10-decandiyl diiodide; sulfonaphthylhydrazone of hellibrienin; chlorotetracycline; N-(7-dimethylamino-4-methyl-2-oxo-3-chromenyl)maleimide; N-(p-(2benzimidazolyl)-phenyl)maleimide; N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin; 4-chloro-7-nitro-2,1,3-benzooxadiazole; merocyanine 540; resorufin; rose bengal; and 2,4-diphenyl-3(2H)-furanone. (see, e.g., Kricka, 1992, Nonisotopic DNA Probe Techniques, Academic Press San Diego, Calif.). Many fluorescent tags are commercially available from SIGMA chemical company (Saint Louis, Mo.), Amersham, Molecular Probes, R&D systems (Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway, N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, Md.), Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland), and Applied Biosystems (Foster City, Calif.) as well as other commercial sources known to one of skill.

[0108] Chemiluminescent labels include luciferin and 2,3-dihydrophthalazinediones, e.g., luminol.

[0109] Isotopic moieties or labels of interest include ³²P, ³³P, ³⁵S, ¹²⁵I,²H, ¹⁴C, and the like (see Zhao et al., 1995, High density cDNA filter analysis: a novel approach for large-scale, quantitative analysis of gene expression, Gene 156:207; Pietu et al., 1996, Novel gene transcripts preferentially expressed in human muscles revealed by quantitative hybridization of a high density cDNA array, Genome Res. 6:492).

[0110] Labels may also be members of a signal producing system that act in concert with one or more additional members of the same system to provide a detectable signal. Illustrative of such labels are members of a specific binding pair, such as ligands, e.g. biotin, fluorescein, digoxigenin, antigen, polyvalent cations, chelator groups and the like, where the members specifically bind to additional members of the signal producing system, where the additional members provide a detectable signal either directly or indirectly, e.g. antibody conjugated to a fluorescent moiety or an enzymatic moiety capable of converting a substrate to a chromogenic product, e.g. alkaline phosphatase conjugate antibody and the like.

[0111] Additional labels of interest include those that provide for signal only when the probe with which they are associated is specifically bound to a target molecule, where such labels include: molecular beacons as described in Tyagi & Kramer, Nature Biotechnology (1996) 14:303 and EP 0 070 685 B1. Other labels of interest include those described in U.S. Pat. No. 5,563,037; WO 97/17471 and WO 97/17076.

[0112] In some cases, hybridized target nucleic acids may be labeled following hybridization. For example, where biotin labeled dNTPs are used in, e.g., amplification or transcription, streptavidin linked reporter groups may be used to label hybridized complexes.

[0113] In other embodiments, the target nucleic acid is not labeled. In this case, hybridization can be determined, e.g., by plasmon resonance, as described, e.g., in Thiel et al. (1997) Anal. Chem. 69:4948.

[0114] In one embodiment, a plurality (e.g., 2, 3, 4, 5 or more) of sets of target nucleic acids are labeled and used in one hybridization reaction (multiplex analysis). For example, one set of nucleic acids may correspond to RNA from one cell or tissue sample and another set of nucleic acids may correspond to RNA from another cell or tissue sample. The plurality of sets of nucleic acids can be labeled with different labels, e.g., different fluorescent labels which have distinct emission spectra so that they can be distinguished. The sets can then be mixed and hybridized simultaneously to one microarray.

[0115] For example, the two different cells can be a diseased cell of a patient having R.A. and a counterpart normal cell. Alternatively, the two different cells can be a diseased cell of a patient having R.A. and a diseased cell of a patient suspected of having R.A. In another embodiment, one biological sample is exposed to a drug and another biological sample of the same type is not exposed to the drug. The cDNA derived from each of the two cell types are differently labeled so that they can be distinguished. In one embodiment, for example, cDNA from a diseased cell is synthesized using a fluorescein-labeled dNTP, and cDNA from a second cell, i.e., the normal cell, is synthesized using a rhodamine-labeled dNTP. When the two cDNAs are mixed and hybridized to the microarray, the relative intensity of signal from each cDNA set is determined for each site on the array, and any relative difference in abundance of a particular mRNA detected.

[0116] In the example described above, the cDNA from the diseased cell will fluoresce green when the fluorophore is stimulated and the cDNA from the cell of a subject suspected of having R.A. will fluoresce red. As a result, if the two cells are essentially the same, the particular mRNA will be equally prevalent in both cells and, upon reverse transcription, red-labeled and green-labeled cDNA will be equally prevalent. When hybridized to the microarray, the binding site(s) for that species of RNA will emit wavelengths characteristic of both fluorophores (and appear brown in combination). In contrast, if the two cells are different, the ratio of green to red fluorescence will be different.

[0117] The use of a two-color fluorescence labeling and detection scheme to define alterations in gene expression has been described, e.g., in Shena et al., 1995, Quantitative monitoring of gene expression patterns with a complementary DNA microarray, Science 270:467-470. An advantage of using cDNA labeled with two different fluorophores is that a direct and internally controlled comparison of the mRNA levels corresponding to each arrayed gene in two cell states can be made, and variations due to minor differences in experimental conditions (e.g, hybridization conditions) will not affect subsequent analyses.

[0118] Examples of distinguishable labels for use when hybridizing a plurality of target nucleic acids to one array are well known in the art and include: two or more different emission wavelength fluorescent dyes, like Cy3 and Cy5, combination of fluorescent proteins and dyes, like phicoerythrin and Cy5, two or more isotopes with different energy of emission, like ³²P and ³³P, gold or silver particles with different scattering spectra, labels which generate signals under different treatment conditions, like temperature, pH, treatment by additional chemical agents, etc., or generate signals at different time points after treatment. Using one or more enzymes for signal generation allows for the use of an even greater variety of distinguishable labels, based on different substrate specificity of enzymes (alkaline phosphatase/peroxidase).

[0119] Further, it is preferable in order to reduce experimental error to reverse the fluorescent labels in two-color differential hybridization experiments to reduce biases peculiar to individual genes or array spot locations. In other words, it is preferable to first measure gene expression with one labeling (e.g., labeling nucleic acid froma first cell with a first fluorochrome and nucleic acid from a second cell with a second fluorochrome) of the mRNA from the two cells being measured, and then to measure gene expression from the two cells with reversed labeling (e.g., labeling nucleic acid from the first cell with the second fluorochrome and nucleic acid from the second cell with the first fluorochrome). Multiple measurements over exposure levels and perturbation control parameter levels provide additional experimental error control.

[0120] The quality of labeled nucleic acids can be evaluated prior to hybridization to an array. For example, a sample of the labeled nucleic acids can be hybridized to probes derived from the 5, middle and 3 portions of genes known to be or suspected to be present in the nucleic acid sample. This will be indicative as to whether the labeled nucleic acids are full length nucleic acids or whether they are degraded. In one embodiment, the GeneChip Test3 Array from Affymetrix (Santa Clara, Calif.) can be used for that purpose. This array contains probes representing a subset of characterized genes from several organisms including mammals. Thus, the quality of a labeled nucleic acid sample can be determined by hybridization of a fraction of the sample to an array, such as the GeneChip Test3 Array from Affymetrix (Santa Clara, Calif.).

[0121] (iii) Exemplary Arrays

[0122] Preferred arrays, e.g., microarrays, for use according to the invention include one or more probes of genes which are up- or down-regulated in R.A., such as one or more genes listed in any of Tables 1-5 or one or more genes characteristic of R.A. In a preferred embodiment, the array comprises probes corresponding to one or more of genes selected from the group consisting of genes which are up-regulated in R.A., e.g., genes selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6 and genes which are down-regulated, e.g., CAMK2B, PLA2G2A, GBAS and SOX15. The array may comprise probes corresponding to at least 10, preferably at least 20, at least 50, at least 100 or at least 1000 genes. The array may comprise probes corresponding to about 10%, 20%, 50%, 70%, 90% or 95% of the genes listed in any of Tables 1-5. The array may comprise probes corresponding to about 10%, 20%, 50%, 70%, 90% or 95% of the genes listed in any of Tables 1-5 whose expression is at least 2 fold, preferably at least 3 fold, more preferably at least 4 fold, 5 fold, 7 fold and most preferably at least about 10 fold higher in cells characteristic of R.A. relative to normal counterpart cells. One array that can be used is the array used and described in the Examples.

[0123] There can be one or more than one probe corresponding to each gene on a microarray. For example, a microarray may contain from 2 to 20 probes corresponding to one gene and preferably about 5 to 10. The probes may correspond to the full length RNA sequence or complement thereof of genes characteristic of R.A., or they may correspond to a portion thereof, which portion is of sufficient length for permitting specific hybridization. Such probes may comprise from about 50 nucleotides to about 100, 200, 500, or 1000 nucleotides or more than 1000 nucleotides. As further described herein, microarrays may contain oligonucleotide probes, consisting of about 10 to 50 nucleotides, preferably about 15 to 30 nucleotides and even more preferably 20-25 nucleotides. The probes are preferably single stranded. The probe will have sufficient complementarity to its target to provide for the desired level of sequence specific hybridization (see below).

[0124] Typically, the arrays used in the present invention will have a site density of greater than 2 100 different probes per cm . Preferably, the arrays will have a site density of greater than 500/cm², more preferably greater than about 1000/cm², and most preferably, greater than about 10,000/cm². Preferably, the arrays will have more than 100 different probes on a single substrate, more preferably greater than about 1000 different probes still more preferably, greater than about 10,000 different probes and most preferably, greater than 100,000 different probes on a single substrate.

[0125] Microarrays can be prepared by methods known in the art, as described below, or they can be custom made by companies, e.g., Affymetrix (Santa Clara, Calif.).

[0126] Generally, two types of microarrays can be used. These two types are referred to as synthesis and delivery. In the synthesis type, a microarray is prepared in a step-wise fashion by the in situ synthesis of nucleic acids from nucleotides. With each round of synthesis, nucleotides are added to growing chains until the desired length is achieved. In the delivery type of microarray, preprepared nucleic acids are deposited onto known locations using a variety of delivery technologies. Numerous articles describe the different microarray technologies, e.g., Shena et al. (1998) Tibtech 16: 301; Duggan et al. (1999) Nat. Genet. 21:10; Bowtell et al. (1999) Nat. Genet. 21: 25.

[0127] One novel synthesis technology is that developed by Affymetrix (Santa Clara, Calif.), which combines photolithography technology with DNA synthetic chemistry to enable high density oligonucleotide microarray manufacture. Such chips contain up to 400,000 groups of oligonucleotides in an area of about 1.6 cm². Oligonucleotides are anchored at the 3 end thereby maximizing the availability of single-stranded nucleic acid for hybridization. Generally such chips, referred to as GeneChips contain several oligonucleotides of a particular gene, e.g., between 15-20, such as 16 oligonucleotides. Since Affymetrix (Santa Clara, Calif.) sells custom made microarrays, microarrays containing genes which are up- or down-regulated in R.A. can be ordered for purchase from Affymetrix (Santa Clara, Calif.).

[0128] Microarrays can also be prepared by mechanical microspotting, e.g., those commercialized at Synteni (Fremont, Calif.). According to these methods, small quantities of nucleic acids are printed onto solid surfaces. Microspotted arrays prepared at Synteni contain as many as 10,000 groups of cDNA in an area of about 3.6 cm².

[0129] A third group of microarray technologies consist in the drop-on-demand delivery approaches, the most advanced of which are the ink-jetting technologies, which utilize piezoelectric and other forms of propulsion to transfer nucleic acids from miniature nozzles to solid surfaces. Inkjet technologies is developed at several centers including Incyte Pharmaceuticals (Palo Alto, Calif.) and Protogene (Palo Alto, Calif.). This technology results in a density of 10,000 spots per cm². See also, Hughes et al. (2001) Nat. Biotechn. 19:342.

[0130] Arrays preferably include control and reference nucleic acids. Control nucleic acids are nucleic acids which serve to indicate that the hybridization was effective. For example, all Affymetrix (Santa Clara, Calif.) expression arrays contain sets of probes for several prokaryotic genes, e.g., bioB, bioC and bioD from biotin synthesis of E. coli and cre from P1 bacteriophage. Hybridization to these arrays is conducted in the presence of a mixture of these genes or portions thereof, such as the mix provided by Affymetrix (Santa Clara, Calif.) to that effect (Part Number 900299), to thereby confirm that the hybridization was effective. Control nucleic acids included with the target nucleic acids can also be mRNA synthesized from cDNA clones by in vitro transcription. Other control genes that may be included in arrays are polyA controls, such as dap, lys, phe, thr, and trp (which are included on Affymetrix GeneChips).

[0131] Reference nucleic acids allow the normalization of results from one experiment to another, and to compare multiple experiments on a quantitative level. Exemplary reference nucleic acids include housekeeping genes of known expression levels, e.g., GAPDH, hexokinase and actin.

[0132] Mismatch controls may also be provided for the probes to the target genes, for expression level controls or for normalization controls. Mismatch controls are oligonucleotide probes or other nucleic acid probes identical to their corresponding test or control probes except for the presence of one or more mismatched bases.

[0133] Arrays may also contain probes that hybridize to more than one allele of a gene. For example the array can contain one probe that recognizes allele 1 and another probe that recognizes allele 2 of a particular gene.

[0134] Microarrays can be prepared as follows. In one embodiment, an array of oligonucleotides is synthesized on a solid support. Exemplary solid supports include glass, plastics, polymers, metals, metalloids, ceramics, organics, etc. Using chip masking technologies and photoprotective chemistry it is possible to generate ordered arrays of nucleic acid probes. These arrays, which are known, e.g., as DNA chips, or as very large scale immobilized polymer arrays (VLSIPS arrays) can include millions of defined probe regions on a substrate having an area of about 1 cm² to several cm², thereby incorporating sets of from a few to millions of probes (see, e.g., U.S. Pat. No. 5,631,734).

[0135] The construction of solid phase nucleic acid arrays to detect target nucleic acids is well described in the literature. See, Fodor et al. (1991) Science, 251: 767-777; Sheldon et al. (1993) Clinical Chemistry 39(4): 718-719; Kozal et al. (1996) Nature Medicine 2(7): 753-759 and Hubbell U.S. Pat. No. 5,571,639; Pinkel et al. PCT/US95/16155 (WO 96/17958); U.S. Pat. Nos. 5,677,195; 5,624,711; 5,599,695; 5,451,683; 5,424,186; 5,412,087; 5,384,261; 5,252,743 and 5,143,854; PCT Patent Publication Nos. 92/10092 and 93/09668; and PCT WO 97/10365. In brief, a combinatorial strategy allows for the synthesis of arrays containing a large number of probes using a minimal number of synthetic steps. For instance, it is possible to synthesize and attach all possible DNA 8 mer oligonucleotides (48, or 65,536 possible combinations) using only 32 chemical synthetic steps. In general, VLSIPS procedures provide a method of producing 4n different oligonucleotide probes on an array using only 4n synthetic steps (see, e.g., U.S. Pat. No. 5,631,734 5,143,854 and PCT Patent Publication Nos. WO 90/15070; WO 95/11995 and WO 92/10092).

[0136] Light-directed combinatorial synthesis of oligonucleotide arrays on a glass surface can be performed with automated phosphoramidite chemistry and chip masking techniques similar to photoresist technologies in the computer chip industry. Typically, a glass surface is derivatized with a silane reagent containing a functional group, e.g., a hydroxyl or amine group blocked by a photolabile protecting group. Photolysis through a photolithogaphic mask is used selectively to expose functional groups which are then ready to react with incoming 5-photoprotected nucleoside phosphoramidites. The phosphoramidites react only with those sites which are illuminated (and thus exposed by removal of the photolabile blocking group). Thus, the phosphoramidites only add to those areas selectively exposed from the preceding step. These steps are repeated until the desired array of sequences have been synthesized on the solid surface.

[0137] Algorithms for design of masks to reduce the number of synthesis cycles are described by Hubbel et al., U.S. Pat. No. 5,571,639 and U.S. Pat. No. 5,593,839. A computer system may be used to select nucleic acid probes on the substrate and design the layout of the array as described in U.S. Pat. No. 5,571,639.

[0138] Another method for synthesizing high density arrays is described in U.S. Pat. No. 6,083,697. This method utilizes a novel chemical amplification process using a catalyst system which is initiated by radiation to assist in the synthesis the polymer sequences. Such methods include the use of photosensitive compounds which act as catalysts to chemically alter the synthesis intermediates in a manner to promote formation of polymer sequences. Such photosensitive compounds include what are generally referred to as radiation-activated catalysts (RACs), and more specifically photo activated catalysts (PACs). The RACs can by themselves chemically alter the synthesis intermediate or they can activate an autocatalytic compound which chemically alters the synthesis intermediate in a manner to allow the synthesis intermediate to chemically combine with a later added synthesis intermediate or other compound.

[0139] Arrays can also be synthesized in a combinatorial fashion by delivering monomers to cells of a support by mechanically constrained flowpaths. See Winkler et al., EP 624,059. Arrays can also be synthesized by spotting monomers reagents on to a support using an ink jet printer. See id. and Pease et al., EP 728,520. cDNA probes can be prepared according to methods known in the art and further described herein, e.g., reverse-transcription PCR (RT-PCR) of RNA using sequence specific primers. Oligonucleotide probes can be synthesized chemically. Sequences of the genes or cDNA from which probes are made can be obtained, e.g., from GenBank, other public databases or publications.

[0140] Nucleic acid probes can be natural nucleic acids, chemically modified nucleic acids, e.g., composed of nucleotide analogs, as long as they have activated hydroxyl groups compatible with the linking chemistry. The protective groups can, themselves, be photolabile. Alternatively, the protective groups can be labile under certain chemical conditions, e.g., acid. In this example, the surface of the solid support can contain a composition that generates acids upon exposure to light. Thus, exposure of a region of the substrate to light generates acids in that region that remove the protective groups in the exposed region. Also, the synthesis method can use 3-protected 5-0-phosphoramidite-activated deoxynucleoside. In this case, the oligonucleotide is synthesized in the 5 to 3 direction, which results in a free 5 end.

[0141] Oligonucleotides of an array can be synthesized using a 96 well automated multiplex oligonucleotide synthesizer (A.M.O.S.) that is capable of making thousands of oligonucleotides (Lashkari et al. (1995) PNAS 93: 7912) can be used.

[0142] It will be appreciated that oligonucleotide design is influenced by the intended application. For example, it may be desirable to have similar melting temperatures for all of the probes. Accordingly, the length of the probes are adjusted so that the melting temperatures for all of the probes on the array are closely similar (it will be appreciated that different lengths for different probes may be needed to achieve a particular Tm where different probes have different GC contents). Although melting temperature is a primary consideration in probe design, other factors are optionally used to further adjust probe construction, such as selecting against primer self-complementarity and the like.

[0143] Arrays, e.g., microarrrays, may conveniently be stored following fabrication or purchase for use at a later time. Under appropriate conditions, the subject arrays are capable of being stored for at least about 6 months and may be stored for up to one year or longer. Arrays are generally stored at temperatures between about 20 C. to room temperature, where the arrays are preferably sealed in a plastic container, e.g. bag, and shielded from light.

[0144] (iv) Hybridization of the Target Nucleic Acids to the Microarray

[0145] The next step is to contact the target nucleic acids with the array under conditions sufficient for binding between the target nucleic acids and the probes of the array. In a preferred embodiment, the target nucleic acids will be contacted with the array under conditions sufficient for hybridization to occur between the target nucleic acids and probes on the microarray, where the hybridization conditions will be selected in order to provide for the desired level of hybridization specificity.

[0146] Contact of the array and target nucleic acids involves contacting the array with an aqueous medium comprising the target nucleic acids. Contact may be achieved in a variety of different ways depending on specific configuration of the array. For example, where the array simply comprises the pattern of size separated probes on the surface of a plate-like rigid substrate, contact may be accomplished by simply placing the array in a container comprising the target nucleic acid solution, such as a polyethylene bag, and the like. In other embodiments where the array is entrapped in a separation media bounded by two rigid plates, the opportunity exists to deliver the target nucleic acids via electrophoretic means. Alternatively, where the array is incorporated into a biochip device having fluid entry and exit ports, the target nucleic acid solution can be introduced into the chamber in which the pattern of target molecules is presented through the entry port, where fluid introduction could be performed manually or with an automated device. In multiwell embodiments, the target nucleic acid solution will be introduced in the reaction chamber comprising the array, either manually, e.g. with a pipette, or with an automated fluid handling device.

[0147] Contact of the target nucleic acid solution and the probes will be maintained for a sufficient period of time for binding between the target and the probe to occur. Although dependent on the nature of the probe and target, contact will generally be maintained for a period of time ranging from about 10 min to 24 hrs, usually from about 30 min to 12 hrs and more usually from about 1 hr to 6 hrs.

[0148] When using commercially available microarrays, adequate hybridization conditions are provided by the manufacturer. When using non-commercial microarrays, adequate hybridization conditions can be determined based on the following hybridization guidelines, as well as on the hybridization conditions described in the numerous published articles on the use of microarrays.

[0149] Nucleic acid hybridization and wash conditions are optimally chosen so that the probe specifically binds or specifically hybridizes to a specific array site, i.e., the probe hybridizes, duplexes or binds to a sequence array site with a complementary nucleic acid sequence but does not hybridize to a site with a non-complementary nucleic acid sequence. As used herein, one polynucleotide sequence is considered complementary to another when, if the shorter of the polynucleotides is less than or equal to 25 bases, there are no mismatches using standard base-pairing rules or, if the shorter of the polynucleotides is longer than 25 bases, there is no more than a 5% mismatch. Preferably, the polynucleotides are perfectly complementary (no mismatches). It can easily be demonstrated that specific hybridization conditions result in specific hybridization by carrying out a hybridization assay including negative controls.

[0150] Hybridization is carried out in conditions permitting essentially specific hybridization. The length of the probe and GC content will determine the Tm of the hybrid, and thus the hybridization conditions necessary for obtaining specific hybridization of the probe to the template nucleic acid. These factors are well known to a person of skill in the art, and can also be tested in assays. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993), Laboratory Techniques in biochemistry and molecular biology-hybridization with nucleic acid probes. Generally, stringent conditions are selected to be about 5 C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Highly stringent conditions are selected to be equal to the Tm point for a particular probe. Sometimes the term Td is used to define the temperature at which at least half of the probe dissociates from a perfectly matched target nucleic acid. In any case, a variety of estimation techniques for estimating the Tm or Td are available, and generally described in Tijssen, supra. Typically, G-C base pairs in a duplex are estimated to contribute about 3 C. to the Tm, while A-T base pairs are estimated to contribute about 2 C., up to a theoretical maximum of about 80-100 C. However, more sophisticated models of Tm and Td are available and appropriate in which G-C stacking interactions, solvent effects, the desired assay temperature and the like are taken into account. For example, probes can be designed to have a dissociation temperature (Td) of approximately 60 C., using the formula: Td(((((3GC)(2AT))37)-562)/bp)-5; where GC, AT, and bp are the number of guanine-cytosine base pairs, the number of adenine-thymine base pairs, and the number of total base pairs, respectively, involved in the annealing of the probe to the template DNA.

[0151] The stability difference between a perfectly matched duplex and a mismatched duplex, particularly if the mismatch is only a single base, can be quite small, corresponding to a difference in Tm between the two of as little as 0.5 degrees. See Tibanyenda, N. et al., Eur. J. Biochem. 139:19 (1984) and Ebel, S. et al., Biochem. 31:12083 (1992). More importantly, it is understood that as the length of the homology region increases, the effect of a single base -mismatch on overall duplex stability decreases.

[0152] Theory and practice of nucleic acid hybridization is described, e.g., in S. Agrawal (ed.) Methods in Molecular Biology, volume 20; and Tijssen (1993) Laboratory Techniques in biochemistry and molecular biology-hybridization with nucleic acid probes, e.g., part I chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, New York provide a basic guide to nucleic acid hybridization.

[0153] Certain microarrays are of active nature, i.e., they provide independent electronic control over all aspects of the hybridization reaction (or any other affinity reaction) occurring at each specific microlocation. These devices provide a new mechanism for affecting hybridization reactions which is called electronic stringency control (ESC). Such active devices can electronically produce different stringency conditions at each microlocation. Thus, all hybridizations can be carried out optimally in the same bulk solution. These arrays are described in U.S. Pat. No. 6,051,380 by Sosnowski et al.

[0154] In a preferred embodiment, background signal is reduced by the use of a detergent (e.g, C-TAB) or a blocking reagent (e.g., sperm DNA, cot-i DNA, etc.) during the hybridization to reduce non-specific binding. In a particularly preferred (embodiment, the hybridization is performed in the presence of about 0.5 mg/ml DNA (e.g., herring sperm DNA). The use of blocking agents in hybridization is well known to those of skill in the art (see, e.g., Chapter 8 in Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 24: Hybridization With Nucleic Acid Probes, P. Tijssen, ed. Elsevier, N.Y., (1993)).

[0155] The method may or may not further comprise a non-bound label removal step prior to the detection step, depending on the particular label employed on the target nucleic acid. For example, in certain assay formats (e.g., homogenous assay formats) a detectable signal is only generated upon specific binding of target to probe. As such, in these assay formats, the hybridization pattern may be detected without a non-bound label removal step. In other embodiments, the label employed will generate a signal whether or not the target is specifically bound to its probe. In such embodiments, the non-bound labeled target is removed from the support surface. One means of removing the non-bound labeled target is to perform the well known technique of washing, where a variety of wash solutions and protocols for their use in removing non-bound label are known to those of skill in the art and may be used. Alternatively, non-bound labeled target can be removed by electrophoretic means.

[0156] Where all of the target sequences are detected using the same label, different arrays will be employed for each physiological source (where different could include using the same array at different times). The above methods can be varied to provide for multiplex analysis, by employing different and distinguishable labels for the different target populations (representing each of the different physiological sources being assayed). According to this multiplex method, the same array is used at the same time for each of the different target populations.

[0157] In another embodiment, hybridization is monitored in real time using a charge-coupled device (CCD) imaging camera (Guschin et al. (1997) Anal. Biochem. 250:203). Synthesis of arrays on optical fibre bundles allows easy and sensitive reading (Healy et al. (1997) Anal. Biochem. 251:270). In another embodiment, real time hybridization detection is carried out on microarrays without washing using evanescent wave effect that excites only fluorophores that are bound to the surface (see, e.g., Stimpson et al. (1995) PNAS 92:6379).

[0158] (v) Detection of Hybridization and Analysis of Results

[0159] The above steps result in the production of hybridization patterns of target nucleic acid on the array surface. These patterns may be visualized or detected in a variety of ways, with the particular manner of detection being chosen based on the particular label of the target nucleic acid. Representative detection means include scintillation counting, autoradiography, fluorescence measurement, colorimetric measurement, light emission measurement, light scattering, and the like.

[0160] One method of detection includes an array scanner that is commercially available from Affymetrix (Santa Clara, Calif.), e.g., the ₄₁₇ Arrayer, the 418 Array Scanner, or the Agilent GeneArray Scanner. This scanner is controlled from the system computer with a Windows^R interface and easy-to-use software tools. The output is a 16-bit.tif file that can be directly imported into or directly read by a variety of software applications. Preferred scanning devices are described in, e.g., U.S. Pat. Nos. 5,143,854 and 5,424,186.

[0161] When fluorescently labeled probes are used, the fluorescence emissions at each site of a transcript array can be detected by scanning confocal laser microscopy. In one embodiment, a separate scan, using the appropriate excitation line, is carried out for each of the two fluorophores used. Alternatively, a laser can be used that allows simultaneous specimen illumination at wavelengths specific to the two fluorophores and emissions from the two fluorophores can be analyzed simultaneously (see Shalon et al., 1996, A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization, Genome Research 6:639-645). In a preferred embodiment, the arrays are scanned with a laser fluorescent scanner with a computer controlled X-Y stage and a microscope objective. Sequential excitation of the two fluorophores can be achieved with a multi-line, mixed gas laser and the emitted light is split by wavelength and detected with two photomultiplier tubes. In one embodiment in which fluorescent target nucleic acids are used, the arrays may be scanned using lasers to excite fluorescently labeled targets that have hybridized to regions of probe arrays, which can then be imaged using charged coupled devices (CCDs) for a wide field scanning of the array. Fluorescence laser scanning devices are described, e.g., in Schena et al., 1996, Genome Res. 6:639-645. Alternatively, the fiber-optic bundle described by Ferguson et al., 1996, Nature Biotech. 14:1681-1684, may be used to monitor mRNA abundance levels.

[0162] Following the data gathering operation, the data will typically be reported to a data analysis operation. To facilitate the sample analysis operation, the data obtained by the reader from the device will typically be analyzed using a digital computer. Typically, the computer will be appropriately programmed for receipt and storage of the data from the device, as well as for analysis and reporting of the data gathered, e.g., subtrackion of the background, deconvolution multi-color images, flagging or removing artifacts, verifying that controls have performed properly, normalizing the signals, interpreting fluorescence data to determine the amount of hybridized target, normalization of background and single base mismatch hybridizations, and the like. In a preferred embodiment, a system comprises a search function that allows one to search for specific patterns, e.g., patterns relating to differential gene expression, e.g., between the expression profile of a cell of R.A. and the expression profile of a counterpart normal cell in a subject. A system preferably allows one to search for patterns of gene expression between more than two samples.

[0163] A desirable system for analyzing data is a general and flexible system for the visualization, manipulation, and analysis of gene expression data. Such a system preferably includes a graphical user interface for browsing and navigating through the expression data, allowing a user to selectively view and highlight the genes of interest. The system also preferably includes sort and search functions and is preferably available for general users with PC, Mac or Unix workstations. Also preferably included in the system are clustering algorithms that are qualitatively more efficient than existing ones. The accuracy of such algorithms is preferably hierarchically adjustable so that the level of detail of clustering can be systematically refined as desired.

[0164] Various algorithms are available for analyzing the gene expression profile data, e.g., the type of comparisons to perform. In certain embodiments, it is desirable to group genes that are co-regulated. This allows the comparison of large numbers of profiles. A preferred embodiment for identifying such groups of genes involves clustering algorithms (for reviews of clustering algorithms, see, e.g., Fukunaga, 1990, Statistical Pattern Recognition, 2nd Ed., Academic Press, San Diego; Everitt, 1974, Cluster Analysis, London: Heinemann Educ. Books; Hartigan, 1975, Clustering Algorithms, New York: Wiley; Sneath and Sokal, 1973, Numerical Taxonomy, Freeman; Anderberg, 1973, Cluster Analysis for Applications, Academic Press: New York).

[0165] Clustering analysis is useful in helping to reduce complex patterns of thousands of time curves into a smaller set of representative clusters. Some systems allow the clustering and viewing of genes based on sequences. Other systems allow clustering based on other characteristics of the genes, e.g., their level of expression (see, e.g. U.S. Pat. No. 6,203,987). Other systems permit clustering of time curves (see, e.g. U.S. Pat. No. 6,263,287). Cluster analysis can be performed using the hclust routine (see, e.g., hclust routine from the software package S-Plus, MathSoft, Inc., Cambridge, Mass.).

[0166] In some specific embodiments, genes are grouped according to the degree of co-variation of their transcription, presumably co-regulation, as described in U.S. Pat. No. 6,203,987. Groups of genes that have co-varying transcripts are termed genesets. Cluster analysis or other statistical classification methods can be used to analyze the co-variation of transcription of genes in response to a variety of perturbations, e.g. caused by a disease or a drug. In one specific embodiment, clustering algorithms are applied to expression profiles to construct a similarity tree or clustering tree which relates genes by the amount of co-regulation exhibited. Genesets are defined on the branches of a clustering tree by cutting across the clustering tree at different levels in the branching hierarchy.

[0167] In some embodiments, a gene expression profile is converted to a projected gene expression profile. The projected gene expression profile is a collection of geneset expression values. The conversion is achieved, in some embodiments, by averaging the level of expression of the genes within each geneset. In some other embodiments, other linear projection processes may be used. The projection operation expresses the profile on a smaller and biologically more meaningful set of coordinates, reducing the effects of measurement errors by averaging them over each cellular constituent sets and aiding biological interpretation of the profile.

[0168] Values that can be compared include gross expression levels; averages of expression levels, e.g., from different experiments, different samples from the same subject or samples from different subjects; and ratios of expression levels, e.g., between R.A. subjects and normal controls, between different R.A. subjects and isolated cell populations.

[0169] 2.2. Other Methods for Determining Gene Expression Levels

[0170] In certain embodiments, it is sufficient to determine the expression of one or only a few genes, as opposed to hundreds or thousands of genes. Although microarrays can be used in these embodiments, various other methods of detection of gene expression are available. This section describes a few exemplary methods for detecting and quantifying mRNA or polypeptide encoded thereby. Where the first step of the methods includes isolation of mRNA from cells, this step can be conducted as described above. Labeling of one or more nucleic acids can be performed as described above.

[0171] In one embodiment, mRNA obtained form a sample is reverse transcribed into a first cDNA strand and subjected to PCR, e.g., RT-PCR. House keeping genes, or other genes whose expression does not vary can be used as internal controls and controls across experiments. Following the PCR reaction, the amplified products can be separated by electrophoresis and detected. By using quantitative PCR, the level of amplified product will correlate with the level of RNA that was present in the sample. The amplified samples can also be separated on a agarose or polyacrylamide gel, transferred onto a filter, and the filter hybridized with a probe specific for the gene of interest. Numerous samples can be analyzed simultaneously by conducting parallel PCR amplification, e.g., by multiplex PCR.

[0172] A quantitative PCR technique that can be used is based on the use of TaqMan probes. Specific sequence detection occurs by amplification of target sequences in the PE Applied Biosystems 7700 Sequence Detection System in the presence of an oligonucleotide probe labeled at the 5 and 3 ends with a reporter and quencher fluorescent dye, respectively (FQ probe), which anneals between the two PCR primers. Only specific product will be detected when the probe is bound between the primers. As PCR amplification proceeds, the 5-nuclease activity of Taq polymerase initially cleaves the reporter dye from the probe. The signal generated when the reporter dye is physically separated from the quencher dye is detected by measuring the signal with an attached CCD camera. Each signal generated equals one probe cleaved which corresponds to amplification of one target strand. PCR reactions may be set up using the PE Applied Biosystem TaqMan PCR Core Reagent Kit according to the instructions supplied. This technique is further described, e.g., in U.S. Pat. No. 6,326,462.

[0173] In another embodiment, mRNA levels is determined by dotblot analysis and related methods (see, e.g., G. A. Beltz et al., in Methods in Enzymology, Vol. 100, Part B, R. Wu, L. Grossmam, K. Moldave, Eds., Academic Press, New York, Chapter 19, pp. 266-308, 1985). In one embodiment, a specified amount of RNA extracted from cells is blotted (i.e., non-covalently bound) onto a filter, and the filter is hybridized with a probe of the gene of interest. Numerous RNA samples can be analyzed simultaneously, since a blot can comprise multiple spots of RNA. Hybridization is detected using a method that depends on the type of label of the probe. In another dotblot method, one or more probes of one or more genes which are up- or down-regulated in R.A. are attached to a membrane, and the membrane is incubated with labeled nucleic acids obtained from and optionally derived from RNA of a cell or tissue of a subject. Such a dotblot is essentially an array comprising fewer probes than a microarray.

[0174] Dot blot hybridization gained wide-spread use, and many versions were developed (see, e.g., M. L. M. Anderson and B. D. Young, in Nucleic Acid Hybridization-A Practical Approach, B. D. Hames and S. J. Higgins, Eds., IRL Press, Washington D.C., Chapter 4, pp. 73-111, 1985).

[0175] Another format, the so-called sandwich hybridization, involves covalently attaching oligonucleotide probes to a solid support and using them to capture and detect multiple nucleic acid targets (see, e.g., M. Ranki et al., Gene, 21, pp. 77-85, 1983; A. M. Palva, T. M. Ranki, and H. E. Soderlund, in UK Patent Application GB 2156074A, Oct. 2, 1985; T. M. Ranki and H. E. Soderlund in U.S. Pat. No. 4,563,419, Jan. 7, 1986; A. D. B. Malcolm and J. A. Langdale, in PCT WO 86/03782, Jul. 3, 1986; Y. Stabinsky, in U.S. Pat. No. 4,751,177, Jan. 14, 1988; T. H. Adams et al., in PCT WO 90/01564, Feb. 22, 1990; R. B. Wallace et al. 6 Nucleic Acid Res. 11, p. 3543, 1979; and B. J. Connor et al., 80 Proc. Natl. Acad. Sci. USA pp. 278-282, 1983). Multiplex versions of these formats are called reverse dot blots. mRNA levels can also be determined by Northern blots. Specific amounts of RNA are separated by gel electrophoresis and transferred onto a filter which is then hybridized with a probe corresponding to the gene of interest. This method, although more burdensome when numerous samples and genes are to be analyzed provides the advantage of being very accurate.

[0176] A preferred method for high throughput analysis of gene expression is the serial analysis of gene expression (SAGE) technique, first described in Velculescu et al. (1995) Science 270, 484-487. Among the advantages of SAGE is that it has the potential to provide detection of all genes expressed in a given cell type, provides quantitative information about the relative expression of such genes, permits ready comparison of gene expression of genes in two cells, and yields sequence information that can be used to identify the detected genes. Thus far, SAGE methodology has proved itself to reliably detect expression of regulated and nonregulated genes in a variety of cell types (Velculescu et al. (1997) Cell 88, 243-251; Zhang et al. (1997) Science 276, 1268-1272 and Velculescu et al. (1999) Nat. Genet. 23, 387-388).

[0177] Techniques for producing and probing nucleic acids are further described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York, Cold Spring Harbor Laboratory, 1989).

[0178] Alternatively, the level of expression of one or more genes which are up- or down-regulated in R.A. is determined by in situ hybridization. In one embodiment, a tissue sample is obtained from a subject, the tissue sample is sliced, and in situ hybridization is performed according to methods known in the art, to determine the level of expression of the genes of interest.

[0179] In other methods, the level of expression of a gene is detected by measuring the level of protein encoded by the gene. This can be done, e.g., by immunoprecipitation, ELISA, or immunohistochemistry using an agent, e.g., an antibody, that specifically detects the protein encoded by the gene. Other techniques include Western blot analysis. Immunoassays are commonly used to quantitate the levels of proteins in cell samples, and many other immunoassay techniques are known in the art. The invention is not limited to a particular assay procedure, and therefore is intended to include both homogeneous and heterogeneous procedures. Exemplary immunoassays which can be conducted according to the invention include fluorescence polarization immunoassay (FPIA), fluorescence immunoassay (FIA), enzyme immunoassay (EIA), nephelometric inhibition immunoassay (NIA), enzyme linked immunosorbent assay (ELISA), and radioimmunoassay (RIA). An indicator moiety, or label group, can be attached to the subject antibodies and is selected so as to meet the needs of various uses of the method which are often dictated by the availability of assay equipment and compatible immunoassay procedures. General techniques to be used in performing the various immunoassays noted above are known to those of ordinary skill in the art.

[0180] In the case of polypeptides which are secreted from cells, the level of expression of these polypeptides can be measured in biological fluids.

[0181] 2.3. Data Analysis Methods

[0182] Comparison of the expression levels of one or more genes which are up- or down-regulated in R.A. with reference expression levels, e.g., expression levels in cells characteristic of R.A. or in normal counterpart cells, is preferably conducted using computer systems. In one embodiment, one or more expression levels are obtained in two cells and these two sets of expression levels are introduced into a computer system for comparison. In a preferred embodiment, one set of one or more expression levels is entered into a computer system for comparison with values that are already present in the computer system, or in computer-readable form that is then entered into the computer system.

[0183] In one embodiment, the invention provides a computer readable form of the gene expression profile data of the invention, or of values corresponding to the level of expression of at least one gene which is up- or down-regulated in R.A. The values can be mRNA expression levels obtained from experiments, e.g., microarray analysis. The values can also be mRNA levels normalized relative to a reference gene whose expression is constant in numerous cells under numerous conditions, e.g., GAPDH. In other embodiments, the values in the computer are ratios of, or differences between, normalized or non-normalized mRNA levels in different samples.

[0184] The computer readable medium may comprise values of at least 2, at least 3, at least 5, 10, 20, 50, 100, 200, 500 or more genes, e.g., genes listed in Tables 1-5. In a preferred embodiment, the computer readable medium comprises at least one expression profile.

[0185] Gene expression data can be in the form of a table, such as an Excel table. The data can be alone, or it can be part of a larger database, e.g., comprising other expression profiles, e.g., publicly available database. The computer readable form can be in a computer. In another embodiment, the invention provides a computer displaying the gene expression profile data.

[0186] Although the invention provides methods in which the level of expression of a single gene can be compared in two or more cells or tissue samples, in a preferred embodiment, the level of expression of a plurality of genes is compared. For example, the level of expression of at least 2, at least 3, at least 5, 10, 20, 50, 100, 200, 500 or more genes, e.g., genes listed in Tables 1-5 can be compared. In a preferred embodiment, expression profiles are compared.

[0187] In one embodiment, the invention provides a method for determining the similarity between the level of expression of one or more genes which are up- or down-regulated in R.A. in a first cell, e.g., a cell of a subject, and that in a second cell. The method preferably comprises obtaining the level of expression of one or more genes which are up- or down-regulated in R.A. in a first cell and entering these values into a computer comprising (i) a database including records comprising values corresponding to levels of expression of one or more genes which are up- or down-regulated in R.A. in a second cell, and (ii) processor instructions, e.g., a user interface, capable of receiving a selection of one or more values for comparison purposes with data that is stored in the computer. The computer may further comprise a means for converting the comparison data into a diagram or chart or other type of output.

[0188] In another embodiment, values representing expression levels of one or more genes which are up- or down-regulated in R.A. are entered into a computer system which comprises one or more databases with reference expression levels obtained from more than one cell. For example, the computer may comprise expression data of diseased and normal cells. Instructions are provided to the computer, and the computer is capable of comparing the data entered with the data in the computer to determine whether the data entered is more similar to that of a normal cell or to that of a diseased cell.

[0189] In another embodiment, the computer comprises values of expression levels in cells of subjects at different stages of R.A., and the computer is capable of comparing expression data entered into the computer with the data stored, and produce results indicating to which of the expression data in the computer, the one entered is most similar, such as to determine the stage of R.A. in the subject.

[0190] In yet another embodiment, the reference expression data in the computer are expression data from cells of R.A. of one or more subjects, which cells are treated in vivo or in vitro with a drug used for therapy of R.A. Upon entering of expression data of a cell of a subject treated in vitro or in vivo with the drug, the computer is instructed to compare the data entered with the data in the computer, and to provide results indicating whether the expression data input into the computer are more similar to those of a cell of a subject that is responsive to the drug or more similar to those of a cell of a subject that is not responsive to the drug. Thus, the results indicate whether the subject is likely to respond to the treatment with the drug or unlikely to respond to it.

[0191] The reference expression data may also be from cells from subjects responding or not responding to several different treatments, and the computer system indicates a preferred treatment for the subject. Accordingly, the invention provides a method for selecting a therapy for a patient having R.A., the method comprising: (i) providing the level of expression of one or more genes which are up- or down-regulated in R.A. in a diseased cell of the patient; (ii) providing a plurality of reference expression levels, each associated with a therapy, wherein the subject expression levels and each reference expression level has a plurality of values, each value representing the level of expression of a gene that is up- or down-regulated in R.A.; and (iii) selecting the reference expression levels most similar to the subject expression levels, to thereby select a therapy for said patient. In a preferred embodiment step (iii) is performed by a computer. The most similar reference profile may be selected by weighing a comparison value of the plurality using a weight value associated with the corresponding expression data.

[0192] In one embodiment, the invention provides a system that comprises a means for receiving gene expression data for one or a plurality of genes; a means for comparing the gene expression data from each of said one or plurality of genes to a common reference frame; and a means for presenting the results of the comparison. This system may further comprise a means for clustering the data.

[0193] In another embodiment, the invention provides a computer program for analyzing gene expression data comprising (i) a computer code that receives as input gene expression data for a plurality of genes and (ii) a computer code that compares said gene expression data from each of said plurality of genes to a common reference frame.

[0194] The invention also provides a machine-readable or computer-readable medium including program instructions for performing the following steps: (i) comparing a plurality of values corresponding to expression levels of one or more genes which are up- or down-regulated in R.A. in a query cell with a database including records comprising reference expression of one or more reference cells and an annotation of the type of cell; and (ii) indicating to which cell the query cell is most similar based on similarities of expression levels.

[0195] The relative levels of expression, e.g., abundance of an mRNA, in two biological samples can be scored as a perturbation (relative abundance difference) or as not perturbed (i.e., the relative abundance is the same). For example, a perturbation can be a difference in expression levels between the two sources of RNA of at least a factor of about 25% (RNA from one source is 25% more abundant in one source than the other source), more usually about 50%, even more often by a factor of about 2 (twice as abundant), 3 (three times as abundant) or 5 (five times as abundant). Perturbations can be used by a computer for calculating and expressing comparisons.

[0196] Preferably, in addition to identifying a perturbation as positive or negative, it is advantageous to determine the magnitude of the perturbation. This can be carried out, as noted above, by calculating the ratio of the emission of the two fluorophores used for differential labeling, or by analogous methods that will be readily apparent to those of skill in the art.

[0197] The computer readable medium may further comprise a pointer to a descriptor of the level of expression or expression profile, e.g., from which source it was obtained, e.g., from which patient it was obtained. A descriptor can reflect the stage of R.A., the therapy that the patient is undergoing or any other descriptions of the source of expression levels.

[0198] In operation, the means for receiving gene expression data, the means for comparing the gene expression data, the means for presenting, the means for normalizing, and the means for clustering within the context of the systems of the present invention can involve a programmed computer with the respective functionalities described herein, implemented in hardware or hardware and software; a logic circuit or other component of a programmed computer that performs the operations specifically identified herein, dictated by a computer program; or a computer memory encoded with executable instructions representing a computer program that can cause a computer to function in the particular fashion described herein.

[0199] Those skilled in the art will understand that the systems and methods of the present invention may be applied to a variety of systems, including IBM-compatible personal computers running MS-DOS or Microsoft Windows.

[0200] The computer may have internal components linked to external components. The internal components may include a processor element interconnected with a main memory. The computer system can be an Intel Pentium-based processor of 200 MHz or greater clock rate and with 32 MB or more of main memory. The external component may comprise a mass storage, which can be one or more hard disks (which are typically packaged together with the processor and memory). Such hard disks are typically of 1 GB or greater storage capacity. Other external components include a user interface device, which can be a monitor, together with an inputing device, which can be a mouse, or other graphic input devices, and/or a keyboard. A printing device can also be attached to the computer.

[0201] Typically, the computer system is also linked to a network link, which can be part of an Ethernet link to other local computer systems, remote computer systems, or wide area communication networks, such as the Internet. This network link allows the computer system to share data and processing tasks with other computer systems.

[0202] Loaded into memory during operation of this system are several software components, which are both standard in the art and special to the instant invention. These software components collectively cause the computer system to function according to the methods of this invention. These software components are typically stored on a mass storage. A software component represents the operating system, which is responsible for managing the computer system and its network interconnections. This operating system can be, for example, of the Microsoft Windows' family, such as Windows 95, Windows 98, or Windows NT. A software component represents common languages and functions conveniently present on this system to assist programs implementing the methods specific to this invention. Many high or low level computer languages can be used to program the analytic methods of this invention. Instructions can be interpreted during run-time or compiled. Preferred languages include C/C, and JAVA. Most preferably, the methods of this invention are programmed in mathematical software packages which allow symbolic entry of equations and high-level specification of processing, including algorithms to be used, thereby freeing a user of the need to procedurally program individual equations or algorithms. Such packages include Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram Research (Champaign, Ill.), or S-Plus from Math Soft (Cambridge, Mass.). Accordingly, a software component represents the analytic methods of this invention as programmed in a procedural language or symbolic package. In a preferred embodiment, the computer system also contains a database comprising values representing levels of expression of one or more genes which are up- or down-regulated in R.A. The database may contain one or more expression profiles of genes which are up- or down-regulated in R.A. in different cells.

[0203] In an exemplary implementation, to practice the methods of the present invention, a user first loads expression data into the computer system. These data can be directly entered by the user from a monitor and keyboard, or from other computer systems linked by a network connection, or on removable storage media such as a CD-ROM or floppy disk or through the network. Next the user causes execution of expression profile analysis software which performs the steps of comparing and, e.g., clustering co-varying genes into groups of genes.

[0204] In another exemplary implementation, expression profiles are compared using a method described in U.S. Pat. No. 6,203,987. A user first loads expression profile data into the computer system. Geneset profile definitions are loaded into the memory from the storage media or from a remote computer, preferably from a dynamic geneset database system, through the network. Next the user causes execution of projection software which performs the steps of converting expression profile to projected expression profiles. The projected expression profiles are then displayed.

[0205] In yet another exemplary implementation, a user first leads a projected profile into the memory. The user then causes the loading of a reference profile into the memory. Next, the user causes the execution of comparison software which performs the steps of objectively comparing the profiles.

[0206] 3. Exemplary Diagnostic and Prognostic Compositions and Devices of the Invention

[0207] Any composition and device (e.g., an array) used in the above-described methods are within the scope of the invention.

[0208] In one embodiment, the invention provides a composition comprising a plurality of detection agents for detecting expression of genes which are up- or down-regulated in R.A. In a preferred embodiment, the composition comprises at least 2, preferably at least 3, 5, 10, 20, 50, or 100 different detection agents. A detection agent can be a nucleic acid probe, e.g., DNA or RNA, or it can be a polypeptide, e.g., as antibody that binds to the polypeptide encoded by a gene characteristic of R.A. The probes can be present in equal amount or in different amounts in the solution.

[0209] A nucleic acid probe can be at least about 10 nucleotides long, preferably at least about 15, 20, 25, 30, 50, 100 nucleotides or more, and can comprise the full length gene. Preferred probes are those that hybridize specifically to genes listed in any of Tables 1-5. If the nucleic acid is short (i.e., 20 nucleotides or less), the sequence is preferably perfectly complementary to the target gene (i.e., a gene that is characteristic of R.A.), such that specific hybridization can be obtained. However, nucleic acids, even short ones that are not perfectly complementary to the target gene can also be included in a composition of the invention, e.g., for use as a negative control. Certain compositions may also comprise nucleic acids that are complementary to, and capable of detecting, an allele of a gene.

[0210] In a preferred embodiment, the invention provides nucleic acids which hybridize under high stringency conditions of 0.2 to 1 SSC at 65 C. followed by a wash at 0.2 SSC at 65 C. to genes which are up- or down-regulated in R.A. In another embodiment, the invention provides nucleic acids which hybridize under low stringency conditions of 6 SSC at room temperature followed by a wash at 2 SSC at room temperature. Other nucleic acids probes hybridize to their target in 3 SSC at 40 or 50 C., followed by a wash in 1 or 2 SSC at 20, 30, 40, 50, 60, or 65 C.

[0211] Nucleic acids which are at least about 80%, preferably at least about 90%, even more preferably at least about 95% and most preferably at least about 98% identical to genes which are up- or down-regulated in R.A. or cDNAs thereof, and complements thereof, are also within the scope of the invention.

[0212] Nucleic acid probes can be obtained by, e.g., polymerase chain reaction (PCR) amplification of gene segments from genomic DNA, cDNA (e.g., by RT-PCR), or cloned sequences. PCR primers are chosen, based on the known sequence of the genes or cDNA, that result in amplification of unique fragments. Computer programs can be used in the design of primers with the required specificity and optimal amplification properties. See, e.g., Oligo version 5.0 (National Biosciences). Factors which apply to the design and selection of primers for amplification are described, for example, by Rylchik, W. (1993) Selection of Primers for Polymerase Chain Reaction, in Methods in Molecular Biology, Vol. 15, White B. ed., Humana Press, Totowa, N.J. Sequences can be obtained from GenBank or other public sources.

[0213] Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16: 3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Nat. Acad. Sci. U.S.A. 85: 7448-7451), etc. In another embodiment, the oligonucleotide is a 2-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15: 6131-6148), or a chimeric RNA-DNA analog (Inoue et al., 1987, FEBS Lett. 215: 327-330).

[0214] Rapid amplification of cDNA ends, or RACE, is a PCR method that can be used for amplifying cDNAs from a number of different RNAs. The cDNAs may be ligated to an oligonucleotide linker and amplified by PCR using two primers. One primer may be based on sequence from the instant nucleic acids, for which full length sequence is desired, and a second primer may comprise a sequence that hybridizes to the oligonucleotide linker to amplify the cDNA. A description of this method is reported in PCT Pub. No. WO 97/19110.

[0215] In another embodiment, the invention provides a composition comprising a plurality of agents which can detect a polypeptide encoded by a gene characteristic of R.A. An agent can be, e.g., an antibody. Antibodies to polypeptides described herein can be obtained commercially, or they can be produced according to methods known in the art.

[0216] The probes can be attached to a solid support, such as paper, membranes, filters, chips, pins or glass slides, or any other appropriate substrate, such as those further described herein. For example, probes of genes which are up- or down-regulated in R.A. can be attached covalently or non covalently to membranes for use, e.g., in dotblots, or to solids such as to create arrays, e.g., microarrays.

[0217] 4. Therapeutic Methods and Compositions for R.A.

[0218] The expression profiling results described in the Examples indicated that certain genes are expressed at higher levels and certain genes are expressed at lower levels in cells of R.A. patients relative to their expression in normal counterpart cells. For example, SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSCl); FST1; Lcn2; GPI; SpiL; and TSG-6 are over-expressed in patients relative to controls. Exemplary genes which are down-regulated include CMAK2B, PLA2G2A, GBAS and SOX15. Accordingly, reducing the expression of one or more of genes that are up-regulated and/or increasing the expression of one or more genes which are down-regulated in diseased cells may provide a method of treatment of R.A. Genes, whose normalization of expression improves R.A. can be identified according to methods known in the art, some of which are set forth below. Accordingly, the invention provides compositions for these therapeutic methods, e.g., compositions comprising isolated polypeptides encoded by a gene selected from the group consisting of SOCS3 (CISH3); RAGE (AGER); LST-1 (LY117); SAA 1-3; HMG-1; S100 A8, A9, and A12; SLPI; GILZ; PTPN-18; GADD-45A and B; Legumain (PRSC1); FST1; Lcn2; GPI; SpiL; and TSG-6; nucleic acids encoding such; plasmids, vectors and host cell comprising these isolated nucleic acids; methods for making a polypeptide; and methods for identifying compounds which modulate gene expression of the genes or the activity of a polypeptide encoded by the genes.

[0219] 4.1. Methods for Determining Whether Modulation of the Expression of a Gene Improves R.A.

[0220] In one embodiment, the effect of up- or down-regulating the level of expression of a gene which is down- or up-regulated, respectively, in a cell characteristic of R.A. is determined by phenotypic analysis of the cell, in particular by determining whether the cell adopts a phenotype that is more reminiscent of that of a normal cell than that of a cell characteristic of R.A.

[0221] In another preferred embodiment, the effect on the cell is determined by measuring the level of expression of one or more genes which are up- or down-regulated in R.A., and preferably at least about 10, or at least about 100 genes characteristic of R.A. In a preferred embodiment, the level of expression of a gene is modulated, and the level of expression of at least one gene characteristic of R.A. is determined, e.g., by using a microarray having probes to the one or more genes. If the normalization of expression of the gene results in at least some normalization of the gene expression profile in the diseased cell, then normalizing the expression of the gene in a subject having R.A. is expected to improve R.A. The term normalization of the expression of a gene in a diseased cell refers to bringing the level of expression of that gene in the diseased cell to a level that is similar to that in the corresponding normal cell. Normalization of the gene expression profile in a diseased cell refers to bringing the expression profile in a diseased cell essentially to that in the corresponding non-diseased cell. If, however, the normalization of expression of the gene does not result in at least some normalization of the gene expression profile in the diseased cell, normalizing the expression of the gene in a subject having R.A. is not expected to improve R.A. In certain embodiments, the expression level of two or more genes which are up- or down-regulated in R.A. is modulated and the effect on the diseased cell is determined.

[0222] A preferred cell for use in these assays is a cell characteristic of R.A. that can be obtained from a subject and, e.g., established as a primary cell culture. The cell can be immortalized by methods known in the art, e.g., by expression of an oncogene or large T antigen of SV40. Alternatively, cell lines corresponding to such a diseased cell can be used. Examples include RAW cells and THP1 cells. However, prior to using such cell lines, it may be preferably to confirm that the gene expression profile of the cell line corresponds essentially to that of a cell characteristic of R.A. This can be done as described in details herein.

[0223] Modulating the expression of a gene in a cell can be achieved, e.g., by contacting the cell with an agent that increases the level of expression of the gene or the activity of the polypeptide encoded by the gene. Increasing the level of a polypeptide in a cell can also be achieved by transfecting the cell, transiently or stably, with a nucleic acid encoding the polypeptide. Decreasing the expression of a gene in a cell can be achieved by inhibiting transcription or translation of the gene or RNA, e.g., by introducing antisense nucleic acids, ribozymes or siRNAs into the cells, or by inhibiting the activity of the polypeptide encoded by the gene, e.g., by using antibodies or dominant negative mutants. These methods are further described below in the context of therapeutic methods.

[0224] A nucleic acid encoding a particular polypeptide can be obtained, e.g., by RT-PCR from a cell that is known to express the gene. Primers for the RT-PCR can be derived from the nucleotide sequence of the gene encoding the polypeptide. The nucleotide sequence of the gene is available, e.g., in GenBank or in the publications. GenBank Accession numbers of the genes listed in Tables 1-5 are provided in the tables. Amplified DNA can then be inserted into an expression vector, according to methods known in the art and transfected into diseased cells of R.A. In a control experiment, normal counterpart cells can also be transfected. The level of expression of the polypeptide in the transfected cells can be determined, e.g., by electrophoresis and staining of the gel or by Western blot using an a agent that binds the polypeptide, e.g., an antibody. The level of expression of one or more genes which are up- or down-regulated in R.A. can then be determined in the transfected cells having elevated levels of the polypeptide. In a preferred embodiment, the level of expression is determined by using a microarray. For example, RNA is extracted from the transfected cells, and used as target DNA for hybridization to a microarray, as further described herein.

[0225] These assays will allow the identification of genes which are up- or down-regulated in R.A. which can be used as therapeutic targets for developing therapeutics for R.A.

[0226] 4.2. Therapeutic Methods

[0227] 4.2.1. Methods for Reducing Expression of Gene in the Cells of a Patient

[0228] Genes which are up-regulated in R.A. may be used as therapeutic targets for treating R.A. For example, it may be possible to treat R.A. by decreasing the level of the polypeptide in the diseased cells.

[0229] (i) Antisense Nucleic Acids

[0230] One method for decreasing the level of expression of a gene is to introduce into the cell antisense molecules which are complementary to at least a portion of the gene or RNA of the gene. An antisense nucleic acid as used herein refers to a nucleic acid capable of hybridizing to a sequence-specific (e.g., non-poly A) portion of the target RNA, for example its translation initiation region, by virtue of some sequence complementarity to a coding and/or non-coding region. The antisense nucleic acids of the invention can be oligonucleotides that are double-stranded or single-stranded, RNA or DNA or a modification or derivative thereof, which can be directly administered in a controllable manner to a cell or which can be produced intracellularly by transcription of exogenous, introduced sequences in controllable quantities sufficient to perturb translation of the target RNA.

[0231] Preferably, antisense nucleic acids are of at least six nucleotides and are preferably oligonucleotides (ranging from 6 to about 200 oligonucleotides). In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 200 nucleotides. The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone. The oligonucleotide may include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86: 6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652: PCT Publication No. WO 88/09810, published Dec. 15, 1988), hybridization-triggered cleavage agents (see, e.g., Krol et al., 1988, BioTechniques 6: 958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5: 539-549).

[0232] In a preferred aspect of the invention, an antisense oligonucleotide is provided, preferably as single-stranded DNA. The oligonucleotide may be modified at any position on its structure with constituents generally known in the art. For example, the antisense oligonucleotides may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.

[0233] In another embodiment, the oligonucleotide comprises at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.

[0234] In yet another embodiment, the oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet another embodiment, the oligonucleotide is a 2--anomeric oligonucleotide. An -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).

[0235] The oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent transport agent, hybridization-triggered cleavage agent, etc. An antisense molecule can be a peptide nucleic acid (PNA). PNA refers to an antisense molecule or anti-gene agent which comprises an oligonucleotide of at least about 5 nucleotides in length linked to a peptide backbone of amino acid residues ending in lysine. The terminal lysine confers solubility to the composition. PNAs preferentially bind complementary single stranded DNA or RNA and stop transcript elongation, and may be pegylated to extend their lifespan in the cell.

[0236] The antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of a target RNA species. However, absolute complementarity, although preferred, is not required. A sequence complementary to at least a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with a target RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. The amount of antisense nucleic acid that will be effective in the inhibiting translation of the target RNA can be determined by standard assay techniques.

[0237] The synthesized antisense oligonucleotides can then be administered to a cell in a controlled manner. For example, the antisense oligonucleotides can be placed in the growth environment of the cell at controlled levels where they may be taken up by the cell. The uptake of the antisense oligonucleotides can be assisted by use of methods well known in the art.

[0238] In an alternative embodiment, the antisense nucleic acids of the invention are controllably expressed intracellularly by transcription from an exogenous sequence. For example, a vector can be introduced in vivo such that it is taken up by a cell, within which cell the vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequences encoding the antisense RNAs can be by any promoter known in the art to act in a cell of interest. Such promoters can be inducible or constitutive. Most preferably, promoters are controllable or inducible by the administration of an exogenous moiety in order to achieve controlled expression of the antisense oligonucleotide. Such controllable promoters include the Tet promoter. Other usable promoters for mammalian cells include, but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-310), the promoter contained in the 3 long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22: 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78: 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42), etc.

[0239] Antisense therapy for a variety of cancers is in clinical phase and has been discussed extensively in the literature. Reed reviewed antisense therapy directed at the Bcl-2 gene in tumors; gene transfer-mediated overexpression of Bcl-2 in tumor cell lines conferred resistance to many types of cancer drugs. (Reed, J. C., N.C.I. (1997) 89:988-990). The potential for clinical development of antisense inhibitors of ras is discussed by Cowsert, L. M., Anti-Cancer Drug Design (1997) 12:359-371. Additional important antisense targets include leukemia (Geurtz, A. M., Anti-Cancer Drug Design (1997) 12:341-358); human C-ref kinase (Monia, B. P., Anti-Cancer Drug Design (1997) 12:327-339); and protein kinase C (McGraw et al., Anti-Cancer Drug Design (1997) 12:315-326.

[0240] (ii) Ribozymes

[0241] In another embodiment, the level of a particular mRNA or polypeptide in a cell is reduced by introduction of a ribozyme into the cell or nucleic acid encoding such. Ribozyme molecules designed to catalytically cleave mRNA transcripts can also be introduced into, or expressed, in cells to inhibit expression of the gene (see, e.g., Sarver et al., 1990, Science 247:1222-1225 and U.S. Pat. No. 5,093,246). One commonly used ribozyme motif is the -hammerhead, for which the substrate sequence requirements are minimal. Design of the hammerhead ribozyme is disclosed in Usman et al., Current Opin. Struct. Biol. (1996) 6:527-533. Usman also discusses the therapeutic uses of ribozymes. Ribozymes can also be prepared and used as described in Long et al., FASEB J. (1993) 7:25; Symons, Ann. Rev. Biochem. (1992) 61:641; Perrotta et al., Biochem. (1992) 31:16-17; Ojwang et al., Proc. Natl. Acad. Sci. (USA) (1992) 89:10802-10806; and U.S. Pat. No. 5,254,678. Ribozyme cleavage of HIV-I RNA is described in U.S. Pat. No. 5,144,019; methods of cleaving RNA using ribozymes is described in U.S. Pat. No. 5,116,742; and methods for increasing the specificity of ribozymes are described in U.S. Pat. No. 5,225,337 and Koizumi et al., Nucleic Acid Res. (1989) 17:7059-7071. Preparation and use of ribozyme fragments in a hammerhead structure are also described by Koizumi et al., Nucleic Acids Res. (1989) 17:7059-7071. Preparation and use of ribozyme fragments in a hairpin structure are described by Chowrira and Burke, Nucleic Acids Res. (1992) 20:2835. Ribozymes can also be made by rolling transcription as described in Daubendiek and Kool, Nat. Biotechnol. (1997) 15(3):273-277.

[0242] (iii) siRNAs

[0243] Another method for decreasing or blocking gene expression is by introducing double stranded small interfering RNAs (siRNAs), which mediate sequence specific mRNA degradation. RNA interference (RNAi) is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by double-stranded RNA (dsRNA) that is homologous in sequence to the silenced gene. In vivo, long dsRNA is cleaved by ribonuclease III to generate 21- and 22-nucleotide siRNAs. It has been shown that 21-nucleotide siRNA duplexes specifically suppress expression of endogenous and heterologous genes in different mammalian cell lines, including human embryonic kidney (293) and HeLa cells (Elbashir et al. Nature 2001 ;411(6836):494-8).

[0244] (iv) Triplex Formation

[0245] Gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the target gene (i.e., the gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body. (See generally, Helene, C. 1991, Anticancer Drug Des., 6(6):569-84; Helene, C., et al., 1992, Ann, N.Y. Accad. Sci., 660:27-36; and Maher, L. J., 1992, Bioassays 14(12):807-15).

[0246] (v) Aptamers

[0247] In a further embodiment, RNA aptamers can be introduced into or expressed in a cell. RNA aptamers are specific RNA ligands for proteins, such as for Tat and Rev RNA (Good et al., 1997, Gene Therapy 4: 45-54) that can specifically inhibit their translation.

[0248] (vi) Dominant Negative Mutants

[0249] Another method of decreasing the biological activity of a polypeptide is by introducing into the cell a dominant negative mutant. A dominant negative mutant polypeptide will interact with a molecule with which the polypeptide normally interacts, thereby competing for the molecule, but since it is biologically inactive, it will inhibit the biological activity of the polypeptide. A dominant negative mutant can be created by mutating the substrate-binding domain, the catalytic domain, or a cellular localization domain of the polypeptide. Preferably, the mutant polypeptide will be overproduced. Point mutations are made that have such an effect. In addition, fusion of different polypeptides of various lengths to the terminus of a protein can yield dominant negative mutants. General strategies are available for making dominant negative mutants. See Herskowitz, Nature (1987) 329:219-222.

[0250] (vi) Use of Agents Inhibiting Transcription or Polypeptide Activity

[0251] In another embodiment, a compound decreasing the expression of the gene of interest or the activity of the polypeptide is administered to a subject having R.A., such that the level of the polypeptide in the diseased cells decreases, and the disease is improved. Compounds may be known in the art or can be identified as further described herein.

[0252] 4.2.2. Methods for Increasing the Expression of a Protein in Cells of a Patient

[0253] Genes which are down-regulated in R.A. may be used as therapeutic targets for treating R.A. For example, it may be possible to treat R.A. by increasing the level of the polypeptide in the diseased cells.

[0254] (i) Administration of a Nucleic Acid Encoding a Polypeptide of Interest to a Subject

[0255] In one embodiment, a nucleic acid encoding a polypeptide of interest, or an equivalent thereof, such as a functionally active fragment of the polypeptide, is administered to a subject, such that the nucleic acid arrives at the site of the diseased cells, traverses the cell membrane and is expressed in the diseased cell.

[0256] A nucleic acid encoding a polypeptide of interest can be obtained as described herein, e.g., by RT-PCR, or from publicly available DNA clones. It may not be necessary to express the full length polypeptide in a cell of a subject, and a functional fragment thereof may be sufficient. Similarly, it is not necessary to express a polypeptide having an amino acid sequence that is identical to that of the wild-type polypeptide. Certain amino acid deletions, additions and substitutions are permitted, provided that the polypeptide retains most of its biological activity. For example, it is expected that polypeptides having conservative amino acid substitutions will have the same activity as the polypeptide. Polypeptides that are shorter or longer than the wild-type polypeptide or which contain from one to 20 amino acid deletions, insertions or substitutions and which have a biological activity that is essentially identical to that of the wild-type polypeptide are referred to herein as equivalents of the polypeptide. Equivalent polypeptides also include polypeptides having an amino acid sequence which is at least 80%, preferably at least about 90%, even more preferably at least about 95% and most preferably at least 98% identical or similar to the amino acid sequence of the wild-type polypeptide.

[0257] Determining which portion of the polypeptide is sufficient for improving R.A. or which polypeptides derived from the polypeptide are equivalents which can be used for treating R.A., can be done in in vitro assays. For example, expression plasmids encoding various portions of the polypeptide can be transfected into cells, e.g., diseased cells of R.A., and the effect of the expression of the portion of the polypeptide in the cells can be determined, e.g., by visual inspection of the phenotype of the cell or by obtaining the expression profile of the cell, as further described herein.

[0258] Any means for the introduction of polynucleotides into mammals, human or non-human, may be adapted to the practice of this invention for the delivery of the various constructs of the invention into the intended recipient. In one embodiment of the invention, the DNA constructs are delivered to cells by transfection, i.e., by delivery of naked DNA or in a complex with a colloidal dispersion system. A colloidal system includes macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a lipid-complexed or liposome-formulated DNA. In the former approach, prior to formulation of DNA, e.g., with lipid, a plasmid containing a transgene bearing the desired DNA constructs may first be experimentally optimized for expression (e.g., inclusion of an intron in the 5 untranslated region and elimination of unnecessary sequences (Felgner, et al., Ann NY Acad Sci 126-139, 1995). Formulation of DNA, e.g. with various lipid or liposome materials, may then be effected using known methods and materials and delivered to the recipient mammal. See, e.g., Canonico et al, Am J Respir Cell Mol Biol 10:24-29, 1994; Tsan et al, Am J Physiol 268; Alton et al., Nat Genet. 5:135-142, 1993 and U.S. Pat. No. 5,679,647 by Carson et al.

[0259] The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs, which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.

[0260] The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Naked DNA or DNA associated with a delivery vehicle, e.g., liposomes, can be administered to several sites in a subject (see below). In a preferred method of the invention, the DNA constructs are delivered using viral vectors. The transgene may be incorporated into any of a variety of viral vectors useful in gene therapy, such as recombinant retroviruses, adenovirus, adeno-associated virus (AAV), and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. While various viral vectors may be used in the practice of this invention, AAV- and adenovirus-based approaches are of particular interest. Such vectors are generally understood to be the recombinant gene delivery system of choice for the transfer of exogenous genes in vivo, particularly into humans.

[0261] It is possible to limit the infection spectrum of viruses by modifying the viral packaging proteins on the surface of the viral particle (see, for example PCT publications WO93/25234, WO94/06920, and WO94/11524). For instance, strategies for the modification of the infection spectrum of viral vectors include: coupling antibodies specific for cell surface antigens to envelope protein (Roux et al., (1989) PNAS USA 86:9079-9083; Julan et al., (1992) J. Gen Virol 73:3251-3255; and Goud et al., (1983) Virology 163:251-254); or coupling cell surface ligands to the viral envelope proteins (Neda et al., (1991) J. Biol. Chem. 266:14143-14146). Coupling can be in the form of the chemical cross-linking with a protein or other variety (e.g. lactose to convert the env protein to an asialoglycoprotein), as well as by generating fusion proteins (e.g. single-chain antibody/env fusion proteins). This technique, while useful to limit or otherwise direct the infection to certain tissue types, and can also be used to convert an ecotropic vector in to an amphotropic vector.

[0262] The expression of a polypeptide of interest or equivalent thereof in cells of a patient to which a nucleic acid encoding the polypeptide was administered can be determined, e.g., by obtaining a sample of the cells of the patient and determining the level of the polypeptide in the sample, relative to a control sample. The successful administration to a patient and expression of the polypeptide or an equivalent thereof in the cells of the patient can be monitored by determining the expression of at least one gene characteristic of R.A., and preferably by determining an expression profile including most of the genes which are up- or down-regulated in R.A., as described herein.

[0263] (ii) Administration of a Polypeptide of Interest to a Subject

[0264] In another embodiment, a polypeptide of interest, or an equivalent thereof, e.g., a functional fragment thereof, is administered to the subject such that it reaches the diseased cells of R.A., and traverses the cellular membrane. Polypeptides can be synthesized in prokaryotes or eukaryotes or cells thereof and purified according to methods known in the art. For example, recombinant polypeptides can be synthesized in human cells, mouse cells, rat cells, insect cells, yeast cells, and plant cells. Polypeptides can also be synthesized in cell free extracts, e.g., reticulocyte lysates or wheat germ extracts. Purification of proteins can be done by various methods, e.g., chromatographic methods (see, e.g., Robert K Scopes Protein Purification: Principles and Practice Third Ed. Springer-Verlag, N.Y. 1994). In one embodiment, the polypeptide is produced as a fusion polypeptide comprising an epitope tag consisting of about six consecutive histidine residues. The fusion polypeptide can then be purified on a Ni column. By inserting a protease site between the tag and the polypeptide, the tag can be removed after purification of the peptide on the Ni column. These methods are well known in the art and commercial vectors and affinity matrices are commercially available.

[0265] Administration of polypeptides can be done by mixing them with liposomes, as described above. The surface of the liposomes can be modified by adding molecules that will target the liposome to the desired physiological location.

[0266] In one embodiment, a polypeptide is modified so that its rate of traversing the cellular membrane is increased. For example, the polypeptide can be fused to a second peptide which promotes transcytosis, e.g., uptake of the peptide by cells. In one embodiment, the peptide is a -portion of the HIV transactivator (TAT) protein, such as the fragment corresponding to residues 37-62 or 48-60 of TAT, portions which are rapidly taken up by cell in vitro (Green and Loewenstein, (1989) Cell 55:1179-1188). In another embodiment, the internalizing peptide is derived from the Drosophila antennapedia protein, or homologs thereof. The 60 amino acid long homeodomain of the homeo-protein antennapedia has been demonstrated to translocate through biological membranes and can facilitate the translocation of heterologous polypeptides to which it is couples. Thus, polypeptides can be fused to a peptide consisting of about amino acids 42-58 of Drosophila antennapedia or shorter fragments for transcytosis. See for example Derossi et al. (1996) J Biol Chem 271:18188-18193; Derossi et al. (1994) J Biol Chem 269:10444-10450; and Perez et al. (1992) J Cell Sci 102:717-722.

[0267] (iii) Use of Agents Stimulating Transcription or Polypeptide Activity

[0268] In another embodiment, a pharmaceutical composition comprising a compound that stimulates the level of expression of a gene of interest or the activity of the polypeptide in a cell is administered to a subject, such that the level of expression of the gene in the diseased cells is increased or even restored, and R.A. is improving in the subject. Compounds may be known in the art or can be identified as further described herein.

[0269] 4.3. Drug Design and Discovery of Therapeutics

[0270] As described above, genes whose modulation of expression improve R.A. can be used as targets in drug design and discovery. For example, assays can be conducted to identify molecules that modulate the expression and or activity of genes which are up- or down-regulated in R.A.

[0271] In one embodiment, an agent which modulates the expression of a gene of interest is identified by contacting cells expressing the gene with test compounds, and monitoring the level of expression of the gene. Alternatively, compounds which modulate the expression of gene X can be identified by conducting assays using the promoter region of a gene and screening for compounds which modify binding of proteins to the promoter region. The nucleotide sequence of the promoter may be described in a publication or available in GenBank. Alternatively, the promoter region of the gene can be isolated, e.g., by screening a genomic library with a probe corresponding to the gene. Such methods are known in the art.

[0272] Inhibitors of the polypeptide can also be agents which bind to the polypeptide, and thereby prevent it from functioning normally, or which degrades or causes the polypeptide to be degraded. For example, such an agent can be an antibody or derivative thereof which interacts specifically with the polypeptide. Preferred antibodies are monoclonal antibodies, humanized antibodies, human antibodies, and single chain antibodies. Such antibodies can be prepared and tested as known in the art.

[0273] If a polypeptide of interest binds to another polypeptide, drugs can be developed which modulate the activity of the polypeptide by modulating its binding to the other polypeptide (referred to herein as binding partner). Cell-free assays can be used to identify compounds which are capable of interacting with the polypeptide or binding partner, to thereby modify the activity of the polypeptide or binding partner. Such a compound can, e.g., modify the structure of the polypeptide or binding partner and thereby effect its activity. Cell-free assays can also be used to identify compounds which modulate the interaction between the polypeptide and a binding partner. In a preferred embodiment, cell-free assays for identifying such compounds consist essentially in a reaction mixture containing the polypeptide and a test compound or a library of test compounds in the presence or absence of a binding partner. A test compound can be, e.g., a derivative of a binding partner, e.g., a biologically inactive peptide, or a small molecule.

[0274] Accordingly, one exemplary screening assay of the present invention includes the steps of contacting the polypeptide or functional fragment thereof or a binding partner with a test compound or library of test compounds and detecting the formation of complexes. For detection purposes, the molecule can be labeled with a specific marker and the test compound or library of test compounds labeled with a different marker. Interaction of a test compound with a polypeptide or fragment thereof or binding partner can then be detected by determining the level of the two labels after an incubation step and a washing step. The presence of two labels after the washing step is indicative of an interaction.

[0275] An interaction between molecules can also be identified by using real-time BIA (Biomolecular Interaction Analysis, Pharmacia Biosensor AB) which detects surface plasmon resonance (SPR), an optical phenomenon. Detection depends on changes in the mass concentration of macromolecules at the biospecific interface, and does not require any labeling of interactants. In one embodiment, a library of test compounds can be immobilized on a sensor surface, e.g., which forms one wall of a micro-flow cell. A solution containing the polypeptide, functional fragment thereof, polypeptide analog or binding partner is then flown continuously over the sensor surface. A change in the resonance angle as shown on a signal recording, indicates that an interaction has occurred. This technique is further described, e.g., in BlAtechnology Handbook by Pharmacia.

[0276] Another exemplary screening assay of the present invention includes the steps of (a) forming a reaction mixture including: (i) a polypeptide of interest, (ii) a binding partner, and (iii) a test compound; and (b) detecting interaction of the polypeptide and the binding partner. The polypeptide and binding partner can be produced recombinantly, purified from a source, e.g., plasma, or chemically synthesized, as described herein. A statistically significant change (potentiation or inhibition) in the interaction of the polypeptide and binding partner in the presence of the test compound, relative to the interaction in the absence of the test compound, indicates a potential agonist (mimetic or potentiator) or antagonist (inhibitor) of the polypeptide bioactivity for the test compound. The compounds of this assay can be contacted simultaneously. Alternatively, the polypeptide can first be contacted with a test compound for an appropriate amount of time, following which the binding partner is added to the reaction mixture. The efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. In the control assay, isolated and purified polypeptide or binding partner is added to a composition containing the binding partner or polypeptide, and the formation of a complex is quantified in the absence of the test compound.

[0277] Complex formation between a polypeptide and a binding partner may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled polypeptides or binding partners, by immunoassay, or by chromatographic detection.

[0278] Typically, it will be desirable to immobilize either the polypeptide or its binding partner to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of the polypeptide to a binding partner, can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, glutathione-S-transferase/polypeptide (GST/polypeptide) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the binding partner, e.g. an ³⁵S-labeled binding partner, and the test compound, and the mixture incubated under conditions conducive to complex formation, e.g. at physiological conditions for salt and pH, though slightly more stringent conditions may be desired. Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintilant), or in the supernatant after the complexes are subsequently dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of the polypeptide or binding partner found in the bead fraction quantitated from the gel using standard electrophoretic techniques such as described in the appended examples.

[0279] Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, either the polypeptide or its cognate binding partner can be immobilized utilizing conjugation of biotin and streptavidin. For instance, biotinylated polypeptide molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with the polypeptide can be derivatized to the wells of the plate, and the polypeptide trapped in the wells by antibody conjugation. As above, preparations of a binding partner and a test compound are incubated in the polypeptide X presenting wells of the plate, and the amount of complex trapped in the well can be quantitated. Exemplary methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the binding partner, or which are reactive with the polypeptide and compete with the binding partner; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the binding partner, either intrinsic or extrinsic activity. In the instance of the latter, the enzyme can be chemically conjugated or provided as a fusion protein with the binding partner. To illustrate, the binding partner can be chemically cross-linked or genetically fused with horseradish peroxidase, and the amount of polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. 3,3-diamino-benzadine terahydrochloride or 4-chloro-1-napthol. Likewise, a fusion protein comprising the polypeptide and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using 1-chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem 249:7130).

[0280] For processes that rely on immunodetection for quantitating one of the proteins trapped in the complex, antibodies against the protein can be used. Alternatively, the protein to be detected in the complex can be epitope tagged in the form of a fusion protein which includes, in addition to the polypeptide sequence, a second polypeptide for which antibodies are readily available (e.g. from commercial sources). For instance, the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety. Other useful epitope tags include myc-epitopes (e.g., see Ellison et al. (1991) J Biol Chem 266:21150-21157) which includes a 10-residue sequence from c-myc, as well as the pFLAG system (International Biotechnologies, Inc.) or the pEZZ-protein A system (Pharmacia, N.J.).

[0281] 4.4. Drug Design Using Microarrays

[0282] The invention also provides methods for designing and optimizing drugs for R.A., e.g., those which have been identified as described herein. In one embodiment, compounds are screened by comparing the expression level of one or more genes which are up- or down-regulated in R.A. in a cell characteristic of R.A. treated with a drug relative to their expression in a reference cell. In an even more preferred embodiment, the expression level of the genes is determined using microarrays, by comparing the gene expression profile of a cell treated the with a test compound with the gene expression profile of a normal counterpart cell (a reference profile). Optionally the expression profile is also compared to that of a cell characteristic of R.A. The comparisons are preferably done by introducing the gene expression profile data of the cell treated with the drug into a computer system comprising reference gene expression profiles which are stored in a computer readable form, using appropriate aglorithms. Test compounds will be screened for those which alter the level of expression of genes which are up- or down-regulated in R.A., so as to bring them to a level that is similar to that in a cell of the same type as a cell characteristic of R.A. are. Such compounds, i.e., compounds which are capable of normalizing the expression of at least about 10%, preferably at least about 20%, 50%, 70%, 80% or 90% of the genes which are up- or down-regulated in R.A., are candidate therapeutics.

[0283] The efficacy of the compounds can then be tested in additional in vitro assays and in vivo, in animal models. Animal models of R.A. include the collagen-induced arthritis mouse model (see Examples). The test compound is administered to the test animal and one or more symptoms of the disease are monitored for improvement of the condition of the animal. Expression of one or more genes which are up- or down-regulated in R.A. can also be measured before and after administration of the test compound to the animal. A normalization of the expression of one or more of these genes is indicative of the efficiency of the compound for treating R.A. in the animal.

[0284] The toxicity of the candidate therapeutic compound, such as resulting from a stress-related response, can be evaluated, e.g., by determining whether it induces the expression of genes known to be associated with a toxic response. Expression of such toxicity related genes may be determined in different cell types, preferably those that are known to express the genes. In a preferred method, microarrays are used for detecting changes in gene expression of genes known to be associated with a toxic response. Changes in gene expression may be a more sensitive marker of human toxicity than routine preclinical safety studies. It was shown, e.g., that a drug which was found not be to toxic in laboratory animals was toxic when administered to humans. When gene profiling was studied in cells contacted with the drug, however, it was found that a gene, whose expression is known to correlate to liver toxicity, was expressed (see below).

[0285] Such microarrays will comprise genes which are modulated in response to toxicity or stress. An exemplary array that can be used for that purpose is the Affymetrix Rat Toxicology U34 array, which contains probes of the following genes: metabolism enzymes, e.g., CYP450s, acetyltransferases, and sulfotransferases; growth factors and their receptors, e.g., IGFs, interleukins, NGTs, TGFs, and VEGT; kinases and phosphatases, e.g, lipid kinases, MAFKs, and stress-activated kinases; nuclear receptors, e.g., retinoic acid, retinoid X and PPARs; transcription factors, e.g., oncogenes, STATs, NF-kB, and zinc finger proteins; apoptosis genes, e.g., Bcl-2 genes, Bad, Bax, Caspases and Fas; stress response genes, e.g., heat-shock proteins and drug transporters; membrane proteins, e.g., gap-junction proteins and selectins; and cell-cycle regulators, e.g., cyclins and cyclin-associated proteins. Other genes included in the microarrays are only known because they contain the nucleotide sequence of an EST and because they have a connection with toxicity.

[0286] In one embodiment, a drug of interest is incubated with a cell, e.g., a cell in culture, the RNA is extracted, and expression of genes is analyzed with an array containing genes which have been shown to be up- or down-regulated in response to certain toxins. The results of the hybridization are then compared to databases containing expression levels of genes in response to certain known toxins in certain organisms. For example, the GeneLogic ToxExpress database can be used for that purpose. The information in this database was obtained in least in part from the use of the Affymetrix GeneChip rat and human probe arrays with samples treated in vivo or in vitro with known toxins. The database contains levels of expression of liver genes in response to known liver toxins. These data were obtained by treating liver samples from rats treated in vivo with known toxins, and comparing the level of expression of numerous genes with that in rat or human primary hepatocytes treated in vitro with the same toxin. Data profiles can be retrieved and analyzed with the GeneExpress database tools, which are designed for complex data management and analysis. As indicated on the Affymetrix (Santa Clara, Calif.) website, the GeneLogic, Inc. (Gaithersburg, Md.) has preformed proof of concept studies showing the changes in gene expression levels can predict toxic events that were not identified by routine preclinical safety testing. GeneLogic tested a drug that had shown no evidence of liver toxicity in rats, but that later showed toxicity in humans. The hybridization results using the Affymetrix GeneChip and GeneExpress tools showed that the drug caused abnormal elevations of alanine aminotransferase (ALT), which indicates liver injury, in half of the patients who had used the drug.

[0287] In one embodiment of the invention, the drug of interest is administered to an animal, such as a mouse or a rat, at different doses. As negative controls, animals are administered the vehicle alone, e.g., buffer or water. Positive controls can consist of animals treated with drugs known to be toxic. The animals can then be sacrificed at different times, e.g., at 3, 6, and 24 hours, after administration of the drug, vehicle alone or positive control drug, mRNA extracted from a sample of their liver; and the mRNA analyzed using arrays containing nucleic acids of genes which are likely to be indicative of toxicity, e.g., the Affymetrix Rat Toxicology U34 assay. The hybridization results can then be analyzed using computer programs and databases, as described above.

[0288] In addition, toxicity of a drug in a subject can be predicted based on the alleles of drug metabolizing genes that are present in a subject. Accordingly, it is known that certain enzymes, e.g., cytochrome p450 enzymes, i.e., CYP450, metabolize drugs, and thereby may render drugs which are innocuous in certain subjects, toxic in others. A commercially available array containing probes of different alleles of such drug metabolizing genes can be obtained, e.g., from Affymetrix (Santa Clara, Calif.), under the name of GeneChip CYP450 assay.

[0289] Thus, a drug for R.A. identified as described herein can be optimized by reducing any toxicity it may have. Compounds can be derivatized in vitro using known chemical methods and tested for expression of toxicity related genes. The derivatized compounds must also be retested for normalization of expression levels of genes which are up- or down-regulated in R.A. For example, the derivatized compounds can be incubated with diseased cells of R.A., and the gene expression profile determined using microarrays. Thus, incubating cells with derivatized compounds and measuring gene expression levels with a microarray that contains the genes which are up- or down-regulated in R.A. and a microarray containing toxicity related genes, compounds which are effective in treating R.A. and which are not toxic can be developed. Such compounds can further be tested in animal models as described above.

[0290] In another embodiment of the invention, a drug is developed by rational drug design, i.e., it is designed or identified based on information stored in computer readable form and analyzed by algorithms. More and more databases of expression profiles are currently being established, numerous ones being publicly available. By screening such databases for the description of drugs affecting the expression of at least some of the genes which are up- or down-regulated in R.A. in a manner similar to the change in gene expression profile from a cell characteristic of R.A. to that of a normal counterpart cell, compounds can be identified which normalize gene expression in a cell characteristic of R.A. Derivatives and analogues of such compounds can then be synthesized to optimize the activity of the compound, and tested and optimized as described above.

[0291] Compounds identified by the methods described above are within the scope of the invention. Compositions comprising such compounds, in particular, compositions comprising a pharmaceutically efficient amount of the drug in a pharmaceutically acceptable carrier are also provided. Certain compositions comprise one or more active compounds for treating R.A.

[0292] The invention also provides methods for designing therapeutics for treating diseases that are different from R.A., but related thereto. Related diseases may in fact have a gene expression profile, which even though not identical to that of R.A., will show some homology, so that drugs for treating R.A. can be used for treating the related disease or for starting the research of compounds for treating the related disease. A compound for treating R.A. can be derivatized and tested as further described herein.

[0293] 4.5. Exemplary Therapeutic Compositions

[0294] Therapeutic compositions include the compounds described herein, e.g., in the context of therapeutic treatments of R.A. Therapeutic compositions may comprise one or more nucleic acids encoding a polypeptide characteristic of R.A., or equivalents thereof. The nucleic acids may be in expression vectors, e.g., viral vectors. Other compositions comprise one or more polypeptides characteristic of R.A., or equivalents thereof. Yet other compositions comprise nucleic acids encoding antisense RNA, or ribozymes, siRNAs or RNA aptamers. Also within the scope of the invention are compositions comprising compounds identified by the methods described herein. The compositions may comprise pharmaceutically acceptable excipients, and may be contained in a device for their administration, e.g., a syringe.

[0295] 4.6. Administration of Compounds and Compositions of the Invention

[0296] In a preferred embodiment, the invention provides a method for treating a subject having R.A., comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a compound of the invention.

[0297] 4.6.1. Effective Dose

[0298] Compounds of the invention refer to small molecules, polypeptides, peptide mimetics, nucleic acids or any other molecule identified as potentially useful for treating R.A.

[0299] Toxicity and therapeutic efficacy of compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (The Dose Lethal To 50% Of The Population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in ordei to minimize potential damage to healthy cells and, thereby, reduce side effects.

[0300] Data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0301] 4.6.2. Formulation

[0302] Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration. In one embodiment, the compound is administered locally, at the site where the diseased cells are present, i.e., in the blood or in a joint.

[0303] The compounds of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, Pa. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.

[0304] For oral administration, the pharmaceutical compositions may take the form of, for example, tablets, lozanges, or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

[0305] For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0306] The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0307] The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

[0308] In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0309] Administration, e.g., systemic administration, can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the compounds of the invention can be formulated into ointments, salves, gels, or creams as generally known in the art. A wash solution can be used locally to treat an injury or inflammation to accelerate healing.

[0310] In clinical settings, a gene delivery system for a gene of interest can be introduced into a patient by any of a number of methods, each of which is familiar in the art. For instance, a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g., by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the recombinant gene is more limited with introduction into the subject or animal being quite localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Pat. No. 5,328,470) or by stereotactic injection (e.g., Chen et al. (1994) PNAS 91: 3054-3057). A nucleic acid, such as one encoding a polypeptide of interest or homologue thereof can be delivered in a gene therapy construct by electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20:105-115). Gene therapy can be conducted in vivo or ex vivo.

[0311] The pharmaceutical preparation of the gene therapy construct or compound of the invention can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle or compound is imbedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.

[0312] The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

[0313] 4. Exemplary Kits

[0314] The invention further provides kits for determining the expression level of genes characteristic of disease B. The kits may be useful for identifying subjects that are predisposed to developing R.A. or who have R.A., as well as for identifying and validating therapeutics for R.A. In one embodiment, the kit comprises a computer readable medium on which is stored one or more gene expression profiles of diseased cells of R.A., or at least values representing levels of expression of one or more genes which are up- or down-regulated in R.A. in a diseased cell. The computer readable medium can also comprise gene expression profiles of counterpart normal cells, diseased cells treated with a drug, and any other gene expression profile described herein. The kit can comprise expression profile analysis software capable of being loaded into the memory of a computer system.

[0315] A kit can comprise a microarray comprising probes of genes which are up- or down-regulated in R.A. A kit can comprise one or more probes or primers for detecting the expression level of one or more genes which are up- or down-regulated in R.A. and/or a solid support on which probes attached and which can be used for detecting expression of one or more genes which are up- or down-regulated in R.A. in a sample. A kit may further comprise nucleic acid controls, buffers, and instructions for use.

[0316] Other kits provide compositions for treating R.A. For example, a kit can also comprise one or more nucleic acids corresponding to one or more genes which are up- or down-regulated in R.A., e.g., for use in treating a patient having R.A. The nucleic acids can be included in a plasmid or a vector, e.g., a viral vector. Other kits comprise a polypeptide encoded by a gene characteristic of R.A. or an antibody to a polypeptide. Yet other kits comprise compounds identified herein as agonists or antagonists of genes which are up- or down-regulated in R.A. The compositions may be pharmaceutical compositions comprising a pharmaceutically acceptable excipient.

[0317] The present invention is further illustrated by the following examples which should not be construed as limiting in any way. The contents of all cited references including literature references, issued patents, published and non published patent applications as cited throughout this application are hereby expressly incorporated by reference.

[0318] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. (See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (RL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); , Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986) (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

[0319] This Example describes the identification of several genes which are up- or downregulated in peripheral blood mononuclear cells (PBMCs) of subjects having rheumatoid arthritis (R.A.) relative to expression in PBMCs of normal subjects.

[0320] PMBCs were isolated form 9 patients with R.A. and 13 normal volunteers as follows. Eight mls of blood were drawn into a CPT Vacutainer tube which was inverted several times. The tube was centrifuged at 1500 g (2700 rpm) in a swinging bucket rotor at room temperature. The serum was removed and PBMCs were transferred to a 15 ml conical centrifuge tube. The cells were washed with the addition of phosphate buffered saline (PBS) and centrifuged at 450 g (1200 rpm) for 5 minutes. The supernatant was discarded and the wash procedure was repeated once more. After removal of the supernatant, total RNA was isolated with the use of the RNeasy minikit, (Qiagen,Hidden,Germany) according to the manufacturers procedure.

[0321] RNA was analyzed on oligonucleotide arrays composed of 6,800 and 12,000 human genes (Affymetrix Hu6800 and HgU95A chip sets, respectively), as follows.

[0322] Target nucleic acid for hybridization was prepared as follows. Total RNA was prepared for hybridization by denaturing 5 g of total RNA from PBMC's for 10 minutes at 70 C. with 100 pM T7/T24-tagged oligo-dt primer (synthesized at Genetics Institute, Cambridge, Mass.), and cooled on ice. First strand cDNA synthesis was performed under the following buffer conditions: 1 first strand buffer (Invitrogen Life Technologies, Carlsbad, Calif.), 10 mM DTT(GIBCO/Invitrogen), 500 M of each dNTP (Invitrogen Life Technologies), 400 units of Superscript RT 11 (Invitrogen Life Technologies) and 40 units RNAse inhibitor (Ambion,Austin, Tex.). The reaction proceeded at 47 C. for 1 hour. Second strand cDNA was synthesized with the addition of the following reagents at the final concentrations listed: 1 second strand buffer (Invitrogen Life Technologies), an additional 200 M of each dNTP (Invitrogen Life Technologies), 40 units of E. coli DNA polymerase I (Invitrogen Life Technologies), 2 units E. coli RNaseH (Invitrogen Life Technologies), and 10 units of E. coli DNA ligase. The reaction proceeded at 15.8 C. for 2 hours and during the last five minutes of this reaction 6 units of T4 DNA polymerase (New England Biolabs, Beverly, Mass.) was added. The resulting double stranded cDNA was purified with the use of BioMag carboxyl terminated particles as follows: 0.2 mg of BioMag particles (Polysciences Inc., Warrington, PA) were equilibrated by washing three times with 0.5M EDTA and resuspended at a concentration of 22.2 mg/ml in 0.5M EDTA. The double stranded cDNA reaction was diluted to a final concentration of 10% PEG/1.25M NaCl and the bead suspension was added to a final bead concentration of 0.614 mg/ml. The reaction was incubated at room temperature for 10 minutes. The cDNA/bead complexes were washed with 300l of 70% ethanol, the ethanol was removed and the tubes were allowed to air dry. The cDNA was eluted with the addition of 20 l of 10 mM Tris-acetate, pH 7.8, incubated for 2-5 minutes and the cDNA containing supernatant was removed. 10l of purified double stranded cDNA was then added to an in vitro transcription (IVT) solution which contained, 1 IVT buffer (Ambion, Austin, Tex.) 5,000 units T7 RNA polymerase (Epicentre Technologies, Madison, Wis.), 3 mM GTP, 1.5 mM ATP, 1.2 mM CTP and 1.2 mM UTP (Amersham/Pharmacia,), 0.4 mM each bio-16 UTP and bio-11 CTP (Enzo Diagnostics, Farmingdale, NY), and 80 units RNase inhibitor (Ambion, Austin, Tex.). The reaction proceeded at 37 C. for 16 hours. Labeled RNA was purified with the use of an RNeasy (Qiagen). The RNA yield was quantitated by measuring absorbance at 260 nm.

[0323] Array Hybridization and Detection of Fluorescence was performed as follows. 12 g of IVT was fragmented in 40 mM Tris-actetate, pH 8.0, 100 mM potassium acetate, and 30 mM magnesium acetate for 35 minutes at 94 C. The fragmented, labeled RNA probes were diluted in hybridization buffer at a final composition of 1 2-N-Morpholinoethanesulfonic acid (MES (buffer (pH 6.5), 50 pM Bio948 (control biotinylated oligo that hybridizes to landmark features on the probe array (Genetics Institute,Cambridge, Mass.)), 100 g/ml herring sperm DNA (Promega, Madison, Wis.), 500 g/ml acetylated BSA (Invitrogen Life Technologies) and 1 l/g standard curve reagent (Proprietary reagent supplied by Gene Logic,Gaithersburg, Md.). This hybridization solution was pre-hybridized with two glass beads (Fisher Scientific, Pittsburgh, Pa.) at 45 C. overnight. The hybridization solution was removed to a clean tube, heated for 1-2 min at 95 C. and microcentrifuged on high for 2 minutes to pellet insoluble debris. Affymetrix oligonucleotide array cartridges (human 6800 array P/N900183 and human U95A (Affymetrix, Santa Clara, Calif.)) were pre-wet with non-stringent wash buffer (0.9M NaCl, 60 mM sodium phosphate, 6 mM EDTA and 0.01% Tween20) and incubated at 45 C. with rotation for 5-10 minutes. Buffer was removed from the Affymetrix cartridges and the arrays were hybridized with 180 l of the hybridization solution at 45 C. rotating at 45-60 rpm overnight. After overnight incubation, the hybridization solutions were removed and the cartridges were filled with non-stringent wash buffer. The array cartridges were washed using an Affymetrix fluidics station according with 10 cycles of 2 mixes/cycle non-stringent wash buffer at 25 C. followed by 4 cycles of 15 mixes/cycle stringent wash buffer (100 mM MES, 0.1M Na, 0.01% Tween20 and 0.005% antifoam). The probe array was then first stained for 10 minutes at 25 C. in SAPE solution (100 mM MES, 1M Na, 0.05% Tween20, 0.005% antifoam, 2mg/ml acetylated BSA (Invitrogen Life Technologies) and 10 g/ml R phycoerythrin streptavidin (Molecular Probes, Eugene, Oreg.)). After first staining, the probe array was washed for 10 cycles of 4 mixes/cycle with non-stringent wash buffer at 25 C. The probe array was then stained for 10 minutes at 25 C. in antibody solution (100 mM MES, IM Na, 0.05% Tween20, 0.005% antifoam, 2 mg/ml acetylated BSA (Invitrogen Life Technologies), 100 g/ml Goat IgG (SIGMA,St. Louis, Mo.) and 3 g/ml biotinylated anti-streptavidin antibody(goat) (Vector Laboratories). Following the second stain, the probe array is stained again for an additional 10 minutes at 25 C. in SAPE solution. Finally, the probe array is washed for 15 cycles of 4 mixes/cycle with non-stringent wash buffer at 30 C. Arrays were scanned using an Affymetrix gene chip scanner (Affymetrix, Santa Clara, Calif.). The scanner contains a scanning confocal microscope and uses an argon ion laser for the excitation source and emission is detected by a photomultipler tube at 530 nm bandpass filter (fluorscein 0 or 560 longpass filter (phycoerythrin).

[0324] Data analysis was performed using GENECHIP 3.0 or 4.0 software with normalizing/scaling to internal controls. For each patient, two parameters were used to filter the data: 1) Absolute Decision, which indicates the presence (P) or absence (A) of RNA of a gene within a given RNA sample; 2) Frequency, which measures the number of copies of a given RNA within a RNA sample, and this value is expressed as Copies per million transcripts. If a gene was called Absent, its frequency was not used to calculate the average frequency of the gene. If a gene was called Absent for more than four patients in the Hu6800 data; more than two patients in the HgU95A data, or more than six normals, no average frequency was calculated. Genes that had average frequencies for normal volunteers only were tagged Normal while those that had average frequencies for patients only were tagged Disease. The fold change in gene expression was calculated by dividing the average gene frequency of the patients by that of the normals. Genes selected for analysis met the following criteria: 1) a fold change greater than 1.95 or less than 1.95 and 2) those genes tagged as either Normal or Disease.

[0325] The results are set forth in Tables 1 and 2, which are attached at the end of the written description as pages 1-66 and 1-5, respectively, and specifically incorporated by reference herein. The data in one of the columns indicates the average frequency (Avg FC) in the patients divided by the average frequency in non-diseased subjects. An increased expression in patients relative to normals is indicated by the absence of a sign in front of the Avg FC RA/normal number, whereas a decrease in expression in patients relative to subjects is indicated by the presence of a sign in front of the number (negative values are listed at the end of the Tables). DIV/0 indicates an infinite number, resulting from expression levels in normals that are undetectable. Accession numbers, Affymetrix identifiers (qualifiers) and gene name are depicted in the Tables. The sequence of most genes are available on GenBank. Genes whose Accession Number is characterized by HT- . . . or HG- . . . are available in the TIGR database on the internet. Genes that seemed of particular significance are highlighted or marked with a star.

[0326] Table 1 shows genes identified using the Hu6800 Affymetrix chip. Table 2 shows the genes of the Hu6800 chip that gave a positive signal and that encode a kinase or a phosphatase. Table 3 shows the genes that represent 1.95 fold or greater change in patients compared to normal, identified using the U95 chip sets. Table 3 is attached at the end of the written description as pages 1-36, and is specifically incorporated by reference herein. The Tables indicate the chromosomal localization of the genes.

[0327] Interestingly, numerous genes which are up-regulated in R.A. patients are located on human chromosome 6 in a region (6p21.3) that contains the genes of the major histocompatibility complex (MHC) and tumor necrosis factor (TNF), suggesting that these genes may be of importance in R.A. Other genes of interest are kinases and phosphatases. Yet other genes which are of interest are those that are up- or down-regulated by a factor of at least two and those in which the ratio of induction could not be determined since no detectable signal was obtained in the normal controls (genes indicated as DIV/0). Other genes of interest are those that are highlighted or marked with a star in the Tables.

[0328] This example describes the identification of several genes which are up- or down-regulated in mice having collagen induced arthritis (CIA) relative to normal mice. Gene expression was measured in paws of mice; PBMCs and in synovium.

[0329] CIA is an accepted animal model for rheumatoid arthritis. The disease was induced as follows in mice. Male DBA/1 (Jackson Laboratories, Bar Harbor, Me.) mice were used for all experiments. Arthritis was induced with the use of either chicken collagen type II (Sigma, St.Louis, Mo.) or bovine collagen type II (Chondrex, Redmond, Wash.). Chicken collagen was dissolved in 0.01 M acetic acid and emulsified with an equal volume of Complete Freund's adjuvant (CFA; Difco Labs, Detroit, Mich.) containing 1 mg/ml Mycobacterium tuberculosis (strain H37RA). 200 g of chicken collagen was intradermally injected in the base of the tail on day 0. On day 21, mice were injected intraperitoneally with a PBS solution containing 100 g of chicken collagen II. Bovine collagen type II (Chondrex, Redmond, Wash.) was dissolved in 0.1 M acetic acid and emulsified in an equal volume of CFA (Sigma) containing 1 mg/ml Mycobacterium tuberculosis (strain H37RA). 200 g of bovine collagen was injected subcutaneously in the base of the tail on day 0. On day 21, mice were injected subcutaneously, in the base of the tail, with a solution containing 200 g of bovine collagen in 0.1 M acetic acid that had been mixed with an equal volume of Incomplete Freund's adjuvant (Sigma). Naive animals received the same sets of injections, minus collagen. Mice were monitored at least three times a week for disease progression. Individual limbs were assigned a clinical score based on the index: 0normal; Pprearthritic, characterized by focal erythema on the tips of digits.; 1visible erythema accompanied by 1-2 swollen digits.; 2pronounced erythema, characterized by paw swelling and/or multi digit swelling.; 3massive swelling extending into ankle or wrist joint.; 4difficulty in use of limb or joint rigidity. The sum of all limb scores for any given mouse could yield a maximum total body score of 16.

[0330] At various stages of disease, animals were euthanized and tissues were harvested. In one series of examples, at least two paws from each animal were flash frozen in liquid nitrogen for RNA analyses. Frozen mouse paws were pulverized to a fine powder with the use of a mortar and pestle and liquid nitrogen. RNA was purified using the Promega RNAgents Total RNA Isolation System (Promega, Madison, Wis.). The RNA was further purified using the RNeasy minikit. The remaining paws were fixed in 10% formalin for histology.

[0331] In another series of examples, gene expression was determined in PBMCs of mice. Blood was collected via cardiac puncture into EDTA coated collection tubes. Blood samples were pooled according to similar total body scores (normal, prearthritic, scores 1, 3, 4, 5, 6, and 7-9) into a 15 ml conical tube. The blood was diluted 1:1 with PBS that contained 2 mM EDTA, and layered on an equal volume of Lympholyte-M (Cedar Lane Labs, Homby, Ontario, Canada). The mixture was centrifuged, with no brake, for 20 minutes at 1850 rpm in a Sorvall centrifuge, (model RT 6000D). Cells at the interface were collected and added to a new tube. The cells were washed with the addition of 10 ml PBS, containing 2 mM EDTA, and centrifuged at 1200 rpm for 10 minutes. The wash was repeated two times. To lyse residual red cells, cell pellets were dispersed in 2 ml of cold 0.2% NaCl and incubated on ice for 45-60 seconds. Lysis was terminated with the addition of 2 ml of 1.6% NaCl and the cells were centrifuged at 1200 rpm for 10 minutes. PBMCs were resuspended in 5 ml of PBS, which contained 2 mM EDTA, and counted. Cells were centrifuged at 1200 rpm for 10 minutes, and the supernatant discarded in preparation for RNA isolation. Total RNA was isolated from the PBMCs using the RNeasy minikit (Qiagen, Hidden, Germany).

[0332] In yet another series of examples, RNA was obtained from isolated synovium of the diseased animals. The joint synovium was dissected from diseased and control animals under a dissection scope. Tissues from five or more animals with similar disease scores were pooled and RNA was isolated using the RNeasy kit (Qiagen, Hidden, Germany).

[0333] Gene expression was analyzed on the oligonucleotide arrays Affymetrix murine 11K chip set composed of 11,000 murine genes on two chips, murine 11 KsubA P/N 900188 and murine llKsubB PIN900189.

[0334] Labeled target nucleic acids for hybridization to the chips were prepared as described in the previous Example with 5 g of PBMC RNA or 7 g of RNA from paws or synovial tissue.

[0335] Data analysis was performed using GENECHIP 3.0 software with normalizing/scaling to internal controls. Each experimental sample was compared to a time matched control in a two-file analysis. Next, the data were entered into the GeneSpring (Silicon Genetics, Redwood City, Calif.) analysis program. The data were filtered in a hierarchical fashion. First, the data were grouped according to paw scores. For each score, a list of genes that were called Present in all samples in a given score group and in the control was created. These lists were further refined by removing all genes that were not called either Increasing or Decreasing (defined in the program) in at least a majority of the samples in each score group. These lists were then filtered for genes that showed fold change greater than or equal to 1.95 or less than or equal to 1.95 in either all of the samples, if there were less than five samples, or in greater than 70% of the samples.

[0336] The results of the PBMCs are indicated in Table 4 and the results of the paw examples are indicated in Table 5. Tables 4 and 5 are attached at the end of the written descripion as pages 1-17 and 1-74, respectively, and are specifically incorporated by reference herein. C stands for control; P stands for prearthitic. The columns represent fold changes compared back to the normal. Accession numbers, Affymetrix identifiers (qualifiers) and gene name are depicted in the Tables.

[0337] The results show that several genes, e.g., PTPN18, HMG-1 and SLPI, that are significantly up-regulated in the mouse model, were also significantly up-regulated in human PBMCs of R.A. patients.

[0338] This Example describes the identity of cells expressing genes which are up-regulated in R.A. by in situ hybridization.

[0339] Paws of CIA mice were fixed in 4% paraformaldeyde, pH 7.47, decalcified in 20% EDTA (pH 8.0) and embedded in paraffin for in situ hybridization according to methods known in the art.

[0340] Sense and anti-sense riboprobes for use in the in situ hybridization were produced by generating 2 independent PCR products, as follows. T7 RNA polymerase binding sites were incorporated into the oligonucelotides to insert T7 binding sites at either the 5end of the PCR product for sense riboprobe or the 3end of the PCR product for antisense riboprobe. Digoxygenin labeled probes were prepared with the use of a DIG RNA labeling mix (Roche Diagnostics, Mannheim, Germany), as described by the manufacturer, and T7 RNA polymerase (Roche Diagnostics).

[0341] The probes were obtained by PCR using the following oligonucleotide primers for each of the sense and antisense probe.

[0342] Murine SAA3 Sense Riboprobe:

[0343] Forward primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGAATGAAG	(SEQ ID NO:1)
CCTTCCATTGCCATCATTCTTTGCA3

[0344] Reverse primer:

5TTAGCGGCCGCTCAGTATCTTTTAGGCAGGCCAGC	(SEQ ID NO:2)
AGGTCGGAA3

[0345] The probe sequence covers the entire coding sequence, is 369 nucleotides long and has the following sequence:

[0346] atgaagcctt ccattgccat cattctttgc atcttgatcc tgggagttga cagccaaaga tgggtccagt tcatgaaaga agctggtcaa gggtctagag acatgtggcg agcctactct gacatgaaga aagctaactg gaaaaactca gacaaatact tccatgctcg ggggaactat gatgctgccc ggaggggtcc cgggggagcc tgggctgcta aagtcatcag cgatgccaga gaggctgttc agaagttcac gggacatgga gcagaggact caagagctga ccagtttgcc aatgagtggg gccggagtgg caaagacccc aaccacttcc gacctgctgg cctgcctaaa agatactga (SEQ ID NO: 3)

[0347] Murine SAA3 Anti-Sense Riboprobe:

[0348] Forward primer:

5TTAGAATTCATGAAGCCTTCCATTGCCATCATTCT	(SEQ ID NO:4)
TTGCA3

[0349] Reverse primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGATCAGTA	(SEQ ID NO:5)
TCTTTTAGGCAGGCCAGCAGGTCGGAA3

[0350] The probe sequence covers the entire coding sequence, is 369 nucleotides long and has the following sequence:

[0351] tcagtatctt ttaggcaggc cagcaggtcg gaagtggttg gggtctttgc cactccggcc ccactcattg gcaaactggt cagctcttga gtcctctgct ccatgtcccg tgaacttctg aacagcctct ctggcatcgc tgatgacttt agcagcccag gctcccccgg gacccctccg ggcagcatca tagttccccc gagcatggaa gtatttgtct gagtttttcc agttagcttt cttcatgtca gagtaggctc gccacatgtc tctagaccct tgaccagctt ctttcatgaa ctggacccat ctttggctgt caactcccag gatcaagatg caaagaatga tggcaatgga aggcttcat (SEQ ID NO: 6)

[0352] Murine LST-1 Sense Riboprobe:

[0353] Forward primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGAATGTCT	(SEQ ID NO:7)
GATGACAATGGATCTGGTAACAATTGCA3

[0354] Reverse primer:

5TTAGCGGCCGCTCAAGTGGGTGTGCTCCTGGCGAT	(SEQ ID NO:8)
GCAGGCATA3

[0355] The probe sequence covers the entire coding sequence, has 288 nucleotides and the following sequence:

[0356] atgtctgatg acaatggatc tggtaacaat tgcacaacca atcatttcct gctctatggg agcctgggac tgggagggct cctcctcctg cttgtcatca tcctgttcat ctgcctgtgc gggttcagtc agagagtgaa gagactggaa aggaatgccc aggtctcagg gcaggagccc cactatgcat ctctccagca gctgccagtg tccagtagtg atatcacaga catgaaagaa gacctcagca ctgactatgc ctgcatcgcc aggagcacac ccacttga (SEQ ID NO: 9)

[0357] Murine LST-1 Anti-Sense Riboprobe:

[0358] Forward primer:

5TTAGAATTCATGTCTGATGACAATGGATCTGGTA	(SEQ ID NO:10)
ACAATTGCA3

[0359] Reverse primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGATC	(SEQ ID NO:11)
AAGTGGGTGTGCTCCTGGCGATGCAGGCATA3

[0360] The probe sequence covers the entire coding sequence, is 288nucleotides long and has the following sequence:

tcaagtgggt gtgctcctgg cgatgcaggc	(SEQ ID NO:12)
atagtcagtg ctgaggtctt ctttcatgtc
tgtgatatca ctactggaca ctggcagctg
ctggagagat gcatagtggg gctcctgccc
tgagacctgg gcattccttt ccagtctctt
cactctctga ctgaacccgc acaggcagat
gaacaggatg atgacaagca ggaggaggag
ccctcccagt cccaggctcc catagagcag
gaaatgattg gttgtgcaat tgttaccaga
tccattgtca tcagacat

[0361] Murine FST1 Sense Riboprobe:

[0362] Forward primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGAATGTG	(SEQ ID NO:13)
GAAACGATGGCTGGCGCTCTCGCTG3

[0363] Reverse primer:

	5AGGAACAGACACAGCGATTGC3	(SEQ ID NO:14)

[0364] The probe is 421 nucleotides long and has the following sequence:

[0365] atgtggaaac gatggctggc gctctcgctg gtgaccatcg ccctggtcca cggcgaggag gaacctagaa gcaaatccaa gatctgcgcc aatgtgtttt gtggagctgg cagggaatgt gccgtcacag agaaggggga gcccacgtgc ctctgcattg agcaatgcaa acctcacaag aggcctgtgt gtggcagtaa tggcaagacc tacctcaacc actgtgaact tcatagagat gcctgcctca ctggatccaa gatccaggtt gattatgatg ggcactgcaa agaaaagaag tctgcgagtc catctgccag cccagttgtc tgctatcaag ctaaccgcga tgagctccga cggcgcctca tccagtggct ggaagctgag atcattccag atggctggtt ctctaaaggc a (SEQ ID NO: 15)

[0366] Murine FST1 Anti-Sense Riboprobe:

[0367] Forward primer:

(SEQ ID NO:16)
5GGGGATATCATGTGGAAACGATGGCTGGCGCTCTCGCTGGTGACCAT
3

[0368] Reverse primer (with T7 site):

(SEQ ID NO:17)
5GACTGATAATACGACTCACTATAGGGCGATGCCTTTAGAGAACCAGCC
ATCTGGAATGA3

[0369] The probe is 421 nucleotides long and has the following sequence:

tgcctttaga gaaccagcca tctggaatga tctcagcttc cagccactgg atgaggcgcc gtcggagctc atcgcggtta	(SEQ ID NO:18)
gcttgatagc agacaactgg gctggcagat ggactcgcag acttcttttc tttgcagtgc ccatcataat caacctggat
cttggatcca gtgaggcagg catctctatg aagttcacag tggttgaggt aggtcttgcc attactgcca cacacaggcc
tcttgtgagg tttgcattgc tcaatgcaga ggcacgtggg ctcccccttc tctgtgacgg cacattccct gccagctcca
caaaacacat tggcgcagat cttggatttg cttctaggtt cctcctcgcc gtggaccagg gcgatggtca ccagcgagag
cgccagccat cgtttccaca t

[0370] Murine SLPI Sense Riboprobe:

[0371] Forward primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGAATGAAGTCCTGCGGCCTTTTACCTTTC	(SEQ ID NO:18)
ACGGTG3

[0372] Reverse primer:

(SEQ ID NO:19)
	5AATGCGGCCGCTCACATCGGGGGCAGGCAGACTTTCCCAC3

[0373] The probe sequence covers the entire coding sequences, is 396 nucleotides long and has the following sequence:

atgaagtcct gcggcctttt acctttcacg gtgctccttg ctctggggat cctggcaccc tggactgtgg aaggaggcaa	(SEQ ID NO:20)
aaatgatgct atcaaaatcg gagcctgccc tgctaaaaag cctgcccagt gccttaagct tgagaagcca caatgccgta
ctgactggga gtgcccggga aagcagaggt gctgccaaga tgcttgcggt tccaagtgcg tgaatcctgt tcccattcgc
aaaccagtgt ggaggaagcc tgggaggtgc gtcaaaactc aggcaagatg tatgatgctt aaccctccca atgtctgcca
gagggacggg cagtgtgacg gcaaatacaa gtgctgtgag ggtatatgtg ggaaagtctg cctgcccccg atgtga

[0374] Murine SLPI Anti-Sense Riboprobe:

[0375] Forward primer:

(SEQ ID NO:21)
	5ATTGAATTCATGAAGTCCTGCGGCCTTTTACCTTTCACGGTGC3

[0376] Reverse primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGATCACATCGGGGGCAGGCAGACTTTCC	(SEQ ID NO:22)
CAC3

[0377] The probe sequence covers the entire coding equence, is 396 nucleotides long and has the following sequence:

tcacatcggg ggcaggcaga ctttcccaca tataccctca cagcacttgt atttgccgtc acactgcccg tccctctggc	(SEQ ID NO:23)
agacattggg agggttaagc atcatacatc ttgcctgagt tttgacgcac ctcccaggct tcctccacac tggtttgcga
atgggaacag gattcacgca cttggaaccg caagcatctt ggcagcacct ctgctttccc gggcactccc agtcagtacg
gcattgtggc ttctcaagct taaggcactg ggcaggcttt ttagcagggc aggctccgat tttgatagca tcatttttgc
ctccttccac agtccagggt gccaggatcc ccagagcaag gagcaccgtg aaaggtaaaa ggccgcagga cttcat

[0378] Murine Legumain Sense Riboprobe:

[0379] Forward primer (with T7 site):

5GACTGATAATACGACTCACTATAGGGCGAACACCAACACCAGCCATGTC3	(SEQ ID NO:24)

[0380] Reverse primer:

	5CTCTCAGCAGTTTCCCCAAATC3	(SEQ ID NO:25)

[0381] The probe is 313 nucleotides long and has the following sequence:

[0382] acaccaacac cagccatgtc atgcaatatg ggaacaaatc tatctctacc atgaaagtga tgcagtttca gggaatgaag cacagagcca gttcccccat ctccctgcct ccggtcacac accttgacct cacccccagc cctgacgtgc ccctgaccat cttgaagagg aagctgctga gaaccaacga cgtgaaggaa tcccagaatc tcattgggca gatccagcaa tttctggatg ccaggcacgt cattgagaag tctgtgcaca agatcgtttc cctgctggcg ggatttgggg aaactgctga gag (SEQ ID NO: 26)

[0383] Murine Legumain Anti-Sense Riboprobe:

[0384] Forward Primer:

	5ACACCAACACCAGCCATGTC3	(SEQ ID NO:27)

[0385] Reverse primer (withT7 site):

5GACTGATAATACGACTCACTATAGGGCGACTCTCAGCAGTTTCCCCAAATC3	(SEQ ID NO:28)

[0386] The probe sequence is 313 nucleotides long and has the following sequence:

[0387] ctctcagcag tttccccaaa tcccgccagc agggaaacga tcftgtgcac agacttctca atgacgtgcc tggcatccag aaattgctgg atctgcccaa tgagattctg ggattccttc acgtcgttgg ttctcagcag cttcctcttc aagatggtca ggggcacgtc agggctgggg gtgaggtcaa ggtgtgtgac cggaggcagg gagatggggg aactggctct gtgcttcatt ccctgaaact gcatcacttt catggtagag atagatttgt tcccatattg catgacatgg ctggtgttgg tgt (SEQ ID NO: 29).

[0388] Sections of paraffin embedded tissue were de-paraffinized with xylene, 2 changes, 3 minutes each, and rehydrated to water. After a rinse in RNase-free water and phosphate buffered saline (PBS), permeabilization was performed by incubation with 0.2% Triton-X 100/PBS for 15 minutes. After 2 washes with PBS, each at 3 minutes, the sections were ready for proteinase K (PK)(Sigma) treatment. Sections were immersed in 0.1M Tris and 50 mM EDTA (Sigma) (pH 8.0) pre-warmed at 37 C. containing 5 g/ml PK for 15 minutes. PK activities were stopped by 0.1M glysine/PBS for 5 minutes followed by a post fixation with 4% paraformaldehyde for 3 minutes and PBS rinsed. To prevent non-specific electrostatic binding of the probe, sections were immersed in 0.25% acetic anhydride and 0.1M triethanolamine solution (pH 8.0) for 10 minutes, followed by 15 seconds in 20% acetic acid at 4 C. After 3 changes in PBS, 5 minutes each, sections were dehydrated through 70%, 90% and 100% ethanol, each at 3 minutes. The sections were completely air dried before 40 l of pre-hybridization buffer was applied, covered with Parafilm and incubated at 52 C. for 30 minutes to reduce non-specific binding. Parafilm was removed and 40 l of hybridization buffer containing 5 ng/l of digoxigenin-labeled probe was applied to each section, recovered with Parafilm and incubated overnight at 52 C.

[0389] Parafilm was carefully removed and sections were immersed into 2 saline sodium citrate (SSC) (Sigma)/0.1% lauryl sulphate (SDS) (Sigma) at room temperature, 4 changes, 5 minutes each. To ensure specific binding of the probe, sections were washed in a high stringency solution containing 0.1 SSC/0.1% SDS at 52 C., 2 changes, 10 minutes each. Endogenous peroxidase was quenched by immersion of sections in 3% H₂O₂, 15 minutes at room temperature followed by 3 washes in PBS, 2 minutes each. The labeled probe was detected with anti-digoxigenin antibody conjugated to peroxidase complex (Roche) diluted 1:50 in 2% normal sheep serum/0.1% Triton X-100. Labeled probe was developed with DAB (Vector Laboratories), washed in water, stained briefly with hematoxylin, dehydrate in graded alcohol and mounted in Permount mountant (Fisher Scientific) before microscopic examination.

[0390] The results indicate that no staining was observed in any of the paws treated with the sense probes (negative control). Expression of all of the genes described below was detected in joints of animals with collagen induced arthritis. No staining was seen in untreated animals.

[0391] More particularly, individual cells expressing the RNAs tested for were identified. FSTl mRNA positive cells were neutrophils, macrophages, fibroblasts, osteoblasts. No FST1 was found in bone tissue. SAA-3 mRNA positive cells were, neutrophils, macrophages, fibroblasts, superficial epidermis and chondrocytes. No staining with SAA-3 was seen in the articular cartilage. SLP-1 mRNA positive cells were osteoblasts, fibroblast and a focal area of chondrogenesis. The macrophages seemed to be positive (mild), endothelial cells appeared to be positive (mild) and neutrophils seemed to be negative for SLP-1 mRNA. Lymphocytes were difficult to identify in the SLP-1 hybridized sections. Legumain mRNA positive cells were seen in the epidermis. Osteoblasts and fibroblast had positive cytoplasmic staining with the Legumain antisense probe. The macrophages were positive (mild) and neutrophils appeared to be negative for Legumain mRNA. Lymphocytes were difficult to identify in the Legumain hybridized sections.

[0392] Equivalents

[0393] It will be apparent to those skilled in the art that the examples and embodiments described herein are by way of illustration and not of limitation, and that other examples may be used without departing from the spirit and scope of the present invention, as set forth in the claims.

	TABLE 1
	6800 chip human RA PBMC
					Avg	Nor-			Avg
			Patients		Freq	mals		Freq
		GeneSpring	called	P	RA	called	(Nor-	P	Nor-		Fold
name	qualifier	qualifier	P > 4	(RA)	Patients	P > 6	mal)	(RA)	mals	Ratio	Change	Symbol	Chromosome	Description	function
MR110000	D64154_at	D64154	fail	4		PASS	13	4	9.77	Normal	Normal			Mr110,000 antigen
RAC2	M64595_at	M64595	fail	3		PASS	13	3	19.85	Normal	Normal	RAC2	22q12-q13.2	ras-related C3 botulinum	ras-related C3 botulinum
														toxin substrate 2 (rho	toxin substrate 2 (rho
														family, small GTP	family, small GTP
														binding protein Rac2)	binding protein Rac2)
J03263_s_at	J03263_s_at	J03263	fail	3		PASS	13	3	9.23	Normal	Normal	LAMP1			membrane glycoprotein
TBXAS1	M80647_at	M80647	fail	4		PASS	12	4	17.42	Normal	Normal	TBXAS1	7q34-q35	thromboxane A synthase 1	thromboxane A synthase 1
														(platelet, cytochrome P450,	(platelet,cytochrome P450,
														subfamily V)	subfamily V)
ALDR1	J04794_at	J04794	fail	4		PASS	12	4	14.42	Normal	Normal	ALDR1			aldehyde reductase
														(EC 1.1.1 2)
HADHA	D16480_at	D16480	fail	2		PASS	12	2	16.33	Normal	Normal	HADHA	2p23	hydroxyacyl-Coenzyme A	hydroxyacyl-Coenzyme A
														dehydrogenase/3-ketoacyl-	dehydrogenase/3-ketoacyl-
														Coenzyme A thiolase/	Coenzyme A thiolase/
														enoyl-Coenzyme A	enoyl-Coenzyme A
														hydratase (trifunctional	hydratase (trifunctional
														protein), alpha su	protein), alpha subunit
M13929_s_at	M13929_s_at	M13929	fail	1		PASS	12	1	9.33	Normal	Normal	MYC		c-myc-P64 protein	ORF 114; putative
HLK1	U40462_at	U40462	fail	1		PASS	12	1	6.42	Normal	Normal	hlK-1		Ikaros/LyF-1-homolog	similar to mouse LyF-1,
															encoded by GenBank
															Accession Number S74708;
															similar to mouse Ikaros
															DNA-binding protein,
															Swiss-Prot Accession
															Number Q03267
MANA2	D63998_at	D63998	fail	1		PASS	12	1	5.25	Normal	Normal	MANA2	5	mannosidase, alpha type II	mannosidase, alpha type II
ITBA2	X92896_at	X92896	fail	0		PASS	12	0	6.42	Normal	Normal	ITBA2
PPP1R2	U68111_at	U68111	fail	0		PASS	12	0	5.17	Normal	Normal	PPP1R2		protein phosphatase
														inhibitor 2
LCP2	U93049_at	U93049	fail	3		PASS	11	3	11.82	Normal	Normal	FYB		FYN-binding protein	FYN-binding protein
														(FYB-120/130)	(FYB-120/130)
PCNA	J05614_at	J05614	fail	3		PASS	11	3	11.73	Normal	Normal
POLR2B	L37127_at	L37127	fail	2		PASS	11	2	13.27	Normal	Normal			RNA polymerase II
DG	HG1872-HT1	HG1872-HT	fail	2		PASS	11	2	10.55	Normal	Normal
MEL	X56741_at	X56741	fail	2		PASS	11	2	7.82	Normal	Normal	rab8		rab8 small GTP binding
U09178_s_at	U09178_s_at	U09178	fail	2		PASS	11	2	6.91	Normal	Normal	DPYD	1p22	dihydropyrimidine	dihydropyrimidine
														dehydrogenase	dehydrogenase
CALM	U45976_at	U45976	fail	2		PASS	11	2	6.91	Normal	Normal	CALM		CALM
TLE4	M99439_at	M99439	fail	2		PASS	11	2	5.73	Normal	Normal	TLE4		transducin-like enhancer	transducin-like enhancer
														protein	of split 4, homolog of
															Drosophila E (spl)
HSPA4	L12723_at	L12723	fail	2		PASS	11	2	5.45	Normal	Normal	HSPA4	5q31.1-q31.2	Heat shock 70 kD protein 4	heat shock 70 kD protein 4
NUCP40	U86602_at	U86602	fail	2		PASS	11	2	5.09	Normal	Normal			nucleolar protein p40	cell proliferation-
															associated protein
E_CIT987SK	U91327_at	U91327	fail	1		PASS	11	1	5.82	Normal	Normal	99D8.1		T-complex protein 1, Beta
															subunit (TCP-1-BETA)
FRAP	L34075_at	L34075	fail	1		PASS	11	1	5.73	Normal	Normal	FRAP1	1p36.2	FKBP-rapamycin	FK506 binding protein 12-
														associated protein	rapamycin associated
															protein 1
EIF2G	L19161_at	L19161	fail	1		PASS	11	1	5.64	Normal	Normal	EIF2S3	Xp22.2-p22.1	eukaryotic translation	eukaryotic translation
														initiation factor 2, subunit	initiation factor 2, subunit
														3, (gamma, 52 kD)	3 (gamma, 52 kD)
P_E46	Z93784_at	Z93784	fail	1		PASS	11	1	5.36	Normal	Normal	dJ398C22 1		dJ398C22.1	E46-like contains exons
															2-9 continues in Z84478
UCHL3	M30496_at	M30496	fail	1		PASS	11	1	4.27	Normal	Normal				ubiquitin carboxyl-terminal
															hydrolase
RPA1	M63488_at	M63488	fail	0		PASS	11	0	7.45	Normal	Normal	RPA1	17	replication protein A1	replication protein A1
														(70 kD)	(70 kD)
RIINF	HG511-HT51	HG511-HT	fail	0		PASS	11	0	5.36	Normal	Normal
M26041_s_at	M26040_s_at	M26041	fail	3		PASS	10	3	20.70	Normal	Normal	LA-DQA1	6p21.3	major histocompatibility	major histocompatibility
														complex, class II,	complex, class II,
														DQ alpha 1	DQ alpha 1
K91_PCSK	D42053_at	D42053	fail	2		PASS	10	2	6.70	Normal	Normal	S1P	16	site-1 protease (subtilisin-	site-1 protease (subtilisin-
														like, sterol-regulated,	like, sterol-regulated,
														cleaves sterol regulatory	cleaves sterol regulatory
														element binding proteins)	element binding proteins)
KCNQ1	U40990_at	U40990	fail	2		PASS	10	2	6.70	Normal	Normal	KVLQT1		voltage gated potassium
GALC	L23116_at	L23116	fail	2		PASS	10	2	5.40	Normal	Normal	GALC	14q31	galactosylceramidase	galactosylceramidase
														(Krabbe disease)	Krabbe disease)
KPNB3	U72761_at	U72761	fail	2		PASS	10	2	5.40	Normal	Normal	KPNB3		karopherin (importin)	karyopherin (importin)
														beta 3	beta 3
DR1	M97388_at	M97388	fail	2		PASS	10	2	5.30	Normal	Normal	DR1	1p22.1	down-regulator of	down-regulator of
														transcription 1, TBP-	transcription 1, TBP-
														binding (negative	binding (negative
														cofactor 2)	cofactor 2)
RFC4	M87339_at	M87339	fail	2		PASS	10	2	5.20	Normal	Normal	RFC4	3127	replication factor C	replication factor C
														(activator 1) 4 (37 kD)	(activator 1) 4 (37 kD)
BIOBM	AFFX-BioB-1	AFFX-BioI	fail	1		PASS	10	1	7.20	Normal	Normal
UBE2D1	HG3344-HT3	HG3344-HT	fail	1		PASS	10	1	6.50	Normal	Normal
MANA2	L28821_at	L28821	fail	1		PASS	10	1	6.30	Normal	Normal	MAN2A2	15q25	alpha mannosidase II	mannosidase, alpha, class
														isozyme	2A, member 2
CAMKA2	U81554 at	U81554	fail	1		PASS	10	1	5.50	Normal	Normal	CAMK2G	10q22	calcium/calmodulin-	calcium/calmodulin-
														dependent protein kinase	dependent protein kinase
														(CaM kinase) II gamma	(CaM kinase) II gamma
HG2797-HT2	HG2797-HT2	HG2797-HT	fail	1		PASS	10	1	5.20	Normal	Normal
POH1	U86782_at	U86782	fail	1		PASS	10	1	5.00	Normal	Normal	POH1		26S proteasome-associated	human homolog of fission
														pad 1 homolog	yeast pad1
GZMM	HG3104-HT3	HG3104-HT	fail	0		PASS	10	0	16.20	Normal	Normal
BAP	U72512_at	U72512	fail	3		PASS	9	3	13.56	Normal	Normal
ESD	D28416_at	D28416	fail	3		PASS	9	3	10.89	Normal	Normal			esterase D
K01160_s_at	K01160_s_at	K01160	fail	3		PASS	9	3	10.00	Normal	Normal
U45878_s_at	U45878_s_at	U45878	fail	3		PASS	9	3	9.22	Normal	Normal			inhibitor of apoptosis	HIAP-1
														protein 1
RPS4Y	M58459_at	M58459	fail	2		PASS	9	2	44.67	Normal	Normal	RPS4Y	Yp11.3	ribosomal protein S4,	ribosomal protein S4,
														Y-linked	Y-linked
LTR	M92449_at	M92449	fail	2		PASS	9	2	9.89	Normal	Normal	PLT			putative
FBP1	U05040_at	U05040	fail	2		PASS	9	2	7.67	Normal	Normal	FUBP		FUSE-binding protein	far upstream element
															binding protein
CD27	M63928_at	M63928	fail	2		PASS	9	2	7.44	Normal	Normal	TNFRSF7	12p13	CD27 antigen	tumor necrosis factor
															receptor superfamily,
															member 7
FGFR1	U28811_at	U28811	fail	2		PASS	9	2	6.11	Normal	Normal	CFR-1		cysteine-rich fibroblast
														growth factor receptor
PTPRA	M34668_at	M34668	fail	2		PASS	9	2	5.67	Normal	Normal	PTPRA	20p13	protein tyrosine phos-	protein tyrosine phos-
														phatase, receptor type,	phatase, receptor type,
														alpha polypeptide	alpha polypeptide
U52191_s_at	U52191_s_at	U52191	fail	2		PASS	9	2	5.56	Normal	Normal	SMCY	Yq	SMC (mouse) homolog, Y	SMC (mouse) homolog, Y
														chromosome	chromosome
CBR	J04056_at	J04056	fail	2		PASS	9	2	4.89	Normal	Normal	CBR1	21q22.1	carbonyl reductase 1	carbonyl reductase 1
HSPB1	ZZ3090_at	Z23090	fail	1		PASS	9	1	12.56	Normal	Normal	HSPB1	7q	heat shock 27 kD protein 1	heat shock 27 kD protein 1
STAT1Mb	AFFX-HUMI	AFFX-HUM	fail	1		PASS	9	1	7.00	Normal	Normal
K129_RFPTE	D50919_at	D50519	fail	1		PASS	9	1	4.89	Normal	Normal	KIAA0129			KIAA0129 gene product
CDK7	L20320_at	L20320	fail	1		PASS	9	1	4.89	Normal	Normal	CDK7	2p15-cen	cyclin-dependent kinase 7	cyclin-dependent kinase 7
														(homolog of Xenopus	(homolog of Xenopus
														MO15 cdk-activating	MO15 cdk-activating
														kinase)	kinase)
FABP5	M94856_at	M94856	fail	1		PASS	9	1	4.78	Normal	Normal	FABP5		fatty acid binding	fatty acid binding
														protein 5 (psoriasis-	protein 5 (psoriasis-
														associated)	associated)
ICSBP1	M91196_at	M91196	fail	0		PASS	9	0	8.33	Normal	Normal	ICSBP1		interferon consensus	interferon consensus
														sequence binding	sequence binding
														protein 1	protein 1
NMT1	M86707_at	M86707	fail	0		PASS	9	0	7.33	Normal	Normal	NMT1			N-myristoyltransferase 1
RAB4	M28211_at	M28211	fail	0		PASS	9	0	5.11	Normal	Normal	RAB4	1q42-q43	RAB4, member RAS	RAB4, member RAS
														oncogene family	oncogene family
ERPRT	M27826_at	M27826	fail	2		PASS	8	2	10.63	Normal	Normal			neutral protease large	Xxx; putative
														subunit
EV12A	M55267_at	M55267	fail	2		PASS	8	2	10.13	Normal	Normal	EVI2A		EVI2 protein
H2BH_f	Z80780_f_at	Z80780	fail	1		PASS	8	1	9.88	Normal	Normal	H2B/h		histone H2B
TIP60	U74667_at	U74667	fail	0		PASS	8	0	7.25	Normal	Normal	TIP60		tat interactive protein	interacts with HIV1 Tat,
															similar to yeast SAS2,
															SAS3 and human MOZ,
															encoded by GenBank
															Accession Numbers
															U14548, Z23261 and
															U47742, respectively;
															similar to sequence with
															GenBank Accession
															Number U40989
PHB	S85655_at	S85655	fail	0		PASS	8	0	6.63	Normal	Normal	PHB	17q21	prohibition	prohibition
EPHB4	U07695_at	U07695	fail	0		PASS	8	0	6.50	Normal	Normal	EPHB4	7	EphB4	EphB4
SNAP23	U55936_at	U55936	fail	0		PASS	8	0	6.00	Normal	Normal	SNAP23		synaptosomal-associated	synaptosomal-associated
														protein, 23 kD	protein, 23 kD
D26155_s_at	D26155_s_at	D26155	fail	0		PASS	8	0	5.13	Normal	Normal	SMARCA2	9p24-p23	SWI/SNF related, matrix	SWI/SNF related, matrix
														associated, actin dependent	associated, actin dependent
														regulator of chromatin,	regulator of chromatin,
														subfamily a, member 2	subfamily a, member 2
PRP4H	U48736_at	U48736	fail	0		PASS	8	0	5.00	Normal	Normal	PRP4		serine/threonine-protein	serine/threonine-protein
														kinase PRP4 homolog	kinase PRP4 homolog
IL16	HG270-HT27	HG270-HT	fail	0		PASS	8	0	4.75	Normal	Normal
E_E18CPGE	HG3991-HT4	HG3991-HT	fail	4		PASS	7	4	30.57	Normal	Normal
RORET	U90547_at	U90547	fail	4		PASS	7	4	12.14	Normal	Normal	RoRet		Ro/SSA ribonucleoprotein
														homolog
HMGIY_rna1	LI7131_rna1	L17131	fail	4		PASS	7	4	9.71	Normal	Normal	HMGIY	6p	high-mobility group	high-mobility group
														(nonhistone chromosomal)	(nonhistone chromosomal)
														protein isoforms I and Y	protein isoforms I and Y
AFFX-BioDn	AFFX-BioDn	AFFX-BioI	fail	2		PASS	7	2	12.29	Normal	Normal
TXBP181	U33822_at	U33822	fail	1		PASS	7	1	9.86	Normal	Normal	MAD1L1	7p22	MAD1 (mitotic arrest	MAD1 (mitotic arrest
														deficient, yeast, homolog)-	deficient, yeast, homolog)-
														like 1	like 1
NUCB	U31342_at	U31342	fail	0		PASS	7	0	6.14	Normal	Normal			nucleobinding
DPH2L	U34880_at	U34880	fail	0		PASS	7	0	6.00	Normal	Normal	DPH2L1	17p13.3	diptheria toxin resistance	diptheria toxin resistance
														protein required for	protein required for
														diphthamide biosynthesis	diphthamide biosynthesis
														(Saccharomyces)-like 1	(Saccharomyces)-like 1
TRAP1	U12595_at	U12595	fail	0		PASS	7	0	5.71	Normal	Normal	TRAP1		tumor necrosis factor	TNF type 1 receptor
														receptor associated protein	associated protein
X60003_s_at	X60003_s_at	X60003	fail	0		PASS	7	0	5.43	Normal	Normal	delta CREB
2OGCP_rna1	X66114_rna1	X66114	fail	0		PASS	7	0	5.43	Normal	Normal	SLC20A4	17p13.3	solute carrier family 20	solute carrier family 20
														(oxoglutarate carrier),	(oxoglutarate carrier),
														member	member 4
K196	D83780_at	D83780	fail	0		PASS	7	0	5.14	Normal	Normal	KIAA0196			KIAA0196 gene product
K52_SK12P	D29641_at	D29641	fail	0		PASS	7	0	5.00	Normal	Normal	KIAA0052
CUL4A	U58090_at	U58090	fail	0		PASS	7	0	5.00	Normal	Normal	CUL4A		Hs-CUL-4A	cullin 4A
E_23707	U79270_at	U79270	fail	0		PASS	7	)	5.00	Normal	Normal	COX11	17q22	cytochrome c oxidase	cytochrome c oxidase
														subunit 11	subunit 11
BLK	S76617_at	S76617	fail	0		PASS	7	0	4.71	Normal	Normal	BLK	8p23-p22	B lymphoid tyrosine kinase	B lymphoid tyrosine kinase
U69140_s_at	U69140_s_at	U69140	fail	0		PASS	7	0	4.71	Normal	Normal			zyginII	synaptotagmin interacting
															protein; Human ortholog
															of rt qyginII
ERPL1	X89211_at	X89211	fail	0		PASS	7	0	4.71	Normal	Normal	HERV-L			Human Endogenous
															Retrovirus-Like elements
															(HERV-L)/pseudo
PRTK1	S76965_at	S76965	fail	0		PASS	7	0	4.71	Normal	Normal	protein		protein kinase inhibitor	This sequence comes
												kinase in-			from FIG. 1B, PKI
												hibitor, PK1
X93511_s_at	X93511_s_at	X93511	fail	0		PASS	7	0	4.00	Normal	Normal	orf1		telomeric DNA binding
														protein
MAGEP15	U19796_at	U19796	PASS	7	23.29	fail	3	7		Disease	Disease			melanoma antigen p15
HG3148-HT3	HG3148-HT3	HG3148-II	PASS	7	12.86	fail	3	7		Disease	Disease
MTA1	U35113_at	U35113	PASS	7	6.71	fail	1	7		Disease	Disease	MTA1		metastasis associated 1	metastasis associated 1
HG4120-HT4	HG4120-HT4	HG4120-HT	PASS	6	5.17	fail	3	6		Disease	Disease
AVPR1B	L37112_at	L37112	PASS	6	15.00	fail	3	6		Disease	Disease			vasopressin V3 receptor
ACRV1_rna1	S65583_rna1	S65583	PASS	6	12.83	fail	3	6		Disease	Disease	SP-10		SP-10	intra-acrosomal protein;
															This sequence comes from
															FIG. 3. Protein sequence
															is in conflict with the
															conceptual translation;
															mismatch(126G-> R)
U57623_s_at	U57623_s_at	U57623	PASS	6	6.33	fail	3	6		Disease	Disease	FABP3	1p33-p32	fatty acid binding protein 3,	fatty acid binding protein 3,
														muscle and heart	muscle and heart
														(mammary-derived	(mammary-derived
														growth inhibitor)	growth inhibitor)
AACT_rna1	X68733_rna1	X68733	PASS	6	10.50	fail	3	6		Disease	Disease	ACT		alpha1-antichymotrypsin	Protein sequence is in
															conflict with the con-
															ceptual translation.
D29675_s_at	D29675_s_at	D29675	PASS	6	16.50	fail	2	6		Disease	Disease
SLO	U02632_at	U02632	PASS	6	5.67	fail	2	6		Disease	Disease	KCNMA1	10	portassium large	potassium large
														conductance calcium-	conductance calcium-
														channel, subfamily M,	channel, subfamily M,
														alpha member 1	alpha member 1
MME	J03779_at	J03779	PASS	6	28.50	fail	1	6		Disease	Disease	MME	3q21-q27	membrane metallo-	membrane metall-
														endopeptidase (neutral	endopeptidase (Neutral
														endopeptidase,	endopeptidase,
														enkephalinase,	enkephalinase,
														CALLA, CD10)	CALLA, CD10)
K246_NOTC	D87433_at	D87433	PASS	6	38.33	fail	1	6		Disease	Disease	KIAA0246
MDC	U83171_at	U83171	PASS	6	14.00	fail	0	6		Disease	Disease	SCYA22	16q13	small inducible cytokine	small inducible cytokine
														subfamily A ()CysCys),	subfamily A (CysCys),
														member 22	member 22
M22403_s_at	M22403_s_at	M22403	PASS	5	6.40	fail	1	5		Disease	Disease	GP1BA	17pter-p12	glycoprotein Ib (platelet),	glycoprotein Ib (platelet),
														alpha polypeptide	alpha polypeptide
FSTRP	U06863_at	U06863	PASS	5	8.80	fail	1	5		Disease	Disease			follistatin-related protein
														precursor
PLCG2H	U45974_at	U45974	PASS	5	15.40	fail	0	5		Disease	Disease				phosphatidylinositol (4,5)
															bisphosphate 5-phosphatase
															homolog
PTPRN	L18983_at	L18983	PASS	5	20.00	fail	0	5		Disease	Disease	PTPRN	2q35-q36.1	protein tyrosine phos-	protein tyrosine phos-
														phatase, receptor type, N	phatase, receptor type, N
AQP9	AB006190_at	AB006190	PASS	5	10.20	fail	0	5		Disease	Disease	AQP7	9p13	aquasporin 7	aquasporin 7
EFNB3	U66406_at	U66406	PASS	5	7.40	fail	0	5		Disease	Disease	EFNB3	17p13.1-p11.2	ephrin-B3	ephrin-B3
M87789_s_at	M87789_s_at
M87789_s_at	M87789_s_at	M87789	PASS	8	118.00	PASS	9	8	19.56	6.03	6.03			IgG	Anti-hepatitis A; putative
OC116	U45285_at	U45285	PASS	9	31.44	PASS	10	9	7.30	4.31	4.31	OC-116 kDa		specific 116 kDa vacuolar	ATPase, Htransporting
														proton pump subunit
TETTRL	L11669_at	L11669	PASS	6	28.33	PASS	11	6	7.18	3.95	3.95	ADD1	4p16.3	adducin 1 (alpha)	adducin 1 (alpha)
CSF3R	M59820_at	M59820	PASS	6	43.67	PASS	7	6	11.57	3.77	3.77	CSF3R	1p35-p34.3	colony stimulating factor 3	colony stimulating factor 3
														receptor (granulocyte)	receptor (granulocyte)
IGF2	S73149 at	S73149	PASS	8	35.13	PASS	9	8	9.33	3.76	3.76	orf in intron
												7 of insulin-
												like growth
												factor II
												gene
18SRNAM	AFFX-HUMI	AFFX-HUM	PASS	6	28.67	PASS	7	6	7.71	3.72	3.72
18SRNA3	AFFX-HUMI	AFFX-HUM	PASS	9	46.89	PASS	11	9	12.64	3.71	3.71
PROTEIN_II	V01512_ma1	V01512	PASS	9	51.44	PASS	13	9	13.92	3.69	3.69	FOS	14q24.3	v-fos FBJ murine
															osteosarcoma viral
															oncogene homolog
ETR101	M62831_at	M62831	PASS	9	105.67	PASS	13	9	28.69	3.68	3.68	ETR101	19	immediate early protein	immediate early protein
DIA1	M28713_at	M28713	PASS	9	33.33	PASS	12	9	9.08	3.67	3.67	DIA1	22q13.31-qter	cytochrome b5 reductase	diaphorase (NADH)
															(cytochrome b-5 reductase)
MX1	M33882_at	M33882	PASS	7	34.71	PASS	9	7	9.56	3.63	3.63	MX1	21q22.3	myxovirus (influenza)	myxovirus (influenza)
														resistance I, homolog of	resistance I, homolog of
														murine (interferon-	murine (interferon-
														inducible protein p78)	inducible protein p78)
SELPLG	U25956_at	U25956	PASS	9	75.89	PASS	13	9	21.08	3.60	3.60	SELPLG	12q24	selectin P ligand	selectin P ligand
LFP40	U72206_at	U72206	PASS	5	33.40	PASS	10	5	9.30	3.59	3.59	LFP40	chr. 1	guanine nucleotide	guanine nucleotide
														regulatory factor	regulatory factor
BB1	S82470_at	S82470	PASS	6	32.00	PASS	12	6	8.92	3.59	3.59	BBI		malignant cell expression-
															enhanced gene/tumor
															progression-enhanced gene;
															This sequence comes from
															FIG. 4A
LYSPHAD	U56417_at	U56417	PASS	9	26.33	PASS	11	9	7.36	3.58	3.58			lysophosphatidic acid	LPAAT-a; 1-acyl-sn-
														acyltransferase-alpha	glycerol-3-phosphate acyl-
															transferase; similar to
															sequence within class III
															MHC locus on chromosome
															6 deposited in GenBank
															Accession Number U89336
HG4535-HT4	HG4535-HT4	HG4535-HT	PASS	8	3850	PASS	8	8	10.88	3.54	3.54
ZYX	X95735_at	X95735	PASS	8	41.38	PASS	10	8	11.70	3.54	3.54	ZYX	7132	zyxin	zyxin
S71043_rna1	S71043_rna1	S71043	PASS	9	88.33	PASS	13	9	25.92	3.41	3.41	Ig & lt;		immunoglobulin A heavy	This sequence comes from
												alpha & gt; 2		chain allotype 2	FIG. 3; IgA2 H chain
HD	L12392_at	L12392	PASS	9	22.33	PASS	9	9	6.56	3.41	3.41	HD	4p16.3	huntingtin	huntingtin (Huntington
															disease)
ILK	U40282_at	U40282	PASS	9	29.22	PASS	12	9	8.58	3.40	3.40	ILK	11p15.5-p15.4	integrin-linked kinase	integrin-linked kinase
PKM2	X56494_at	X56494	PASS	8	63.50	PASS	13	8	18.77	3.38	3.38	PKM2	15q22-qter	pyruvate kinase, muscle	pyruvate kinase, muscle
CD63_rna1	X62654_rna1	X62654	PASS	9	41.78	PASS	13	9	12.38	3.37	3.37	CD63	12q12-q13	CD63 antigen (melanoma	CD63 antigen (melanoma 1
														antigen)	antigen)
SA	M60922_at	M60922	PASS	8	55.88	PASS	12	8	16.58	3.37	3.37	FLOT2	17g11-q12	flotillin 2	flotillin 2
X62083_s_at	X62083_s_at	X62083	PASS	9	70.89	PASS	13	9	21.15	3.35	3.35	FSH
J03260_s_at	J03260_s_at	J03260	PASS	7	28.71	PASS	7	7	8.57	3.35	3.35	GNAZ	22q11.1-q11.2	guanine nucleotide	guanine nucleotide
														binding protein (G	binding protein (G
														protein), alpha 2	protein), alpha 2
														polypeptide	polypeptide
CDC25	S78187_at	S78187	PASS	9	63.89	PASS	13	9	19.08	3.35	3.35	CDC25B	20p13	cell division cycle	cell division cycle
														25B	25B
RELA	L19067_at	L19067	PASS	9	39.78	PASS	10	9	11.90	3.34	3.34			NF-kappa-B transcrip-	putative
														tion factor subunit
XQTP	D16469_at	D16469	PASS	9	31.67	PASS	11	9	9.55	3.32	3.32	ATP6S1	Xq28	ATPasc, H transporting,	ATPase, H transporting,
														lysosomal (vacuolar proton	lysosomal (vacuolar proton
														pump), subunit 1	pump), subunit 1
RAGE_cds1	U89336_cds1	U89336	PASS	9	71.78	PASS	13	9	21.69	3.31	3.31	HBX2		homeobox PBX2 gene	intron-exon boundaries
															identified by a contig of
															ESTs with GenBank
															Accession Numbers
															W76064, R59617, W72507
K154_ADTG	D63876_at	D63876	PASS	9	33.89	PASS	12	9	10.25	3.31	3.31	KIAA0154			KIAA0154 gene product
															is related to mouse
															gamma adaptin.
PRSM1	U58048_at	U58048	PASS	8	18.63	PASS	9	8	5.67	3.29	3.29	PRSM1	16q24.3	protease, metallo, 1, 33 kD	protease, metallo, 1, 33 kD
ATP6C	M62762_at	M62762	PASS	9	69.67	PASS	13	9	21.23	3.28	3.28	ATP6C	16p13.3	ATPasc, H transporting	ATPase, H transporting,
														lysosomal (vacuolar proton	lysosomal (vacuolar proton
														pump) 16 kD	pump) 16 kD
NCF1	M55067_at	M55067	PASS	9	72.33	PASS	13	9	22.09	3.28	3.28	NCF1	7q11.23	neutrophil cytosolic factor 1	neutrophil cytosolic factor 1
															(47 kD, chronic
															granulomatous disease,
															autosomal 1)
K220	D86974_at	D86974	PASS	9	239.22	PASS	13	9	73.38	3.26	3.26	K1AA0220
K109_CLAS1	D63475_at	D63475	PASS	8	45.88	PASS	13	8	14.15	3.24	3.24	CLAPM1	3q28	clathrin-associated	clathrin-associated/
														assembly/adaptor	assembly/adaptor
														protein, medium 1	protein, medium 1
TSC2	L48546_at	L48546	PASS	9	30.44	PASS	7	9	9.43	3.23	3.23	TSC2	16p13.3	tuberous sclerosis 2	tuberous sclerosis 2
EDR2	U89278_at	U89278	PASS	8	25.25	PASS	12	8	7.83	3.22	3.22	EDR2		early development regulator	early development regulator
														2 (homolog of poly-	2 (homolog of poly-
														homeotic 2)	homeotic 2)
M34996_s_at	M34996_s_at	M34996	PASS	9	80.56	PASS	13	9	25.08	3.21	3.21			cell surface glycoprotein
U59632_s_at	U59632_s_at	U59632	PASS	9	97.22	PASS	13	9	30.54	3.18	3.18	PNUTL1	22q11.2	peanut (Drosphila)-like 1	peanut (Drosphila)-like 1
UHX1	U44839_at	U44839	PASS	9	60.22	PASS	13	9	18.92	3.18	3.18	USP11	Xp21.2-p11.2	Ubiquitin carboxyl-terminal	Ubiquitin specific protease
														hydrolase, X-linked	11
UROD	X89267_at	X89267	PASS	5	47.60	PASS	8	5	15.25	3.12	3.12			uroporphymogen
															decarboxylase
PLCB2	M95678_at	M95678	PASS	9	84.00	PASS	12	9	26.92	3.12	3.12	PLCB2	15q15	phospholipase C, beta 2	phospholipase C, beta 2
BST2	D28137_at	D28137	PASS	8	51.13	PASS	13	8	16.38	3.12	3.12	BST2	19p13.2	bone marrow stromal cell	bone marrow stromal cell
														antigen 2	antigen 2
NFER2	S77763_at	S77763	PASS	9	32.33	PASS	11	9	10.36	3.12	3.12	nuclear		nuclear factor erythroid 2	basic leucine zipper protein;
												erythroid 2		isoform f	This sequence comes from
												isoform f,			FIG. 1; transcription
												transcription			factor fNF-E2
												factor
												fNF-E2
EBVIP	U19261_at	U19261	PASS	6	22.67	PASS	7	6	7.29	3.11	3.11			Epstein-Barr virus-induced	EBV induced protein
28SRNAM	AFFX-M278	AFFX-M27	PASS	5	91.00	PASS	7	5	29.29	3.11	3.11
GSTZ1	U86529_at	U86529	PASS	9	25.56	PASS	11	9	8.27	3.09	3.09	GSTZ1	14q24.3	glutathione S-transferase	glutathione S-transferase
														Zeta 1	Zeta 1
CD151	D29963_at	D29963	PASS	8	31.13	PASS	7	8	10.14	3.07	3.07	CD151	11p15.5	CD151 antigen	CD151 antigen
SAT_rna1	U40369_rna1	U40369	PASS	9	37.67	PASS	13	9	12.31	3.06	3.06	SAT	Xp22.1	spermidine/spermine N1-	spermidine-spermine N1-
														acetyltransferase	acetyltransferase
CLU	M63379_at	M63379	PASS	9	222.78	PASS	13	9	72.85	3.06	3.06	CLU	Sp21-p12	clusterin (complement lysis	clusterin (complement lysis
														inhibitor, SP-40,40,	inhibitor, SP-40,40
														sulfated glycoprotein 2,	sulfated glycoprotein 2,
														testosterone-repressed	testosterone-repressed
														prostate message 2,	prostate message 2,
														apolipoprotein J)	apolipoprotein J)
HMG1	D63874_at	D63874	PASS	9	83.22	PASS	13	9	27.31	3.05	3.05	HMG1	13q12	high-mobility group	high-mobility group
														(nonhistone chromosomal)	(nonhistone chromosomal)
														protein 1	protein 1
DEFA1	M26602_at	M26602	PASS	7	185.43	PASS	11	7	61.09	3.04	3.04	DEFA1	8p23-2p23.1	defensin, alpha 1, myeloid-	defensin, alpha 1, myeloid-
														related sequence	related sequence
FCGR1A	J004162_at	J04162	PASS	9	4656	PASS	13	9	15.38	3.03	3.03	FCGR3A	1q23		Fe fragment of IgG, low
															affinity IIIa, receptor
															for (CD16)
M32304_s_at	M32304_s_at	M32304	PASS	8	26.75	PASS	13	8	8.85	3.02	3.02	TIMP2	17q25	tissue inhibitor of	tissue inhibitor of
														metalloproteinase 2	metalloproteinase 2
LSP1	M33552_at	M33552	PASS	9	48.11	PASS	13	9	15.92	3.02	3.02	LSP1			lymphocte-specific
															protein 1 (LSP1)
U83239_s_at	U83239_s_at	U83239	PASS	6	34.33	PASS	11	6	11.36	3.02	3.02			CC chemokine STCP-1
GSTH	U90313_at	U90313	PASS	9	43.22	PASS	13	9	14.31	3.02	3.02	GSTTLp28		glutathione-S-transferase	glutathione-S-transferase
														like	like
IGLT1	U82275_at	U82275	PASS	8	27.88	PASS	12	8	9.25	3.01	3.01			immunoglobulin-like	ILT1; Ig-superfamily
														transcript 1	member
NRGN_rna1	X99076_rna1	X99076	PASS	9	230.11	PASS	13	9	76.54	3.01	3.01	NRGN		neurogranin
UBA52	M26880_at	M26880	PASS	9	198.00	PASS	13	9	66.31	2.99	2.99	UBA52	19p13.1-p12	ubiquitin A-52 residue	ubiquitin A-52 residue
														ribosomal protein fusion	ribosomal protein fusion
															product 1
TMEM1	D26579_at	D26579	PASS	9	31.56	PASS	13	9	10.62	2.97	2.97	ADAM8	10q26.3	a disintegrin and metallo-	a disintegrain and metallo-
														protease domain 8	protease domain 8
GP1	K03515_at	K03515	PASS	9	35.78	PASS	13	9	12.08	2.96	2.96	GP1	19q13.1	glucose phosphate	glucose phosphate
														isomerase	isomerase
TYL	X99688_at	X99688	PASS	9	23.44	PASS	12	9	7.92	2.96	2.96	TYL
UBE1L	L13852_at	L13852	PASS	9	54.78	PASS	13	9	18.62	2.94	2.94	UBE1L	3p21	ubiquitin-activating	ubiquitin-activating
														enzyme E1, like	enzyme E1, like
KRT1_rna1	M98776_rna1	M98776	PASS	7	19.29	PASS	9	7	6.56	2.94	2.94	KRT1		keratin 1
K45_YKL	D28476_at	D28476	PASS	9	27.44	PASS	12	9	9.33	2.94	2.94	TRIP12		thyroid hormone receptor
															interactor 12
HCFC1	L20010_at	L20010	PASS	8	26.13	PASS	13	8	8.92	2.93	2.93
SLC9A1	S68616_at	S68616	PASS	5	20.20	PASS	10	5	6.90	2.93	2.93	SLC9A1	1p36.1-p35	Na/H exchanger	solute carrier family 9
														NHE-1 isoform	(sodium/hydrogen
															exchanger), isoform 1
															(antiporter, Na/H,
															amiloride sensitive)
SCYA5	M21121_at	M21121	PASS	9	156.78	PASS	13	9	53.69	292	2.92	SCYA5	17q11.2-q12	small inducible cytokine	small inducible cytokine
														A5 (RANTES)	A5 (RANTES)
PRKMK3	D87116_at	D87116	PASS	9	32.89	PASS	11	9	11.27	2.92	2.92	PRKMK3	17q11.2	protein kinase, mitogen-	protein kinase, mitogen-
														activated, kinase 3	activated, kinase 3
														(MAP kinase kinase 3)	(MAP kinase kinase 3)
CCND3	M92287_at	M92287	PASS	9	68.33	PASS	13	9	23.62	2.89	2.89	CCND3	6p21	cyclin D3	cyclin D3
SMN1_rna2	U80017_rna2	U80017	PASS	8	18.38	PASS	11	8	6.36	2.89	2.89	btf2p44		basic transcription	NAIP
														factor 2 p44
PLCG2H	U45975_at	U45975	PASS	6	23.50	PASS	7	6	8.14	2.89	2.89				phosphatidylmositol
															(4,5)bisphosphate 5-
															phosphatase homolog
X74874_rna2	X74874_rna2	X74874	PASS	8	19.75	PASS	13	8	6.85	2.88	2.88			RNA polymerase II
														largest subunit
M36118_s_at	M36118_s_at	M36118	PASS	8	33.63	PASS	12	8	11.67	2.88	2.88	GZMB	14q11.2	granzyme B (granzyme	granzyme B (granzyme
														2, cytotoxic T-	2, cytotoxic T-
														lymphocyte-associated	lymphocyte-associated
														serine esterase 1)	serine esterase 1)
IMPDH1	J05272_at	J05272	PASS	9	31.44	PASS	13	9	10.92	2.88	2.88	IMPDH1	7q31.3-q32	IMP (inosine mono-	IMP (inosine mono-
														phosphate) dehydrogenase	phosphate) dehydrogenase
														1	1
S40719_s_at	S40719_s_at	S40719	PASS	9	19.89	PASS	11	9	6.91	2.88	2.88	GFAP	17q21	glial fibrillary acidic	glial fibrillary acidic
														protein	protein
NAP1L4	U77456_at	U77456	PASS	6	29.50	PASS	12	6	10.25	2.88	2.88			nucleosome assembly	hNAP2
														protein 2
E_ZNF162	L49380_at	L49380	PASS	9	46.44	PASS	13	9	16.15	2.88	2.88	ZNF162	11q13	zinc finger protein 162	zinc finger protein 162
S100A12	D83657_at	D83657	PASS	9	65.44	PASS	13	9	22.77	2.87	2.87			CAAF1 (calcium-binding
														protein in amniotic fluid
K56	D29954_at	D29954	PASS	8	18.88	PASS	7	8	6.57	2.87	2.87	KIAA0056
E_DDX11	U75968_at	U75968	PASS	9	20.56	PASS	12	9	7.17	2.87	2.87	CHLR1	CHL1 protein
ORP150	U65785_at	U65785	PASS	9	33.67	PASS	12	9	11.75	2.87	2.87			150 kDa oxygen-regulated
														protein ORP150
ARF5	M57567_at	M57567	PASS	8	46.00	PASS	13	8	16.15	2.85	2.85	ARF5	7q31.3	ADP-ribosylation factor 5	ADP-ribosylation factor 5
S69272_s_at	S69272_s_at	S69272	PASS	9	24.67	PASS	13	9	8.69	2.84	2.84	P16	6p25	protease inhibitor 6	protease inhibitor 6
														(placental thrombin	(placental thrombin
														inhibitor)	inhibitor)
AB002356_s	AB002356_s	AB002356	PASS	9	31.67	PASS	12	9	11.17	2.84	2.84	MADD	11p11.21-	MAP-kinase activating	MAP-kinase activating
													p11.22	death domain	death domain
CSF1	HG1155-HT4	HG1155-HT	PASS	8	27.63	PASS	9	8	9.78	2.83	2.83
RGS2	L13391_at	L13391	PASS	9	60.33	PASS	13	9	21.38	2.82	2.82	RGS2	1q31	regulator of G-protein	regulator of G-protein
														signalling 2,24 kD	signalling 2, 24 kD
UP	X90858_at	X90858	PASS	9	21.44	PASS	13	9	7.62	2.82	2.82	UP	7	uridine phosphorylase	uridine phosphorylase
K250	D87437_at	D87437	PASS	9	19.33	PASS	9	9	6.89	2.81	2.81	KIAA0250			KIAA0250 gene product
CNP_cds1	D13146_cds1	D13146	PASS	9	49.89	PASS	13	9	17.85	2.80	2.80			2,3-cyclic-nucleotide 3-	alternative splicing
														phosphodiesterase (CNPT)
CDA	L27943_at	L27943	PASS	6	32.33	PASS	10	6	11.60	2.79	2.79	CDA	1p36.2-p35	cytidine deaminase	cytidine deaminase
FAST	X86779_at	X86779	PASS	9	20.33	PASS	10	9	7.30	2.79	2.79	fast		FAST kinase
X59932_s_at	X59932_s_at	X59932	PASS	9	62.44	PASS	13	9	22.46	2.78	2.78	CSK	15q23-q25	c-src tyrosine kinase	c-src tyrosine kinase
MAZ	M94046_at	M94046	PASS	9	29.67	PASS	13	9	10.69	2.77	2.77
DF	M84526_at	M84526	PASS	5	43.40	PASS	12	5	15.67	2.77	2.77	DF		D component of	D component of
														complement (adipsin)	complement (adipsin)
PRKM3	D28915_at	D28915	PASS	7	16.00	PASS	10	7	5.80	2.76	2.76			hepatitis C-associated
														microtubular aggregate
														protein p44
CD33	M23197_at	M23197	PASS	8	21.00	PASS	13	8	7.62	2.76	2.76	CD33	19q13.3	CD33 antigen (gp67)	CD33 antigen (gp67)
D78577_s_at	D78577_s_at	D78577	PASS	9	85.67	PASS	13	9	31.08	2.76	2.76			14-3-3 protein eta chain
BRF2	X78992_at	X8992	PASS	8	64.88	PASS	13	8	23.54	2.76	2.76	ERF-2
CLTA	M20471_at	M20471	PASS	9	73.56	PASS	13	9	26.69	2.76	2.76	CLTA	12q23-q24	clathrin, light polypeptide	clathrin, light polypeptide
														(Lea)	(Lea)
HG2868-HT3	HG2868-HT3	HG2868-HT	PASS	7	18.57	PASS	12	7	6.75	2.75	2.75
MCL1	L08246_at	L08246	PASS	9	88.67	PASS	13	9	32.23	2.75	2.75	MCL1	1q21		myeloid cell leukemia
															(BCL2-related)
S100A11	D38583_at	D38583	PASS	9	81.00	PASS	13	9	29.54	2.74	2.74
TNFR2	M32315_at	M32315	PASS	9	67.44	PASS	13	9	24.62	2.74	2.74	TNFRSF1B	1p36.3-p36.2	tumor necrosis factor	tumor necrosis factor
														receptor 2 (75 kD)	superfamily, member 1B
GNG10	U31383_at	U31383	PASS	9	18.33	PASS	13	9	6.69	2.74	2.74	GNG10		guanine nucleodide	guanine nucleotide
														binding protein 10	binding protein 10
D38251_s_at	D38251_s_at	D38251	PASS	8	30.75	PASS	13	8	11.23	2.74	2.74	PLLR2E	19p13.3	polymerase (RNA) II	polymerase (RNA) II
														(DNA directed) poly-	(DNA directed) poly-
														peptide E (25 kD)	peptide E (25 kD)
K50_K41	D30758_at	D30758	PASS	9	61.89	PASS	13	9	22.62	2.74	2.74	KIAA0050			KIAA0050 gene product
M38449_s_at	M38449_s_at	M38449	PASS	6	33.50	PASS	8	6	12.25	2.73	2.73	TGF-beta		transforming growth factor-
GT197	L38932_at	L38932	PASS	9	40.33	PASS	13	9	14.77	2.73	2.73	BECN1		beclin 1 (coiled-coil,	beclin 1 (coiled-coil,
														myosin-like BCL2-	myosin-like BCL2-
														interacting protein)	interacting protein)
AMPD2_cds1	M91029_cds2	M91029	PASS	9	30.3	PASS	13	9	11.15	2.72	2.72	AMPD2	1p13.3	adenosine monophosphate	adenosine monophosphate
														deaminase 2 (isoform L)	deaminase 2 (isoform L)
RABGGTA	Y08200_at	Y08200	PASS	9	23.56	PASS	12	9	8.67	2.72	2.72	RABGGTA	14q11.2	Rab geranylgeranyl-	Rab geranylgeranyl-
														transferase, alpha subunit	transferase, alpha subunit
Y08682_rna1	Y08682_rna1	Y08682	PASS	9	13.56	PASS	8	9	5.00	2.71	2.71	CPT1B		carnitine palmitoyl-	type I
														transferase 1
MYH9	M31013_at	M31013	PASS	9	149.78	PASS	13	9	55.38	2.70	2.70	MYH9	22q12.3-q13.1		myosin, heavy polypeptide
															9, non-muscle
D00749_s_at	D00749_s_at	D00748	PASS	9	69.89	PASS	13	9	25.85	2.70	2.70			CD7 antigen
U65416_rna1	U65416_rna1	U65416	PASS	9	17.33	PASS	12	9	6.42	2.70	2.70	MICB		MHC class I molecule	MHC class I chain-related
															gene B; cDNA sequence
															deposited under GenBank
															Accession Number
															X91625
Z22951_rna1	Z22951_rna1	Z22951	PASS	5	18.60	PASS	10	5	6.90	2.70	2.70	p65		p65 subunit of transcription
														factor NF-kappaB
PRCC_rna1	X99720_rna1	X99720	PASS	7	22.43	PASS	9	7	8.33	2.69	2.69	TPRC
HG2238-HT2	HG2238-HT2	HG2238-HT	PASS	9	25.67	PASS	13	9	9.54	2.69	2.69
SLC2A3	M20681_at	M20681	PASS	9	26.00	PASS	12	9	9.67	2.69	2.69	SLC2A3	12p13.3		solute carrier family 2
															(facilitated glucose
															transporter), member 3
FCGRT	U12255_at	U12255	PASS	9	78.56	PASS	13	9	29.23	2.69	2.69	FCGRT	19q13.3	Fc fragment of IgG,	Fc fragment of IgG,
														receptor, transporter, alpha	receptor, transporter, alpha
MAPT	HG2566-HT4	HG2566-HT	PASS	8	28.38	PASS	7	8	10.57	2.68	2.68
E_IFNGR2	U05875_at	U05875	PASS	8	34.88	PASS	8	8	13.00	2.68	2.68			AF-1	second chain of the receptor
TCFL1	D43642_at	D43642	PASS	9	38.22	PASS	13	9	14.31	2.67	2.67	YL-1		YL-1 protein	Nuclear protein with DNA-
															binding ability
U66711_rna1	U66711_rna1	U66711	PASS	8	48.75	PASS	12	8	18.25	2.67	2.67	LY6E	8q24.3	lymphocyte antigen 6	lymphocyte antigen 6
														complex, locus E	complex, locus E
HVEM	U70321_at	U70321	PASS	9	28.11	PASS	13	9	10.54	2.67	2.67	TNPRSF14	1p36.3-p36.2	tumor necrosis factor	tumor necrosis factor
														receptor superfamily,	receptor superfamily,
														member 14; herpes virus	member 14; (herpes virus
														entry mediator	entry mediator)
TPR2	U46571_at	U46571	PASS	9	17.78	PASS	12	9	6.67	2.67	2.67	TTC2	17q11.2	tetratricopeptide repeat	tetratricopeptide repeat
														domain 2	domain 2
GARS	U09587_at	U09587	PASS	9	29.67	PASS	13	9	11.15	2.66	2.66			glycyl-tRNA synthetase
ARAF1	U01337_at	U01337	PASS	9	32.67	PASS	12	9	12.33	2.65	2.65	A-RAP-1		Ser/Thr protein kinase	cytoplasmic
ISGF3G	M87503_at	M87503	PASS	8	52.50	PASS	13	8	19.85	2.65	2.65	ISGF3-		IFN-alpha responsive
												gamma		transcription factor
P1	K01396_at	K01396	PASS	9	139.78	PASS	13	9	52.85	2.64	2.64	P1	14q32.1	protease inhibitor 1 (anti-	protease inhibitor 1 (anti-
														elastase), alpha-1-	elastase), alpha-1-
														antitrypsin	antitrypsin
BTG2	U72649_at	U72649	PASS	9	4033	PASS	12	9	15.25	2.64	2.64	BTG2		BTG2	rat PC3 and murine
															TIS21 genes homolog
TXNRD1	U78678_at	U78678	PASS	8	20.25	PASS	9	8	7.67	2.64	2.64			thioredoxin
CSNK2A2	M55268_at	M55268	PASS	9	17.33	PASS	7	9	6.57	2.64	2.64	CSNK2A2	16p13.3-p13.2	casein kinase 2, alpha	casein kinase 2, alpha
														prime polypeptide	prime polypeptide
ARHG	X61587_at	X61587	PASS	9	51.89	PASS	13	9	19.69	2.63	2.63	ARHG	11p15.5-p15.4	ras homolog gene family,	ras homolog gene family,
														member G (rho G)	member G (rho G)
IRF3	Z56281_at	Z56281	PASS	9	25.11	PASS	13	9	9.54	2.63	2.63	IRP3	19q13.3-q13.4	interferon regulatory factor	interferon regulatory factor
														3	3
HEM1	M58285_at	M58285	PASS	9	38.44	PASS	13	9	14.62	2.63	2.63			membrane-associated
														protein HEM-1
NRAMP1	D50402_at	D50402	PASS	9	19.11	PASS	11	9	7.27	2.63	2.63	NRAMP1	2q35	Nramp	natural resistance-
															associated macrophage
															protein 1 (might include
															Leishmaniasis)
CLAPB1	M34175_at	M34175	PASS	9	28.22	PASS	12	9	10.75	2.63	2.63	CLAPB1	17q11.2-q12	clathrin-associated/	clathrin-associated/
														assembly/adaptor	assembly/adaptor
														protein, large, beta 1	protein, large, beta 1
ZFP77	HG4332-HT4	HG4332-HT	PASS	8	14.63	PASS	7	8	5.57	2.63	2.63
K151_SPK1	D63485_at	D63485	PASS	9	18.89	PASS	10	9	7.20	2.62	2.62	KIAA0151			KIAA0151 gene product
K226	D86979_at	D86979	PASS	9	20.56	PASS	13	9	7.85	2.62	2.62	KIAA0226			KIAA0226 gene product
BTN_rna1	U97502_rna1	U97502	PASS	6	16.50	PASS	13	6	6.31	2.62	2.62	BT3.3		butyrophilin
L32831_s_at	L32831_s_at	L32831	PASS	5	18.00	PASS	9	5	6.89	2.61	2.61			G protein-coupled receptor
														GPR3
FKBP4	M88279_at	M88279	PASS	9	23.11	PASS	13	9	8.85	2.61	2.61	FKBP4		FK506-binding protein 4	FK506-binding protein 4
														(59 kD)	(59 kD)
CTSD	M63138_at	M63138	PASS	9	82.89	PASS	12	9	31.75	2.61	2.61	CTSD	11p15.5	cathepsin D (lysosomal	cathepsin D (lysosomal
														aspartyl protease)	aspartyl protease)
HG2815-HT4	HG2815-HT4	HG2815-HT	PASS	9	360.22	PASS	13	9	138.00	2.61	2.61
L13939_s_at	L13939_s_at	L13939	PASS	8	24.88	PASS	13	8	9.54	2.61	2.61	ADTB1	22q12	adaptin, beta 1 (beta prime)	adaptin, beta 1 (beta prime)
AOAH	M62840_at	M62840	PASS	8	27.50	PASS	9	8	10.56	2.61	2.61	AOAH	7p14-p12	acyloxyacyl hydrolase	acyloxyacyl hydrolase
														(neutrophil)	(neutrophil)
TPR1	U46570_at	U46570	PASS	9	41.67	PASS	13	9	16.08	2.59	2.59	TTC1	5q32-q33.2	tetratricopeptide repeat	tetratricopeptide repeat
														domain 1	domain 1
TUBA1	X01703_at	X01703	PASS	9	37.67	PASS	13	9	14.54	2.59	2.59			alpha-tubulin
C5R1	M62505_at	M62505	PASS	8	25.00	PASS	12	8	9.67	2.59	2.59	C5R1	19q13.3-q13.4	complement component 5	complement component 5
														receptor 1 (C5a ligand)	receptor 1 (C5 ligand)
U43185_s_at	U43185_s_at	U43185	PASS	9	27.56	PASS	12	9	10.67	2.58	2.58	STAT5A	17q11.2	signal transducer and	signal transducer and
														activator of transcription	activator of transcription
														5A	5A
AARS	D32050_at	D32050	PASS	8	19.38	PASS	12	8	7.50	2.58	2.58	AARS	16q22	alanyl-tRNA synthetase	alanyl-tRNA synthetase
SREBF1	U00968_at	U00968	PASS	6	24.67	PASS	7	6	9.57	2.58	2.58	SREBF1	17p1.2	sterol regulatory element	sterol regulatory element
														binding transcription	binding transcription
														factor 1	factor 1
G1P2	M13755_at	M13755	PASS	7	30.71	PASS	13	7	11.92	2.58	2.58	ISG15	1		interferon-stimulated
															protein, 15 kDa
BCAT2	U62739_at	U62739	PASS	9	18.78	PASS	10	9	7.30	2.57	2.57	BCAT2	19	branched chain	branched chain
														aminotransferase 2,	aminotransferase 2,
															mitochondrial
DCTD	L39874_at	L39874	PASS	8	26.38	PASS	11	8	10.27	2.57	2.57	DCTD		DCMP deaminase	dCMP deaminase
K15_PPMIA	D13640_at	D13640	PASS	9	29.00	PASS	12	9	11.33	2.56	2.56	KIAA0015			KIAA0015 gene product
RTP	D87953_at	D87953	PASS	9	39.56	PASS	13	9	15.46	2.56	2.56	GC4		RTP
PXN	U14588_at	U14588	PASS	9	39.11	PASS	13	9	15.31	2.55	2.55	PXN	12q24	paxillin	paxillin
KAP1_TIFIE	U95040_at	U95040	PASS	9	44.00	PASS	13	9	17.31	2.54	2.54			hKAP1/TIF1B
NRBTK	L20773_at	L20773	PASS	9	25.56	PASS	13	9	10.08	2.54	2.54
AJ000099_s	AJ000099_s	AJ000099	PASS	7	28.57	PASS	11	7	11.27	2.53	2.53	HYAL2	3p21.3	hyaluronoglucosaminidase	hyaluronoglucosaminidase
														2	2
BZRP	L21954_at	L21954	PASS	9	127.89	PASS	13	9	50.46	2.53	2.53	BZRP	22q13.3	benzodiazapine receptor	benzodiazapine receptor
														peripheral	peripheral
HUK5	U67963_at	U67963	PASS	9	18.89	PASS	11	9	7.45	2.53	2.53	HU-K5		lysophospholinase homolog
YF5	U84569_at	U84569	PASS	8	24.88	PASS	13	8	9.85	2.53	2.53			YF5	similar to A2 encoded by
															GenBank Accession
															Number U84570 and to
															sequence with GenBank
															Accession Number
															AC000020
STX5A	U26648_at	U26648	PASS	6	21.33	PASS	9	6	8.44	2.53	2.53	STX5A		syntaxin 5A	syntaxin 5A
X65784_s_at	X65784_s_at	X65784	PASS	8	21.88	PASS	12	8	8.67	2.52	2.52	CMAR	16q		cell matrix adhesion
															regulator
SFCC13	L10910_at	L10910	PASS	9	16.11	PASS	13	9	6.38	2.52	2.52	CC1.3	20	splicing factor (CC1.3)	splicing factor (CC1.3)
K79_CHR7	D38555_at	D38555	PASS	9	21.33	PASS	10	9	8.50	2.51	2.51	KIAA0079	10	Sec24p, S. Cerevisiae,	Sec24p, S. Cerevisiae,
														homolog of	homolog of
E_A9A2BRD	U00952_at	U00952	PASS	5	17.80	PASS	10	5	7.10	2.51	2.51
LAG2	M85276_at	M85276	PASS	9	138.22	PASS	13	9	55.15	2.51	2.51	NKG5	NKG5 protein
M16750_s_at	M16750_s_at	M16750	PASS	9	34.89	PASS	13	9	13.92	2.51	2.51	PIM1	6p21	pim-1 oncogene	pim-1 oncogene
K120_NP25	D21261_at	D21261	PASS	9	278.78	PASS	13	9	111.31	2.50	2.50	TAGLN2	1121-q25	transgelin 2	transgelin 2
PRKACG	U42412_at	U42412	PASS	8	16.38	PASS	11	8	6.55	2.50	2.50	PRKAG1	12q12-q14	protein kinase, AMP-	protein kinase, AMP-
														activated, gamma 1 non-	activated, gamma 1 non-
														catalytic subunit	catalytic subunit
U41315_rna1	U41315_rna1	U41315	PASS	9	15.00	PASS	11	9	6.00	2.50	2.50	ZNF127-Xp		ZNF127-Xp	ring zing-finger protein;
															escapes X chromosome
															inactivation
NF116	HG3494-HT3	HG3494-HT	PASS	9	80.56	PASS	13	9	32.23	2.50	2.50
ANX11	L19605_at	L19605	PASS	9	97.56	PASS	13	9	39.08	2.50	2.50	ANX11	10q22-q23	annexin XI (56 kD	annexin XI (56 kD
														autoantigen)	autoantigen)
K25	D14695_at	D14695	PASS	8	17.88	PASS	12	8	7.17	2.49	2.49	KIAA0025			KIAA0025 gene product
K144_DAGK	D63478_at	D63478	PASS	7	13.43	PASS	13	7	5.38	2.49	2.49	KIAA0144			KIAA0144 gene product
S100A6	HG2788-HT2	HG2788-HT	PASS	9	179.22	PASS	13	9	72.15	2.48	2.48
PUTDNABP	U49278_at	U49278	PASS	8	27.63	PASS	13	8	11.15	2.48	2.48	UBE2V2		ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E2 variant 2	enzyme E2 variant 2
HG3395-HT3	HG3395-HT3	HG3395-HT	PASS	7	12.71	PASS	7	7	5.14	2.47	2.47
BCL6	U00115_at	U00115	PASS	7	13.71	PASS	9	7	5.56	2.47	2.47	BCL6	3q27	B-cell CLL/lymphoma 6	B-cell CLL/lymphoma 6
														(zinc finger protein 51)	(zinc finger protein 51)
SAFB	L43631_at	L43631	PASS	9	25.44	PASS	13	9	10.31	2.47	2.47	SAFB	19p13	scaffold attachment	scaffold attachment
														factor B	factor B
SRFGLYCP	Z50022_at	Z50022	PASS	8	32.00	PASS	13	8	13.00	2.46	2.46	C21ORF1	21q22.3	chromosome 21 open	chromosome 21 open
														reading frame 1	reading frame 1
MSN	M69066_at	M69066	PASS	9	178.78	PASS	13	9	72.85	2.45	2.45	MSN	Xq11 2-q12	moesin	moesin
PPP4C	X70218_at	X70218	PASS	7	27.43	PASS	11	7	11.18	2.45	2.45	PPP4C	16p12-16p11	protein phosphatase 4	protein phosphatase 4
														(formerly X), catalytic	(formerly X), catalytic
														subunit	subunit
EMP3	U52101_at	U52101	PASS	9	159.33	PASS	13	9	65.15	2.45	2.45	EMP3		epithelial membrane	epithelial membrane
														protein 3	protein 3
TPI1	HG2279-HT2	HG2279-HT	PASS	9	73.33	PASS	13	9	30.00	2.44	2.44
K121	D50911_at	D50911	PASS	9	16.44	PASS	11	9	6.73	2.44	2.44	KIAA0121			KIAA0121 gene product
M83652_s_at	M83652_s_at	M83652	PASS	9	46.56	PASS	13	9	19.08	2.44	2.44	PFC	Xp11 4	properdin P factor,	properdin P factor
														complement	complement
PLBK	U78095_at	U78095	PASS	5	26.40	PASS	11	5	10.82	2.44	2.44			bikunin	member of the Kunitz
															family of protease
															inhibitors
FKBP1	M34539_at	M34539	PASS	9	42.78	PASS	13	9	17.54	2.44	2.44	FKBP1A	20p13	FK506-binding protein	FK506-binding protein
														1A (12 kD)	1A (12 kD)
S100A4	M80563_at	M80563	PASS	9	213.22	PASS	13	9	87.62	243	2.43	S100A4	1q12-q22	S100 calcium-binding	S100 calcium-binding
														protein A4 (calcium	protein A4 (calcium
														protein, calvaculm,
														metastasin, murine	metastasin, murine
														placental homolog)	placental homolog)
UQCRC1	L16842_at	L16842	PASS	9	24.11	PASS	12	9	9.92	2.43	2.43	UQCRC1	3p21	ubiquinol-cytochrome c	ubiquinol-cytochrome c
														reductase core protein 1	reductase core protein 1
Y10807_s_at	Y10107_s_at	Y10807	PASS	7	35.14	PASS	13	7	14.46	2.43	2.43	HRMT1L2	19q13	HMT1 (hnRNP methyl-	HMT1 (hnRNP methyl-
														transferase, S. cerevisiae)-	transferase, S. cerevisiae)-
														like 2	like 2
SELP	M25322_at	M25322	PASS	9	15.00	PASS	11	9	6.18	2.43	2.43	SELP	1q22-q25	selectin P (granule	selectin P (granule
														membrane protein 140 kD,	membrane protein 140 kD,
														antigen CD62)	antigen CD62)
PTGS1	M59979_at	M59979	PASS	8	15.25	PASS	7	8	6.29	2.43	2.43	PTGS1	9q32q33.3	prostaglandin endoperoxide	prostaglandin-endoperoxide
														synthase	synthase 1 (prostaglandin
															G/H synthase and cyclo-
															oxygenase)
PIL	U46751_at	U46751	PASS	9	99.78	PASS	13	9	40.77	2.42	2.42	P62		UBIQUITIN-BINDING	UBIQUITIN-BINDING
														PROTEIN P62,	PROTEIN P62,
														phosphotyrosine	phosphotyrosine
														independent ligand for the	independent ligand for the
														Lck SH2 domain p62	Lck SH2 domain p62
ITPK1	U51336_at	Y51336	PASS	9	49.00	PASS	13	9	20.23	2.42	2.42			inositol 1,3,4-tris-
														phosphate 5/6-kinase
KNS2	L04733_at	L04733	PASS	7	17.29	PASS	7	7	7.14	242	2.42			kinesin light chain	putative
M23323_s_at	M23323_s_at	M23323	PASS	9	45.78	PASS	13	9	18.92	2.42	2.42	CD3E	11q23	CD3E antigen, epsilon	CD3E antigen, epsilon
														polypeptide (TiT3 complex)	polypeptide (TiT3 complex)
X76223_s_at	X76223_at	X76223	PASS	7	36.86	PASS	12	7	15.25	2.42	2.42	MAL	2cen-q13	mal, T-cell differentiation	mal, T-cell differentiation
														protein	protein
OS9	U41635_at	U41635	PASS	9	58.56	PASS	13	9	24.23	2.42	2.42			OS-9 precursor	ubiquitously expressed in
															human tissues and
															amplified in sarcoma
RPS6KA2	L07597_at	L07597	PASS	9	28.78	PASS	12	9	11.92	2.41	2.41	RPS6KA1	3	ribosomal protein S6	ribosomal protein S6
														kinase, 90 kD, polypeptide	kinase, 90 kD, polypeptide
														1	1
IFNG	L07633_at	L07633	PASS	9	84.33	PASS	13	9	34.92	2.41	2.41	PSME1	14q11.2	interferon-gamma	proteasome (prosome,
															macropain) activator
															subunit 1 (PA28 alpha)
FRAPI.	L37033_at	L37033	PASS	8	29.38	PASS	11	8	12.18	2.41	2.41	FKBP38		FK-506 binding protein
														homologue
CES1	L07765_at	L07765	PASS	7	15.43	PASS	10	7	6.40	2.41	2.41	CES1	16q13-q22.1	carboxylesterase 1	carboxylesterase 1
														(monocyte/macrophage	monocyte/macrophage
														serine esterase 1)	serine esterase 1)
X56681_s_at	X56681_s_at	X56681	PASS	9	114.44	PASS	13	9	47.54	2.41	2.41	JUND	19p13.2	junD protein	jun D proto-oncogene
HDLBP	M64088_at	M64098	PASS	8	20.00	PASS	13	8	8.31	2.41	2.41	HBP		high density lipoprotein
														binding protein
ECGF1_rna3	U62317_rna3	U62317	PASS	9	66.22	PASS	13	9	27.54	2.40	2.40			arylsulfatase A	hypothetical protein
															384D8 2
K140	D50930_at	D50930	PASS	8	18.13	PASS	11	8	7.55	2.40	2.40	KIAA0140
HG4541-HT4	HG4541-HT4	HG4541-HT	PASS	9	41.56	PASS	13	9	17.31	240	2.40
ARP	M83751_at	M83751	PASS	9	21.22	PASS	13	9	8.85	2.40	2.40	ARP		arginine-rich protein	putative
HG417-HT41	HG417-HT41	HG417-HT	PASS	9	71.33	PASS	13	9	29.77	2.40	2.40
STM	U20499_at	U20499	PASS	9	20.33	PASS	12	9	8.50	239	2.39	SULT1A3	16p112	thermolabile phenol	sulfotransferase family
														sulfotransferase	1A, phenol-preferring,
															member 3
NP	K02574_at	K02574	PASS	8	32.88	PASS	13	8	13.77	2.39	2.39	NP	14111.2	nucleoside phosphorylase	nucleoside phosphorylase
GLA	X14448_at	X14448	PASS	9	20.56	PASS	13	9	8.62	2.39	2.39			alpha D-galactosidase A
ARNP	M74002_at	M74002	PASS	9	20.00	PASS	13	9	8.38	2.39	2.39	SFRS11	1p21-p34	splicing factor, arginine/	splicing factor, arginine/
														serine-rich 11	serine-rich 11
K168	D79990_at	D79990	PASS	9	2933	PASS	13	9	12.31	2.38	2.38	KIAA0168			KIAA0168 gene product
SUPT4H1	U43923_at	U43923	PASS	8	21.63	PASS	12	8	9.08	2.38	2.38	SUPT4H1	17q21-q23	suppressor of Ty (S.	suppressor of Ty (S.
														cerevisiae) 4 homolog 1	cerevisiae) 4 homolog 1
K174	D79996_at	D79996	PASS	9	28.56	PASS	13	9	12.00	2.38	2.38	K1AA0174			KIAA0174 gene product
DCT	U49785_at	U49785	PASS	9	24.89	PASS	13	9	10.46	2.38	2.38	DDT	22q11.2	D-dopachrome tautomerase	D-dopachrome tautomerase
CLP36	U90878_at	U90878	PASS	9	26.56	PASS	12	9	11.17	2.38	2.38	CLIM1	10q22-q27	carboxyl terminal LIM	carboxy terminal LIM
														domain protein	domain protein 1
LAMP5	U51240_at	U51240	PASS	9	146.89	PASS	13	9	61.77	2.38	2.38	LAPTm5		lysosomal-associated
														multitransmembrane protein
NK4	M59807_at	M59807	PASS	9	116.67	PASS	13	9	49.15	2.37	2.37	NK4	16p13.3	natural killer cell	natural killer cell
														transcript 4	transcript 4
K223_COSZ1	D86976_at	D86976	PASS	9	103.11	PASS	13	9	43.46	2.37	2.37	KIAA0223			similar to C. elegans
															protein (Z37093)
B94	M92357_at	M92357	PASS	9	27.00	PASS	13	9	11.38	237	2.37			B94 protein
SPARC	J303040_at	J03040	PASS	9	57.78	PASS	13	9	24.38	2.37	2.37	SPARC	5q31-q33	secreted protein, acidic	secreted protein, acidic
														cysteine-rich (osteonectin)	cystein-rich (osteonectin)
PPGB	M22960_at	M22960	PASS	9	83.44	PASS	13	9	35.23	2.37	2.37	PPGB	20q13.1	protective protein for	protective protein for
														beta-galactosidase	beta-galactosidase
															(galactosialidosis)
MX2	M30818_at	M30818	PASS	9	20.56	PASS	13	9	8.69	2.36	2.36	MX2	21q22.3	interferon-induced Mx	myxovirus (influenza)
														protein	resistance 2, homolog
															of murine
SMRT	U37146_at	U37146	PASS	9	26.56	PASS	13	9	11.23	2.36	2.36	SMRT		silencing mediator of	transcriptional co-repressor
														retinoid and thyroid
														hormone action
DGK5Z	U51477_at	U51477	PASS	9	32.56	PASS	13	9	13.77	2.36	2.36	DGKZ		diacylglycerol kinase,	diacylglycerol kinase,
														zeta (104 kD)	zeta (104 kD)
LAMP1	J04182_at	J04182	PASS	9	47.78	PASS	13	9	20.23	2.36	2.36	LAMP1		lysosomal membrane	precursor
														glycoprotein-1
YWHAE	U54778_at	U54778	PASS	8	14.50	PASS	13	8	6.15	2.36	2.36			14-3-3 epsilon
U51333_s_at	U51333_s_at	U51333	PASS	9	47.11	PASS	13	9	20.00	2.36	2.36	HK3	5g35.2	hexokinase 3 (white cell)	hexokinase 3 (white cell)
CRFB4	Z17227_at	Z17227	PASS	9	15.78	PASS	10	9	6.70	2.35	2.35	IL10RB	21g22.1-g22.1	interleukin 10 receptor,	interleukin 10 receptor,
														beta	beta
PIM2	U77735_at	U77735	PASS	6	24.33	PASS	12	6	10.33	2.35	2.35			pim-2 protooncogene	similar to murine pim-2
														homolog pim-2h	product endoded by
															GenBank Accession
															Number L41495; serine/
															threonine protein kinase
AAMP	M95627_at	M95627	PASS	9	22.11	PASS	12	9	9.42	2.35	2.35	AAMP		angio-associated, migratory	angio-associated, migratory
														cell protein	cell protein
K67_TOP2	D31891_at	D31891	PASS	9	18.56	PASS	11	9	7.91	2.35	2.35	KIAA0067			KIAA0067 gene product
NKG2D	X54870_at	X54870	PASS	9	31.33	PASS	13	9	13.38	2.34	2.34	NKG2-D			type II integral membrane
												gene			protein
M81695_s_at	M81695_s_at	M81695	PASS	9	32.22	PASS	13	9	13.77	2.34	2.34	ITGAX	16p13.1-p11	integrin, alpha X (antigen	integrin, alpha X (antigen
														CD11C (p150), alpha	CD11C (p150), alpha
														polypeptide)	polypeptide)
KRT12	U77643_at	U77643	PASS	8	28.25	PASS	13	8	12.08	2.34	2.34	SECTM1	17g25	secreted and trans-	secreted and trans-
														membrane 1	membrane 1
LGALS9	AB006782_at	AB006782	PASS	9	78.89	PASS	13	9	33.77	2.34	2.34	LGALS9		lectin, galactoside-binding,	lectin, galactoside-binding,
														soluble, 9 (galectin 9)	soluble 9 (galectin 9)
ARF3	M74491_at	M74491	PASS	9	54.11	PASS	13	9	23.23	2.33	2.33	ARP3	12q13	ADP-ribosylation factor 3	ADP-ribosylation factor 3
ALDH7	U10868_at	U10868	PASS	8	16.88	PASS	12	8	7.25	2.33	2.33	ALDH7	11g13	aldehyde dehydrogenase 7	aldehyde dehydrogenase 7
M54915_s_at	M54915_s_at	M54915	PASS	9	54.67	PASS	13	9	23.54	2.32	2.32			pim-1 protein
FAH	M55150_at	M55150	PASS	6	18.50	PASS	8	6	8.00	2.31	2.31	FAH	15q23-q25	furnarylacetoacetate	furnarylacetoacetate
TPM3	HG3514-HT3	HG3514-HT	PASS	9	149.22	PASS	13	9	64.54	2.31	2.31
CAKB	U43522_at	U43522	PASS	8	14.13	PASS	9	8	6.11	2.31	2.31	PTK2B	8p21.1	focal adhesion kinase	protein tyrosine kinase
														2 (protein kinase B)	2 beta
ICAM3	X69819_at	X69819	PASS	9	52.22	PASS	13	9	22.62	2.31	2.31	ICAM3	19p13.3-p13.2	intercellular adhesion	intercellular adhesion
														molecule 3	molecule 3
IRF5	U51127_at	U51127	PASS	9	29.00	PASS	7	9	12.57	2.31	2.31	IRFS	7q32	interferon regulatory	interferon regulatory
														molecule 3	molecule 3
CAP	L12168_at	L12168	PASS	9	134.67	PASS	13	9	58.38	2.31	2.31	CAP		adenylyl cyclase-	putative
														associated protein
RBPS6	U51334_at	U51334	PASS	8	25.50	PASS	13	8	11.08	2.30	2.30	TAF2N	17q11.1-q11.2	TATA box binding protein	TATA box binding protein
														(TBP)-associated factor,	(TBP)-associated factor,
														RNA polymerase II,	RNA polymerase II,
														N, 68 kD (RNA-binding	N, 68 kD (RNA-binding
														protein 56)	protein 56)
HSPAIL_rna	M11717_rna	M11717	PASS	9	53.11	PASS	13	9	2308	2.30	2.30	HSPAIL		heat shock protein	70 kDa
RGL2	U68142_at	U68142	PASS	9	15.67	PASS	11	9	6.82	2.30	2.30	RGL2		RalGDS-like
PM5	X57398_at	X57398	PASS	9	27.33	PASS	12	9	11.92	2.29	2.29	pM5		pm5 protein	Protein sequence is in
															conflict with the
															conceptual translation
K217	D86971_at	D86971	PASS	5	17.20	PASS	10	5	7.50	2.29	2.29	KIAA0217			no similarities to
															reported gene products
CAPG	M94345_at	M94345	PASS	9	49.33	PASS	13	9	21.54	2.29	2.29	CAPG	2cen-q24	capping protein (actin	capping protein (actin
														filament), gelsolin-like	filament), gelsolin-like
PIN1	U49070_at	U49070	PASS	6	14.50	PASS	12	6	6.33	2.29	2.29	PIN1		Pin1	NIMA-interacting protein
															1, essential mitotic
															regulator, essential
															peptidyl-prolyl isomerase
U72882_s_at	U72882_s_at	U72882	PASS	6	15.50	PASS	9	6	6.78	2.29	229	IFP35		interferon-induced leucine
														zipper protein
ITGAM	J03925_at	J03925	PASS	9	23.56	PASS	13	9	10.31	2.29	2.29	ITGAM	16p11.2	integrin, alpha M	integrin, alpha M
														(complement component	(complement component
														receptor 3, alpha;	receptor 3; alpha;
														alpha; also known as	alpha; also known as
														CD11b (p170), macrophage	CD11b (p170), macrophage
														antigen alpha polypeptide)	antigen alpha polpeptide)
IQGAP2	U51903_at	U51903	PASS	8	17.38	PASS	13	8	7.62	2.28	2.28	IQGAP2		RasGAP-related protein	IQGAP2; Cdc42-, Rac1-,
															and calmodulin-binding
															protein
MLN62	X80200_at	X80200	PASS	9	15.11	PASS	8	9	6.63	2.28	2.28	TRAF4	17q11-q12	TNF receptor-associated	TNF receptor-associated
														factor 4	factor 4
INPP5D	U57650_at	U57650	PASS	9	42.78	PASS	13	9	18.77	2.28	2.28	INPP5D	2q36-q37	SH2-containing inositol 5-	inositol polyphosphate-
														phosphatase	5-phosphatase, 145 kD
M13829_s_at	M13829_s_at	M13829	PASS	8	15.25	PASS	13	8	6.69	2.28	2.28	ARAF1	Xp11.4-p11.2	V-raf murine sarcoma	v-raf murine sarcoma
														3611 viral oncogene	3611 viral oncogene
														homolog 1	homolog 1
ITGB2	M15395_at	M15395	PASS	9	86.11	PASS	13	9	37.85	2.28	2.28	ITGB2	21q22.3	integrin, beta 2 (antigen	integrin, beta 2 (antigen
														CD18 (p95), lymphocyte	CD18 (p95), lymphocyte
														function-associated	function-associated
														antigen 1; macrophage	antigen 1; macrophage
														antigen 1 (mac-1) beta	antigen 1 (mac-1) beta
														subunit)	subunit)
D43682_s_at	D43682_s_at	D43682	PASS	9	41.44	PASS	13	9	18.23	2.27	2.27	ACADVL	17p13-p11	acyl-Coenzyme A	acyl-Coenzyme A
														dehydrogenase, very	dehydrogenase, very
														long chain	long chain
FTH1	L20941_at	L20941	PASS	9	279.00	PASS	13	9	122.77	2.27	2.27	FTH1	11q13	ferritin, heavy polypeptide	ferritin, heavy polypeptide
														1	1
PSMHC9	D00763_at	D00763	PASS	9	42.78	PASS	12	9	18.83	2.27	2.27	PSMA4		proteasome (prosome,	proteasome (prosome,
														macropain) subunit, alpha	macropain) subunit, alpha
														type, 4	type, 4
AKT1	M63167_at	M63167	PASS	8	23.13	PASS	11	8	10.18	2.27	2.27	AKT1	14q32.3	rac protein kinase-alpha	v-akt murine thymorna viral
															oncogene homolog 1
POGA	L24783_at	L24783	PASS	7	14.29	PASS	10	7	6.30	2.27	2.27
K106_B15C	D14662_at	D14662	PASS	9	36.44	PASS	13	9	16.08	2.27	2.27	KIAA0106	1	anti-oxidant protein 2	anti-oxidant protein 2
														(non-selenium glutathione	(non-selenium glutathione
														peroxidase, acidic calcium-	peroxidase, acidic calcium-
														independent phospholipase	independent phospholipase
														A2	A2
CYP2A6_f	X13930_f_at	X13930	PASS	5	13.60	PASS	9	5	6.00	2.27	2.27				P-450 IIA4 protein
															(AA 1-494)
K113	D30755_at	D30755	PASS	9	29.11	PASS	13	9	12.85	2.27	2.27	KIAA0113
P115RHOGE	U64105_at	U64105	PASS	9	43.56	PASS	13	9	19.23	2.26	2.26	SUB1.5	19q13.13	guanine nucleotide	guanine nucleotide
														exchange factor; 115- kD;	exchange factor; 115- kD;
														mouse Lsc homolog	mouse Lsc homolog
TALDO1	L19437_at	L19437	PASS	9	85.33	PASS	13	9	37.69	2.26	2.26			transaldolase
PSMD2	D78151_at	D78151	PASS	9	36.22	PASS	13	9	16.00	2.26	2.26	PSMD2		proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase, 2	non-ATPase, 2
LGALS1	J04456_at	J04456	PASS	9	102.89	PASS	13	9	45.46	2.26	2.26	LGALS1	22q12-q13	lectin, galactoside-binding,	lectin, galactoside-binding
														soluble, 1 (galectin 1)	soluble, 1 (galectin 1)
UFD1L	U64444_at	U64444	PASS	9	22.78	PASS	13	9	10.08	2.26	2.26	UFD1L		ubiquitin fusion-	ubiquitin like protein
														degradation 1 like
														protein
K68	D38549_at	D38549	PASS	8	19.63	PASS	10	8	8.70	226	2.26	KIAA0068
PBX1	M86546_at	M86546	PASS	6	12.50	PASS	11	6	5.55	2.25	2.25	PBX1	1q23	pre-B-cell leukemia	pre-B-cell leukemia
														transcription factor 1	transcription factor 1
RAC2	HG1102-HT1	HG1102-HT	PASS	9	20.11	PASS	13	9	8.92	2.25	2.25
PRKMK2	L11285_at	L11285	PASS	9	29.11	PASS	13	9	12.92	2.25	2.25	PRKMK2			protein kinase, mitogen-
															activated, kinase 2, p45
															(MAP kinase kinase 2)
K82_ACNPV	D43949_at	D43949	PASS	8	16.75	PASS	11	8	7.45	2.25	2.25	KIAA0082			This gene is novel
PACE4	M80482_at	M80482	PASS	7	11.71	PASS	9	7	5.22	2.24	2.24	PACE4	15q26	paired basic amino acid	paired basic amino acid
														cleaving system 4	cleaving system 4
GMCSFIND	S69115_at	S69115	PASS	8	80.38	PASS	13	8	35.85	2.24	2.24	granulocyte			This sequence comes from
												colony-			FIG. 3.
												stimulating
												factor
												induced gene
ZAP70	L05148_at	L05148	PASS	9	36.56	PASS	13	9	16.31	2.24	2.24
X96506_s_at	X96506_s_at	X96506	PASS	5	22.40	PASS	10	5	10.00	2.24	2.24	NC2			alpha subunit; forms
															heterodimer with NC2
															alpha/Dr1
BRCA2	U50535_at	U50535	PASS	9	15.67	PASS	12	9	7.00	2.24	2.24
														subunit
PPP2R1A	J02902_at	J02902	PASS	8	33.38	PASS	12	8	14.92	2.24	2.24			phosphatase 2A regulatory
														subunit
IL2RB	M26062_at	M26062	PASS	8	35.25	PASS	13	8	15.77	2.24	2.24	IL2RB	22q13	interleukin 2 receptor,	interleukin 2 receptor,
														beta	beta
DJ1	D61380_at	D61380	PASS	9	58.44	PASS	13	9	26.15	2.23	2.23			DJ-1 protein
UBL1	D23662_at	D23662	PASS	9	53.11	PASS	13	9	23.77	2.23	2.23			ubiquitin-like protein
ZNF173	U09825_at	U09825	PASS	9	21.44	PASS	13	9	9.62	2.23	2.23	ZNF173	6p21.3	zinc finger protein 173
UCP2	U94592_at	U94592	PASS	9	50.22	PASS	13	9	22.54	2.23	2.23	UCPH		uncoupling protein
														homolog
L35249_s_at	L35249_s_at	L35249	PASS	9	33.89	PASS	13	9	15.23	2.23	2.23	ATP6B2		ATPase, H transporting,	ATPase, H transporting,
														lysosomal (vacuolar	lysosomal (vacuolar
														proton pump), beta	proton pump), beta
														polypeptide, 56/58 kD,	polypeptide, 56/58 kD,
														isoform 2	isoform 2
SLA	D89077_at	D89077	PASS	9	31.89	PASS	12	9	14.33	2.22	2.22			Src-like adapter protein
TUBB2	HG1980-HT2	HG1980-HT	PASS	9	53.22	PASS	13	9	23.92	2.22	2.22
K88	D42041_at	D42041	PASS	9	21.56	PASS	13	9	9.69	2.22	2.22	KIAA0088			The ha1225 gene product
															is related to human
															alpha-glucosidase.
GUSB	M15182_at	M15182	PASS	9	18.89	PASS	12	9	8.50	2.22	2.22	GUSB	7q22	glucuronidase, beta	glucuronidase, beta
RAD23A	D21235_at	D21235	PASS	9	15.56	PASS	10	9	7.00	2.22	2.22	RAD23A	19p13.2	HHR23A protein	RAD23 (S. cerevisiae)
															homolog A
TRAIL	U37518_at	U37518	PASS	9	3444	PASS	13	9	15.54	2.22	2.22	TNPSF10	3q26	tumor necrosis factor	tumor necrosis factor
														(ligand) superfamily,	(ligand) superfamily,
														member 10	member 10
UNP	U20657_at	U20657	PASS	9	14.78	PASS	12	9	6.67	2.22	2.22	USP4	13p21.3	ubiquitin specific protease,	ubiquitin specific protease
														proto-oncogene	4 (proto-oncogene)
PDIRP5	D49489_at	D49489	PASS	9	19.22	PASS	13	9	8.69	2.21	2.21			human P5	The transcript is amplified
															in hydroxyurea-resistant
															cells; an endoplasmic
															reticulum-retention signal
															(ER-retention signal) at
															1403-1414; two
															thioredoxin-like sequences
															(Trx-like motifs) at
															254-271, 659-676
OGDH	D10523_at	D10523	PASS	7	13.57	PASS	7	7	6.14	2.21	2.21	OGDH	7p13-p11.2	oxoglutarate dehydrogenase	oxoglutarate dehydrogenase
														(lipoamide)	(lipoamide)
PALMPTH	U44772_at	U44772	PASS	9	26.00	PASS	13	9	11.77	2.21	2.21	PPT	1p32	palmitoyl-protein	palmitoyl-protein
														thioesterase (ceroid-	thioesterase (ceroid-
														lipfuscinosis, neuronal 1,	lipfuscinosis, neuronal 1,
														infantile; Haltia-	infantile; Haltia-
														Santavuori disease)	Santavuori disease)
ATPLP	D89052_at	D89052	PASS	9	53 11	PASS	13	9	24.08	2.21	2.21	ATP6F	1p32.3	ATPase, H transporting,	ATPase, H transporting,
														lysosomal (vacuolar proton	lysosomal (vacuolar proton
														pump) 21 kD	pump) 21 kD
FGR	M19722_at	M19722	PASS	9	94.78	PASS	13	9	43.00	2.20	220	PGR	1p362-p36.1		Gardner-Rasheed feline
															sarcoma viral (v-fgr)
															oncogene homolog
PCMT1	D25547_at	D25547	PASS	9	13.22	PASS	9	9	6.00	2.20	2.20			PIMT isozyme I
NCF2	M32011_at	M32011	PASS	9	53.22	PASS	13	9	24.23	2.20	2.20	NCF2	1cen-q32	neutrophil cyttosolic factor	neutrophil cytosolic factor
														2 (65 kD)	2 (65 kD, chronic
															granulomatous disease,
															autosomal 2)
HG998-HT99	HG998-HT99	HG998-HT	PASS	9	21.00	PASS	12	9	9.58	2.19	2.19
K218_HYP29	D86972_at	D86972	PASS	9	13.78	PASS	10	9	6.30	2.19	2.19	KIAA0218			KIAA0218 gene product
H2A2	L19779_at	L19779	PASS	9	71.89	PASS	13	9	32.92	2.18	2.18	H2AFO		H2A histone family,	H2A histone family,
														member O	member O
Z47038_s_at	Z47038 s_at	Z47038	PASS	8	12.88	PASS	11	8	5.91	2.18	2.18	putative			open reading frame;
												microtabule			N-terminal region
												associated
												protein 1A
K224_DDX	D86977_at	D86977	PASS	8	15.25	PASS	13	8	7.00	2.18	2.18	KIAA0224			KIAA0224 gene product
K160	D63881_at	D63881	PASS	9	14.56	PASS	13	9	6.69	2.17	2.17	KIAA0160			KIAA0160 gene product
															is novel.
D83260_s_at	D83260_s_at	D83260	PASS	9	16.56	PASS	13	9	762	2.17	2.17	DXS9928E	Xq28	putative candidate disease	putative candidate disease
														gene XAP5	gene XAP5
EIF3	U78525_at	U78525	PASS	9	19.56	PASS	13	9	9.00	2.17	2.17	EIF3S9		eukaryotic translation	eukaryotic translation
														initiation factor 3,	initiation factor 3,
														subunit 9 (eta, 116 kD)	subunit 9 (eta, 116 kD)
K169	D79991_at	D79991	PASS	9	13.67	PASS	10	9	6.30	2.17	2.17	KIAA0169			putative hydrophobic
															domain in amino acid
															positions 373-390.
GZMA_rna1	M18737_rna1	M18737	PASS	9	75.22	PASS	13	9	34.69	2.17	2.17	GZMA	5q21-q12		granzyme A (granzyme 1,
															cytotoxic T-lmphocyte-
															associated serine
															esterase 3)
PP1	U14603_at	U14603	PASS	9	76.56	PASS	13	9	35.31	2.17	2.17	PTP4A2	1p35	protein tyrosine	protein tyrosine
														phosphatase type IVA,	phosphatase type IVA,
														member 2	member 2
MLF2	U57342_at	U57342	PASS	9	26.00	PASS	13	9	12.00	2.17	2.17	MLF2		myelodysplasia/myeloid
														leukemia factor 2
M84371_rna1	M84371_rna1	M84371	PASS	8	14.38	PASS	11	8	6.64	2.17	2.17	CD19
H1X	D64142_at	D64142	PASS	9	54.89	PASS	13	9	25.38	2.16	2.16	H1FX		histone H1x	H1 histone family,
															member X
CMKBR2_rn	U95626_rna1	U95626	PASS	8	36.75	PASS	13	8	17.00	2.16	2.16	ccr2		ccr2a	confirmed by similarity
															to Human monocyte
															chemoattractant protein
															1 receptor (ccr2)
															alternatively spliced
															A-form, Encoded by
															GenBank Accession
															Number U80924,
															gi 1168965
U32986_s_at	U32986_s_at	U32986	PASS	9	24.67	PASS	12	9	11.42	2.16	2.16	DDB1	11q12-q13	damage-specific DNA	damage-specific DNA
														binding protein 1 (127 kD)	binding protein 1 (127 kD)
MPP1	M64925_at	M64925	PASS	9	34.89	PASS	12	9	16.17	2.16	2.16	MPP1	Xq28	membrane protein,	membrane protein,
														palmitoylated 1 (55 kD)	palmitoylated 1 (55 kD)
BCL2	M14745_at	M14745	PASS	9	16.22	PASS	13	9	7.54	2.15	2.15
DAGK1	X62535_at	X62535	PASS	9	38.56	PASS	13	9	17.92	2.15	2.15	DGKA	12	diacylglycerol kinase	diacylglycerol kinase,
															alpha (80 kD)
M63438_s_at	M63438_s_at	M63438	PASS	9	167.11	PASS	13	9	77.77	2.15	2.15
TRADD	L41690_at	L41690	PASS	9	18.00	PASS	13	9	8.38	2.15	2.15	TRADD		tumor necrosis factor	TNFRSF1A-associated
														receptor type 1 associated	via death domain
														protein
PGM1	M83088_at	M83088	PASS	9	16.67	PASS	13	9	7.77	2.15	2.15	PGM1	1p22.1	phosphoglucomutase 1	phosphoglucomutase 1
CRIP1	U09770_at	U09770	PASS	9	35.33	PASS	12	9	16.50	2.14	2.14	hCRHP		cysteine-rich heart protein
K43_HOM	D26362_at	D26362	PASS	8	17.13	PASS	9	8	8.00	2.14	2.14	KIAA0043			KIAA0043 gene product
MYD88	U70451_at	U70451	PASS	8	38.13	PASS	13	8	17.85	2.14	2.14	MYD88	3p22	myeloid differentiation	myeloid differentiation
														primary response gene (88)	primary response gene (88)
HNRPH1	L22009_at	L22009	PASS	9	74.00	PASS	13	9	34.69	2.13	2.13			hnRNP H	49 kDa protein; hetero-
															geneous nuclear ribo-
														nucleoprotein H
MXI1	L07648_at	L07648	PASS	9	17.56	PASS	13	9	8.23	2.13	2.13	MXI1
GUK1	L76200_at	L76200	PASS	8	56.25	PASS	13	8	26.38	2.13	2.13	GUK1	1q32-q42	guanylate kinase 1	guanylate kinase 1
C8FWPH	AJ000480_at	AJ000480	PASS	5	11.60	PASS	9	5	5.44	2.13	2.13	C8FW		phosphoprotein
GNG11	U31384_at	U31384	PASS	9	38.78	PASS	13	9	18.23	2.13	2.13	GNG11		guanine nucleotide binding	guanine nucleotide binding
														protein 11	protein 11
HG3076-HT3	HG3076-HT3	HG3076-HT	PASS	9	52.33	PASS	13	9	24.62	2.13	2.13
UGT2B4	U03105_at	U03105	PASS	7	19.86	PASS	11	7	9.36	2.12	2.12			B4-2 protein
DPYSL2	U97105_at	U97105	PASS	8	18.75	PASS	13	8	8.85	2.12	2.12	DPYSL2	8p22-p21	dihydropyrimidinase-like 2	dihydropyrimidinase-like 2
GGTB2	D29805_at	D29805	PASS	9	40.89	PASS	13	9	19.31	2.12	2.12	B4GALT1	9p13	glycoprotein-4-beta-	UDP-Gal:betaGlcNAc beta
														galactosyltransferase 2	1,4-galactosyltransferase,
															polypeptide 1
M61827_rna1	M61827_rna1	M61827	PASS	9	33.22	PASS	10	9	15.70	2.12	2.12	SPN		leukosialin
D63479_s_at	D63479_s_at	D63479	PASS	9	18.67	PASS	12	9	8.83	2.11	2.11	DGKD		diacylglycerol kinase,	diacylglycerol kinase,
														delta (130 kD)	delta (130 kD)
IP	L47738_at	L47738	PASS	9	29.22	PASS	12	9	13.83	2.11	2.11				inducible protein
X98534_s_at	X98534_s_at	X98534	PASS	8	25.50	PASS	13	8	12.08	2.11	2.11	VASP	19q13.2-q13.3	vasodilator-stimulated	vasodilator-stimulated
														phosphoprotein	phosphoprotein
CALM1	HG1862-HT1	HG1862-HT	PASS	9	91.11	PASS	13	9	43.15	2.11	2.11
HPK1	U66464_at	U66464	PASS	9	16.89	PASS	13	9	8.00	2.11	2.11	HPK1		hematopoietic progenitor	serine/threonine protein
															kinase
FKBP2	M75099_at	M75099	PASS	9	23.56	PASS	12	9	11.17	2.11	2.11	FKBP2	11q13.1-q13.3	FK506-binding protein 2	FK506-binding protein 2
														(13 kD)	(13 kD)
CMKBR7	L31584_at	L31584	PASS	9	39.89	PASS	13	9	18.92	2.11	2.11	CCR7	17q12-q21.2	chemokine (CC motif)	chemokine (CC motif)
														receptor 7	receptor 7
GPRK6	L16862_at	L16862	PASS	7	25.29	PASS	7	7	12.00	2.11	2.11	GPRK6	5q35	G protein-coupled	G protein-coupled
														receptor kinase 6	receptor kinase 6
FCER1G	M33195_at	M33195	PASS	9	112.00	PASS	13	9	53.15	2.11	2.11	FCER1G	1q23	Fc fragment of IgE,	Fc fragment of IgE,
														high affinity I,	high affinity I,
														receptor for; gamma	receptor for; gamma
														polypeptide	polypeptide
MRP	HG1612-HT1	HG1612-HT	PASS	8	20.00	PASS	12	8	9.50	2.11	2.11
LYL1	M22638_at	M22638	PASS	8	14.38	PASS	12	8	6.83	2.10	2.10	LYL1
IRAK1	L76191_at	L76191	PASS	9	32.67	PASS	13	9	15.54	2.10	2.10	IRAKI	Xq28	interleukin-1 receptor-	interleukin-1 receptor-
														associated kinase 1	associated kinase 1
P14KB	U81802_at	U81802	PASS	7	14.71	PASS	11	7	7.00	2.10	2.10	PIK4CB	1q21	phosphatidylmositol 4-	phosphatidylmositol 4-
														kinase, catalytic, beta	kinase, catalytic, beta
														polypeptide	polypeptide
GT335	U53003_at	U53003	PASS	9	12.22	PASS	11	9	5.82	2.10	2.10	GT335			similar to E. coli SCRP27A
															and to zebrafish ES1
M58286_s_at	M58286_s_at	M58286	PASS	7	17.43	PASS	10	7	8.30	2.10	2.10	TNFRSF1A	12p13.2	tumor necrosis factor	tumor necrosis factor
														receptor 1 (55 kD)	receptor superfamily,
															member 1A
PSMA28	D45248_at	D45248	PASS	9	69.44	PASS	13	9	33.08	2.10	2.10	PSME2	14q11.2	proteasome (prosome,	proteasome (prosome,
														macropain) activator	macropain) activator
														subunit 2 (PA28 beta)	subunit 2 (PA28 beta)
CKAP1	D49738_at	D49738	PASS	9	34.56	PASS	13	9	16.46	2.10	2.10	CKAP1	19q13.11-	cytoskeleton-associated	cytoskeleton-associated
													q13.12	protein 1	protein 1
HG4334-HT4	HG4334-HT4	HG4334-HT	PASS	6	14.50	PASS	12	6	6.92	2.10	2.10
SRF	J03161_at	J03161	PASS	6	18.83	PASS	9	6	9.00	2.09	2.09	SRF		serum response factor	serum response factor
														(c-fos serum response	(c-fos serum response
														element-binding	element-binding
														transcription factor)	transcription factor)
CRAA	U78556_at	U78556	PASS	8	15.75	PASS	13	8	7.54	2.09	2.09	hCRA alpha		cisplatin resistance
														associated alpha protein
S83513_s_at	S83513_s_at	S83513	PASS	7	11.14	PASS	9	7	5.33	2.09	2.09	ADCYAP1	18p11	adenylate cyclase activating	adenylate cyclase activating
														polypeptide 1 (primary)	polypeptide 1 (primary)
VCL	M33308_at	M33308	PASS	9	50.22	PASS	13	9	24.08	2.09	2.09	VCL	10q11.2-qter	vinculin	vinculin
K183	D80005_at	D80005	PASS	9	25.00	PASS	13	9	12.00	2.08	2.08	KIAA0183
J04046_s_at	J04046_s_at	J04046	PASS	8	29.13	PASS	12	8	14.00	2.08	2.08	CALM1			calmodulin
STXBP3	D63851_at	D63851	PASS	5	9.80	PASS	7	5	4.71	2.08	2.08	STXBP1	9q34.1	syntaxin binding protein 1	syntaxin-binding protein 1
COPA	U24105_at	U24105	PASS	9	36.78	PASS	13	9	17.69	2.08	208	COPA		coatomer protein complex,	coatomer protein complex,
														subunit alpha	subunit alpha
DDB2	U18300_at	U18300	PASS	9	12.11	PASS	12	9	5.83	2.08	2.08	DDB2	11p12-p11	damage-specific DNA	damage-specific DNA
														binding protein 2 (48 kD)	binding protein 2 (48 kD)
MLN_rna1	X15393_rna1	X15393	PASS	7	13.29	PASS	10	7	6.40	2.08	2.08	motilin		motinlin
GAPDH3	AFFX-HUM	AFFX-HUM	PASS	9	318.33	PASS	13	9	153.54	2.07	2.07
P2RX5	U49395_at	U49395	PASS	9	17.44	PASS	12	9	8.42	2.07	2.07	P2RX5		purinergic receptor P2X,	purinergic receptor P2X,
														ligand-gated ion channel, 5	ligand-gated ion channel, 5
CDC42	U02570_at	U02570	PASS	9	25.56	PASS	12	9	12.33	2.07	2.07	ARHGAP1		Rho GTPase activating	Rho GTPase activating
														protein 1	protein 1
L10338_s_at	L10338_s_at	L10338	PASS	7	12.43	PASS	8	7	6.00	2.07	2.07	SCN1B	19	sodium channel, voltage-	sodium channel, voltage-
														gated, type 1, beta	gated, type 1, beta
														polypeptide	polypeptide
A1P	U29680_at	U29680	PASS	8	15.00	PASS	12	8	7.25	2.07	2.07	BCL2A1	15q24.3	BCL2-related protein A1	BCL2-related protein A1
Z69043_s_at	Z69043_s_at	Z69043	PASS	9	57.11	PASS	13	9	27.62	2.07	2.07	H-TRAP		translocon-associated
												delta		protein delta subunit
														precursor
HAX1	U68566_at	U68566	PASS	9	31.00	PASS	11	9	15.00	2.07	2.07			HAX-1	localized to the mito-
															chondrial membrane, HS1
															binding protein
CREB2	D90209_at	D90209	PASS	9	57.89	PASS	13	9	28.08	2.06	2.06	ATF4		activating transcription	activating transcription
														factor 4 (tax-responsive	factor 4 (tax-responsive
														enhancer	enhancer element B67)
ZFP_r	HG3565-HT3	HG3565-HT	PASS	8	35.50	PASS	9	8	17.22	2.06	2.06
RH18019	U24166 at	U24166	PASS	9	28.22	PASS	13	9	13.69	2.06	2.06			EB1
STAT4	L78440_at	L78440	PASS	9	22.33	PASS	13	9	10.85	2.06	2.06	STAT4	2q32.2-q32.3	signal transducer and	signal transducer and
														activator of	activator of
														transcription 4	transcription 4
COX6B_rna2	AC002115_rn	AC002115	PASS	8	17.50	PASS	10	8	850	2.06	2.06	COX6B		F25451_2	hypothetical 36.5 kDa
															protein most similar to
															ssRNA binding proteins,
															BLASTX similarity to
															(Y07952) ssRNA-binding
															protein Dictyostelium
															discoideum (52%)
															within RNP domains; and
															to (Z70043) hypothetical
															24.4 kD protein C22E12.02
															in chromosome I
															Schizosaccharomyces
															pombe
HK1	M75126_at	M75126	PASS	9	58.56	PASS	13	9	28.46	2.06	2.06	HK1	10q22	hexokinase 1	hexokinase 1
HH109	D23673_at	D23673	PASS	9	32.11	PASS	13	9	15.62	2.06	2.06
RPL39	D79205_at	D79205	PASS	9	465.11	PASS	13	9	226.31	2.06	2.06	RPL39		ribosomal protein L39	ribosomal protein L39
M92843_a_at	M92843_s_at	M92843	PASS	9	33.33	PASS	13	9	16.23	2.05	2.05	ZFP36	19q13.1	zinc finger protein	zinc finger protein
														homologous to Zfp-36	homologous to Zfp-36
														in mouse	in mouse
P19INK4D	U40343_at	U40343	PASS	9	27.44	PASS	13	9	13.38	2.05	2.05	CDKN2D	19p13	cyclin-dependent kinase	cyclin-dependent kinase
														inhibitor 2D (p19, inhibits	inhibitor 2D (p19, inhibits
														CDK4)	CDK4)
PFN1	J03191_at	J03191	PASS	9	184.22	PASS	13	9	90.00	2.05	2.05	PFN1	17p13.3		profilin 1
TFDP1	M73547_at	M73547	PASS	9	22.67	PASS	13	9	11.08	2.05	2.05	DP1		polyposis locus-encoded
														protein
RAB32	U59878_at	U59878	PASS	6	16.17	PASS	11	6	7.91	2.04	2.04	RAB32		low-Mr GTP-binding	Low-Mr GTP-binding
														protein Rab32	protein of the Rab
															subfamily
X97267_rna1	X97267_rna1	X97267	PASS	9	75.00	PASS	13	9	36.69	2.04	2.04			LPAP
QARS	X76013_at	X76013	PASS	9	37.22	PASS	13	9	18.23	2.04	2.04	QARS	3	glutaminyl-tRNA	glutamine-tRNA
														synthetase	synthetase
NFAT4C	L41067_at	L41067	PASS	9	16.33	PASS	13	9	8.00	2.04	2.04	NFATC4		nuclear factor of	nuclear factor of
														activated T-cells,	activated T-cells,
														cytoplasmic 4	cytoplasmic 4
PF4	M25897_at	M25897	PASS	9	278.33	PASS	13	9	136.46	2.04	2.04	PF4V1	4q12-q21	platelet factor 4	platelet factor 4
														variant 1	variant 1
RPA2	J05249_at	J05249	PASS	9	30.11	PASS	13	9	14.77	2.04	2.04	RPA2	1	replication protein A2	replication protein A2
														(32 kD)	(32 kD)
CNN1	D83735_at	D83735	PASS	9	66.00	PASS	13	9	32.38	2.04	2.04	CNN2	21q11.1	calponin 2	calponin 2
AFPX-HSAC	APFX-HSAC	AFFX-HSA	PASS	9	153.44	PASS	13	9	75.31	2.04	2.04
100KDCOA	U22055_at	U22055	PASS	9	39.33	PASS	13	9	19.31	2.04	2.04			100 kDa coactivator
ETR3	U69546_at	U69546	PASS	7	22.71	PASS	13	7	11.15	2.04	2.04			Etr-3	protein contains 3 RRM
															motifs that may bind RNA;
															putative RNA binding
															protein; Elav-type ribo-
															nucleoprotein; complete
															sequence of human EST,
															GenBank Accession
															Number R57293
GSK3A	L40027_at	L40027	PASS	9	19.89	PASS	13	9	9.77	2.04	2.04			glycogen synthase kinase 3
HLA-A_f	D32129_f_at	D32129	PASS	9	342.11	PASS	13	9	168.23	2.03	2.03			HLA-A26	exon 1 part (leader region)
															bp6-77; exon 2 part (alpha-
															1 domain) bp78-347; exon
															3 part (alpha-2 domain);
															bp348-623; exon 4 part
															(alpha-3 domain: bp624-
															899; exon 5 part (trans-
															membrane region). bp900-
															1016; exon 6 part (cyto-
															plasmic region): bp 1050-
															1097; exon 8 part (cyto-
															plasmic region): bp1098-
															1103
RBI	L22343_at	L22343	PASS	7	12.86	PASS	9	7	6.33	2.03	2.03			nuclear phosphoprotein	IFN-induced
PIK4	L36151_at	L36151	PASS	9	39.89	PASS	13	9	19.69	2.03	2.03	PIK4CA		phosphatidylinositol 4-	phosphatidylinositol 4-
														kinase, catalytic, alpha	kinase, catalytic, alpha
														polypeptide	polypeptide
SPS2	U43286_at	U43286	PASS	9	13.67	PASS	12	9	6.75	2.02	2.02	SP52		selenophosphate synthetase	the amino acid residue
														2	number 60 is a seleno-
															cysteine encoded by the
															TGA (UGA) codon; We
															designated this enzyme
															selenophosphate synthetase
															2 to distinguish it from the
															human homolog described
															by Low, S. C., Harney,
															J. W. and Berry, M. J.
															J. Biol Chem. 270, 21659-
															21664 (1995) (GenBank
															Accession Number
															U34044)
HYPA	U81556 at	U81556	PASS	9	40.44	PASS	13	9	20.00	2.00	2.02			hypothetical protein A4
3PK	U09578_at	U09578	PASS	8	17.25	PASS	13	8	8.54	2.02	2.02	MAPKAPK3	3p21.13	mitogen-activated protein	mitogen-activated protein
														kinase-activated protein	kinase-activated protein
														kinase 3	kinase 3
K23_CAN	D14689_at	D14689	PASS	9	32.11	PASS	12	9	15.92	2.02	2.02	KIAA0023			KIAA0023 gene product
RNA_OSTB	AB000115_at	AB000115	PASS	7	12.86	PASS	8	7	6.38	2.02	2.02
IL2RG	D11086_at	D11086	PASS	9	42.00	PASS	13	9	20.85	2.01	2.01	IL2RG	Xq13	interleukin 2 receptor,	interleukin 2 receptor,
														gamma (severe combined	gamma (severe combined
														immunodeficiency)	immunodeficiency)
SEC14L	D67029_at	D67029	PASS	5	15.60	PASS	12	5	7.75	2.01	2.01	SEC14L	17q25.1-g25.2	SEC14 (S. cerevisiae)-like	SEC14 (S. cerevisiae)-like
POLG	U60325_at	U60325	PASS	6	13.33	PASS	8	6	6.63	2.01	2.01	POLG	15q24	polymerase (DNA	polymerase (DNA
														directed), gamma	directed), gamma
K142_K6	D63476_at	D63476	PASS	9	14.22	PASS	13	9	7.08	2.01	2.01	P85SPR	13	PAK-interacting exchange	PAK-interacting exchange
														factor beta	factor beta
FCGR1A	M63835_at	M63835	PASS	7	12.29	PASS	8	7	6.13	2.01	2.01	FCGR1A	1q21.2-q21.3	IgG Fc receptor 1	Fc fragment of IgG,
															high affinity Ia, receptor
														for (CD64)
MLK3	L32976_at	L32976	PASS	7	12.29	PASS	7	7	6.14	2.00	2.00	MLK3	11q13.1-q13.3	mixed lineage kinase 3	mixed lineage kinase 3
E_CCA12	U06681_at	U06681	PASS	5	12.40	PASS	10	5	6.20	2.00	2.00
FACL1	D10040_at	D10040	PASS	5	12.00	PASS	9	5	6.00	2.00	2.00	FACLI	3q13	fatty-acid-Coenzyme A	fatty-acid-Coenzyme A
														ligase, long-chain 1	ligase, long-chain 1
MCM6	D84557_at	D84557	PASS	9	13.44	PASS	11	9	6.73	2.00	2.00			HsMcm6
BRCA2	U50523_at	U50523	PASS	9	84.89	PASS	13	9	42.54	2.00	2.00
BIOC3	APFX-BioC-1	AFFX-BioC	fail	4		PASS	13	4	14.46	Normal	Normal
L15189_s_at	L15189_s_at	L15189	fail	4		PASS	13	4	6.77	Normal	Normal	HSPA9B	5q31.1	heat shock 70 kD protein	heat shock 70 kD protein
														9B (mortalin-2)	9B (mortalin-2)
NIP71	U83843_at	U83843	fail	4		PASS	13	4	6.77	Normal	Normal	Nip7-1		HIV-1 Nef interacting	similar to murine CCT
														protein	(chaperonin containing
															TCP-1) cta subunit encoded
															by GenBank Accession
															Number Z31399; CCT
															assists the folding of
															proteins in eukaryotic
															cytosol; Nef enhances the
															infectivity of HIV and SIV
APT1	D49396_at	D49396	fail	4		PASS	13	4	4.85	Normal	Normal			Aop1_Human, MER5
														(Aop1_Mouse)-like protein
RAB1	M28209_at	M28209	fail	3		PASS	13	3	6.23	Normal	Normal	RAB1	2p14-p13.4	RAB1, member RAS	RAB1, member RAS
														oncogene family	oncogene family
M28213_s_at	M28213_s_at	M28213	fail	3		PASS	13	3	5.77	Normal	Normal	RAB2		RAB2, member RAS	RAB2, member RAS
														oncogene family	oncogene family
L00634_s_at	L00634_s_at	L00634	fail	2		PASS	13	2	6.15	Normal	Normal	FNTA	8q22-q11	farncsyltransferase, CAAX	farnesyltransferase, CAAX
														box, alpha	box, alpha
PEPD	J04605_at	J04605	fail	2		PASS	13	2	5.38	Normal	Normal	PEPD	19q12-q13.2	peptidase D	peptidase D
SEC7PL	U59752_at	U59752	fail	4		PASS	12	4	7.92	Normal	Normal	PSCD2		pleckstrin homology, Sec7	pleckstrin homology, Sec7
PEPD	J04605_at	J04605	fail	2		PASS	13	2	5.38	Normal	Normal	PEPD	19q12-q13.2
														and coiled/coil domains	and coiled/coil domains
														2 (cytohesin-2)	2 (cytohesin-2)
K112	D25218_at	D25218	fail	4		PASS	12	4	6.42	Normal	Normal	KIAA0112
PP21	M99701_at	M99701	fail	4		PASS	12	4	5.75	Normal	Normal	TCEAL1	Xq22.1	transcription elongation	transcription elongation
														factor A (SII)-like 1	factor A (SII)-like 1
AFFX-BioB-1	AFFX-BioB-1	AFFX-BioB	fail	3		PASS	12	3	10.75	Normal	Normal
E_CREBBP	U89355_at	U89355	fail	3		PASS	12	3	5.17	Normal	Normal	CREBBP	16p13.3	CREB binding protein	CREB binding protein
														(Rubinstein-Taybi	(Rubinstein-Taybi
														syndrome)	syndrome)
CUL1	U58087_at	U58087	fail	4		PASS	11	4	8.64	Normal	Normal	CUL1		cullin 1	cullin 1
L09229_s_at	L09229_s_at	L09229	fail	4		PASS	11	4	8.36	Normal	Normal	FACL1		long-chain acyl-CoA	ATP-binding domain
														synthetase	(bp. 1447 . . . 1846)
SLC20A3_rna	X96924_rna1	X96924	fail	4		PASS	11	4	8.18	Normal	Normal			mitochondrial citrate
														transport protein
K233_COST1	C87071_at	D87071	fail	4		PASS	11	4	7.45	Normal	Normal	KIAA0233			KIAA0233 gene product
E_23773	U90904_at	U90904	fail	4		PASS	11	4	7.00	Normal	Normal
MTHFD	L38928_at	L38928	fail	4		PASS	11	4	6.73	Normal	Normal			5,10-methenyltetrahydro-
														folate synthetase
MEF	U32645_at	U32645	fail	4		PASS	11	4	6.27	Normal	Normal	ELF4		E74-like factor 4 (ets	E74-like factor 4 (ets
														domain transcription factor	domain transcription factor
OAT	M29927_at	M29927	fail	4		PASS	11	4	6.00	Normal	Normal	OAT	10q26	ornithine aminotransferase	ornithine aminotransferase
														(gyrate atrophy)	(gyrate atrophy)
MPV17	X76538_at	X76538	fail	4		PASS	11	4	5.82	Normal	Normal	MPV17	2p23-p21	MpV17 transgene, murine	MpV17 transgene, murine
														homolog, glomerulo-	homolog, glomerulo-
														sclerosis	sclerosis
FH	U59309_at	U59309	fail	4		PASS	11	4	5.73	Normal	Normal	FH	1q42.1	fumarate hydratase	fumarate hydratase
GBP1	M55542_at	M55542	fail	4		PASS	11	4	5.64	Normal	Normal	GBP1	1	guanylate binding protein 1,	guanylate binding protein 1,
														interferon-inducible, 67 kD	interferon-inducible, 67 kD
ARF6	M57763_at	M57763	fail	3		PASS	11	3	7.64	Normal	Normal	ARF6		ADP-ribosylation factor 6	ADP-ribosylation factor 6
GUBP	U78524_at	U78524	fail	3		PASS	11	3	6.00	Normal	Normal	DDXBP1	15q	DEAD/H (Asp-Glu-Ala-	Dead/H (Asp-Glu-Ala-
														Asp/His) box binding	Asp/His) box binding
														protein 1	protein 1
E_23828	U79285_at	U79285	fail	3		PASS	11	3	5.73	Normal	Normal
PTEN	U92436_at	U92436	fail	3		PASS	11	3	5.00	Normal	Normal	PTEN	10q23	phosphatase and tensin	phosphatase and tensin
														homolog (mutated in	homolog (mutated in
														multiple advanced cancers	multiple advanced cancers
														1)	1)
SLBP	U75679_at	U75679	fail	3		PASS	11	3	4.91	Normal	Normal	SLBP		histone stem-loop binding
														protein
AFFX-HSAC	AFFX-HSAC	AFFX-HSA	fail	1		PASS	11	1	7	27	Normal	Normal
U04806_s_at	U04806_s_at	U04806	fail	4		PASS	10	4	8.90	Normal	Normal			FLT3/FLK2 ligand
TRIP7	L40357_at	L40357	fail	4		PASS	10	4	7.60	Normal	Normal	TRIP7		thyroid receptor interactor	thyroid hormone receptor
															interactor 7
STAT1	M97936_at	M97936	fail	4		PASS	10	4	7.50	Normal	Normal
LRMP	U10485_at	U10485	fail	4		PASS	10	4	7.00	Normal	Normal	LRMP		lymphoid-restricted	lymphoid-restricted
														membrane protein	membrane protein
LAP18_rna1	M31303_rna1	M31303	fail	4		PASS	10	4	6.60	Normal	Normal	Op18		oncoprotein 18
DIFF48	U49187_at	U49187	fail	4		PASS	10	4	6.50	Normal	Normal	Diff48
SNRPD3	U15009_at	U15009	fail	4		PASS	10	4	6.40	Normal	Normal	SNRPD3		small nuclear ribonucleo-	small nuclear ribonucleo-
														protein D3 polypeptide	protein D3 polypeptide
														(18 kD)	18 kD)
X62153_s_at	X62153_s_at	X62153	fail	4		PASS	10	4	6.30	Normal	Normal			P1.h protein
CTR2	U83461_at	U83461	fail	4		PASS	10	4	6.20	Normal	Normal	SLC31A2	9q31-q32	solute carrier family 31	solute carrier family 31
														(copper transporters),	(copper transporters),
														member 2	member 2
GPCR	L42324_at	L42324	fail	4		PASS	10	4	6.10	Normal	Normal	GPCR		G protein-linked receptor
EIF5	U49436_at	U49436	fail	4		PASS	10	4	6.00	Normal	Normal	EIF5		eukaryotic translation	eukaryotic translation
														initiation factor 5	initiation factor 5
K100_EL	D43947_at	D43947	fail	4		PASS	10	4	5.90	Normal	Normal	KIAA0100			KIAA0100 gene product
K274_HYON	D87464_at	D87464	fail	4		PASS	10	4	5.90	Normal	Normal	K1AA0274			KIAA0274 gene product
GOT2	M22632_at	M22632	fail	4		PASS	10	4	5.90	Normal	Normal	GOT2	16q21	glutamic-oxaloacetic	glutamic-oxaloacetic
														transaminase 2,	transaminase 2,
														mitochondrial (aspartate	mitochondrial (aspartate
														aminotransferase 2)	aminotransferase 2)
DGUOK	U41668_at	U41668	fail	4		PASS	10	4	5.90	Normal	Normal	DGUOK		deoxyguanosien kinase	deoxyguanosine kinase
IRRCP	U18321_at	U18321	fail	4		PASS	10	4	5.80	Normal	Normal	DAP3	1q21	Death associated protein 3	Death associated protein 3
HZF1	X78924_at	X78924	fail	4		PASS	10	4	5.80	Normal	Normal	HZF1		zinc finger protein
D29640_s_at	D329640_s_at	D29640	fail	4		PASS	10	4	5.70	Normal	Normal	SAR1	15	rasGAP-like with IQ motifs	rasGAP-like with IQ motifs
SNRPA1	X13482_at	X13482	fail	4		PASS	10	4	5.60	Normal	Normal	SNRPA1		small nuclear ribonucleo-	small nuclear ribonucleo-
														protein polypeptide A	protein polypeptide A
U47686_s_at	U47686_s_at	U47686	fail	4		PASS	10	4	5.10	Normal	Normal			signal transducer and	STAT protein; is activated
														activator of transcription	by IL-2, IL-7, IL-15,
														Stat5B	growth hormone, IL-3,
															GM-CSF, thrombopoietin,
															prolactin, and erythro-
															poietin; tyrosine 699
															phosphorylation is required
															for activation and dimeriza-
															tion of Stat5B
K267_NAHE	D87743_at	D87743	fail	4		PASS	10	4	4.80	Normal	Normal	K1AA0267			Similar to Human Na/H
															exchanger 2 (A57644)
RPP38	U77664_at	U77664	fail	4		PASS	10	4	4.70	Normal	Normal	RPP38		RNaseP protein P38
L38593_s_at	L38593_s_at	L38593	fail	3		PASS	10	3	6.50	Normal	Normal	NRAMP1		integral membrane protein	alternative
TB1	M74089_at	M74089	fail	3		PASS	10	3	5.50	Normal	Normal	TB1
CHED	M80629_at	M80629	fail	3		PASS	10	3	5.30	Normal	Normal	CDC2L		cholinesterase-related cell	cholinesterase-related cell
														division controller	division controller
RCPN	U03644_at	U03644	fail	3		PASS	10	3	5.30	Normal	Normal	CIR		CBF1 interacting co-	CBF1 interacting co-
														repressor	repressor
CCNG2	U47414_at	U47414	fail	3		PASS	10	3	5.30	Normal	Normal	CCNG2		cyclin G2	cyclin G2
E_23721	U79291_at	U79291	fail	3		PASS	10	3	5.00	Normal	Normal
LIVP	L13800_at	Ll3800	fail	3		PASS	10	3	4.90	Normal	Normal
PXMP3	M86852_at	M86852	fail	3		PASS	10	3	4.80	Normal	Normal	PXMP3	8q21.1	peroxisomal membrane	peroxisomal membrane
														protein 3 (35 kD, Zellweger	protein 3 (35 kD, Zellweger
														syndrome)	syndrome)
CPSPF	U37012_at	U37012	fail	4		PASS	9	4	8.00	Normal	Normal			cleavage and polyadensyla-	160 kDa subunit
														tion specificity factor
CD9	M38690_at	M38690	fail	4		PASS	9	4	7.33	Normal	Normal	CD9	12p13	CD9 antigen (p24)	CD9 antigen (p24)
CASM	AF000177_at	AF000177	fail	4		PASS	9	4	7.11	Normal	Normal	CaSm		CaSm	Sm-like protein; encodes
															Sm motifs; overexpressed
															in pancreatic cancer
K138_THH	D50928_at	D50928	fail	4		PASS	9	4	7.00	Normal	Normal	KIAA0138			KIAA0138 gene product
PHBLN1	U03891_at	U03891	fail	4		PASS	9	4	5.89	Normal	Normal	DJ742C19.2	22q12.3-q13.1	phorbolin (similar to	phorbolin (similar to
														apolipoprotein B mRNA	apolipoprotein B mRNA
														editing protein)	editing protein)
HLA-DPB1	M83664_at	M83664	fail	4		PASS	9	4	5.67	Normal	Normal	HLA-DPB1		HLA-DPB1
K251_COSC	D87438_at	D87438	fail	4		PASS	9	4	5.44	Normal	Normal	KIAA0251			Similar to a C. elegans
														protein in cosmid C14H10
SORD	L29008_at	L29008	fail	4		PASS	9	4	5.33	Normal	Normal	SORD	15q15-q21.1	sorbitol dehydrogenase	sorbitol dehydrogenase
K92_MYH6	D42054_at	D42054	fail	4		PASS	9	4	5.22	Normal	Normal	KIAA0092			KIAA0092 gene product
RECA	L07493_at	L07493	fail	4		PASS	9	4	4.89	Normal	Normal	RPA3	7	replication protein A3	replication protein A3
														(14 kD)	(14 kD)
SCP2	U11313_at	U11313	fail	4		PASS	9	4	4.89	Normal	Normal	SCP2	1pter-p21	sterol carrier protein 2	sterol carrier protein 2
YAF2	U72209_at	U72209	fail	4		PASS	9	4	4.78	Normal	Normal	YAF2		YY1-associated factor 2	zinc finger protein
PPP2R1B	M65254_at	M65254	fail	4		PASS	9	4	4.56	Normal	Normal	PPP2R1B	11q23	protein phosphatase-2A	protein phosphatase 2
														regulatory subunit-beta	(formerly 2A), regulatory
															subunit A (PR 65), beta
															isoform
CD94	U30610_at	U30610	fail	3		PASS	9	3	8.44	Normal	Normal	KLRD1	12p13	killer cell lectin-like	killer cell lectin-like
														receptor subfamily D,	receptor subfamily D,
														member 1	member 1
SNRPB2	M15841_at	M15841	fail	3		PASS	9	3	744	Normal	Normal	SNRPB2		small nuclear ribonucleo-	small nuclear ribonucleo-
														protein polypeptide B	protein polypeptide B
CLC	L01664_at	L01664	fail	3		PASS	9	3	7.22	Normal	Normal	CLC	19q13.1	Charot-Leyden crystal	Charot-Leyden crystal
														protein	protein
AFFX-HUM	AFFX-HUM	APFX-HUM	fail	3		PASS	9	3	7.11	Normal	Normal
SNX1	U53225_at	U53225	fail	3		PASS	9	3	6.67	Normal	Normal	SNX1		sorting nexin 1	sorting nexin 1
FKBP5	U42031_at	U42031	fail	3		PASS	9	3	6.56	Normal	Normal	FKB5		FK506-binding protein 5	FK506-binding protein 5
S72024_s_at	S72024_s_at	S72024	fail	3		PASS	9	3	6.44	Normal	Normal	eif-5A			eukaryotic initiation factor
															5A
SMARCC1	U66615_at	U66615	fail	3		PASS	9	3	5.67	Normal	Normal	SMARCC1	3p23-p21	SWI/SNF related, matrix	SWI/SNF related, matrix
														associated, actin dependent	associated, actin dependent
														reulator of chromatin,	regulator of chromatin,
														subfamily c, member 1	subfamily c, member 1
L05624_s_at	L05624_s_at	L05624	fail	3		PASS	9	3	5.56	Normal	Normal			MAP kinase kinase
TPP2	M73047_at	M73047	fail	3		PASS	9	3	5.56	Normal	Normal	TPP2	13q32-q33	tripeptidyl peptidase II	tripeptidyl peptidase II
PLK	U01038_at	U01038	fail	3		PASS	9	3	5.56	Normal	Normal			pLK
STAT6	U16031_at	U16031	fail	3		PASS	9	3	5.56	Normal	Normal	STAT6	12q13	signal transducer and	signal transducer and
														activator of transcription	activator of transcription
														6, interleukin-4 induced	6, interleukin-4 induced
NUP88	Y08612_at	Y08612	fail	3		PASS	9	3	5.44	Normal	Normal	NUP88	17p13	nucleoporin 88 kD	nucleoporin 88 kD
S79219_s_at	S79219_s_at	S79219	fail	3		PASS	9	3	5.22	Normal	Normal	PCCA	13q32	propionyl Coenzyme A	propionyl Coenzyme A
														carboxylase, alpha	carboxylase, alpha
														polypeptide	polypeptide
C2F	U72514_at	U72514	fail	3		PASS	9	3	5.00	Normal	Normal	C2f		C2f	similar to EST with
															GenBank Accession
															Number R64505; similar to
															S. cerevisiae hypothetical
															protein L9470.5 encoded by
															GenBank Accession
															Number S51431, and to S.
															pombe hypothetical
															34.9KD protein encoded by
															GenBank Accession
															Number Z68198; see
															corresponding genomic
															sequence in GenBank
															Accession Number U72506
E_23733	U79274_at	U79274	fail	3		PASS	9	3	5.00	Normal	Normal
DCK	M60527_at	M60527	fail	3		PASS	9	3	4.67	Normal	Normal	DCK	4q13.3-q21.l	deoxycytidine kinase	deoxycytidine kinase
AFFX-BioB-1	XPFX-BioB-1	AFFX-BioB	fail	0		PASS	9	0	17.44	Normal	Normal
RE5424A	AB000464_at	AB000464	fail	4		PASS	8	4	8.50	Normal	Normal
SSRP1	M86737_at	M86737	fail	4		PASS	8	4	7.75	Normal	Normal	SSRP1	11q12	structure specific	structure specific
														recognition protein 1	recognition protein 1
BAT3	M33521_at	M33521	fail	4		PASS	8	4	7.50	Normal	Normal	D6SS52E	6p21.3	HLA-B associated	HLA-B associated
														transcript-3	transcript-3
PNOC	U48263_at	U48263	fail	4		PASS	8	4	7.00	Normal	Normal	OFQ		pre-pro-orphanin FA
ERCC1	M13194_at	M13194	fail	4		PASS	8	4	6.63	Normal	Normal	ERCC1	19q13.2-q13.3	excision repair cross-	excision repair cross-
														complementing rodent	complementing rodent
														repair deficiency,	repair deficiency,
														complementation group 1	complementation group 1
														(includes overlapping	(includes overlapping
														antisense sequence)	antisense sequence)
TRNAGUTR	U30888_at	U30888	fail	4		PASS	8	4	6.38	Normal	Normal	USP14		tRNA-Guanine	ubiquitin specific protease
														Transglycosylase	14 (tRNA-guanine trans-
															glycosylase)
L24774_s_at	L24774_s _at	L24774	fail	4		PASS	8	4	5.88	Normal	Normal	DCI	16p13.3	dodecenoyl-Coenzyme A	dodecenoyl-Coenzyme A
														delta isomerase (3,2	delta isomerase (3,2
														trans-enoyl-Coenzyme	trans-enoyl-Coenzyme
														A isomerase)	A isomerase)
HG33l9-HT3	Ht33319-HT3	HG3319-HT	fail	4		PASS	8	4	5.63	Normal	Normal
G9	X78687_at	X78687	fail	4		PASS	8	4	5.38	Normal	Normal	NEu	6 or 10pter-	neuraminidase	neuraminidase
													q23
ZNF139	U09848_at	U09848	fail	4		PASS	8	4	5.00	Normal	Normal	ZNF139		zinc finger protein	zinc finger protein
															139 (clone pHZ-37)
ZFX	X59739_at	X59739	fail	4		PASS	8	4	5.00	Normal	Normal	ZFX	Xp22.1-q21.3	zinc finger protein,	zinc finger protein,
														X-linked	X-linked
S80267_s_at	S80267_s_at	S80267	fail	4		PASS	8	4	4.88	Normal	Normal	p72syk		p72syk	This sequence comes from
															FIG. 3.
DARS	J05032_at	J05032	fail	4		PASS	8	4	4.63	Normal	Normal	DARS		aspartyl-tRNA synthetase	aspartyl-tRNA synthetase
U18271_cds	U18271_cds3	U18271	fail	4		PASS	8	4	4.63	Normal	Normal	TMPO		thymopoitin beta
K128_HCDC	D50918_at	D50918	fail	3		PASS	8	3	7.13	Normal	Normal	KIAA0128			The KIAA0128 gene is
															related to cdc10.
TDRAA	HG3578-HT3	HG3578-HT	fail	3		PASS	8	3	6.25	Normal	Normal
LAMB2	M94362_at	M94362	fail	3		PASS	8	3	6.00	Normal	Normal	LAMB2		lamin B2
SH3BP2	U32519_at	U32519	fail	3		PASS	8	3	5.50	Normal	Normal			GAP SH3 binding protein
MURR1	D85433_at	D85433	fail	3		PASS	8	3	5.38	Normal	Normal
ITGAE	L25851_at	L25851	fail	3		PASS	8	3	5.25	Normal	Normal	ITGAE		integrin, alpha E (antigen	integrin, alpha E (antigen
														CD103, human mucosal	CD103, human mucosal
														lymphocyte antigen 1;	lymphocyte antigen 1;
														alpha polypeptide)	alpha polypeptide)
SPLREGSUP	U08377_at	U08377	fail	3		PASS	8	3	5.25	Normal	Normal	SFRS8		splicing factor, arginine/	splicing factor, arginine/
														serine-rich 8 (suppressor-	serine-rich 8 (suppressor-
														of-white-apricot,	of-white-apricot,
														Drosophila homolog)	Drosophila homolog)
STX16C	AF008937_at	AF008937	fail	3		PASS	8	3	5.00	Normal	Normal	STX16		syntaxin 16	syntaxin 16
ANX3B	U37139_at	U37139	fail	3		PASS	8	3	4.88	Normal	Normal			beta 3-endonexin long form	The long form does not
															bind to the integrin
															beta 3 subunit
															sytoplasmic domain
K33	D26067_at	D26067	fail	3		PASS	8	3	4.75	Normal	Normal	KIAA0033
AHR	L19872_at	L19872	fail	3		PASS	8	3	4.75	Normal	Normal	AHR	7p15	aryl hydrocarbon receptor	aryl hydrocarbon receptor
MEST	D78611_at	D78611	fail	3		PASS	8	3	4.38	Normal	Normal	MEST	7q32	mesoderm specific	mesoderm specific
														transcript (mouse) homolog	transcript (mouse) homolog
PIGH	L19783_at	L19783	fail	3		PASS	8	3	4.38	Normal	Normal	PIGH	14q11-q24	phosphatidylinositol glycan,	phosphatidylinositol glycan
														class H	class H
M34338_s_at	M34338_s_at	M34338	fail	2		PASS	8	2	7.50	Normal	Normal	SRM	1p36-p22	spermidine sythase	spermidine synthase
WWP1	U96113_at	U96113	fail	2		PASS	8	2	5.88	Normal	Normal			WWP1	Nedd-4-like ubiquitin-
															protein ligase; WW
															domain-containing protein
RH17599	L06175_at	L06175	fail	2		PASS	8	2	5.75	Normal	Normal	P5-1			occurs in MHC class 1
															region; ORF
ITBA1	X92475_at	X92475	fail	2		PASS	8	2	5.75	Normal	Normal	ITBA1	Xg28	ITBA1 protein	ITBA1 gene
CL1042	X70649_at	X70649	fail	2		PASS	8	2	5.38	Normal	Normal	DDX1	2p24	member of DEAD box	DEAD/H (Asp-Gln-
														protein family	Ala-Asp/His) box
															polypeptide 1
HG3417-HT3	HG3417-HT3	HG3417-HT	fail	2		PASS	8	2	5.25	Normal	Normal
TACT	M88282_at	M88282	fail	2		PASS	8	2	5.25	Normal	Normal			tactile protein	T cell surface antigen,
															increased during activation
ZFP2	U71598_at	U71598	fail	2		PASS	8	2	5.25	Normal	Normal	zf2		zinc finger protein zfp2
K116_75KD	D29958_at	D29958	fail	2		PASS	8	2	5.13	Nonoal	Normal	KIAA0116
IMOG38	Z68747_at	Z68747	fail	2		PASS	8	2	5.13	Normal	Normal			imogen 38	proprotein
BTG3	D64110_at	D64110	fail	2		PASS	8	2	5.00	Normal	Normal			ANA
RATC10	HG1879-HT1	HG1879-HT	fail	2		PASS	8	2	5.00	Normal	Normal
GCF	M29204_at	M29204	fail	2		PASS	8	2	5.00	Normal	Normal	TCF9	2p11.2-p11.1	transcription factor 9	transcription factor 9
														(binds GC-rich sequences)	(binds GC-rich sequences)
HG3546-HT3	HG3546-HT3	HG3546-HT	fail	2		PASS	8	2	4.88	Normal	Normal
ATF1	X55544_at	X55544	fail	2		PASS	8	2	4.75	Normal	Normal	ATF1	12q13	TREB protein	activating transcription
															factor 1
UNKP	U50950_at	U50950	fail	2		PASS	8	2	4.13	Normal	Normal
ALDOC	X05196_at	X05196	fail	1		PASS	8	1	7.00	Normal	Normal	ALDOC	17cen-q12	aldolase C	aldolase C, fructose-
															bisphosphate
SEC23B	X97065_at	X97065	fail	1		PASS	8	1	6.13	Normal	Normal	sec23		Sec23 protein	COPII component;
															isoform B
GTF2B	M76766_at	M76766	fail	1		PASS	8	1	5.88	Normal	Normal	GTF2B	1p22-p21	general transcription	general transcription
														factor IIB	factor IIB
RPP30	U77665_at	U77665	fail	1		PASS	8	1	5.63	Normal	Normal	RPP30		RNaseP protein P30
COASYNT	Z68204_at	Z68204	fail	1		PASS	8	1	5.50	Normal	Normal	SUCLG1		succinyl coenzyme A	succinate-CoA ligase,
														synthetase	GDP-forming, alpha
															subunit
DDX3	U50553_at	U50553	fail	1		PASS	8	1	5.13	Normal	Normal	DDX3	Xp11.3-p11.23	DEAD/H (Asp-Glu-Ala-	DEAD/H (Asp-Glu-Ala-
														Asp/His) box polypeptide 3	Asp/His) box polypeptide 3
SFRS2	HG3088-HT3	HG3088-HT	fail	1		PASS	8	1	4.75	Normal	Normal
CD1C	M28827_at	M28827	fail	1		PASS	8	1	4.75	Normal	Normal	CD1C	1q22-q23	CD1C antigen, c poly-	CD1C antigen, c poly-
														peptide	peptide
BTF2	M95809_at	M95809	fail	1		PASS	8	1	4.75	Normal	Normal	BTF2		basic transcription
														factor 62 kD subunit
TSNAX	X95073_at	X95073	fail	1		PASS	8	1	4.75	Normal	Normal	TRAX		Translin associated protein
														X
CSNK1A1	L37042_at	L37042	fail	4		PASS	7	4	8.00	Normal	Normal	CSNK1A1	13q13	casein kinase 1, alpha 1	casein kinase 1, alpha 1
PLCD1	U09117_at	U09117	fail	4		PASS	7	4	7.57	Normal	Normal			phospholipase c delta 1
S10	D14889_at	D14889	fail	4		PASS	7	4	5.71	Normal	Normal	RAB33A	X	RAB33A, member RAS	RAB33A, member RAS
														oncogene family	oncogene family
AEBP1	D86479_at	D86479	fail	4		PASS	7	4	5.71	Normal	Normal	AEBPI	7	AE-binding protein 1	AE-binding protein 1
SKB1	AF015913_at	AF015913	fail	4		PASS	7	4	5.57	Normal	Normal	SKB1Hs		Skb1Hs	homolog of fission yeast
															Skb1
K03498_xpt1	K03498_xpt1	K03498	fail	4		PASS	7	4	5.57	Normal	Normal			pol protein	env ORF (bases 110-& gt;
															290) first start codon at
															191; putative
SL1	L39059_at	L39059	fail	4		PASS	7	4	5.43	Normal	Normal			transcription factor SL1
PIGF	D13435_at	D13435	fail	4		PASS	7	4	5.29	Normal	Normal	PIGF	2p21-p16	phosphatidyinositol glycan,	phosphatidyinositol glycan,
														class F	class F
TCF4	M74719_at	M747l9	fail	4		PASS	7	4	5.14	Normal	Normal	TCF4	18q21.1	transcription factor 4	transcription factor 4
GOLGA1	U51S87_at	U51587	fail	4		PASS	7	4	5.14	Normal	Normal	GOLGA1	golgin 97	golgi autoantigen, golgin
															subfamily a, 1
X75091_s_at	X75091_s_at	X75091	fail	4		PASS	7	4	5.00	Normal	Normal			PHAPII (Putative HLA DR
														Associated Protein II)
POLR3	U93867_at	U93867	fail	4		PASS	7	4	4.71	Normal	Normal	RPC62		RNA polymerase III
														subunit
GLCLC	M90656_at	M90656	fail	4		PASS	7	4	4.43	Normal	Normal	GLCLC	6p12	glutamate-cysteine ligase	glutamate-cystein ligase
															(gamma-glutamylcysteine
															synthetase), catalytic
															(72.8 kD)
PTPRE	HG620-HT62	HG620-HT	fail	3		PASS	7	3	8.00	Normal	Normal
OBRGRP	Y12670_at	Y12670	fail	3		PASS	7	3	8.00	Normal	Normal	OB-RGRP		leptin receptor gene-
														related protein
DRNM23	U29656_at	U29656	fail	3		PASS	7	3	7.29	Normal	Normal	NME3	16q13	non-metastatic cells 3,	non-metastatic cells 3,
														protein expressed in	protein expressed in
OMD	AB000114_at	AB000114	fail	3		PASS	7	3	6.86	Normal	Normal	OMB		osteomodulin	osteomodulin
RY1	X76302_at	X76302	fail	3		PASS	7	3	6.86	Normal	Normal	RY-1		nucleic acid binding protein
K12_TOLL	D13637_at	D13637	fail	3		PASS	7	3	6.57	Normal	Normal	TLR1	4p14	toll-like receptor 1	toll-like receptor 1
CSNK2A1	M55265_at	M55265	fail	3		PASS	7	3	5.86	Normal	Normal	CSNK2A1	20p13	casein kinase 2, alpha 1	casein kinase 2, alpha 1
														polypeptide	polypeptide
DOC2	U53446_at	U53446	fail	3		PASS	7	3	5.86	Normal	Normal	DAB2	6p23	disabled (Drosophila)	disabled (Drosphila)
														homolog 2 (mitogen-	homolog 2 (mitogen-
														responsive phosphoprotein)	responsive phosphoprotein)
SMARCD1	U66617_at	U66617	fail	3		PASS	7	3	5.71	Normal	Normal	SMARCD1	12q13-q14	SWI/SNF related, matrix	SWI/SNF related, matrix
														associated, actin dependent	associated, actin dependent
														regulator of chromatin,	regulator of chromatin,
														subfamily d, member 1	subfamily d, member 1
ZNF131	U09410_at	U09410	fail	3		PASS	7	3	5.43	Normal	Normal	ZNF232		zinc finger protein ZNF131	zinc finger protein 131
															(clone pIIZ-10)
GLIPR	U16307_at	U16307	fail	3		PASS	7	3	5.43	Normal	Normal	GIiPR		glioma pathogenesis-
														related protein
E2F5	U31556_at	U31556	fail	3		PASS	7	3	5.43	Normal	Normal			E2F-5	transcription factor
BARDL1	U76638_at	U76638	fail	3		PASS	7	3	4.29	Normal	Normal	BARDI	2q34-q35	BRCA1 associated RING	BRCA1 associated RING
														domain 1	domain 1
U40763_s_at	U40763_s_at	U40763	fail	3		PASS	7	3	4.14	Normal	Normal	CYP		Clk-associating RS-	Clk-associating RS-
														cyclophilin	cyclophilin
ARH9	L25081_at	L25081	fail	2		PASS	7	2	8.86	Normal	Normal	ARHC	1p21-p13	GTPase	ras homolog gene family,
															member C
HSN	U03057_at	U03057	fail	2		PASS	7	2	8.86	Normal	Normal	SNL	7p22	singed (Drosophila)-like	singed (Drosophila)-like
														(sea urchin fascin homolog	(sea urchin fascin homolog
														like)	like)
TARS	M63180_at	M63180	fail	2		PASS	7	2	5.57	Normal	Normal	TARS	5p13-cen	threonyl-tRNA synthetase	threonl-tRNA synthetase
K182	U80004_at	U80004	fail	2		PASS	7	2	5.43	Normal	Normal	KIAA0182
TFAP3B	U91931_at	U91931	fail	2		PASS	7	2	5.43	Normal	Normal	ADTB3		Beta-3A-adaptin	Beta-3A-adaptin
CTIP	U72066_at	U72066	fail	2		PASS	7	2	5.14	Normal	Normal	RBBP8	18q11.2	retinoblastoma-binding	retinoblastoma-binding
														protein 8	protein 8
CD72	M54992_at	M54992	fail	2		PASS	7	2	5.00	Normal	Normal	CD72	9p	CD72 antigen	CD72 antigen
PDE6B	S41458_at	S41458	fail	2		PASS	7	2	4.86	Normal	Normal	PDE6B	4p16.3	phosphodiesterase 6B,	phosphodiesterase 6B,
														cGMP-specific, rod, beta	cGMP-specific, rod, beta
														(congential stationary	(congential stationary
														night blindness 3,	night blindness 3,
														autosomal dominant)	autosomal dominant)
GTBP	U73737_at	U73737	fail	2		PASS	7	2	4.86	Normal	Normal	GTBP	2p26	G/T mismatch-binding	G/T mismatch binding
														protein	protein
U67932 a_at	U67932 a_at	U67932	fail	2		PASS	7	2	4.57	Normal	Normal	Pde7A2		cAMP phosphodiesterase
GBE1	L07956_at	L07956	fail	2		PASS	7	2	4.43	Normal	Normal	GBE1	3p21	glucan (1,4-alpha-),	glucan (1,4-alpha-),
														enzyme 1 (glycogen	enzyme 1 (glycogen
														branching enzyme,	branching enzyme,
														Andersen disease, glycogen	Andersen disease, glycogen
														glycogen storage disease	glycogen storage disease
														type IV)	type IV)
CDR2	M63256_at	M63256	fail	2		PASS	7	2	4.43	Normal	Normal	CDR2	16p13.1-p12	major Yo paraneoplastic	cerebellar degeneration-
														antigen	related protein (62 kD)
RP1H	U90437_at	U90437	fail	2		PASS	7	2	4.29	Normal	Normal
HNRPA0	U23803_at	U23803	fail	1		PASS	7	1	8.71	Normal	Normal			heterogeneous	hnRNP protein; hnRNA
														ribonucleoprotein A0	binding protein
ICRF	Z69915_at	Z69915	fail	1		PASS	7	1	6.00	Normal	Normal
SSR1	Z12830_at	Z12830	fail	1		PASS	7	1	5.86	Normal	Normal	SSR1		signal sequence receptor,	signal sequence receptor,
														alpha (translocon-	alpha (translocon-
														associated protein alpha)	associated protein alpha)
RALGDS	U14417_at	U14417	fail	1		PASS	7	1	5.71	Normal	Normal			Ral guanine nucleotide	the C-terminal non-catalytic
														dissociation stimulator	domain of the Ral GDS
															interacts with Ras
SMARCC2	U66616_at	U66616	fail	1		PASS	7	1	5.71	Normal	Normal	SMARCC2	12q13-q14	SWI/SNF related, matrix	SWI/SNF related, matrix
														associated, actin dependent	associated, actin dependent
														regulator of chromatin,	regulator of chromatin,
														subfamily c, member 2	subfamily c, member 2
PCCB	S67325_at	S67325	fail	1		PASS	7	1	5.29	Normal	Normal	PCCB	3q21-q22	propionyl Coenzyme A	propionyl Coenzyme A
														carboxylase, beta	carboxylase, beta
														polypeptide	polypeptide
G16P	U50839_at	U50839	fail	1		PASS	7	1	5.00	Normal	Normal	g16		g16 protein
CUL2	U83410_at	U83410	fail	1		PASS	7	1	5.00	Normal	Normal	CUL2		cullin 2	cullin 2
CEBPG	U20240_at	U20240	fail	1		PASS	7	1	4.86	Normal	Normal	CEBPG		CCAAT/enhancer binding	CCAAT/enhancer binding
														protein (C/EBP), gamma	protein (C/EBP), gamma
RAB9	U44103_at	U44103	fail	1		PASS	7	1	4.86	Normal	Normal	RAB9		RAB9, member RAS	RAB9, member RAS
														oncogene family	oncogene family
KSS TRE	D29956_at	D29956	fail	1		PASS	7	1	4.43	Normal	Normal	USP8
CRIP2	D42123_at	D42123	PASS	9	25.56	fail	5	9		Disease	Disease	CRIP2	14g32.3	cysteine-rich protein 2	cysteine-rich protein 2
K14	D25216_at	D25216	PASS	9	31.67	fail	5	9		Disease	Disease	KIAA0014			KIAA0014 gene product
LTK	D16105_at	D16105	PASS	9	23.78	fail	3	9		Disease	Disease	LTK	15	leukocyte tyrosine kinase	leukocyte tyrosine kinase
K60_GNPTA	D31766_at	D31766	PASS	8	14.50	fail	6	8		Disease	Disease	KIAA0060			KIAA0060 gene product
CDK2	M68520_at	M68520	PASS	8	7.63	fail	6	8		Disease	Disease	CDK2	12q13	cyclin-dependent kinase 2	cyclin-dependent kinase 2
IL11RA	U32324_at	U32324	PASS	8	9.75	fail	6	8		Disease	Disease	IL22RA	9p13	interleukin 11 receptor,	interleukin 11 receptor,
														alpha	alpha
ACP2_rna1	X15525_rna1	X15525	PASS	8	8.75	fail	6	8		Disease	Disease	ACP2		acid phosphatase
H326	U06631_at	U06631	PASS	8	23.13	fail	5	8		Disease	Disease	H326			homologous to mouse gene
															PC326:GenBank Accession
															Number M95564
TEB4	AF009301_at	AF009301	PASS	8	9.88	fail	5	8		Disease	Disease		TEB4 protein
K170_CALT	D79992_at	D79992	PASS	8	6.88	fail	5	8		Disease	Disease	KIAA0170			KIAA0170 gene product
PRKACG	M34182_at	M34182	PASS	8	41.00	fail	5	8		Disease	Disease	PRKACG	9q13	protein kinase, cAMP-	protein kinase, cAMP-
														dependent, catalytic,	dependent, catalytic,
														gamma	gamma
PLEC1	U3204_at	U53204	PASS	8	40.38	fail	4	8		Disease	Disease	PLEC1	8q24	protein 1, intermediate	protein 1, imtermediate
														filament binding protein,	filament binding protein,
														500 kD	500 kD
E_LF113	U18009_at	U18009	PASS	8	13.00	fail	4	8		Disease	Disease				similar to Pacific ray
															VAT1 protein, Swiss-Prot
															Accession Number P19333
18SRNA5	AFFX-HUM	AFFX-HUM	PASS	8	12.00	fail	3	8		Disease	Disease
MUC3	HG2147-HT2	H02147-HT	PASS	8	60.63	fail	3	8		Disease	Disease
MYBPC3	X73113_at	X73113	PASS	8	11.25	fail	3	8		Disease	Disease	MYBPC2	19	myosin-binding protein	myosin-binding protein
														C, fast-type	C, fast-type
NB	D89016_at	D89016	PASS	8	20.63	fail	2	8		Disease	Disease	nbr		Neuroblastoma
U47025 a_at	U47025_s_at	U47025	PASS	7	27.43	fail	6	7		Disease	Disease	PYGB	20	phosphorylase, glycogen;	phosphorylase, glycogen;
														brain	brain
KIDDNABP	D45132_at	D45132	PASS	7	5.86	fail	6	7		Disease	Disease			zinc-finger DNA-binding
														protein
K179_HYPD	D80001_at	D80001	PASS	7	8.00	fail	6	7		Disease	Disease	KIAA0179			similar to hypothetical
														protein D4478 of
														S. cerevisiae.
K213	D86968_at	D86968	PASS	7	4.14	fail	6	7		Disease	Disease	KIAA0213			Similar to Mouse TFIIi-
															associated transactivator
															factor p17
															(GB_RO.MMU11548)
															Containing protein kinase
															motif
HG2175-HT2	HG2175-HT2	HG2175-HT	PASS	7	5.43	fail	6	7		Disease	Disease
INPPL1	L36818_at	L36818	PASS	7	21.71	fail	6	7		Disease	Disease			51C protein
GS1	M86934_at	M86934	PASS	7	8.14	fail	6	7		Disease	Disease	GS2			Gene from Xp22.3 which
															escapes X-inactivation.
															Function unknown.
MFAP1	U04209_at	U04209	PASS	7	6.00	fail	6	7		Disease	Disease			associated microfibrillar
IFNRG7A	U53830_at	U53830	PASS	7	15.29	fail	6	7		Disease	Disease	1RF7	11	interferon regulatory	interferon regulatory
														factor 7	factor 7
GABRA1	X14766_at	X14766	PASS	7	8.71	fail	6	7		Disease	Disease	GABRA1	5q34-q35	gamma-aminobutyric acid	gamma-aminobutyric acid
														(GABA) A receptor,	(GABA) A receptor,
														alpha 1	alpha 1
CSRP1	M76378_at	M76378	PASS	7	23.29	fail	5	7		Disease	Disease	CSRP1	1q32	cysteine and glycine-rich	cysteine and glycine-rich
														protein 1	protein 1
K146	D63480_at	D63480	PASS	7	6.14	fail	5	7		Disease	Disease	KIAA0146			The KIAA0146 gene
															product is novel
GLGF2	HG4704-HT5	HG4704-HT	PASS	7	6.14	fail	5	7		Disease	Disease
TAL1	M63589_at	M63589	PASS	7	13.00	fail	5	7		Disease	Disease	TAL1	1p321	T-cell acute lymphocytic	T-cell acute lymphocytic
														leukemia 1	leukemia 1
SIAHBP1	U51586_at	U51586	PASS	7	8.29	fail	5	7		Disease	Disease	SiahBP1		siah binding protein 1
ENO2_rna1	X51956_rna1	X51956	PASS	7	9.43	fail	5	7		Disease	Disease	ENO2	12p13	human gamma enolase	enolase 2, (gamma,
															neuronal)
K27	D25217_at	D25217	PASS	7	16.29	fail	4	7		Disease	Disease	KIAA0027
EBI3	L08187_at	L08187	PASS	7	13.86	fail	4	7		Disease	Disease	EBI3		cytokine receptor
RETROTP	Z48633_at	Z48633	PASS	7	12.14	fail	4	7		Disease	Disease
SP2	D28588_at	D28588	PASS	6	6.83	fail	6	6		Disease	Disease	SP2		Sp2 transcription factor	Sp2 transcription factor
K263_HYPY	D87452_at	D87452	PASS	6	13.33	fail	6	6		Disease	Disease	KIAA0263			KIAA0263 gene product
HEPG2	K03195_at	K03195	PASS	6	9.50	fail	6	6		Disease	Disease	SGLT1			glucose transporter
														glycoprotein
IDS	L40586_at	L40586	PASS	6	6.67	fail	6	6		Disease	Disease	IDS	Xq27.3-q28	iduronate 2-sulfatase	iduronate 2-sulfatase
														(Hunter syndrome)	(Hunter syndrome)
FOSB	L49169_at	L49169	PASS	6	10.67	fail	6	6		Disease	Disease	GOS3			GOS3 is human homolog
															of mouse FOSB gene
MYOIC	U14391_at	U14391	PASS	6	9.00	fail	6	6		Disease	Disease	MYOIC	15g21-q22	myocin-IC	myosin IC
HCCS	U36787_at	U36787	PASS	6	7.00	fail	6	6		Disease	Disease			halocytochomre c-type	putative
														synthetase
HA2	X90761_at	X90761	PASS	6	8.67	fail	6	6		Disease	Disease	KRTHA2	17q12-q211	keratin, hair, acidic, 2	keratin, hair, acidic, 2
X92493_s_at	X92493_s_at	X92493	PASS	6	5.00	fail	6	6		Disease	Disease	PIPSK1B	9q13	phosphatidylinositol-4-	phosphatidylinositol-4-
														phosphate 5-kinase,	phosphate 5-kinase,
														type 1, beta	type 1, beta
XPA	D14533_at	D14533	PASS	6	4.50	fail	5	6		Disease	Disease	XPA	9	xeroderma pigmentosum,	xeroderma pigmentosum,
														complementation group A	complementation group A
K76	D38548_at	D38548	PASS	6	16.33	fail	5	6		Disease	Disease	KIAA0076			KIAA0076 gene product
K268_C219R	D87742_at	D87742	PASS	6	5.17	fail	5	6		Disease	Disease	KIAA0268			Similar to Human C219-
															reactive peptide (L34688)
DAO	HG2280-HT2	HG2280-HT	PASS	6	15.50	fail	5	6		Disease	Disease
H2AIB	L19778_at	L19778	PASS	6	5.00	fail	5	6		Disease	Disease	H2AFP		histone H2A.Ib	H2A histone family,
															member P
MAP4	M64571_at	M64571	PASS	6	11.83	fail	5	6		Disease	Disease	MAP4	3p21	microtubule-associated	microtubule-associated
														protein 4	protein 4
PML	M79462_at	M79462	PASS	6	12.00	fail	5	6		Disease	Disease	PML	15q22	promycelocytic leukemia	promycelocytic leukemia
S78798_s_at	S78798_s_at	S78798	PASS	6	6.50	fail	5	6		Disease	Disease	1-phos-		1-phosphatidylinositol-4-	Method: conceptual
												phatidyl-		phosphate 5-kinase	translation with partial
												linositol-4-		isoform C	peptide sequencing. This
												phosphate 5			sequence comes from
												kinase			FIG. 2; PtdIns4P 5-kinase
												isoform C,			isoform C
												PtdIns4P 5-
												kinase
												isoform C
HSD17B3	U05659_at	U05659	PASS	6	18.17	fail	5	6		Disease	Disease	HSD17B3	9q22	hydroxysteroid (17-beta)	hydroxysteroid (17-beta)
														dehydrogenase 3	dehydrogenase 3
ASMT	U11090_at	U11090	PASS	6	11.50	fail	5	6		Disease	Disease	ASMT	Xpter-p22.32	acetylserotomin N-	acetylserotonin N-
													and Yp11.3	methyltransferase	methyltransferase
MHC2TA	U18259 at	U18259	PASS	6	5.00	fail	5	6		Disease	Disease	MHC2TA	Chr.16	MHC class II transactivator	MHC class II transactivator
U22431_s_at	U22431_s_at	U22431	PASS	6	6.83	fail	5	6		Disease	Disease	HIP1A	14q21-q24	hypoxia-inducible factor 1,	hypoxia-inducible factor 1,
														alpha subunit (basic	alpha subunit (basic
														helix-loop-helix	helix-loop-helix
														transcription factor	transcription factor
SNAP	U39412_at	U39412	PASS	6	16.50	fail	5	6		Disease	Disease	NAPA		N-ethylmaleimide-sensitive	N-ethylmaleimide-sensitive
														factor attachment	factor attachment
														protein, alpha	protein, alpha
U43189_s_at	U43189_s_at	U43189	PASS	6	7.17	fail	5	6		Disease	Disease	NERP-1a,b		NERF-1b	Ets transcription factor
CHM	U84720_at	U84720	PASS	6	1l.83	fail	5	6		Disease	Disease	RAE1;		Homolog of yeast Rae1	Homolog of yeast Rae1
														(Bharathi) mRNA-	(Bharathi) mRNA-
														associated protein of	associated protein of
														41 kDa (Kraemer)	41 kDa (Kraemer)
ITGA6_rna1	X53586_rna1	X53586	PASS	6	8.83	fail	5	6		Disease	Disease	ITGA6	2	integrin, alpha 6	integrin, alpha 6
LY64	D83597_at	D83597	PASS	6	11.83	fail	4	6		Disease	Disease	LY64	Sq12	RP105	lymphocyte antigen 64
															(mouse) homolog,
															radioprotective, 105 kD
MLLT3	L13744_at	L13744	PASS	6	5.00	fail	4	6		Disease	Disease	AF-9
KPNA1	S75295_at	S75295	PASS	6	5.67	fail	4	6		Disease	Disease	KPNA1		karopherin alpha 1	karopherin alpha
														(importin alpha 5)	(importin alpha 5)
ZNF133	U09366_at	U09366	PASS	6	7.50	fail	4	6		Disease	Disease	ZNF169	9q22	zinc finger protein 169	zinc finger protein 169
SGSH	U30894_at	U30894	PASS	6	10.50	fail	4	6		Disease	Disease	SGSH	17q25.3	N-sulfoglucosamine	N-sulfoglucosamine
														sulfohydrolase	sulfohydrolase
														(sulfamidase)	(sulfamidase)
AMT	D14686_at	D14686	PASS	5	12.20	fail	6	5		Disease	Disease	AMT	3p21.2-p21.1	aminomethyltransferase	aminomethyltransferase
														(glycine cleavage system	(glycine cleave system
														protein T)	protein T)
APT1LG1	D38122_at	D38122	PASS	5	5.40	fail	6	5		Disease	Disease	TNFSF6	1q23	apoptosis (APO-1) antigen	tumor necrosis factor
														ligand 1	(ligand) superfamily,
															member 6
K83_CHR3	D42046_at	D42046	PASS	5	6.60	fail	6	5		Disease	Disease	DNA2L	10q21.2-22.1		DNA2 (DNA replication
															helicase, yeast, homolog-
															like
TESK1	D50863_at	D50863	PASS	5	8.80	fail	6	5		Disease	Disease	TESK1	9p13	TESK1	testis-specific kianse 1
K172_ANK3	D79994_at	D79994	PASS	5	6.20	fail	6	5		Disease	Disease	KIAA0172			similar to ankytrin of
															Chromatium vinosum.
HG1783-HT1	HG1783-HT1	HG1783-HT	PASS	5	4.60	fail	6	5		Disease	Disease
HOXP12	HG2810-HT2	HG2810-HT	PASS	5	6.00	fail	6	5		Disease	Disease
X104	L27476_at	L27476	PASS	5	5.20	fail	6	5		Disease	Disease	ZO-2	9q13-q21	Friedreich ataxia region	Friedreich ataxia region
														gene X104 (tight junction	gene X104 (tight junction
														protein ZO-2)	protein ZO-2)
BRE	L38616_at	L38616	PASS	5	11.00	fail	6	5		Disease	Disease	BRE		brain and reproductive	brain and reproductive
														organ-expressed	organ-expressed
														(TNFRSF1A modulator)	(TNFRSF1A modulator)
ZNF8	M29581_at	M29581	PASS	5	8.80	fail	6	5		Disease	Disease	ZNF8	20q13
U50648_s_at	U50648_s_at	U50648	PASS	5	24.60	fail	6	5		Disease	Disease	PRKR	2p22-p21	protein kinase, interferon-	protein kinase, interferon-
														inducible double stranded	inducible double stranded
														RNA dependent	RNA dependent
SCA2	U70323_at	U70323	PASS	5	12.20	fail	6	5		Disease	Disease	SCA2	12q24	ataxin 2	spinocerebellar ataxia 2
															(olivopontocerebellar
															ataxia 2, autosomal
															dominant, ataxin 2)
ADARB1	U76421_at	U76421	PASS	5	6.20	fail	6	5		Disease	Disease	ADARB1	21q22.3	adenosine deaminase,	adenosine deaminase,
														RNA-specific, B1	RNA-specific, B1
														(homolog of rat RED1)	(homolog of rat RED1)
TSG101	U82130_at	U82l30	PASS	5	7.80	fail	6	5		Disease	Disease	TSG101		tumor susceptibility protein
PMM1	U86070_at	U86070	PASS	5	12.60	fail	6	5		Disease	Disease	PMM1	22q13	phosphomannomutase 1	phosphomannomutase 1
TST	X59434_at	X59434	PASS	5	8.80	fail	6	5		Disease	Disease	TST		thiosulfate sulfurtransferase	thiosulfate sulfurtransferase
														(rhodanese)	(rhodanese)
PFKP	D25328_at	D25328	PASS	5	8.60	fail	5	5		Disease	Disease	PFKP	10p15	platelet-type	phosphofructinase,
														phosphofructokinase	platelet
K65_ZNF11B	D31763_at	D31763	PASS	5	7.60	fail	5	5		Disease	Disease	KIAA0065			ha0946 protein is
															Kruppel-related
K188_SMP2	D80010_at	D80010	PASS	5	5.40	fail	5	5		Disease	Disease	KIAA0188
HG2809-HT2	H532809-HT2	HG2809-HT	PASS	5	9.80	fail	5	5		Disease	Disease
M11025_s_at	M11025_s_at	M11025	PASS	5	6.40	fail	5	5		Disease	Disease	ASGR2	17p	asialoglycoprotein	asialoglycoprotein
														receptor 2	receptor 2
M19267_s_at	M19267_s_at	M19267	PASS	5	7.80	fail	5	5		Disease	Disease	TPM1	15q22.1	tropomyosin 1 (alpha)	tropomyosin 1 (alpha)
TNNC1_rna1	M37984_rna1	M37984	PASS	5	12.80	fail	5	5		Disease	Disease	TnC		slow twitch skeletal/	putative
														cardiac muscle troponin C
ECGF1	S72487_at	S72487	PASS	5	10.00	fail	5	5		Disease	Disease	orf1 5 to
												PD-
												ECGF/TP
EIF2B	U23028_at	U23028	PASS	5	8.20	fail	5	5		Disease	Disease	EIF2B5		eIF-2Bepsilon	eukaryotic translation
															initiation factor 2B,
															subunit 5 (epsilon 82 kD)
CBLB	U26710_at	U26710	PASS	5	6.20	fail	5	5		Disease	Disease	CBLB	3q	Cas-Br-M (murine)	Cas-Br-M (murine)
														ectropic retroviral	ectropic retroviral
														transforming sequence b	transforming sequence b
ADK	U50196_at	U50196	PASS	5	5.00	fail	5	5		Disease	Disease			adenosine kinase
ERVK_cds2	U60269_cds2	U60269	PASS	5	5.80	fail	5	5		Disease	Disease				putative polymerase; orf
															similar to the integrase
															domain of Type A and
															Type B retroviruses and
															to class II HERVs
U68162cda	U68162_cds	U68162	PASS	5	6.40	fail	5	5		Disease	Disease	MPL		thrombopoietin receptor	alternative initiation codon
															used
POU2AF1	Z49194_at	Z49194	PASS	5	7.20	fail	5	5		Disease	Disease	POU2AF1	11q23.1	oct-binding factor	POU domain, class 2,
															associating factor 1
K334	AB002332_at	AB002332	PASS	5	4.80	fail	4	5		Disease	Disease	CLOCK	4q12	clock (mouse) homolog	clock (mouse) homolog
K238_PERM	D87075_at	D87075	PASS	5	6.00	fail	4	5		Disease	Disease	KIAA0238		similar to Mouse yolk sac
															permease like molecule 1
															(U25739)
K258	D87447_at	D87447	PASS	5	9.20	fail	4	5		Disease	Disease	KIAA0258			KIAA0258 gene product
K279_EGFL	D87469_at	D87469	PASS	5	5.80	fail	4	5		Disease	Disease	EGFL2	chr. 1		EGF-like-domain,
															multiple 2
AMY2B	D90097_at	D90097	PASS	5	5.60	fail	4	5		Disease	Disease	AMY2B	1p21	alpha-amylase	amylase, alpha 2B;
															pancreatic
M34458_rna1	M34458_rna1	M34458	PASS	5	5.80	fail	4	5		Disease	Disease				lamin B
M81182_s_at	M81182_s_at	M81182	PASS	5	5.00	fail	4	5		Disease	Disease	PXMP1	1p22-p21	peroxisomal membrane	peroxisomal membrane
														protein 1 (70 kD, Zellweger	protein 1 (70 kD, Zellweger
														syndrome)	syndrome)
HRC1	M91083_at	M91083	PASS	5	8.00	fail	4	5		Disease	Disease	C11ORF13	11p15.5	HRAS1-related cluster-1	chromsome 11 open
															reading frame 13
ITGB3	S70348_at	S70348	PASS	5	7.00	fail	4	5		Disease	Disease	integrin		integrin beta 3	This sequence comes from
												beta 3			FIG. 1a. Protein sequence
															is in conflict with the
															conceptual translation;
															mismatch (29G->Q)
PTFD	U44755_at	U44755	PASS	5	9.00	fail	4	5		Disease	Disease	SNAPC2		small nuclear RNA	small nuclear RNA
														activating complex,	activating complex,
														polypeptide 2, 45 kD	polypeptide 2, 45 kD
GCDH	U69141_at	U69141	PASS	5	6.40	fail	4	5		Disease	Disease	GCDH	19p13.2	glutaryl-Coenzyme A	glutaryl-Coenzyme A
														dehydrogenase	dehydrogenase
UNKP	D28124_at	D28124	PASS	5	16.40	fail	3	5		Disease	Disease	NBL1	1p36.3-p36.2		neuroblastoma candidate
															region, suppression of
															tumorigenicity 1
NCBPIP1	D59253_at	D59253	PASS	5	5.80	fail	3	5		Disease	Disease			NCBP Interacting Protein 1	RNA-binding protein that
														has two RNP consensus
															motifs
ITGB3	HG2320-HT2	HG2320-HT	PASS	5	11.60	fail	3	5		Disease	Disease
M33684_s_at	M33684_s_at	M33684	PASS	5	6.60	fail	3	5		Disease	Disease	PTPN1		non-receptor tyrosine
														phosphatase 1
MYH10_r	U34301_r_at	U34301	PASS	5	15.40	fail	3	5		Disease	Disease
X07434_s_at	X07438_s_at	X07438	PASS	5	9.00	fail	3	5		Disease	Disease
CREB1	X68994_at	X68994	PASS	5	5.60	fail	3	5		Disease	Disease	CREB		Y protein
MYL2	J02854_at	J02854	PASS	5	26.00	fail	2	5		Disease	Disease	MYL2		myosin light chain 2
AC1	D82070_at	D82070	PASS	5	5.00	fail	2	5		Disease	Disease	aC1
CGM7	D90276_at	D90276	PASS	5	14.60	fail	2	5		Disease	Disease	CGM7	19q13.2	carcinoembryonic antigen	carcinoembryonic entigen
														gene family member 7	gene family member 7
HG4020-HT4	HG4020-HT4	HG4020-HT	PASS	5	16.00	fail	2	5		Disease	Disease
PCK1	L05144_at	L05144	PASS	5	5.60	fail	2	5		Disease	Disease	PCK1	20q13.31	phosphoenolpyruvate	phosphoenolpyruvate
														carboxykinase 1 (soluble)	carboxykinase 1 (soluble)
DEFA5_rna1	M97925_rna1	M97925	PASS	5	9.00	fail	2	5		Disease	Disease	DEFAS	8pter-p21	defensin 5	definsin, alpha 5, Paneth
															cell-specific
CCNG1IP	U61836_at	U61836	PASS	5	8.80	fail	2	5		Disease	Disease
KRT3	X82634_at	X82634	PASS	5	6.40	fail	2	5		Disease	Disease	KRTHA7	17q12-q21	keratin, hair, acidic, 7	keratin, hair, acidic, 7
NMOR2	J02888_at	J02888	PASS	7	12.71	PASS	8	7	6.38	1.99	1.99	NMOR2	6pter-q12	NAD(P)H menadione	NAD(P)H menadione
														oxidoreductase 2, dioxin-	oxidoreductase 2, dioxin-
														inducible	inducible
HG33-HT33	HG33-HT33	HG33-HT3	PASS	9	309.00	PASS	13	9	155.08	1.99	1.99
RES422B	AB000460_at	AB000460	PASS	9	27.56	PASS	12	9	13.83	1.99	1.99	RES4-22	4p16.3	gene with multiple splice	gene with multiple splice
														variants near HD locus	variants near HD locus
														on 4p16.3	on 4p16.3
MIC2	M16279_at	M16279	PASS	9	72.22	PASS	13	9	36.31	1.99	1.99	MIC2	Xp22.32;	antigen identified by	antigen identified by
													Yp11.3	monocolonal antibodies	monoclonal antibodies
														12E7, F21 and O13	12E7, F21 and O13
RB1	L22342_at	L22342	PASS	9	27.33	PASS	12	9	13.75	1.99	1.99	IFI75		interferon-induced protein	interferon-induced protein
														75, 52 kD	75, 52 kD
HLA-DNA	M31525_at	M31525	PASS	6	13.50	PASS	10	6	6.80	1.99	1.99	HLA-DNA			MHC HLA-DNA precursor
LRP1	X79882_at	X79882	PASS	7	27.29	PASS	12	7	13.75	1.98	1.98	LRP			lung resistance-related
															protein
RAGE_cds3	U89336_cds	U89336	PASS	9	12.56	PASS	12	9	6.33	1.98	1.98	HBX2		homeobox PBX2 gene	intron-exon boundaries
															identified by a contig of
															ESTs with GenBank
															Accession Number
															W76064, R59617, W72507
J03805_s_at	J03805_s_at	J03805	PASS	9	14.33	PASS	13	9	7.23	1.98	1.98	PPP2CB	8p12-p11.2	protein phosphatase 2	protein phosphatase 2
														(formerly 2A), catalytic	(formerly 2A), catalytic)
														subunit, beta isoform	subunit, beta isoform
ATOX1	U70660_at	U70660	PASS	8	13.38	PASS	12	8	6.75	1.98	1.98	ATOX1	5q32-q33	ATX1 (antioxidant protein	ATX1 (antioxidant protein
														1, yeast) homolog 1	1, yeast) homolog 1
K22	D14664_at	D14664	PASS	8	16.50	PASS	12	8	8.33	1.98	1.98	KIAA0022			KIAA0022 gene product
SMS	Z49099_at	Z49099	PASS	9	20.44	PASS	12	9	10.33	1.98	1.98	SMS	Xp22.1	spermine synthase	spermine synthase
TCTEL1	D50663_at	D50663	PASS	8	22.75	PASS	12	8	11.50	1.98	1.98	TCTEL1			similar to murine Tete1
															gene product
CSTF3	U15782_at	U15782	PASS	8	11.38	PASS	12	8	5.75	1.98	1.98	CSTF3		cleavage stimulation factor	cleavage stimulation factor,
														subunit 3	3 pre-RNA, subunit 3,
															77 kD
PL1	M11119_at	M11119	PASS	7	15.00	PASS	12	7	7.58	1.98	1.98				pseudo-evn cds/pseudo
M20867_s_at	M20867_s_at	M20867	PASS	8	14.13	PASS	13	8	7.15	1.97	1.97	GLUD1			glutamate dehydrogenase
G6PD	M24470_at	M24470	PASS	9	1578	PASS	11	9	8.00	1.97	1 97	GMPR 6p23
															(EC 1.4.1.3.)
K24_PTDSS	D14694_at	D14694	PASS	9	41.11	PASS	13	9	20.85	1.97	1.97	KIAA0024			KIAA0024 gene product
REQ	U94585_at	U94585	PASS	9	19.11	PASS	13	9	9.69	1.97	1.97	hsReq		requiem homolog	zinc finger; contains one
															C2H2 and two C4HC3
L19493_s_at	L19493_s_at	L19493	PASS	7	9.86	PASS	11	7	5.00	1.97	1.97	FMR1
M12959_s_at	M12959_s_at	M12959	PASS	9	137.22	PASS	13	9	69.62	1.97	1.97	TCRA			T-cell receptor alpha-
															chain (VDJC)
TRSP	M86752_at	M86752	PASS	8	16.13	PASS	11	8	8.18	1.97	1.97	IEF SSP		transformation-sensitive
												3521		protein
MYCBP	D89667_at	D89667	PASS	9	114.11	PASS	13	9	5792	1.97	1.97	PFDN5		prefoldin 5	prefoldin 5
MYL6	HG2815-HT2	HG2815-HT	PASS	9	292.33	PASS	13	9	148.4	61.97	1.97
GOK	U52426_at	U52426	PASS	7	14.00	PASS	9	7	7.11	1.97	1.97	STIM1	11p15.5	stromal interaction	stromal interaction
														molecule 1	molecule 1
ALDH7	U34252_at	U34252	PASS	8	13.63	PASS	13	8	6.92	1.97	1.97	ALDH9	1q22-q23	aldehyde dehydrogenase 9	aldehyde dehydrogenase 9
														(gamma-aminobutyralde-	(gamma-aminobutyralde-
														hyde dehydrogenase,	hyde dehydrogenase,
														E3 isozyme)	E3 isozyme)
ETFB	X71129_at	X71129	PASS	9	12.00	PASS	10	9	6.10	1.97	1.97	ETFB	19q13.3	electron-transfer-	electron-transfer-
														flavoprotein, beta poly-	flavoprotein, beta poly-
														peptide	peptide
DIPA	U63825_at	U63825	PASS	8	21.63	PASS	13	8	11.00	1.97	1.97	dipA		hepatitis delta antigen	isolated in a two hybrid
														interacting protein A	screen to identify cellular
															proteins that interact with
															hepatitis delta antigen;
															similar to hepatitis delta
															antigen, and has two
															regions predicted to form
															coiled-coil protein
															interaction domains
NAGA	M62783_at	M62783	PASS	9	16.44	PASS	13	9	8.38	1.96	1.96	NAGA	22q13-qter	N-acetylgalactosaminidase,	N-acetylgalactosaminidase,
														alpha-	alpha-
K317	AB002315_at	AB002315	PASS	9	11.11	PASS	12	9	5.67	1.96	1.96	KIAA0317			KIAA0317 gene product
GLB1	M34423_at	M34423	PASS	9	17.11	PASS	11	9	8.73	1.96	1.96	GLB1	3p21.33		galactosidase, beta 1
CDC34	L22005_at	L22005	PASS	6	12.00	PASS	8	6	6.13	1.96	1.96	CDC34	19p13.3	ubiquitin conjugating	cell division cycle 34
														enzyme
AGC1	U16306_at	U16306	PASS	9	104.11	PASS	13	9	53.15	1.96	1.96			chondroitin sulfate
														proteoglycan versican V0
														splice-variant precursor
														peptide
SNRPN	J04615_at	J04615	PASS	9	51.22	PASS	13	9	26.15	1.96	1.96	SNRPN	15q12	small nuclear ribonucleo-	small nuclear ribonucleo-
														protein polypeptide N	protein polypeptide N
ECHS1	D13900_at	D13900	PASS	9	27.00	PASS	10	9	13.80	1.96	1.96	ECHS1	10q26.2-q26.3	enoyl Coenzyme A	enoyl Coenzyme A
														hydratase, short chain 1,	hydratase, short chain 1,
														mitochondrial	mitochondrial
CD14	X13334_at	X13334	PASS	9	180.11	PASS	13	9	92.08	1.96	1.96	CD14	5q22-q32	CD14 antigen	CD14 antigen
S164	L40392_at	L40392	PASS	8	14.00	PASS	12	8	7.17	1.95	1.95				ORF, putative
LRPAP1	M63959_at	M63959	PASS	8	28.25	PASS	13	8	14.46	1.95	1.95	LRPAP1	4p16.3	low density lipoprotein-	low density lipoprotein-
														related protein-associated	related protein-associated
														protein 1 (alpha-2-	protein 1 (alpha-2-
														macroglobulin receptor-	macroglobulin receptor-
														protein 1)	protein 1)
TXBP151	U33821_at	U33821	PASS	9	32.56	PASS	13	9	16.69	1.95	1.95	U33821		TXBP151	tax1-binding protein
K177_ADPR	D79999_at	D79999	PASS	6	25.50	PASS	13	6	13.08	1.95	1.95	KIAA0177			similar to chicken poly
															(ADP-ribose) synthase, has
															putative hydrophobic
															domain in amino acid
															positions 638-662.
MOZ	U47742_at	U47742	PASS	9	26.67	PASS	13	9	13.69	1.95	1.95	MOZ		monocytic leukaemia zinc
														finger protein
HCG5	X81003_at	X81003	PASS	9	16.78	PASS	13	9	8.62	1.95	1.95	HCGV	6p21.3		hemochromatosis candidate
															gene V
J04130_s_at	J04130_s_at	J04130	PASS	9	27.56	PASS	13	9	14.15	1.95	1.95	SCYA4	17q21	small inducible cytokine	small inducible cytokine
														A4 (homologous to	A4 (homologous to
														mouse (Mip-1b)	mouse (Mip-1b)
H3F3B	M11353_at	M11353	PASS	9	245.78	PASS	13	9	126.31	1.95	1.95	H3FJ	6p22-p21.3	H3 histone family,	H3 histone family,
														member J	member J
PSEN1	L76517_at	L76517	PASS	9	18.56	PASS	13	9	9.54	1.95	1.95	PSEN1	14q24.3	presenilin 1 (Alzheimer	presenilin 1 (Alzheimer
														disease 3)	disease 3)
MGST2	U77604_at	U77604	PASS	8	19.00	PASS	13	8	9.77	1.94	1.94	MGST2	4q28-q31	microsomal glutathione S-	microsomal glutathione S-
														transferase 2	transferase 2
MACS	D10522_at	D10522	PASS	8	13.75	PASS	13	8	7.08	1.94	1.94	MACS	6q21	myristoylated alanine-rich	myristoylated alanine-rich
														protein kinase C substrate	protein kinase C substrate
														(MARCKS, 80K-L)	(MARCKS, 80K-L)
PSMHSN3	D26600_at	D26600	PASS	9	46.78	PASS	13	9	24.08	1.94	1.94	PSMB4	1q21	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, beta	macropain) subunit, beta
														type, 4	type, 4
MYL2	M21812_at	M21812	PASS	8	11.38	PASS	7	8	5.86	1.94	1.94			myosin light chain 2
SKI	U73377_at	U73377	PASS	9	11.44	PASS	11	9	5.91	1.94	1.94	SHC		p66shc	alternatively spliced
															isoform in GenBank
															Accession Number X68148
CLK2	L29218_at	L29218	PASS	7	13.71	PASS	11	7	7.09	1.93	1.93	CLK2	1q21	CDC-like kinase 2	CDC-like kinase 2
PPBP	M54995_at	M54995	PASS	9	251.56	PASS	13	9	130.31	1.93	1.93	PPBP	4q12-q13	pro-platelet basic protein	pro-platelet basic protein
														(includes platelet basic	(includes platelet basic
														protein, beta-thrombo-	protein, beta-thrombo-
														globulin, connective	globulin, connective
														tissue-activating peptide	tissue-activating peptide
														III, neu	III, neutrophil-activating
															peptide-2)
SDHA	L21936_at	L21936	PASS	9	23.44	PASS	13	9	12.15	1.93	1.93	SDHA	5p15	succinate dehydrogenase	succinate dehydrogenase
														complex, subunit A,	complex subunit A,
														flavoprotein (Fp)	flavorprotein (Fp)
UBA52	S79522_at	S79522	PASS	9	286.56	PASS	13	9	148.69	1.93	1.93	RPS27A	2	ribosomal protein S27a	ribosomal protein S27a
SARS	X91257_at	X91257	PASS	9	38.22	PASS	13	9	19.85	1.93	1.93	serS		seryl-tRNA synthetase
GPS2	U28963_at	U28963	PASS	8	13.63	PASS	13	8	7.08	1.93	1.93	GPS2		G protein pathway	G protein pathway
														suppressor 2	suppressor 2
ELANH2	M93056_at	M93056	PASS	8	16.13	PASS	13	8	8.38	1.92	1.92	ELANH2	6p25		protease inhibitor 2 (anti-
															elastase), monocyte/
															neutrophil
NT5	D38524_at	D38524	PASS	8	10.00	PASS	10	8	5.20	1.92	1.92			5-nucleotidase	putative
ATP5O	S77356_at	S77356	PASS	9	21.00	PASS	13	9	10.92	1.92	1.92	transcript			oligomycin sensitivty
												ch21			conferral protein oscp
															homolog; This sequence
															from FIG. 3. Protein
															sequence is in conflict
															with the conceptual
															translation, insertious
															(7-9, missing Y)
K58	D31767_at	D31767	PASS	9	108.22	PASS	13	9	56.31	1.92	1.92	KIAA0058			KIAA0058 gene product
YY1	M77698_at	M77698	PASS	9	13.44	PASS	9	9	7.00	1.92	1.92	YY1	14q	YY1 transcription factor	YY1 transcripton factor
POLR2	U37690_at	U37690	PASS	9	51.56	PASS	13	9	26.85	1.92	1.92	hsRPB10		RNA polymerase II subunit
CR3p21IGS	L13434_at	L13434	PASS	6	12.00	PASS	8	6	6.25	1.92	1.92
MEA	HG1869-HT1	HG1869-HT	PASS	9	19.33	PASS	13	9	10.08	1.92	1.92
PSMC3	M34079_at	M34079	PASS	6	13.17	PASS	8	6	6.88	1.92	1.92	PSMC3	11p12-p13	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,)
														ATPase, 3	ATPase, 3
CTGB43A	L10378_at	L10378	PASS	9	18.22	PASS	13	9	9.54	1.91	1.91
K84	D42043_at	D42043	PASS	9	26.00	PASS	13	9	13.62	1.91	1.91	K1AA0084			The ha2022 gene product is
															novel.
UB_rna1	U49869_rna1	U49869	PASS	9	329.78	PASS	13	9	173.00	1.91	1.91			ubiquitin
CYBA	M21186_at	M21186	PASS	9	221.67	PASS	13	9	116.38	1.90	1.90	CYBA	16q24	cytochrome b-245 alpha	cytochrome b-245 alpha
														polypeptide	polpeptide
PGAM1	J04173_at	J04173	PASS	9	72.56	PASS	13	9	38.15	1.90	1.90	PGAM1	10q25.3	phosphoglycerate mutase 1	phosphoglycerate mutase 1
														(brain)	(brain)
M6PR_rna1	X56253_rna1	X56253	PASS	9	46.33	PASS	13	9	24.38	1.90	1.90
ITGB5	J05633_at	J05633	PASS	7	9.29	PASS	9	7	4.89	1.90	1.90	ITGB5		integrin, beta 5	integrin, beta 5
U68105_s_at	U68105 s_at	U68105	PASS	9	97.56	PASS	13	9	51.38	1.90	1.90
ADAR	U10439_at	U10439	PASS	9	34.56	PASS	13	9	18.23	1.90	1.90	AI3AR	1q21.1-q21.2	adenosine deaminase,	adenosine deaminase,
														RNA-specific	RNA-specific
TP53BP2	U58334_at	U58334	PASS	6	12.00	PASS	12	6	6.33	1.89	1.89	TP53BP2	1q42.1	Bbp/53BP2	tumor protein p53-
															binding protein, 2
K135_PIM1	D50925_at	D50925	PASS	6	12.00	PASS	9	6	6.33	1.89	1.89	KIAA0135		The KIAA0135 gene is
															related to pim-1 oncogene.
EWSR1	X71428_at	X71428	PASS	9	72.00	PASS	13	9	38.00	1.89	1.89	PUS	16p11.2	FUS gycline rich protein	fusion, derived from
															y(12;16) malignant
															liposarcoma
PSMD7	U70735_at	U70735	PASS	9	15.44	PASS	13	9	8.15	1.89	1.89			34 kDa Mov34 homolog	similar to Mov34
ZAP112	L40399_at	L40399	PASS	6	26.50	PASS	10	6	14.00	1.89	1.89				ORF; putative
ALOX5	J03600_at	J03600	PASS	9	29.33	PASS	12	9	15.50	1.89	1.89	ALOX5	10g11.2	arachidonate 5-lipoxy-	arachidonate 5-lipoxy-
														genase	genase
MEN1_rna2	U93237_rna2	U93237	PASS	6	11.67	PASS	12	6	6.17	1.89	1.89	MENI	11q13	multiple endocrine	multiple endocrine
														neoplasia I	neoplasia I
K262	D87451_at	D87451	PASS	9	54.89	PASS	13	9	29.08	1.89	1.89	KIAA0262			KIAA0262 gene product
X55448_cds1	X55448_cds1	X55448	PASS	9	27.44	PASS	13	9	14.54	1.89	1.89	G6PD		glucose-6-phosphate
														dehydrogenase
E_23745	U79260_at	U79260	PASS	6	12.33	PASS	11	6	6.55	1.88	1.88				similar to human oligo-
															dendrocyte myelin glyco-
															protein encoded
															by GenBank Accession
															Number L05367
CBOG53955	D87119_at	D87119	PASS	8	19.75	PASS	12	8	10.50	1.88	1.88			GS3955
BLVRA	U34877_at	U34877	PASS	8	14.88	PASS	12	8	7.92	1.88	1.88	BLVRA	7p14-cen	biliverdin reductase A	biliverdin reductase A
HEXB	M23294_at	M23294	PASS	6	20.67	PASS	12	6	11.00	1.88	1.88	HEXB	5q13	hexosaminidase B (beta	hexosaminidase B (beta
														polypeptide)	polypeptide)
AC002045_x	AC002045_x	AC002045	PASS	9	25.00	PASS	13	9	13.31	1.88	1.88	A-589H1.1		Unknown protein product
															CIT987SK-A-589H1_1
															splice form 1
NOL1	HG1116-HT1	HG1116-HT	PASS	7	12.86	PASS	13	7	6.85	1.88	1.88
HG2090-HT2	HG2090-HT2	HG2090-HT	PASS	9	16.89	PASS	11	9	9.00	1.88	1.88
NDUFA4	U94586_at	U94586	PASS	9	32.44	PASS	13	9	17.31	1.87	1.87	NDUFA4		NADH dehydrogenase	NADH dehydrogenase
														(ubiquinone) 1 alpha	(ubiquinone) 1 alpha
														subcomplex, 4 (9 kD,	subcomplex, 4 (9 kD,
														MLRQ)	MLRQ)
K59_DMT	D31883_at	D31883	PASS	9	45.56	PASS	13	9	24.31	1.87	1.87	LIMAB1	10q25	LIM actin binding	LIM actin binding
														(limatin)	(limatin)
3P25MP	L09260_at	L09260	PASS	9	16.11	PASS	13	9	8.62	1.87	1.87
YWHAZ	M86400_at	M86400	PASS	9	116.22	PASS	13	9	62.15	1.87	1.87	YWHAZ	2p25.2-p25.1	tyrosine 3-monoxy-	tyrosine 3-monoxy-
														genase/tryptophan 5-	genase/tryptophan 5-
														monoxygenase activation	monoxygenase activation
														protein, zeta polypeptide	protein, zeta polypeptide
Z74792_s_at	Z74792 s_at	Z74792	PASS	5	10.80	PASS	9	5	5.78	1.87	1.87			CCAAT transcription
														binding factor, gamma
														subunit
HBG2_rna1	M91036_rna1	M91036	PASS	9	60.56	PASS	12	9	32.42	1.87	1.87	HBG1	11p15.5	hemoglobin, gamma A	hemoglobin, gamma A
COX6B_cds	AC002115_c	AC002115	PASS	9	114.11	PASS	13	9	61.23	1.86	1.86	COX6B		F25451_2	hypothetical 36.5 kDa
															protein most similar to
															ssRNA binding proteins;
															BLASTX similarity to
															(Y07952) ssRNA-binding
															protein Dictostellum
															discoideum (52%)
															within RNP domains; and
															to (Z70043) hypothetical
															24.4 kD protein C22E12.02
															in chromosome I
															Schizosaccharomyces
															pombe
PSMHSC10	D26598_at	D26598	PASS	9	45.56	PASS	13	9	24.46	1.86	1.86	PSMB3	2q35	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, beta	macropain) subunit, beta
														type, 3	type, 3
M14328_s_at	M14328_s_at	M14328	PASS	9	173.22	PASS	13	9	93.15	1.86	1.86	ENO1	1p36.2-p36.3	enolase 1, (alpha)	enolase 1, (alpha)
CAPN2	M23254_at	M23254	PASS	9	63.33	PASS	13	9	34.08	1.86	1.86	CAPN2	1	calpain, large	calpain, large
														polypeptide L2	polypeptide L2
HG110-IIT11	HG110-HT11	HG110-HT	PASS	9	26.44	PASS	13	9	14.23	1.86	1.86
U45448_s_at	U45448_s_at	U45448	PASS	8	13.63	PASS	12	8	7.33	1.86	1.86	P2RX1	17p	purinergic receptor P2X,	purinergic receptor P2X,
														ligand-gated ion channel 1	ligand-gated ion channel 1
K275_SPOC1	D87465_at	D87465	PASS	9	50.44	PASS	13	9	27.15	1.86	1.86	KIAA0275			KIAA0275 gene product
NCL_rna1	M60858_rna1	M60858	PASS	9	73.00	PASS	13	9	39.31	1.86	1.86	NCL	2g12-qter	nucleolin	nucleolin
IRATHL60N	U09196_at	U09196	PASS	9	27.00	PASS	13	9	14.54	1.86	1.86
CPBP	U44975_at	U44975	PASS	8	13.00	PASS	11	8	7.00	1.86	1.86	COPEB	10p15	core promoter element	core promoter element
														binding protein	binding protein
ATP5G1	D13118_at	D13118	PASS	9	37.44	PASS	12	9	20.17	1.86	1.86	ATP5G3	2	ATP synthase, H	ATP synthase, H
														transporting, mitochondrial	transporting, mitochondrial
														FO complex, subunit c	FO complex, subunit c
														(subunit 9) isoform 3	(subunit 9) isoform 3
EIF3	U36764_at	U36764	PASS	9	25.33	PASS	13	9	13.69	1.85	1.85	EIF352	1p34.1	eukaryotic translation	eukaryotic translation
														initiation factor 3,	initiation factor 3,
														subunit 2 (beta, 36 kD)	subunit 2 (beta, 36 kD)
XBP1	M31627_at	M31627	PASS	9	33.00	PASS	13	9	17.85	1.85	1.85	XBP1	22		X-box binding protein 1
HLA-A_f	HG3597-HT3	HG3597-HT	PASS	9	182.11	PASS	13	9	98.62	1.85	185
K77	D38521 _at	D38521	PASS	9	11.67	PASS	12	9	6.33	1.84	1.84	KIAA0077			The ha0919 gene product is
															novel.
KPNB1	L38951_at	L38951	PASS	7	15.86	PASS	13	7	8.62	1.84	1.84	KPNB1		karopherin (importin)	karopherin (importin)
														beta 1	beta 1
NDP52	U22897_at	U22897	PASS	9	14.22	PASS	11	9	7.73	1.84	1.84	ndp52		NDP52	nuclear domain 10 protein
															as characterized by a
															monoclonal antibody
															recognizing the encoded
															protein
ARF1	M84332_at	M84332	PASS	9	115.56	PASS	13	9	62.85	1.84	1.84	ARF1	1q42	ADP-ribosylation factor 1	ADP ribosyltation factor 1
DAD1	D15057_at	D15057	PASS	9	20.22	PASS	13	9	11.00	1.84	1.84	DAD1	14q11-q12	defender against cell	defender against cell
														death 1	death 1
PPIA_rna1	X52851_rna1	X52851	PASS	9	139.56	PASS	13	9	75.92	1.84	1.84			peptidylprolyl isomerase
PPP2RB56A	L42373_at	L42373	PASS	9	17.78	PASS	13	9	9.69	1.83	1.83	PPP2R5A	1q41	protein phosphatase 2A	protein phosphatase 2,
														B56-alpha	regulatory subunit B
															(B56), alpha isoform
EIF4C	L18960_at	L18960	PASS	9	11.00	PASS	11	9	6.00	1.83	1.83	EIF1AY	Y chr.	eukaryotic translation	eukaryotic translation
														initiation factor 1A,	initiation factor 1A,
														Y chromosome	Y chromosome
GCH1	U19523_at	U19523	PASS	7	10.86	PASS	13	7	5.92	1.83	1.83	GCH1	14q22.1-q22.2	GTP cyclohydrolase 1	GTP cyclohydrolase 1
														(dopa-responsive dystomia)	(dopa-responsive dystomia)
CD37	X14046_at	X14046	PASS	9	74.67	PASS	13	9	40.77	1.83	1.83	CD37	19q13-q13.4	CD37 antigen	CD37 antigen
K240	D87077 at	D87077	PASS	6	9.33	PASS	10	6	5.10	1.83	1.83	KIAA0240
M24485_s_at	M24485_s_at	M24485	PASS	9	80.33	PASS	13	9	43.92	1.83	1.83	GSTP1	11q13	glutathione S-transferase pi	glutathione S-transferase pi
HSPD1	M22382_at	M22382	PASS	9	31.22	PASS	13	9	17.08	1.83	1.83	HSPD1		heat shock 60 kD protein 1	heat shock 60 kD protein 1
														(chaperonin)	(chaperonin)
D26156_s_at	D26156_s_at	D26156	PASS	8	13.63	PASS	13	8	7.46	1.83	1.83	SMARCA4		SWI/SNF related, matrix	SWI/SNF related, matrix
														associated, actin dependent	associated, actin dependent
														regulator of chromatin,	regulator of chromatin,
														subfamily a, member 4	subfamily a, member 4
HLA-C_f	HG658-HT65	HG658-HT	PASS	9	320.78	PASS	13	9	175.77	1.82	1.82
HLA-E_f	HG2917-HT3	HG2917-HT	PASS	9	248.00	PASS	13	9	136.00	1.82	1.82
K34_CLTCL	D21260_at	D21260	PASS	9	23.00	PASS	13	9	12.62	1.82	1.82	CLTCL2		clathrin, heavy poly-	clathrin, heavy poly-
														peptide-like 2	peptide-like 2
PRKCD	D10495_at	D10495	PASS	9	30.22	PASS	12	9	16.58	1.82	1.82	35550		protein kinase C delta-type
M37238_s_at	M37238_s_at	M37238	PASS	9	11.33	PASS	9	9	6.22	1.82	1.82	PLCG2	16q24.1	phospholipase C, gamma 2	phospholipase C, gamma 2
														(phosphatidylinositol-	(phosphatidylinositol-
														specific)	specific)
RER1	AJ001421_at	AJ001421	PASS	9	33.89	PASS	13	9	18.62	1.82	1.82			Rer1 protein
PPR1A	HG1614-HT1	HG1614-HT	PASS	9	106.56	PASS	13	9	58.62	1.82	1.82
PPP2R4	U37352_at	U37352	PASS	7	12.57	PASS	13	7	6.92	1.82	1.82	PPP2R4	9q34	protein phosphatase 2A,	protein phosphatase 2A,
														regulatory subunit B	regulatory subunit B
														(PR 53)	(PR 53)
HUNC18B2	AB002559_at	AB002559	PASS	8	21.63	PASS	11	8	11.91	1.82	1.82			hunc18b2	putative alternatively
															spliced form of
															gbIU63533IHSU63533
J03077_s_at	J03077_s_at	J03077	PASS	9	339.89	PASS	13	9	187.54	1.81	1.81	PSAP	10q21-q22		prosposm (variant Gaucher
															disease and variant meta-
															chromatic leukodystrophy)
ARRB2	HG2059-HT2	HG2059-HT	PASS	9	24.67	PASS	13	9	13.62	1.81	1.81
E_23652	U90911_at	U90911	PASS	9	13.00	PASS	11	9	7.18	1.81	1.81
HG1595-HT4	HG1595-HT4	HG1595-HT	PASS	8	26.00	PASS	13	8	14.38	1.81	1.81
CSNK1D	U29171_at	U29171	PASS	9	18.22	PASS	12	9	10.08	1.81	1.81	CSNK1D	17q25	casein kinase 1, delta	casein kinase 1, delta
RPS3A	M84711_at	M84711	PASS	9	298.78	PASS	13	9	165.62	1.80	1.80	RPS3A	4q31.2-q31.3	ribosomal protein S3A	ribosomal protein S3A
GLUL	X59834_at	X59834	PASS	9	23.00	PASS	12	9	12.75	1.80	1.80	GLUL	1q31	glutamate-ammonia ligase	glutamate-ammonia ligase
														(glutamine synthase)	(glutamine synthase)
IL4R	X52425_at	X52425	PASS	9	26.22	PASS	11	9	14.55	1.80	1.80	IL4R	16p11.2-p12.1	interleukin 4 receptor	interleukin 4 receptor
CSTB_rna1	U46692_rna1	U46692	PASS	9	47.22	PASS	13	9	26.23	1.80	1.80	CSTB	21q22.3	cystatin B (stefin B)	systatin B (stefin B)
M22348_s_at	M22348_s_at	M22348	PASS	8	11.38	PASS	9	8	6.33	1.80	1.80	UQBP			ubiquinone-binding protein
															precursor
RP517	M18000_at	M18000	PASS	9	464.56	PASS	13	9	258.69	1.80	1.80	RPS17	11pter-p13 or	ribosomal protein S17	ribosomal protein S17
													15q	15q
RPLP0	M17885_at	M17885	PASS	9	436.11	PASS	13	9	243.00	1.79	1.79	RPLP0	12	ribosomal protein, large, P0	ribosomal protein, large, P0
YRS28	D14530_at	D14530	PASS	9	367.89	PASS	13	9	205.31	1.79	1.79	RPS23	5q	ribosomal protein S23	ribosomal protein S23
CBFB	L20298_at	L20298	PASS	9	21.78	PASS	13	9	12.15	1.79	1.79	CBFB	16q22.1	transcription factor	core-binding factor,
														beta subunit
CANX	L10284_at	L10284	PASS	9	41.89	PASS	13	9	23.38	1.79	1.79	CANX	5q35	calnexin	calnexin
HLARK	U89505_at	U89505	PASS	8	17.75	PASS	13	8	9.92	1.79	1.79	RBM4	11q13	RNA binding motif protein	RNA binding motif protein
														4	4
ZFP	U69645_at	U69645	PASS	8	10.13	PASS	12	8	5.67	1.79	1.79			zinc finger protein	C2H2 type zinc finger
SU11	L26247_at	L26247	PASS	9	177.22	PASS	13	9	99.38	1.78	1.78	sui1isol		isolog of yeast sui1 and
															rice gos2; putative
VDAC1	L06132_at	L06132	PASS	8	15.50	PASS	13	8	8.69	1.78	1.78	VDAC1	5q31	voltage-dependent anion	voltage-dependent anion
														channel 1	channel 1
L12711_s_at	L12711_s_at	L12711	PASS	9	67.89	PASS	13	9	38.08	1.78	1.78	TKT	3p14.3	transketolase	transketolase (Wenncke-
															Korsakoff syndrome)
EIF4AI	D13748_at	D13748	PASS	9	107.22	PASS	13	9	60.15	1.78	1.78	EIF4A1	17p13	eukaryotic translation	eukaryotic translation
														initiation factor 4A,	initiation factor 4A,
														isoform 1	isoform 1
STAT13	AFFX-HUM1	AFFX-HUM	PASS	9	23.44	PASS	13	9	13.15	1.78	1.78
POLR2G_rna1	U52427_rna1	U52427	PASS	9	29.56	PASS	12	9	16.58	1.78	1.78	POLR2G	11q13.1	polymerase (RNA) II	polymerase (RNA) II
														(DNA directed) polypeptide	(DNA directed) polypeptide
														G	G
M61832_s_at	M61832_s_at	M61832	PASS	7	10.29	PASS	9	7	5.78	1.78	1.78	AHCY	20cen-q13.1	S-adenosylhomocysteine	S-adosylhomocysteine
														hydrolase	hydrolase
ADPRT	J03473_at	J03473	PASS	9	17.11	PASS	13	9	9.62	1.78	1.78	ADPRT	1q41-q42	ADP-ribosyltransferase	ADP-ribosyltransferase
														(NAD; poly (ADP-	(NAD; poly (ADP-
														ribose-polymerase)	ribose-polymerase)
HSPA9	L11066_at	L11066	PASS	9	28.33	PASS	13	9	15.92	1.78	1.78
SMC1_xpt2	Z97054_xpt2	Z97054	PASS	6	10.00	PASS	8	6	5.63	1.78	1.78			KIAA0178	match D80000; similar to
															mitosis-specific
															chromosome; segregation
															protein SMC1 of S.
															cerevisiae
RPL34	L38941_at	L38941	PASS	9	432.56	PASS	13	9	243.62	1.78	1.78	RPL34	4 or 17	ribosomal protein L34	ribosomal protein L34
HLA-E_f	HG2915-HT3	HG2915-HT	PASS	9	245.00	PASS	13	9	138.15	1.77	1.77
AMPHL	U68485_at	U68485	PASS	5	29.40	PASS	12	5	16.58	1.77	1.77	AMPHL	2q14	amphiphysin-like	amphiphysin-like
MGAT1	M55621_at	M55621	PASS	8	18.13	PASS	13	8	10.23	1.77	1.77	MGAT1	5	mannosyl (alpha-1,3-)-	mannosyl (alpha-1,3-)-
														glycoprotein beta-1,2-N-	glycoprotein beta-1,2-N-
														acetylglucosanimyl-	acetylglucosaminyl-
														transferase	transferase
PDHA1	D90084_at	D90084	PASS	8	10.63	PASS	9	8	6.00	1.77	1.77	PDHA1	Xp22.1	pyruvate dehydrogenase	pyruvate dehydrogenase
														(lipoamide) alpha 1	(lipoamide) alpha 1
COX4	U90915_at	U90915	PASS	9	104.44	PASS	13	9	59.00	1.77	1.77	COX4	16q22-qter	cytochrome c oxidase	cytochrome c oxidase
														subunit IV	subunit IV
COPINE1	U83246 at	U83246	PASS	9	49.11	PASS	13	9	27.77	1.77	1.77	CPNE1		copine 1	copine 1
EDG2	U11861_at	U11861	PASS	9	38.89	PASS	13	9	22.00	1.77	1.77	G10		maternal G10 transcript	maternal G10 transcript
K96_PK	D43636_at	D43636	PASS	9	15.89	PASS	13	9	9.00	1.77	1.77	KIAA0096			KIAA0096 gene product
															is related to a protein
															kinase.
K126_UB	D50916_at	D50916	PASS	8	13.00	PASS	11	8	7.36	1.77	1.77	UFD2	11	homolog of yeast (S.	homolog of yeast (S.
														cerevisiae) ufd2	cerevisiae) ufd2
E_23682	U79288_at	U79288	PASS	8	19.13	PASS	12	8	10.83	1.77	1.77
RPS6_rna1	M77232_rna1	M77232	PASS	9	274.44	PASS	13	9	155.46	1.77	1.77	RP56	9p21	ribosomal protein S6	ribosomal protein S6
GP250	U60975_at	U60975	PASS	9	63.00	PASS	13	9	35.69	1.77	1.77	SORL1	11q23.2-q24.4	sortilin-related receptor,	sortilin-related receptor,
														L(DLR class) A repeats-	L(DLR class) A repeats-
															containing
TTC3	D84294_at	D84294	PASS	9	16.56	PASS	13	9	9.38	1.76	1.76			TPRD1
FYN	M14676_at	M14676	PASS	9	31.89	PASS	13	9	18.08	1.76	1.76	FYN	6q21	FYN oncogene related to	FYN oncogene related to
														SRC, FGR, YES	SRC, FGR, YES
TUBFOLDC	U61234_at	U61234	PASS	8	11.38	PASS	11	86.45	1.76	1.76	TBCC		tubulin-specific	tubulin-speific
														chaperone c	chaperone c
IL10R	U00672'at	U00672	PASS	9	30.22	PASS	13	9	17.15	1.76	1.76	IL20RA	11q23	interleukin 10 receptor,	interleukin 10 receptor,
														alpha	alpha
HG1400-HT1	HG1400-HT1	HG1400-HT	PASS	9	11.78	PASS	13	9	6.69	1.76	1.76
K75'E2F3	D38550_at	D38550	PASS	9	10.56	PASS	10	9	6.00	1.76	1.76	E2F3	6p22	E2F transcription factor 3	E2F transcription factor 3
EBP1	U21931_at	U21931	PASS	9	23.67	PASS	13	9	13.46	1.76	1.76	FBP1		fructose-1,6-biphosphatase
DHPS	U79262_at	U79262	PASS	8	14.88	PASS	13	8	8.46	1.76	1.76			deoxyhypusine synthase	similar to human deoxy-
															pusine synthase encoded
															by GenBank Accession
															Number L39068
IGRM	X58529_at	X58529	PASS	9	112.11	PASS	13	9	63.85	1.76	1.76	IGHM	14q32.33		immunoglobulin mu
K200_MAM	D83785_at	D83785	PASS	8	12.88	PASS	12	8	7.33	1.76	1.76	KIAA0200			KIAA0200 gene product
EEF1D	Z21507_at	Z21507	PASS	9	104.11	PASS	13	9	59.31	1.76	1.76	EEF1D		eukaryotic translation	eukaryotic translation
														elongation factor 1 delta	elongation factor 1 delta
														(guanine nucleotide	(guanine nucleotide
														exchange protein)	exchange protein)
HG2259-HT2	HG2259-HT2	HG2259-HT	PASS	9	67.44	PASS	13	9	38.54	1.75	1.75
FUCA1	M29877_at	M29877	PASS	8	14.00	PASS	13	8	8.00	1.75	1.75	FUCA1	1p34	fucosidase, alpha-L-1,	fucosidase, alpha-L-1,
														tissue	tissue
SELL	M25280_at	M25280	PASS	9	130.11	PASS	13	9	74.38	1.75	1.75	LNHR			lymph node homing
															receptor precursor
M26311_s_at	M26311_s_at	M26311	PASS	9	301.44	PASS	13	9	172.39	1.75	1.75	5100A9	1q12-q22	S100 calcium-binding	S100 calcium-binding
														protein A9 (calgranulin B)	protein A9 (calgranulin B)
ANX2	D00017_at	D00017	PASS	9	98.33	PASS	13	9	50.62	1.75	1.75	ANX2	1.5q21-q22	annexin II (lipocortin 11;	annexin II (lipocortin 11;
														calpactin I, heavy	calpactin I, heavy
														polypeptide)	polypeptide)
K57_COSC	D97446_at	D87446	PASS	9	9.89	PASS	12	9	5.67	1.75	1.75	KIAA0257			Similar to a C. elegans
															protein encoded in cosmid
															C25F2 (U40419)
K239_K215	D87076_at	D97076	PASS	7	19.00	PASS	10	7	10.90	1.74	1.74	KIAA0239			similar to human bromo-
															domain protein BR140
															(JC2069)
S79771_s_at	S78771_s_at	S78771	PASS	6	12.00	PASS	10	6	6.90	1.74	1.74
X89109_s_at	X99109 s_at	X99109	PASS	9	107.22	PASS	13	9	61.69	1.74	1.74			coronin homologue
S92447_s_at	S82447_s_at	S92447	PASS	8	10.25	PASS	10	8	5.90	1.74	1.74	GCN5L1	12q13-q14	GCN5 (general control of	GCN5 (general control of
														amino-acid synthesis,	amino-acid sythesis,
														yeast, homolog)-like 1	yeast, homolog-(like 1
FCN1	D83920_at	D83920	PASS	9	244.89	PASS	13	9	141.00	1.74	1.74	FCN1	9q34	ficolin (collagen/fibrinogen	ficolin (collagen/fibrinogen
														domain-containing) 1	domain-containing) 1
HLA-DMB	U15085_at	U15085	PASS	9	54.22	PASS	13	9	31.23	1.74	1.74	HLA-DMB	6p21.3	major histocompatability	major histocompatability
														complex, class II, DM beta	complex, class II, DM beta
CCND2	D13639_at	D13639	PASS	9	39.11	PASS	13	9	22.54	1.74	1.74	CCND2	12p13	cyclin D2	cyclin D2
CSNK1G2	U89896_at	U89996	PASS	6	9.83	PASS	9	6	5.67	1.74	1.74			casein kinase 1 gamma 2
TAF2H	U13991_at	U13991	PASS	9	33.44	PASS	13	9	19.31	1.73	1.73	tafI130		TATA-binding protein
														associated factor 30 kDa
														subunit
M55409_s_at	M55409_s_at	M55409	PASS	9	259.79	PASS	13	9	149.46	1.73	1.73	EEF1IG		eukaryotic translation	eukarotic translation
														elongation factor 1 gamma	elongation factor 1 gamma
W52B2_f	HG698-HT68	HG688-HT	PASS	8	61.25	PASS	13	8	35.39	1.73	1.73
TRNASTL	U07424_at	U07424	PASS	7	14.00	PASS	11	7	8.09	1.73	1.73	FARSL		phenylalanine-tRNA	phenylalanine-tRNA
														synthetase-like	synthetase-like
EIF2B	M29536_at	M29536	PASS	9	24.89	PASS	13	9	14.38	1.73	1.73	EIF2S2		eukaryotic translation	eukaryotic translation
														initiation factor 2,	initiation factor 2,
														subunit 2 (beta, 38 kD)	subunit 2 (beta, 38 kD)
E_23722	U90909_at	U90909	PASS	8	9.75	PASS	11	8	5.64	1.73	1.73
LGALS3	M57710_at	M57710	PASS	9	66.89	PASS	13	9	39.69	1.73	1.73	LGALS3	1p13	lectin, galactosidide-	lectin, galactosidide-
														binding, soluble, 3 (galactin	binding, soluble, 3 (galactin
														3)	3)
PKUA	AB004884_at	AB004884	PASS	7	12.29	PASS	8	7	7.13	1.72	1.72			PKU-alpha	PKU-alpha
J05016_rna1	305016_rna1	305016	PASS	8	9.88	PASS	11	8	5.73	1.72	1.72	ERP70	7; 10	protein disulfide isomerase	protein disulfide isomerase
														related protein (calcium-	related protein (calcium-
														binding protein, intestinal-	binding protein, intestinal-
															related)
Y09392_s_at	Y09392_s_at	Y09392	PASS	9	11.67	PASS	13	9	6.77	1.72	1.72	wsl-1		WSL-S2 protein
U23852's_at	U23852_s_at	U23852	PASS	9	66.89	PASS	13	9	38.85	1.72	1.72	lck		p56lck	truncated from of T-
															lymphocyte-specific protein
															tyrosine kinase p56lck,
															this abberant message
															encoding primarily the
															SH3 domains of p56lck
															was observed by northern
															hybridization and PCR
															amplification in poly-A
															selected RNA from two
															human leukemic T-cell
															lines.
P4HB	J02783_at	J02783	PASS	5	30.20	PASS	11	5	17.55	1.72	1.72	P4HB	17q25	procollagen-proline, 2-	procollagen-proline, 2-
														oxoglutarate 4-dioxy-	oxoglutarate 4-dioxy-
														genase (proline 4-	genase (proline 4-
														hydroxylase), beta	hydroxylase), beta
														polypeptide (protein	polypeptide (protein
														disulfide isomerase; thyroid	disulfide isomerase; thyroid
														hormone binding protein	hormone binding protein
														p55)	p55)
DYRK	D86550_at	D86550	PASS	9	18.67	PASS	13	9	10.85	1.72	1.72	hMNB		serine/threonine protein	human homolog of
														kinase	Drosophila mnb (minibrain)
															gene
PSMC1	L02426_at	L02426	PASS	9	25.67	PASS	13	9	14.92	1.72	1.72	PSMC1	19p13.3	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														ATPase, 1	ATPase, 1
CD1D	L38820_at	L38820	PASS	8	12.50	PASS	11	8	7.27	1.72	1.72	CD1D		CD1D antigen
RPL9	U09953_at	U09953	PASS	9	318.56	PASS	13	9	185.46	1.72	1.72	RPL9	4p13	ribosomal protein L9	ribosomal protein L9
U59877_s_at	U59877_s_at	U59877	PASS	6	15.67	PASS	8	6	9.13	1.72	1.72	RAB31		low-Mr GTP-binding	Low Mr GTP-binding
														protein Rab31	protein of the Rab
															subfamily
GALT	M60091_at	M60091	PASS	9	11.44	PASS	9	9	6.67	1.72	1.72	GALT		galactose-1-phosphate
														uridyl transferase
MARS	X94754_at	X94754	PASS	9	13.33	PASS	13	9	7.77	1.72	1.72	MARS	12	yeast methionyl-tRNA	methionine-tRNA
														synthetase homolog	synthetase
S153	L40391_at	L40391	PASS	9	26.44	PASS	12	9	15.42	1.72	1.72
CCNI	D50310_at	D50310	PASS	9	99.33	PASS	13	9	57.92	1.71	1.71			cyclin I
K99_PUML	D43951_at	D43951	PASS	9	12.00	PASS	11	9	7.00	1.71	1.71	KIAA0099			KIAA0099 gene product
SRI	M81637_at	M81637	PASS	8	9.00	PASS	8	8	5.25	1.71	1.71	grancalcin		grancalcin	putative
NDUFS8	U65579_at	U65579	PASS	6	9.00	PASS	8	6	5.25	1.71	1.71	NDUFS8	11q13	NADH dehydrogenase	NADH dehydrogenase
														(ubiquinone) Fe-S protein 8	(ubiquinone) Fe-S protein 8
														(23 kD) (NADH-coenzyme	(23 kD) (NADH-coenzyme,
														Q reductase)	Q reductase)
E_23693	U79254_at	U79254	PASS	9	20.56	PASS	13	9	12.00	1.71	1.71
K272_HYPC	D87462_at	D87462	PASS	6	11.50	PASS	7	6	6.71	1.71	1.71	BAP1	3p21.31-p21.2	BRCA1 associated protein-	BRCA1 associated protein-
														1 (ubiquitin carboxy-	1 (ubiquitin carboxy-
														terminal hydrolase)	terminal hydrolase)
A4	L09604_at	L09604	PASS	9	80.22	PASS	13	9	46.85	1.71	1.71	PLP2	Xp11.23	proteolipid protein 2	proteolipid protein 2
														(colonic epithelium-	colonic epithelium-
														enriched)	enriched)
SLC6A8_rna1	U6341_rna1	U36341	PASS	9	13.11	PASS	9	9	7.67	1.71	1.71	SLC6A8		creatine transporter
TFAP3D	U91930_at	U91930	PASS	9	20.11	PASS	13	9	11.77	1.71	1.71	ADTD	19p13.3	adaptin, delta	adaptin, delta
SEPW1	U67171_at	U67171	PASS	9	25.89	PASS	13	9	15 15	1.71	1.71	SEPW1		selenoprotein W, 1	selenoproein W, 1
P542	L38696_at	L38696	PASS	6	17.33	PASS	13	6	10.15	1.71	1.71			autoantigen p542	huRaly; hnRNP C3, N-
															terminus similar to
															huRNP C
ERCC5	X69978_at	X69978	PASS	8	12.88	PASS	9	8	7.56	1.70	1.70	ERCC5	13q22-q34	XPG complementing	excision repair cross-
														protein	complementing rodent
															repair deficiency,
															complentation group 5,
															(xeroderma pigmentosum,
															complementation group G
															(Cockayne syndrome)
ARF4	M36341_at	M36341	PASS	9	17.56	PASS	13	9	10.31	1.70	1.70	ARF4		ADP-ribosylation factor 4	ADP-ribosylation factor 4
POLRMP	U75370_at	U75370	PASS	7	10.43	PASS	8	7	6.13	1.70	1.70	POLRMT	19p13.3	mitochondrial RNA	polymerase (RNA)
														polymerase	mitochondrial (DNA
															directed
LUMAN	AF009368_at	AF009368	PASS	7	17.29	PASS	11	7	10.18	1.70	1.70			Luman	basic leucine zipper
															(BZIP) protein; binds to
															herpes simplex virus VP16-
															associated host cellular
															factor (HCF); member of
															CREB/ATF protein family,
															mouse LZIP homolog
SAP61	U08815_at	U08815	PASS	8	10.75	PASS	9	8	6.33	1.70	1.70	SAP 61	SAP 61	similar to yeast PRP9,
															Swiss-Prot Accession
															Number P19736
ITK	L10717_at	L10717	PASS	9	15.67	PASS	13	9	9.23	1.70	1.70			tyrosine kinase	2024-2555 unique domain;
															2556-2708 SH3 domain;
															2750-3044 Sh2 domain
															binds phosphotyrosine-
															containing proteins);
															3095-3884 kiase domain
															(phophorylation of tyrosine
															residues); putative
AFFX-HUM	AFFX-HUM	AFFX-HUM	PASS	7	14.14	PASS	9	7	8.33	1.70	1.70
EIF23	U94855_at	U94855	PASS	9	60.00	PASS	13	9	35.38	1.70	1.70	EIF3S5		eukaryotic translation	eukaryotic translation
														initiation factor 3,	initiation factor 3,
														subunit 5 (epsilon, 47 kD)	subunit 5 (epsilon, 47 kD)
U50079_s_at	U50079_s_at	U50079	PASS	7	22.43	PASS	13	7	13.23	1.70	1.70			histone deacetylase HD1	similar to S. cerevisiae
															RPD3, a global transcrip-
															tional regulator; trapoxin
															receptor
ISG20	U88964_at	U88964	PASS	9	49.00	PASS	13	9	28.92	1.69	1.69	ISG20	15q26	interferon stimulated gene	interferon stimulated gene
														(20 kD)	(20 kD)
CD81	M33680_at	M33680	PASS	9	76.22	PASS	13	9	45.00	1.69	1.69	CD81	11p15	CD81 antigen (target of	CD81 antigen (target of
														antiproliferative antibody 1)	antiproliferative antibody 1)
U19713_s_at	U19713_s_at	U19713	PASS	9	45.33	PASS	13	9	26.77	1.69	1.69	IRT-1		interferon gamma	interferon gamma
														responsive transcript	responsive transcript
APRT_rna1	Y00486_rna1	Y00486	PASS	9	43.22	PASS	13	9	25.54	1.69	1.69	APRT	16q24	adenine phosphoribosyl-	adenine phosphoribosyl-
														transferase	transferase
NF45	U10323_at	U10323	PASS	9	24.33	PASS	13	9	14.38	1.69	1.69	ILF2		interleuken enhancer	interleuken enhancer
														binding factor 2, 45 kD	binding factor 2, 45 kD
IP30	J03909_at	J03909	PASS	9	159.78	PASS	13	9	94.54	1.69	1.69				gamma-interferon-inducible
															protein precursor
ORF	M68864_at	M68864	PASS	9	36.78	PASS	13	9	21.77	1.69	1.69				ORF
RPL27A	U14968_at	U14968	PASS	9	369.33	PASS	13	9	218.85	1.69	1.69	RPL27A	11	ribosomal protein L27a	ribosomal protein L27a
RENT1	D86988_at	D86981	PASS	9	27.11	PASS	13	9	16.08	1.69	1.69	RENT1	19	regulator of nonsense	regulator of nonsense
														transcripts 1	transcripts 1
MOV34L	D50063_at	D50063	PASS	9	19.11	PASS	12	9	11.33	1.69	1.69	PSMD7	16q23-q2	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase, 7 (Mov 34	non-ATPase, 7 (Mov 34
														homolog)	homolog)
FHL1	U60115_at	U60115	PASS	9	10.89	PASS	13	9	6.46	1.69	1.69	FHl.1	Xg27.2	four and a half LIM	four and a half LIM
														domains 1	domains 1
COX5B	M19961_at	M19961	PASS	8	35.88	PASS	13	8	21.31	1.68	1.68	COX5B	2cen-q13	cytochrome c oxidase	sytochrome c oxidase
														subunit Vb	subunit Vb
EIF4132	U73824_at	U73824	PASS	9	48.56	PASS	13	9	28.85	1.68	1.68	EIF4G2	11p15	eukaryotic translation	eukaryotic translation
														initiation factor 4 gamma, 2	initiation factor 4 gamma, 2
K70_KARS	D31890_at	D31890	PASS	9	31.44	PASS	13	9	18.69	1.68	1.68	KIAA0070			similar to lysyl tRNA
															synthetase.
CDC37L	U43077_at	U43077	PASS	9	24.44	PASS	13	9	14.54	1.68	1.68			CDC37 homolog	similar to S. cerevisiae
															Cdc37p
SSBP	M94556_at	M94556	PASS	9	23.78	PASS	13	9	14.15	1.68	1.68	SSBP	7q34	single-stranded DNA-	single-stranded DNA-
														binding protein	binding protein
RGS3	U27655_at	U27655	PASS	8	8.25	PASS	12	8	4.92	1.68	1.68			RGP3
K190_UBP3	D80012_at	D80012	PASS	8	14.25	PASS	12	8	8.50	1.68	1.68	USP10		ubiquitin specific
															protease 10
FLII_rna1	U80184_rna1	U80184	PASS	7	18.43	PASS	13	7	11.00	1.68	1.68	FLII	17p11.2	flightless I (Drosophilia)	flightless I (Drosophilia)
														homolog	homolog
AIM1	U83115_at	U83115	PASS	9	20.44	PASS	13	9	12.23	1.67	1.67	AIM1	6q21	non-lens beta gamma-	absent in melanoma 1
														crystallin like protein
TATSF1	U76992_at	U76992	PASS	7	10.29	PASS	13	7	6.15	1.67	1.67	Tat-SF1		Tat-SF1	similar to EWS and
														FUS/TLS77
K235_K99	D87078_at	D87078	PASS	5	23.40	PASS	13	5	14.00	1.67	1.67	KIAA0235			similar to D. melanogaster
															pumilio protein (522026);
															similar to human
															KIAA0099 protein
															(D43951)
HSPB1	U12404_at	U12404	PASS	9	340.44	PASS	13	9	203.69	1.67	1.67			Csa-19
K205_COSC	D86960_at	D86960	PASS	9	9.89	PASS	12	9	5.92	1.67	1.67	KIAA0205			KIAA0205 gene product
CTBP1	U37408_at	U37408	PASS	9	19.67	PASS	13	9	11.77	1.67	1.67	CTBP1	4p16	C-terminal binding	C-terminal binding
														protein 1	protein 1
EBVSRAP	HG662-HT6	HG662-HT	PASS	9	150.89	PASS	13	9	90.38	1.67	1.67
ARHGDIB	L20688_at	L20688	PASS	9	315.00	PASS	13	9	188.69	1.67	1.67	ARHGDIB	12p12.3	GDP dissociation inhibitor	GDP dissociation inhibitor
LTA4H	J03459_at	J03459	PASS	9	78.78	PASS	13	9	47.23	1.67	1.67	LTA4H	12q22	leukotriene A4 hydrolase	leukotriene A4 hydrolase
ELP1	M88458_at	M88458	PASS	9	12.44	PASS	13	9	7.46	1.67	1.67
NP220	D83032_at	D83032	PASS	9	10.00	PASS	13	9	6.00	1.67	1.67			nuclear protein, NP220	unsure initial methyonine;
															putative
TAP	U80073_at	U80073	PASS	9	14.44	PASS	12	9	8.67	1.67	1.67	TAP		tip associating protein
EV12B	M60830_at	M60830	PASS	8	20.25	PASS	13	8	12.15	1.67	1.67				open reading frame
K249_K188	D87436_at	D87436	PASS	8	8.88	PASS	12	8	5.33	1.66	1.66	K1AA0249			KIAA0249 gene product
CIT987SK'rna	U95740'rna1	U95740	PASS	9	14.00	PASS	12	9	8.42	1.66	1.66	A-362G6.1		Unknown gene product
NASP	M97856_at	M97856	PASS	8	12.88	PASS	8	8	7.75	1.66	1.66	NASP		nuclear autoantigenic	nuclear autoantigenic
														sperm protein (histone-	sperm protein (histone-
														binding)	binding)
K94_MEAP1	D42084_at	D42084	PASS	8	11.63	PASS	13	8	7.00	1.66	1.66	KIAA0094			KIAA0094 gene product
															is related to S.
															cerevisiae methionine
															aminopeptidase.
L10333_s_at	L10333_s_at	L10333	PASS	5	9.80	PASS	11	5	5.91	1.66	1.66	NSP		nueroendocrine-specific
														protein A
H2A1L	U90551_at	U90551	PASS	9	42.22	PASS	13	9	25.46	1.66	1.66	H2A/l		histone 2A-like protein
K49_IAI3B	D30756_at	D30756	PASS	9	10.44	PASS	13	9	6.31	1.66	1.66	KIAA0049			KIAA0049 gene product
DNAPK	U85611_at	U85611	PASS	9	35.89	PASS	13	9	21.69	1.65	1.65	KIP		DNA-PK interaction
														protein
D13720 s_at	D13720 s_at	D13720	PASS	8	14.25	PASS	13	8	8.62	1.65	1.65			ITK	originally named lyk
K241_COST	D63877_at	D63877	PASS	6	8.50	PASS	7	6	5.14	1.65	1.65	KIAA0157			KIAA0157 gene product is
															novel.
RCH1	U28386_at	U28386	PASS	7	8.86	PASS	11	7	5.36	1.65	1.65	KPNA2	17q23.1-q23.3	karyopherin alpha 2	karyopherin alpha 2
														(RAG cohort 1, importin	(RAG cohort 1, importin
														alpha 1)	alpha 1)
K37 ADCY	D25538_at	D25538	PASS	9	17.78	PASS	13	9	10.77	1.65	1.65	ADCY7	16q12-q13	adenylate cyclse 7	adenlate cyclase 7
RS1	M24194_at	M24194	PASS	9	326.89	PASS	13	9	198.15	1.65	1.65	H12-3		MHC B complex protein	homologue, putative
														12.3
IEFSSP95O2	L07758_at	L07758	PASS	9	9.44	PASS	11	9	5.73	1.65	1.65			IEF SSP 9502	nuclear phosphoprotein
															(similarity to Saccharomyes
															cerevisiae PWP1 protein)
K53'CDC42	D29642_at	D29642	PASS	9	27.89	PASS	12	9	16.92	1.65	1.65	K1AA0053			KIAA0053 gene product
ABR	U01147_at	U01147	PASS	9	9.89	PASS	12	9	6.00	1.65	1.65	ABR	17p13.3	guanine nucleotide	active BCR-related
														regulatory protein	gene
SET	M93651_at	M93651	PASS	9	24.33	PASS	13	9	14.77	1.65	1.65	SET	9q34	SET translocation	SET translocation
														(myeloid leukemia-	(myeloid leukemia-
														associated)	associated)
K38	D26068_at	D26068	PASS	9	5422	PASS	13	9	32.92	1.65	1.65	WBSCR1	7q11.23		Williams-Beuren syndrome
															chromosome region 1
PTPCAAX1	U48296_at	U48296	PASS	7	8.43	PASS	8	7	5.13	1.64	1.64	PTP4A1	6q12	Protein tyrosine	protein tyrosine
														phosphatase IVA1	phosphatase type IVA,
															member 1
U01691_s_at	U01691_s_at	1301691	PASS	9	17.44	PASS	13	9	10.62	1.64	1.64	ANX5	4q28-q32	annexin V	annexin V (endonexin II)
M16591_s_at	M16591_s_at	M16591	PASS	9	29.44	PASS	13	9	17.92	1.64	1.64	HCK	20q11-q12	hemopoietic cell kinase	hemopoietic cell kinase
KI02_SPC25	D14658_at	D14658	PASS	9	22.11	PASS	13	9	13.46	1.64	1.64	KIAA0102			KIAA0102 gene product
E_23815	U90916_at	U90916	PASS	8	11.88	PASS	13	8	7.23	1.64	1.64
NFE2L2	S74017_at	S74017	PASS	5	11.00	PASS	10	5	6.70	1.64	1.64	Nrf2		Nrf2	NF-E2-like basic leucine
															zipper transcriptional
															activator; This sequence
															comes from FIG. 1
MTH1	D16581_at	D16581	PASS	8	17.00	PASS	11	8	10.36	1.64	1.64	MTH1	7p22	mutT (E. coli) human
															homolog (8-oxo-7,8-
															dihydroguanosine tri-
															phosphate
FKHR	U36922_at	U36922	PASS	9	17.78	PASS	13	9	10.85	1.64	1.64
K105	D14661_at	D14661	PASS	7	8.57	PASS	13	7	5.23	1.64	1.64	KIAA0105	6	gene predicted from	gene predicted from
														cDNA with a complete	cDNA with a complete
														coding	coding
CAST	D16217_at	D16217	PASS	9	20.67	PASS	13	9	12.62	1.64	1.64	CAST	5q14-q22	calpastatin	calpastatin
K209_DODK	D86964_at	D86964	PASS	9	20.78	PASS	13	9	12.69	1.64	1.64	DOCK2			dedicator of cyto-kinesis 2
X91911_s_at	X91911_s_at	X91911	PASS	8	21.13	PASS	13	8	12.92	1.63	1.63	rtvp-1
DAPM	AFFX-DapX	AEFX-DapX	PASS	9	505.56	PASS	13	9	309.31	1.63	1.63
TCF7	X59871_at	X59871	PASS	9	45.22	PASS	13	9	27.69	1.63	1.63	TCP7	5q31	transcription factor 7	transcription factor 7
														(T-cell specific, HMG-box)	(T-cell specific, HMG-box)
RPS13	HG821-HT82	HG821-HT	PASS	9	277.00	PASS	13	9	169.77	1.63	1.63
X77588_s_at	X77588_s_at	X77588	PASS	8	10.88	PASS	12	8	6.67	1.63	1.63	ARD1	Xq28	ARD1 N-acetyl transferase	N-acetyltransferase,
														homologue	homolog of S. cerevisiae
															ARD1
V00599_s_at	V00599_s_at	V00599	PASS	9	49.78	PASS	13	9	30.54	1.63	1.63				beta-tubulin
TP53	M22898_at	M22898	PASS	7	8.00	PASS	11	7	4.91	1.63	1.63	TP53	17p13.1	tumor protein p53	tumor protein p53 (Li-
															Fraumeni syndrome)
U31903_a_at	U31903_s_at	U31903	PASS	7	16.14	PASS	11	7	9.91	1.63	1.63	CREBL1	6p21.3	cAMP responsive elemtn	cAMP responsive element
														binding protein-like 1	binding protein-like 1
SLC1A7	U53347_at	U53347	PASS	7	13.57	PASS	12	7	8.33	1.63	1.63			neutral amino acid
														transporter
D13413_rna1	D13413_rna1	D13413	PASS	9	438.11	PASS	13	9	269.08	1.63	1.63	HNRPU		heterogeneous nuclear	heterogeneous nuclear
														ribonucleoprotein U	ribonucleoprotein U
														(scaffold attachment	(scaffold attachment
														factor A)	factor A)
TGFBI	M77349_at	M77349	PASS	9	42.67	PASS	13	9	26.23	1.63	1.63	TGFBI	5q31	transforming growth factor,	transforming growth factor,
														beta-induced, 68 kD	beta-induced, 68 kD
K122	D50912_at	D50912	PASS	6	8.33	PASS	8	6	5.13	1.63	1.63	KIAA0122			The KIAA0122 gene
															product is novel.
AES	U04241_at	U04241	PASS	9	65.33	PASS	13	9	40.23	1.62	1.62	AES	19p13.13	amino-terminal enhancer of	amino-terminal enhancer of
															split
MAD3	M69043_at	M69043	PASS	9	41.33	PASS	13	9	25.46	1.62	1.62	NFKBIA	14q13		nuclear factor of kappa
															light polypeptide gene
															enhancer in B-cells
															inhibitor, alpha
NME2	HG1153-HT1	HG1153-HT	PASS	9	42.00	PASS	13	9	25.92	1.62	1.62
K26	D14812_at	D14812	PASS	9	36.44	PASS	12	9	22.50	1.62	1.62	KIAA0026			KIAA0026 gene product
HG4312-HT4	HG4312-HT4	HG4312-HT	PASS	9	48.33	PASS	13	9	29.85	1.62	1.62
TCRG	M30894_at	M30894	PASS	9	19.56	PASS	13	9	12.08	1.62	1.62	CD3G			Ti antigen CD3-associated
															protein precursor
U05572_s_at	U05572_s_at	U05572	PASS	9	27.89	PASS	13	9	17.23	1.62	1.62	MANB	19cen-q13.1	alpha-mannosidase	mannosidase, alpha B,
															lysosomal
M98399_s_at	M938399_s_a	M98399	PASS	8	15.38	PASS	12	8	9.50	1.62	1.62	CD36	7q11.2	CD36 antigen (collagen	CD36 antigen (collagen
														type I receptor, thrombo-	type I receiptor, thrombo-
														spondin receptor)	spondin receptor)
BLVRB	D26308_at	D26308	PASS	9	36.00	PASS	12	9	22.25	1.62	1.62	BLVRB	19q13.1-q13.2	biliverdin reductase B	biliverdin reductase B
														(flavin reductase	(flavin reductase
														(NADPH))	(NADPH))
K147_ADCY	D63481_at	D63481	PASS	7	9.57	PASS	12	7	5.92	1.62	1.62	KIAA0147			The KIAA0147 gene
															product is related to
															adenylyl cyclase.
K115_OLIGT	D29643_at	D29643	PASS	9	26.22	PASS	13	9	16.23	1.62	1.62	KIAA0115			similar to Canis
															oligosaccharyltransferase
															48 kDa subunit (M98392).
RPL11	X79234_at	X79234	PASS	9	299.56	PASS	13	9	185.62	1.61	1.61	RPL11	1	ribosomal protein L11	ribosomal protein L11
HNRPA2B1	M29064_at	M29064	PASS	9	34.00	PASS	13	9	21.08	1.61	1.61	HNRPA2B1	7p15	heterogeneous nuclear	heterogeneous nuclear
														ribonucleoprotein A2/B1	ribonucleoprotein A2/B1
PSM27	AB003177_at	AB003177	PASS	7	16.71	PASS	11	7	10.36	1.61	1.61	PSMD9	12q24.31-	proteasome (prosome,	proteasome (prosome,
													q24.32	macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase,9	non-ATPase, 9
D42040_s_at	D42040_s_at	D42040	PASS	8	20.38	PASS	11	8	12.64	1.61	1.61	KIAA9001			KIAA9001 gene product
ARA9	U78521_at	U78521	PASS	9	54.56	PASS	13	9	33.85	1.61	1.61	AIP	11q13.3	aryl hydrocarbon receptor-	aryl hydrocarbon receptor-
														interacting protein	interacting protein
K245_PRMA	D87432_at	D87432	PASS	8	7.88	PASS	9	8	4.89	1.61	1.61	SLCTA6		solute carrier family 7	solute carrier family 7
														(cationic amino acid	(cationic amino acid
														transporter, y system),	transporter, y system),
														member 6	member 6
GMFB	AB001106_a	AB001106	PASS	7	10.14	PASS	13	7	6.31	1.61	1.61	GMFB		glia maturation factor,	glia maturation factor,
														beta	beta
K136	D50926_at	D50926	PASS	8	11.50	PASS	13	8	7.15	1.61	1.61	KIAA0136			The KIAA0136 gene
															product is novel.
BM11	L13689_at	L13689	PASS	9	9.89	PASS	13	9	6.15	1.61	1.61	BM11	10p13		murine leukemia viral
															(bmi-1) oncogene homolog
MVK	L77213_at	L77213	PASS	6	8.83	PASS	10	6	5.50	1.61	1.61			phosphomevalonate kinase
PNN	U77718_at	U77718	PASS	8	10.50	PASS	13	8	6.54	1.61	1.61	PNN		pinin, desmosome	pinin, desmosome
														associated protein
13KDDAP	U34343_at	U34343	PASS	9	27.67	PASS	13	9	17.23	1.61	1.61			13 kD differentiation-
														associated protein
AF000424_s	AF000424_s	AF000424	PASS	8	68.25	PASS	13	8	42.54	1.60	1.60	LST1			cLST1/C splice variant
U72936_s_at	U72936_s_at	U72936	PASS	8	9.38	PASS	13	8	5.85	1.60	1.60	ATRX		putative DNA dependent	XH2; XNP; alternatively
														ATPase and helicase	spliced product 1, contains
															all exons; translation starts
															in exon 9; ATRX gene
															deposited in GenBank
															Accession Numbers
															U72900-U72935
M36429_s_at	M36429_s_at	M36429	PASS	7	15.29	PASS	13	7	9.54	1.60	1.60				transducin beta-2 subunit
EEF1B1	X60489_at	X60489	PASS	9	134.56	PASS	13	9	84.00	1.60	1.60	EEF1B2	2	eukaryotic translation	eukaryotic translation
														elongation factor 1 beta 2	elongation factor 1 beta 2
CAPZA	U56637_at	U56637	PASS	9	62.33	PASS	13	9	38.92	1.60	1.60			capping protein alpha
														subunit isoform 1
RPL28	U14969_at	U14969	PASS	9	444.22	PASS	13	9	277.62	1.60	1.60	RPL28	19q13.4	ribosomal protein L28	ribosomal protein L28
K208_DISH3	D86963_at	D86963	PASS	6	9.33	PASS	12	6	5.83	1.60	1.60	DVL3	3q27	dishevelled 3 (homologous	dishevelled 3 (homologous
														to Drosophila dsh)	to Drosophila dsh)
COL11A1	J04177_at	J04177	PASS	6	7.00	PASS	8	6	4.38	1.60	1.60	COL11A1	1p21	collagen, type XI, alpha 1	collagen, type XI, alpha 1
PD123	D14878_at	D14878	PASS	8	10.13	PASS	12	8	6.33	1.60	1.60	D123		protein D123	D123 gene product
ATP5G2_rna	X69908_rna1	X69908	PASS	9	48.67	PASS	13	9	30.46	1.60	1.60	ATP5G2	12		ATP synthase, H
															transporting mitochondrial
															F0 complex, subunit c
															(subunit 9), isoform 2
PAP	X76770_at	X76770	PASS	7	10.14	PASS	11	7	6.36	1.59	1.59
U49835_s_at	U49835_s_at	U49835	PASS	9	13.67	PASS	12	9	8.58	1.59	1.59	CHI3L2	1p13.3	YKL-39 precursor	chitinase 3-like 2
CDC10	S72008_at	S72008	PASS	9	32.33	PASS	13	9	20.31	1.59	1.59	CDC10		cell division cycle 10	cell division cycle 10
														(homologus to CDC10 of	(homologous to CDC10 of
														S. cerevisiae)	S. cerevisiae)
IQGAP1	L33075_at	L33075	PASS	9	42.00	PASS	13	9	26.38	1.59	1.59	IQGAP1		ras GTPase-activating-	amino acid feature: IQ
														like protein	calmodulin-binding
															domains, aa 740 . . . 865;
															amino acid feature: N-
															terminal repeats, aa
															210 . . . 680; amino acid
															feature. putative GAP
															catalytic domain, aa
															1000 . . . 1270
IMPDH2_rna	L33842_rna1	L33842	PASS	9	15.89	PASS	13	9	10.00	1.59	1.59	IMPDH2	3p21.2	IMP (inosine mono-	IMP (inosine mon-
														phosphate) dehydrogenase	phosphate) dehydrogenase
														2	2
RAND	D25274_at	D25274	PASS	9	26.33	PASS	13	9	16.62	1.58	1.58
GPS1	U20285_at	U20285	PASS	9	15.11	PASS	13	9	9.54	1.58	1.58	GPS1		G protein pathway	G protein pathway
														suppressor 1	suppressor 1
LYZ_f	J03801_f_at	J03801	PASS	9	176.33	PASS	13	9	111.31	1.58	1.58	LYZ	12	lysozyme	lysozyme (renal
															amyloidosis)
SRD5A1	M32313_at	M32313	PASS	7	8.14	PASS	7	7	5.14	1.58	1.58	SRD5A1	5p15	steroid-5-alpha-	steroid-5-alpha-
														reductase, alpha poly-	reductase, alpha poly-
														peptide 1	peptide 1 (3-oxo-5
															alpha-steroid delta 4-
															dehydrogenase alpha 1)
RPS24L	M81757_at	M81757	PASS	9	420.33	PASS	13	9	265.54	1.58	1.58	RPS19	19q13.2	ribosomal protein S19	ribosomal protein S19
ARC20	AF006087_at	AF006087	PASS	8	19.63	PASS	10	8	12.40	1.58	1.58	ARC20		p20-Arc	20 kD subunit of the
															Arp2/3 protein complex
ARHA	L25080_at	L25080	PASS	9	143.56	PASS	13	9	90.77	1.58	1.58	ARHA	3p21.3	GTP-binding protein	ras homolog gene family,
															member A
RPLP1	M17886_at	M17886	PASS	9	381.67	PASS	13	9	241.38	1.58	1.58	RPLP1		ribosomal protein, large,	ribosomal protein, large,
														P1	P1
PRKAR2B	M31158_at	M31158	PASS	8	17.75	PASS	13	8	11.23	1.58	1.58	PRKAR2B	7q31-qter	protein kinase, cAMP-	protein kinase, cAMP-
														dependent, regulatory,	dependent, regulatory,
														type II, beta	type II, beta
BAG1	Z35491_at	Z35491	PASS	8	9.63	PASS	11	8	6.09	1.58	1.58	BAG1	9p12	BCL2-associated	BCL2-associated
														athanogene	athanogene
RPS20	HG1800-HT1	HG1800-HT	PASS	9	384.89	PASS	13	9	243.62	1.58	1.58
L43575_s_at	L43575_s_at	L43575	PASS	8	10.63	PASS	11	8	6.73	1.58	1.58
CHS1	U67615_at	U67615	PASS	7	10.00	PASS	12	7	6.33	1.58	1.58	CHS1	1q42.1-q42.2	Chediak-Higashi	Chediak-Higashi
														syndrome 1	syndrome 1
RAP1A	M22995_at	M22995	PASS	8	16.13	PASS	13	8	10.23	1.58	1.58	RAP1A	1p13.3	RAP1A, member of RAS	RAP1A, member of RAS
														oncogene family	oncogene family
L04483_s_at	L04483_s_at	L04483	PASS	9	437.33	PASS	13	9	277.77	1.57	1.57	RPS21	20q13.3	ribosomal protein S21	ribosomal protein S21
KSRP	U94832_at	U94832	PASS	9	8.44	PASS	11	9	5.36	1.57	1.57			KSRP	RNA binding protein,
															KH type RNA binding
															domain; alternative
															splicing regulator; coopera-
															tive complex formation
PSMB6	D29012_at	D29012	PASS	9	24.44	PASS	13	9	15.54	1.57	1.57	PSMB6	17p13	proteasome subunit Y	proteasome (prosome,
															macropain) subunit, beta
															type, 6
RLIP76	L42542_at	l42542	PASS	8	11.25	PASS	13	8	7.15	1.57	1.57			RLIP76 protein
LMO2_rna1	X61118_rna1	X61118	PASS	8	15.00	PASS	13	8	9.54	1.57	1.57	TTG-
												2a/RBTN-
												2a
BPGM	X04327_at	X04327	PASS	7	7.86	PASS	11	7	5.00	1.57	1.57	BPGM	7q31-q34	2,3-bisphosphoglycerate	2,3-bisphosphoglycerate
														mutase	mutase
MTHFD	J04031_at	J04031	PASS	7	7.86	PASS	8	7	5.00	1.57	1.57	MTHFD	14q24		5,10-methylenetetrahydro-
															genase, 5,10-methylene-
															tetrahydrofolate cyclo-
															hydrolase, 10-formyltetra-
															hydrofolate synthetase
23KDBP	X56932_at	X56932	PASS	9	454.22	PASS	13	9	289.23	1.57	1.57			23 kD highly basic protein
RPL17	X57959_at	X57959	PASS	9	127.33	PASS	13	9	81.15	1.57	1.57	RPL7	8	ribosomal protein L7	ribosomal protein L7
RPS14_cds2	M13934_cds2	M13934	PASS	9	368.11	PASS	13	9	235.08	1.57	1.57	RPS14		unknown protein	ORF; putative
ESD	M13450_at	M13450	PASS	8	19.88	PASS	13	8	12.69	1.57	1.57	ESD	13q14.1-q14.2		esterase D/formyl-
															glutathione hydrolase
LDLR	L00352_at	L00352	PASS	5	8.00	PASS	9	5	5.11	1.57	1.57	LDLR	19p13.3	low density lipoprotein	low density lipoprotein
														receptor (familial	receptor (familial
														hypercholesterolemia)	hypercholesterolemia)
E_23612	U90902_at	U90902	PASS	9	11.33	PASS	12	9	7.25	1.56	1.56
ADD1SP2	HG651-HT42	HG651-HT	PASS	9	20.89	PASS	13	9	13.38	1.56	1.56
SEC61B	L25085_at	L25085	PASS	9	28.44	PASS	13	9	18.23	1.56	1.56			Sec 61-complex beta-
														subunit
U2AF1	M96982_at	M96982	PASS	9	28.56	PASS	13	9	18.31	1.56	1.56			U2 snRNP auxiliary
														factor small subunit
HLA-DRB5	M3600_F_at	M33600	PASS	9	171.78	PASS	13	9	110.15	1.56	1.56	HLA-DRB5	6p21.3	major histocompatibility	major histocompatibility
														complex, class II, DR	complex, class II, DR
														beta 5	beta 5
XPC	D21089_at	D21089	PASS	7	17.29	PASS	11	7	11.09	1.56	1.56	XPC	3p25	xeroderma pigmentosum,	xeroderma pigmentosum,
														complementation group C	complementation group C
ATIC	D82348'at	D82348	PASS	9	15.33	PASS	13	9	9.85	1.56	1.56	ATIC		5-aminoimidazole-4-	5-aminoimidazole-4-
														carboxamide ribonucleotide	carboxamide ribonucleotide
														formyltransferase/IMP	formyltransferase/IMP
														cyclohydrolase	cyclohydrolase
DNMTN	U50733_at	U50733	PASS	9	15.56	PASS	13	9	10.00	1.56	1.56			dynamitin	similar to GenBank EST
															Accession Number
															T08494; p50 subunit of
															dynactin complex
GBP2	M55543_at	M55543	PASS	9	12.44	PASS	11	9	8.00	1.56	1.56	GBP2		guanylate binding protein 2,	guanylate binding protein 2,
														interferon-inducible	interferon-inducible
RPS12	HG613-HT61	HG613-HT	PASS	9	290.33	PASS	13	9	186.69	1.56	1.56
DNCLI2	U32944_at	U32944	PASS	9	42.67	PASS	13	9	27.46	1.55	1.55	PIN	14q24	dynein, cytoplasmic,	dynein, cytoplasmic
														light polypeptide	light polypeptide
CTCF	U25435_at	U25435	PASS	7	8.29	PASS	12	7	5.33	1.55	1.55	CTCF		CTCF	11-Zn-finger transcription
															factor
GATA3	X58072_at	X58072	PASS	7	8.29	PASS	12	7	5.33	1.55	1.55	hGATA3		hGATA3 transcription
														factor
TRIP3	L40410_at	L40410	PASS	9	11.00	PASS	12	9	7.08	1.55	1.55	TRIP3		thyroid receptor interactor	thyroid hormone receptor
															interactor 3
FIP1	U41654_at	U41654	PASS	9	11.22	PASS	13	9	7.23	1.55	1.55	FIP-1		adenovirus E3-14.7K	putative GTP-binding
														interacting protein 1	protein, homolog of small
															GTPase family members
L25931_s_at	L25931_s_at	L25931	PASS	9	15.78	PASS	12	9	10.17	1.55	1.55	LBR	1q42.1	lamin B receptor	lamin B receptor
TFE3_rna1	X97160_rna1	X97160	PASS	7	9.29	PASS	7	7	6.00	1.55	1.55			TFE3 transcription factor
CYP1B1	U03688_at	U03688	PASS	5	8.40	PASS	7	5	5.43	1.55	1.55	CYP1B1	2p21	cytochrome P450, sub-	chytochrome P450, sub-
														family I (dioxin-inducible),	family I (dioxin-inducible),
														polypeptide 1 (glaucoma 3,	polypeptide 1 (glaucoma 3,
														primary infantile)	primary infantile)
K118_RABB	D42087_at	D42087	PASS	9	9.00	PASS	11	9	5.82	1.55	1.55	KIAA0118			The gene product of
															HA0793 is related to
															Dictyostelium discoideum
															RabB protein.
LDHB_rna1	X13794_rna1	X13794	PASS	9	69.00	PASS	13	9	44.62	1.55	1.55	ldhB		lactate dehydrogenase B
E51	L37368_at	L37368	PASS	8	14.75	PASS	13	8	9.54	1.55	1.55			RNA-binding protein	putative
U04285_s_at	U04285_s_at	U04285	PASS	6	14.50	PASS	13	6	9.38	1.55	1.55	LIPA		lysosomal acid lipase/
														cholesteryl ester hydrolase
QDPR	M16447_at	M16447	PASS	7	7.14	PASS	8	7	4.63	1.54	1.54	QDPR	4p15.3	quinoid dihydropteridine	quinoid dihydropteridine
														reductase	reductase
ATP5	M37104_at	M37104	PASS	9	11.44	PASS	12	9	7.42	1.54	1.54	ATP5	10	ATP synthase, H	ATP synthase, H
														transporting, mitochondrial	transporting, mitochondrial
ATP6E	D49400_at	D49400	PASS	9	33.11	PASS	13	9	21.46	1.54	1.54	ATP6S14	12	ATPase, vacuolar, 14 kD	ATPase, vacuolar, 14 kD
TIS11D	U07802_at	U07802	PASS	9	37.56	PASS	13	9	24.38	1.54	1.54		Tis11d
U70439_s_at	U70439_s_at	U70439	PASS	9	87.67	PASS	13	9	56.92	1.54	1.54			silver-stainable protein	similar to human PHAP12a
														protein SSP29	encoded by GenBank
															Accession Number
															Y07569 and human
															PHAP12b encoded by
															GenBank Accession
															Number Y07570
CIRBP	D78134_at	D78134	PASS	9	53.89	PASS	13	9	35.00	15.4	1.54	CIRBP	19p13.3	cold inducible RNA-	cold inducible RNA-
														binding protein	binding protein
MAD2L1	U68018_at	U68018	PASS	7	9.00	PASS	13	7	5.85	1.54	1.54	hMAD-2		mad protein homolog
RPL30	HG2873-HT3	HG2873-HT	PASS	9	487.44	PASS	13	9	317.15	1.54	1.54
ATP5O	X83218_at	X83218	PASS	9	22.44	PASS	13	9	14.62	1.54	1.54	ATP5O	21q22.1-q22.2	ATP synthase, H	ATP synthase, H
														transporting, mitochondrial	transporting, mitochondrial
														F1 complex, O subunit	F1 complex, O subunit
														(oligomycin sensitivity	(oligomycin sensitivity
														conferring protein)	conferring protein)
RPL26	HG384-HT38	HG384-HT	PASS	9	170.56	PASS	13	9	111.08	1.54	1.54
AC002477_s	AC002477_s	AC002477	PASS	9	13.22	PASS	13	9	8.62	1.53	1.53	ZNF183		zinc-finger protein	match to X98253 (NID
															g2274981) (PID:
															g2274982)
UBECS	U73379_at	U73379	PASS	3	9.20	PASS	10	5	6.00	1.53	1.53			cyclin-selective ubiquitin	UbcH10
														carrier protein
DECR	U49352_at	U49352	PASS	6	10.17	PASS	11	6	6.64	1.53	1.53	DECR	8q21.3	2,4-dienoyl CoA reductase	2,4-dienoyl CoA reductase
X55037_s_at	X55037_s_at	X55037	PASS	7	9.86	PASS	9	7	6.44	1.53	1.53	GATA3	10p15	GATA-binding protein 3	GATA-binding protein 3
IL8RB	L19593_at	L19593	PASS	5	7.80	PASS	10	5	5.10	1.53	1.53	IL8RB	2q35	interleukin 8 receptor, beta	interleukin 8 receptor, beta
TAF2D	U18062_at	U18062	PASS	9	8.67	PASS	12	98	5.67	1.53	1.53	TAFII55		TFIID subunit TAFII55
DBI_rna1	M14200_rna1	M14200	PASS	8	16.00	PASS	13	8	10.46	1.53	1.53	DBI			diazepam binding inhibitor
HG4264-HT4	HG4264-HT4	HG4264-HT	PASS	9	14.11	PASS	13	9	9.23	1.53	1.53
ACO2	U80040_at	U80040	PASS	8	13.75	PASS	13	8	9.00	1.53	1.53	ACO2	22q11.2-	aconitase 2, mitochondrial	aconitase 2, mitochondrial
													113.31
HLAE	X56841_at	X56841	PASS	9	140.78	PASS	13	9	92.31	1.53	1.53	HLA-E		HLA-E
NF2TS_f	HG3236-HT3	HG3236-Ht	PASS	9	44.22	PASS	13	9	29.00	1.52	1.52
ACAT1	HG4073-HT4	HG4073-HT	PASS	9	9.78	PASS	12	9	6.42	1.52	1.52
S75256_s_at	S75256_s_at	S75256	PASS	8	10.25	PASS	11	8	6.73	1.52	1.52	HNL			neutrophil lipocalin
MNDA	M81750_at	M81750	PASS	8	41.13	PASS	13	8	27.00	1.52	1.52	MNDA	1q22	myeloid cell nuclear	myeloid cell nuclear
														differentiation antigen	differentiation antigen
TCRB	M12886_at	M12886	PASS	9	227.67	PASS	13	9	149.69	1.52	1.52	TCRB	7q35	T-cell receptor, beta	T-cell receptor, beta
														cluster	cluster
L09209_s_at	L09209_s_at	L09209	PASS	9	45.89	PASS	13	9	30.23	1.52	1.52	APLP2	111q23-q25	amyloid beta (A4)	amyloid beta (A4)
														precursor-like protein 2	precursor-like protein 2
FTL	M11147_at	M11147	PASS	9	409.56	PASS	13	9	269.92	1.52	1.52	FTL	19q13.3-q13.4	ferritin, ligh polypeptide	ferritin, light polypeptide
ARD1	U14575_at	U14575	PASS	8	8.25	PASS	9	8	5.44	1.52	1.52	PPP1R8	Chr. 1	protein phosphatase 1,	protein phosphatase 1,
														regulatory (inhibitor)	regulatory (inhibitor)
														subunit 8	subunit 8
HLA-A_f	M94880_f'at	M94880	PASS	9	275.11	PASS	13	9	181.69	1.51	1.51
M19311_s_at	M19311_s_at	M19311	PASS	9	108.67	PASS	13	9	71.77	1.51	1.51				calmodulin
M30448_s_at	M30448l s_at	M30448	PASS	9	58.11	PASS	13	9	38.38	1.51	1.51	CSNK2B	6p21-p12		casein kinase 2, beta
															polypeptide
BACTIN3	AFFX-HSAC	AFFX-HSA	PASS	9	385.33	PASS	13	9	254.54	1.51	1.51
M13560_s_at	M13560_s_at	M13560	PASS	9	150.33	PASS	13	9	99.31	1.51	1.51			cell surface glycoprotein	Ia-associated gamma chain
RBL38	Z26876_at	Z26876	PASS	9	308.11	PASS	13	9	203.62	1.51	1.51	RPL38	17	ribosomal protein L38	ribosomal protein L38
CLIC1	U93205_at	U93205	PASS	9	94.22	PASS	13	9	62.31	1.51	1.51	CLIC1		chloride intracellular	chloride intracellular
														channel 1	channel 1
NHC	U90549_at	U90549	PASS	5	12.40	PASS	10	5	8.20	1.51	1.51	NHC		non-histone chromosomal
														protein
NPAT	D83243_at	D83243	PASS	9	9.89	PASS	11	9	6.55	1.51	1.51	NPAT	11q22-q23	nuclear protein, ataxia-	nuclear protein, ataxia-
														telangiectasia locus	telangiectasia locus
NRNPC	M16342'at	M16342	PASS	9	25.44	PASS	13	9	16.85	1.51	1.51	HNRPC		heterogeneous nuclear ribo-	heterogeneous nuclear ribo-
														nucleoprotein C (C1/C2)	nucleoprotein C (C1/C2)
HG1322-HT5	HG1322-HT5	HG1322-HT	PASS	9	49.22	PASS	13	9	32.62	1.51	1.51
SNCA	U46901_at	U46901	PASS	9	8.11	PASS	8	9	5.38	1.51	1.51	SNCA	4q21.3-q22	synuclein, alpha (non A4	synuclein, alpha (non A4
														component of amyloid	component of amyloid
														precursor)	precursor)
K5	D13630_at	D13630	PASS	8	12.75	PASS	11	8	8.45	1.51	1.51	KIAA0005			KIAA0005 gene product
HDAC1	D50405_at	D50405	PASS	9	16.22	PASS	13	9	10.77	1.51	1.51	HDAC1	1p34.1	RPD3 protein	histone deacetylase 1
GJA4	Y08915_at	Y08915	PASS	9	19.11	PASS	13	9	12.69	1.51	1.51	IGBP1	Xq13.1-q13.3	immunoglobulin (CD79A)	immunoglobulin (CD79A)
														binding protein 1	binding protein 1
LUCA15	U23946_at	U23946	PASS	6	9.33	PASS	10	6	6.20	1.51	1.51	LUCA15
VDAC2	L08666_at	L08666	PASS	9	19.89	PASS	13	9	13.23	1.50	1.50	VDAC2	10q22	voltage-dependent anion	voltage-dependent anion
														channel 2	channel 2
M83667_rna1	M83667_rna1	M83667	PASS	9	42.67	PASS	13	9	28.38	1.50	1.50	NF-IL6-		NF-IL6-beta protein
												beta
CII3	U57877_at	U57877	PASS	5	14.80	PASS	13	5	9.85	1.50	1.50	SDHC	1q21	succinate dehydrogenase	succinate dehydrogenase
														complex, subunit C,	complex, subunit C,
														integral membrane	integral membrane
														protein, 15 kD	protein, 15 kD
U89922_s_at	U89922_s_at	U89922	PASS	9	143.56	PASS	13	9	95.54	1.50	1.50	LTB	6p21.3	lymphotoxin B	lymphotoxin beta (TNF
															superfamily, member 3)
LYZ_rna1_f	X14008_rna1	X14008	PASS	9	159.22	PASS	13	9	106.00	1.50	1.50			lysozyme	Protein sequence is in
															conflict with the
															conceptual translation
NDUFV2	M22538_at	M22538	PASS	8	28.88	PASS	13	8	19.23	1.50	1.50	NDUFV2	18p11.31-	NADH-ubiquinone	NADH dehydrogenase
													p11.2	reductase	(ubiquninone) flavoprotein
															2 (24 kD)
L05072_s_at	L05072_s_at	L05072	PASS	9	17.56	PASS	13	9	11.69	1.50	1.50	IRF1	5q23-q31	interferon regulatory factor	interferon regulatory factor
														1	1
K247	D87434_at	D87434	PASS	8	10.63	PASS	13	8	7.08	1.50	1.50	KIAA0247			KIAA0247 gene product
RPS10	U14972_at	U14972	PASS	9	350.00	PASS	13	9	233.31	1.50	1.50	RPS10	6	ribosomal protein S10	ribosomal protein S10
NOT56L	Y09022_at	Y09022	PASS	8	12.13	PASS	12	8	8.08	1.50	1.50	not		Not56-like protein
BTG1	X61123_at	X61123	PASS	9	54.11	PASS	13	9	36.08	1.50	1.50	BTG1	12q22	B-cell translocation	B-cell translocation
														gene 1, anti-proliferative	gene 1, anti-proliferative
HMOX1	X06985_at	X06985	PASS	8	32.63	PASS	13	8	21.77	1.50	1.50	HMOX1	22q12	heme oxygenase	heme oxygenase
														(decycling) 1	(decycling) 1
RPS29	U14973_at	U14973	PASS	9	390.44	PASS	13	9	260.54	1.50	1.50	RPS29	14	ribosomal protein S29	ribosomal protein S29
PSMHSC7	D26599_at	D26599	PASS	9	24.22	PASS	12	9	16.17	1.50	1.50	PSMB2	1p34.2	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, beta	macropain) subunit, beta
														type, 2	type, 2
SPTBN1	M96803_at	M96803	PASS	5	10.60	PASS	13	5	7.08	1.50	1.50	SPTBN1	2p21	spectrin, beta, non-	spectrin, beta, non-
														erythrocytic 1	erythrocytic 1
K98_TCP1	D43950_at	D43950	PASS	8	17.63	PASS	13	8	11.77	1.50	1.50	KIAA0098			KIAA0098 is a human
															counterpart of mouse
															chaperonin containing
															TCP-1 gene.
K137_COSC	D50927_at	D50927	PASS	8	10.25	PASS	13	8	6.85	1.50	1.50	KIAA0137			KIAA0137 gene product
PAK1	U24152_at	U24152	PASS	9	13.22	PASS	12	9	8.83	1.50	1.50	PAK1	11q13-q14	p21-Cdc42/Rac1-activated	p21-Cdc42/Rac1-activated
														kinase 1 (yeast Ste20-	kinase 1 (yeast Ste20-
														related)	related)
U76764_s_at	U76764_s_at	U76764	PASS	9	38.67	PASS	13	9	25.85	1.50	1.50	CD97	19p13	CD97 antigen	CD97 antigen
X65965_s_at	X65965_s_at	X65965	PASS	9	19.44	PASS	13	9	13.00	1.50	1.50
HCPA78L	S73591_at	S73591	PASS	9	350.56	PASS	13	9	234.46	1.50	1.50	brain-		VDUP1	1,25-dihydroxyvitamin D-3
												HHCPA78			up-regulated. This sequence
												HHCPA78			comes from FIG. 2. Protein
												homolog			sequence is in conflict with
															the conceptual translation;
															mismatch (26K-&get; R)
S79873_s_at	S79873_s_at	S79873	PASS	7	7.29	PASS	8	7	4.88	1.49	1.49	LAMP2	Xq24	lysosomal-associated	lysosomal-associated
														membrane protein 2	membrane protein 2
L03411_s_at	L03411_s_at	L03411	PASS	9	10.00	PASS	13	9	6.69	1.49	1.49	RD	1pter-p22.1	Radin blood group	Radin blood group
RPS27	HG3214-HT3	HG3214-HT	PASS	9	438.11	PASS	13	9	293.46	1.49	1.49
COX8_rna1	J04823_rna1	J04823	PASS	9	80.33	PASS	13	9	53.85	1.49	1.49	COX8	11q12-q13	cytochrome c oxidase	cytochrome c oxidase
														subunit VIII	subunit VIII
K127	D50917_at	D50917	PASS	7	8.29	PASS	9	7	5.56	1.49	1.49	KIAA0127			KIAA0127 gene product
M36284_s_at	M36284_s_at	M36284	PASS	9	28.33	PASS	13	9	19.00	1.49	1.49	GYPC	2q14-q21	glycophorin C (Gerbich	glycophorin C (Gerbich
														blood group)	blood group)
NOF1	U39400_at	U39400	PASS	8	11.25	PASS	11	8	7.55	1.49	1.49	C11orf4	11q13	NOF1	chromosome 11 open
															reading frame 4
WTRP	HG3549-HT3	HG3549-HT	PASS	9	410.22	PASS	13	9	275.23	1.49	1.49
NELRP2	D83018_at	D83018	PASS	9	18.22	PASS	13	9	12.23	1.49	1.49			nel-related protein 2	NRP2
PSM445	AB003102_at	AB003102	PASS	7	13.57	PASS	9	7	9.11	1.49	1.49	PSMD11		proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase, 11	non-ATPase, 11
UDPPH	U27460_at	U27460	PASS	9	12.22	PASS	9	9	8.22	1.49	1.49			uridine diphosphoglucose	similar to uridine di-
														pyrophosphorylase	phosphoglucose pyro-
															phosphorylase in human
															liver, Swiss-Prot
															Accession Number
															Q07131; the 5UTR and
															3UTR of this clone are
															completely different from
															those of the liver form
DFS70	U94319_at	U94319	PASS	9	12.00	PASS	13	9	8.08	1.49	1.49	P52/P75		transcriptional coactivator	transcriptional coactivator
														p52/p75	p52/p75
HRG4	U40998_at	U40998	PASS	8	11.75	PASS	12	8	7.92	1.48	1.48	UNC119	17q11.2	retinal protein	unc119 (C. elegans)
															homolog
P43LSB	S75463_at	S75463	PASS	9	29.11	PASS	13	9	19.62	1.48	1.48	TUFM	16p11.2	Tu translation elongation	Tu translation elongation
														factor, mitochondrial	factor, mitochondrial
RPL18AH	L11566_at	L11566	PASS	9	309.00	PASS	13	9	208.23	1.48	1.48	RPL18		ribosomal protein L18	ribosomal protein L18
ATPA	D14710_at	D14710	PASS	9	90.22	PASS	13	9	60.85	1.48	1.48	ATP5A1	18q12-q21	ATP synthase, II	ATP synthase, H
														transporting, mitochondrial	transporting, mitochondrial
														F1 complex, alpha subunit,	F1 complex, alpha subunit,
														isoform 1, cardiac muscle	isoform 1, cardiac muscle
K261_SIS	D87450_at	D87450	PASS	9	8.67	PASS	13	9	5.85	1.48	1.48	KIAA0261			Similar to D. melanogaster
															parallel sister chromatids
															protein
HBC647	U68494_at	U68494	PASS	7	8.00	PASS	10	7	5.40	1.48	1.48
OAZ	D78361_at	D78361	PASS	9	383.22	PASS	13	9	258.69	1.48	1.48				ORF1
RPL32	X03342_at	X03342	PASS	9	420.11	PASS	13	9	283.85	1.48	1.48	RPL32	3q13.3-q21	ribosomal protein L32	ribosomal protein L32
U19247_rna1	U19247_rna1	U19247	PASS	9	14.11	PASS	13	9	9.54	1.48	1.48	IFNGR1	6q23-q24	interferon gamma receptor	interferon gamma receptor
														1	1
SATB1	M97287_at	M97287	PASS	9	19.78	PASS	13	9	13.38	1.48	1.48	SATB1	3p23	special AT-rich sequence	special AT-rich sequence
														binding protein 1 (binds	binding protein 1 (binds
														1 (binds to nuclear matrix/	1 (binds to nuclear matrix/
														scaffold-associating	scaffold-associating
														DNA's)	DNA's)
CIT987SK_rn	U96629_rna2	U96629	PASS	8	8.13	PASS	8	8	5.50	1.48	1.48	2A8.2		unknown protein
														CIT987SK_2A8_1
HG1471-HT3	HG1471-HT3	HG1471-HT	PASS	7	7.71	PASS	9	7	5.22	1.48	1.48
CD48	M37766_at	M37766	PASS	9	121.67	PASS	13	9	82.38	1.48	1.48	CD48	1q21.3-q22	CD48 antigen (B-cell	CD48 antigen (B-cell
														membrane protein)	membrane protein)
HNRPA1_rna	X12671_rna1	X12671	PASS	9	87.11	PASS	13	9	59.00	1.48	1.48			hnrnp a1 protein
UBE2N	D83004_at	D83004	PASS	9	9.89	PASS	10	9	6.70	1.48	1.48	UBE2N		ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E2N (homologous	enzyme E2N (homologous
														to yeast UBC13)	to yeast UBC13)
GTF2A2	U14193_at	U14193	PASS	8	11.13	PASS	13	8	7.54	1.48	1.48	GTF2A1		general transcription	general transcription
														factor IIA, 1 (37 kD and	factor IIA, 1 (37 kD and
														19 kD subunits)	19 kD subunits)
T1227H	D50525_at	D50525	PASS	9	9.44	PASS	10	9	6.40	1.48	1.48
UGALT	D87989_at	D87989	PASS	7	13.14	PASS	11	7	8.91	1.48	1.48			UGTrell	highly similar to UDP-N-
															acetylglucosamine
														transporter of K. lactis
SAP145	U41371_at	U41371	PASS	9	17.78	PASS	11	9	12.09	1.47	1.47	SAP 145		spliceosome associated
														protein
CMKRL1	U20350_at	U20350	PASS	9	63.78	PASS	13	9	43.38	1.47	1.47	CX3CR1	3p21	chemokine (C-X3-C)	chemokine (C-X3-C)
														receptor 1	receptor 1
RPL27	L19527_at	L19527	PASS	9	320.89	PASS	13	9	218.31	1.47	1.47	RPL27	17	ribosomal protein L27	ribosomal protein L27
SPTAN1	J05243_at	J05243	PASS	8	8.00	PASS	9	8	5.44	1.47	1.47	SPTAN1	9q33-q34	spectrin, alpha, non-	spectrin, alpha, non-
														erythrocytic 1 (alpha-	erythrocytic 1 (alpha-
														fodrin)	fodrin)
G22P1	M30938_at	M30938	PASS	9	19.78	PASS	13	9	13.46	1.47	1.47				Ku (p70/p80) subunit
MCP	X59405_at	X59405	PASS	8	9.38	PASS	13	8	6.38	1.47	1.47
K264	D87453_at	D87453	PASS	5	7.60	PASS	11	5	5.18	1.47	1.47	KIAA0264
SRP14	U07857_at	U07857	PASS	9	47.78	PASS	13	9	32.62	1.46	1.46	SRP14	15q22	signal recognition particle	signal recognition particle
														14 kD (homologous Alu	14 kD (homologus Alu
														RNA-binding protein)	RNA-binding protein)
K111_NUK3	D21853_at	D21853	PASS	9	16.00	PASS	13	9	10.92	1.46	1.46	KIAA0111			KIAA0111 gene product
IF127SEP	J04164_at	J04164	PASS	9	227.56	PASS	13	9	155.38	1.46	1.46	IF117		interferon-induced protein	interferon-induced protein
														17	17
RPL35	U12465_at	U12465	PASS	9	268.44	PASS	13	9	183.31	1.46	1.46			ribosomal protein L35
CCT6	L27706_at	L27706	PASS	7	9.57	PASS	13	7	6.54	1.46	1.46	CCT6		chaperonin containing T-	chaperonin containing T-
														complex subunit 6	complex subunit 6
FNTA	L10413_at	L10413	PASS	9	34.33	PASS	13	9	23.46	1.46	1.46			farnesyl-protein transferase
														alpha-subunit
RPS9	U14971_at	U14971	PASS	9	277.78	PASS	13	9	189.85	1.46	1.46	RPS9	19q13.4	ribosomal protein S9	ribosomal protein S9
U09510_s_at	U09510_s_at	U09510	PASS	9	8.33	PASS	10	9	5.70	1.46	1.46	GARS	7p15	glycyl-tRNA synthetase	glycyl-tRNA synthetase
PECAM1	L34657_at	L34657	PASS	8	18.75	PASS	12	8	12.83	1.46	1.46	PECAM1	17q23	platelet/endothelial cell	platelet/endothelial cell
														adhesion molecule	adhesion molecule
														(CD31	(CD31 antigen)
NPC1	AF002020_at	AF002020	PASS	5	8.60	PASS	9	5	5.89	1.46	1.46	NPC1	18	Niemann-Pick disease,	Niemann-Pick disease,
														type C1	type C1
HSP40	D85429_at	D85429	PASS	9	21.89	PASS	13	9	15.00	1.46	1.46	HSPF1		heat shock protein 40	Hsp40; Similar to bacterial
															DnaJ heat shokc protein
PP3CB	S46622_at	S46622	PASS	5	6.40	PASS	10	5	4.40	1.45	1.45	calcineurin		calcineurin A catalytic	This sequence comes from
												A catalytic		subunit	FIG. 1; calmodulin-
												subunit,			dependent protein
												calmodulin-			protein phosphatase
												dependent			catalytic subunit; CaM-PrP
												protein			catalytic subunit
												phosphatase
												catalytic
												subunit,
												CaM-PrP
												catalytic
												subunit
ZPK	U07358_at	U07358	PASS	7	8.86	PASS	11	7	6.09	1.45	1.45	ZPK	12q13	serine/threonine protein	zipper (leucine) protein
														kinase	kinase
RPL12	L06505_at	L06505	PASS	9	221.67	PASS	13	9	152.46	1.45	1.45	RPL12		ribosomal protein L12	ribosomal protein L12
MMP1	M63483_at	M63483	PASS	5	12.60	PASS	12	5	8.67	1.45	1.45
U45328_s_at	U45328_s_at	U45328	PASS	6	16.33	PASS	12	6	11.25	1.45	1.45	UBE21	16p13.3	ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E21 (homologous	enzyme E21 (homologous
														to yeast UBC9)	to yeast UBC9)
ACTN1	M95178_at	M95178	PASS	7	12.71	PASS	13	7	8.77	1.45	1.45	ACTN1	14q24	actinin, alpha 1	actinin, alpha 1
SFRS4	L14076_at	L14076	PASS	9	11.11	PASS	12	9	7.67	1.45	1.45			pre-mRNA splicing factor	SR protein family member;
															member; SR domain:
															(bp.583 . . . 1529); RNA
															binding domains: RNP-2
															(bp. 57 . . . 80) and RNP-1
															(bp. 150 . . . 173)
D12775_s_at	D12775_s_at	D12775	PASS	9	7.11	PASS	11	9	4.91	1.45	1.45	AMPD3	11pter-p13	adenosine monophosphate	adenosine monophosphate
														deaminase (isoform E)	deaminase (isoform E)
PF4V1_rna1	M26167_rna1	M26167	PASS	6	7.50	PASS	11	6	5.18	1.45	1.45	PF4var1		platelet factor 4	precursor protein
ANX4	M82809_at	M82809	PASS	6	7.83	PASS	12	6	5.42	1.45	1.45	ANX4	2p13	annexin IV	annexin IV (placental
															anticoagulant protein II)
RPL37	HG3364-HT3	HG3364-HT	PASS	9	405.56	PASS	13	9	280.62	1.45	1.45
HLADRA	X00274_at	X00274	PASS	9	327.33	PASS	13	9	226.54	1.44	1.44			HLA-DR alpha heavy chain	Protein sequence is in
															conflict with the
															conceptual translation.
CAPZA	U03851_at	U03851	PASS	9	21.56	PASS	13	9	14.92	1.44	1.44			capping protein alpha	similar to chicken alpha
															2 isoform
CMPSIAT	D87969_at	D87969	PASS	9	10.11	PASS	12	9	7.00	1.44	1.44			CMP-sialic acid transporter
ITGB7	S80335_at	S80335	PASS	9	16.44	PASS	13	9	11.38	1.44	1.44	ITGB7	12q13.1	integrin, beta 7	integrin, beta 7
ATP2A2	M23114_at	M23114	PASS	5	6.60	PASS	7	5	4.57	1.44	1.44	ATP2A2	12q23-q24.1	ATPase, Ca transporting,	ATPase, Ca transporting,
														cardiac muscle, slow twitch	cardiac muscle, slow twitch
														2	2
J00105_s_at	J00150_s_at	J00105	PASS	9	422.56	PASS	13	9	292.69	1.44	1.44			beta-2 microglobulin
PSMB10_cds	X71874_cds1	X71874	PASS	9	73.89	PASS	13	9	51.23	1.44	1.44	PSMB10	16q22.1	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, beta	macropain) subunit, beta
														type, 10	type, 10
CLARP	AF005775_at	AF005775	PASS	8	9.00	PASS	12	8	6.25	1.44	1.44	CFLAR	2q33-q34	CASP8 and FADD-like	CASP8 and FADD-like
														apoptosis regulator	apoptosis regulator
NTRK1	X66397l at	X66397	PASS	9	15.22	PASS	12	9	10.58	1.44	1.44	TPR	1	translocated promotor	translocated promoter
														region (to activated	region (to activated
														MET oncogene)	MET oncogene)
TRA2A	U53209_at	U53209	PASS	7	22.14	PASS	10	7	15.40	1.44	1.44	htra-2 alpha		transformer-2 alpha	pre-mRNA processing
															factor
ATP5B	M19483_at	M19483	PASS	9	46.22	PASS	13	9	32.15	1.44	1.44	ATP5B	12p13-pter	ATP synthase, H	ATP synthase, H
														transporting, mitochondrial	transporting, mitochondrial
														F1 complex, beta poly-	F1 complex, beta poly-
														peptide	peptide
RPL30	HG311-HT31	HG311-HT	PASS	9	202.44	PASS	13	9	140.85	1.44	1.44
M36430_s_at	M36430_s_at	M36430	PASS	7	12.71	PASS	13	7	8.85	1.44	1.44	GNB1	1p36.21-36.33		guanine nucleotide binding
															protein (G protein), beta
															polypeptide 1
IGHMBP2	V00563_at	V00563	PASS	9	42.56	PASS	13	9	29.62	1.44	1.44				reading frame (part 8)
															(1 is 2nd base in codon)
RPL17	X55954_at	X55954	PASS	9	294.00	PASS	13	9	204.69	1.44	1.44	RPL23	17q	ribosomal protein L23	ribosomal protein L23
RPL4	D23660_at	D23660	PASS	9	297.78	PASS	13	9	207.46	1.44	1.44	RPL4	15	ribosomal protein L4	ribosomal protein L4
D63861_s_at	D63861_s_at	D63861	PASS	7	7.71	PASS	8	7	5.38	1.44	1.44	hCyP40		cyclophilin 40
ZNF134	U09412_at	U09412	PASS	7	6.86	PASS	9	7	4.78	1.44	1.44	ZNF134	19q13.4	zinc finger protein 134	zinc finger protein 134
														(clone pHZ-15)	(clone pHZ-15)
ATP1B3	U51478_at	U51478	PASS	9	32.11	PASS	13	9	22.38	1.43	1.43	ATP1B3	3q22-q23	ATPase, Na/K	ATPase, Na/K
														transporting, beta 3	transporting, beta 3
														polypeptide	polypeptide
STX4A	U07158_at	U07158	PASS	9	11.22	PASS	12	9	7.83	1.43	1.43	STX4A		syntaxin 4A (placental)	syntaxin 4A (placental)
HO3	U18937_at	U18937	PASS	8	7.88	PASS	10	8	5.50	1.43	1.43	HO3		histidyl-tRNA synthetase
														homologue
CD3Z	J04132_at	J04132	PASS	9	31.56	PASS	13	9	22.08	1.43	1.43	CD3Z	1q22-q25	CD3Z antigen, zeta poly-	CD3Z antigen, zeta poly-
														peptide (TiT3 complex)	peptide (TiT3 complex)
K41_ZNFGC	D26069_at	D26069	PASS	7	8.43	PASS	10	7	5.90	1.43	1.43	KIAA0041
CD79B	M89957_at	M89957	PASS	6	12.33	PASS	11	6	8.64	1.43	1.43	CD79B	17q23	cell surface glycoprotein	CD79B antigen (immuno-
															globulin-associated
															beta)
UQCRFS1	L32977_at	L32977	PASS	9	27.22	PASS	13	9	19.08	1.43	1.43	UQCRFS1		Rieske Fe-S protein
PHC	X60036_at	X60036	PASS	9	57.89	PASS	13	9	40.62	1.43	1.43	PHC	12	phosphate carrier,	phosphate carrier,
														mitochondrial	mitochondrial
RPS16	M60854_at	M60854	PASS	9	411.67	PASS	13	9	289.15	1.42	1.42	RPS16	19q	ribosomal protein S16	ribosomal protein S16
TMSB4	M17733_at	M17733	PASS	9	430.44	PASS	13	9	302.69	1.42	1.42	TMSB4Y	Y	thymosin, beta 4, Y	thymosin, beta 4, Y
														chromosome	chromosome
HMGCL	L07033_at	L07033	PASS	8	7.75	PASS	11	8	5.45	1.42	1.42	HMGCL	1	3-hydroxymethyl-3-	3-hydroxymethyl-3-
														methylglutaryl-Coenzyme	methylglutaryl-Coenzyme
														A lyase (hydroxy-	A lyase (hydroxy-
														methylglutaricaciduria)	methylglutaricaciduria)
RPSKA2	U08316_at	U08316	PASS	3	8.00	PASS	11	5	5.64	1.42	1.42	RPS6KA3	Xp22.2-p22.1	ribosomal protein S6	ribosomal protein S6
														kinase, 90 kD, polypeptide	kinase, 90 kD, polypeptide
														3	3
M96995_s_at	M96995_s_at	M96995	PASS	6	18.00	PASS	13	6	12.69	1.42	1.42	GRB2	17q24-q25	growth factor receptor-	growth factor receptor-
														bound protein 2	bound protein 2
U43901_rna1	U43901_rna1	U43901	PASS	9	287.89	PASS	13	9	203.08	1.42	1.42			37 kD laminin receptor	37LRP/p40, metastasis-
														precursor/p40 ribosome	associated multifunctional
														associated protein	protein
RPL37A	L06499_at	L06499	PASS	9	428.44	PASS	13	9	302.38	1.42	1.42	RPL37A		ribosomal protein L37a	ribosomal protein L37a
GLB1	M83822_at	M83822	PASS	7	7.43	PASS	12	7	5.25	1.41	1.41	BGL		beige-like protein	similar to yeast YCR032w,
															GenBank Accession
															Number X59720, Mus
															musculus BG, GenBank
															Accession Number
															U52461 and C. elegans
															F10F2.1, GenBank
															Accession Number
															Z35598; previously
															identified as CDC4L
F13A1	M14539_at	M14539	PASS	9	78.00	PASS	13	9	55.15	1.41	1.41	F13A1	6p24.2-p23	coagulation factor XIII,	coagulation factor XIII,
														A1 polypeptide	A1 polypeptide
M26708_s_at	M26708_s_at	M26708	PASS	9	183.67	PASS	13	9	130.00	1.41	1.41	PTMA			prothymosin alpha
K02777_s_at	K02777_s_at	K02777	PASS	7	25.86	PASS	13	7	18.31	1.41	1.41	TCRA	14q11.2	T-cell receptor, alpha	T-cell receptor, alpha
														(V, D, J, C)	(V, D, J, C)
ITRAF	U59863_at	U59863	PASS	6	6.67	PASS	11	6	4.73	1.41	1.41			I-TRAF
RPS24L	X62691_at	X62691	PASS	9	325.00	PASS	13	9	230.46	1.41	1.41	RPS15A	16p	ribosomal protein S15a	ribosomal protein S15a
MIHB	U37547_at	U37547	PASS	7	9.71	PASS	9	7	6.89	1.41	1.41	AP12	11q22	apoptosis inhibitor 2	apoptosis inhibitor 2
TRA2B	U68063_at	U68063	PASS	8	13.13	PASS	13	8	9.31	1.41	1.41	SFRS10	3q	splicing factor, arginine/	splicing factor, arginine/
														serine-rich (transformer	serine-rich (transformer
														2 Drosophila homolog) 10	2 Drosophila homolog) 10
POLR2F	Z27113_at	Z27113	PASS	9	22.33	PASS	13	9	15.85	1.41	1.41			RNA Polymerase II
														subunit 14 4 kD
RPL8	Z28407_at	Z28407	PASS	9	324.56	PASS	13	9	230.46	1.41	1.41	RPL8	8	ribosomal protein L8	ribosomal protein L8
K158_DIFF6	D63878_at	D63878	PASS	8	34.13	PASS	12	8	24.25	1.41	1.41	DIFF6	2q37	differentiation 6	differentiation 6
														(deoxyguanosine	(deoxyguanosine
														triphosphate tri-	triphosphate tri-
														phosphohydrolase)	phosphohydrolase)
M97935_s_at	M97935_s_at	M97935	PASS	9	20.44	PASS	13	9	14.54	1.41	1.41			transcription factor ISGF-3
S171	L40393_at	L40393	PASS	8	8.25	PASS	8	8	5.88	1.40	1.40	NUMB	14q24.3	numb (Drosophila)	numb (Drosophila)
														homolog	homolog
HG3638-HT3	HG3638-HT3	HG3638-HT	PASS	5	9.20	PASS	9	5	6.56	1.40	1.40
K171_HYPL	D79993_at	D79993	PASS	6	7.83	PASS	12	6	5.58	1.40	1.40	KIAA0171			KIAA0171 gene product
YSEC7	M85169_at	M85169	PASS	9	22.56	PASS	13	9	16.08	1.40	1.40	PSCD1	17q25	pleckstrin homology,	pleckstrin homology,
														Sec7 and coiled/coil	Sec 7 and coiled/coil
														domains 1 (cytohesin 1)	domains 1 (cytohesin 1)
PRCP	L13977_at	L13977	PASS	9	14.67	PASS	11	9	10.45	1.40	1.40	PRCP	11q14	prolylcaqrboxypeptidase	prolylcarboxypeptidase
															(angiotensinase C)
M4P	L03532_at	L03532	PASS	9	25.89	PASS	13	9	18.46	1.40	1.40			M4 protein
ARC41	AF006084_at	AF006084	PASS	9	88.22	PASS	13	9	62.92	1.40	1.40	ARC41	p41-Arc	WE repeat containing
															protein; similar to Sop2Hs;
															41 kD subunit of the
															Arp2/3 protein complex
K159_CHR1	D63880_at	D63880	PASS	8	7.00	PASS	9	8	5.00	1.40	1.40	KIAA0159			KIAA0159 gene product
E_POV2	U18919_at	U18919	PASS	5	6.80	PASS	7	5	4.86	1.40	1.40
AQP3	AB001325_at	AB001325	PASS	9	20.56	PASS	13	9	14.69	1.40	1.40	AQP3	9p13	aquaporin 3	aquaporin 3
ATP5G3	U09813_at	U09813	PASS	9	33.44	PASS	13	9	23.92	1.40	1.40	P3		mitochondrial ATP
														synthase subunit 9
														precursor
STAT3	L29277_at	L29277	PASS	8	10.13	PASS	12	8	7.25	1.40	1.40	STAT3	17q21	signal transducer and	signal transducer and
														activator of transcription	activator of transcription
														3 (acute-phase response	3 (acute-phase response
														factor	factor
CSE1	U33286_at	U33286	PASS	8	8.75	PASS	11	8	6.27	1.39	1.39	CSE1L	20q13	chromosome segregation 1	chromosome segregation 1
														(yeast homolog)-like	(yeast homolog)-like
HNRPG	Z23064_at	Z23064	PASS	9	12.33	PASS	13	9	8.85	1.39	1.39	HNRPG	6p12	heterogeneous nuclear	heterogeneous nuclear
														ribonucleoprotein G	ribonucleoprotein G
U61397_s_at	U61397_s_at	U61397	PASS	9	9.22	PASS	13	9	6.62	1.39	1.39	UBL1	2q32.2-q33	ubiquitin-like 1 (sentrin)	ubiquitin-like 1 (sentrin)
CD53	M37033_at	M37033	PASS	9	103.22	PASS	13	9	74.08	1.39	1.39	CD53	1p31-p12	CD53 glycoprotein	CD53 antigen
RPL7A	M36072_at	M36072	PASS	9	272.56	PASS	13	9	195.62	1.39	1.39	RPL7A	9q33-q34	ribosomal protein L7a	ribosomal protein L7a
ATP7A	AB000409_a	AB000409	PASS	9	9.89	PASS	10	9	7.10	1.39	1.39	MKNK1		MAP kinase-interacting	MAP kinase-interacting
														serine/threonine kinase 1	serine/threonine kinase 1
RPS8_rna1	X67247_rna1	X67247	PASS	9	359.78	PASS	13	9	258.46	1.39	1.39	RPS8	qp34.1-p32	ribosomal protein S8	ribosomal protein S8
K184	D80006_at	D80006	PASS	9	20.44	PASS	13	9	14.69	1.39	1.39	KIAA0184
RPL6	X69391_at	X69391	PASS	9	178.33	PASS	13	9	128.23	1.39	1.39	RPL6	12q23-q24.1	ribosomal protein L6	ribosomal protein L6
SHGC	M88108_at	M88108	PASS	9	22.44	PASS	13	9	16.15	1.39	1.39	p62		p62
K107	D14663_at	D14663	PASS	7	11.86	PASS	13	7	8.54	1.39	1.39	KIAA0107			KIAA0107 gene product
EIF3	U46025_at	U46025	PASS	9	38.33	PASS	13	9	27.62	1.39	1.39	EIF3S8	16p11.2	eukaryotic translation	eukaryotic translation
														initiation factor 3,	initiation factor 3,
														subunit 8 (110 kD)	subunit 8 (110 kD)
K64	D31764_at	D31764	PASS	5	14.20	PASS	13	5	10.23	1.39	1.39	KIAA0064			KIAA0064 gene product
PTPN12	M93425_at	M93425	PASS	9	16.22	PASS	13	9	11.69	1.39	1.39	PTPN12	7q11.23	protein tyrosine	protein tyrosine
														phosphatase, non-receptor	phosphatase, non-receptor
														type 12	type 12
ACERA	U70063_at	U70063	PASS	7	13.71	PASS	9	7	9.89	1.39	1.39	ASAH		N-acylsphingosine amido-	N-acylsphingosine amido-
														hydrolase	hydrolase
RPL5	HG4319-HT4	HG4319-HT	PASS	9	351.78	PASS	13	9	253.69	1.39	1.39
ATPBPCD	D64158_at	D64158	PASS	7	8.57	PASS	11	7	6.18	1.39	1.39			ATP binding protein	APACD:ATP binding
															protein associated with
															cell differentiation
S100A10	M38591_at	M38591	PASS	9	75.56	PASS	13	9	54.54	1.39	1.39	S100A10	1q21	S100 calcium-binding	S100 calcium-binding
														protein A10 (annexin II	protein A10 (annexin II
														ligand, capactin I, light	ligand, capactin I, light
														polypeptide	polypeptide (p11))
GP25L2	X90872_at	X90872	PASS	8	15.13	PASS	13	8	10.92	1.38	1.38	gp2512			associated to Golgi
															apparatus
K225_COSK	D86978_at	D86978	PASS	8	8.00	PASS	9	8	5.78	1.38	1.38	KIAA0225			similar to a C. elegans
															protein encoded in cosmid
															K12D12(Z49069)
SLC20A1	L20859_at	L20859	PASS	9	7.89	PASS	10	9	5.70	1.38	1.38	GLVR1		leukemia virus receptor 1
U79528_s_at	U79528_s_at	U79528	PASS	9	15.00	PASS	13	9	10.85	1.38	1.38			SR31747 binding protein 1	sterol isomerase 1; SR-BP1
RPS5	U14970_at	U14970	PASS	9	293.11	PASS	13	9	212.00	1.38	1.38	RPS5	19q13.4	ribosomal protein S5	ribosomal protein S5
AFFX-HSAC	AFFX-HSAC	AFFX-HSA	PASS	7	19.14	PASS	13	7	13.85	1.38	1.38
MCM7	D55716_at	D55716	PASS	6	9.50	PASS	8	6	6.88	1.38	1.38	Plcdc47		Plcdc47
PBP1	U83463_at	U83463	PASS	8	10.63	PASS	13	8	7.69	1.38	1.38			scaffold protein Pbp1
MDCR	U72342_at	U72342	PASS	9	12.11	PASS	13	9	8.77	1.38	1.38	PAFAH1B1	17p13.3-p13.3	platelet-activating factor	platelet-activating factor
														acetylhydrolase, isoform	acetylhydrolase, isoform
														1b, alpha subunit (45 kD)	1b, alpha subunit (45 kD)
RPI	L35035_at	L35035	PASS	8	7.25	PASS	8	8	5.25	1.38	1.38
UBE2D2	U39317_at	U39317	PASS	9	14.22	PASS	13	9	10.31	1.38	1.38	UBE2D3		ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E2D 3 (homolo-	enzyme E2D 3 (homolo-
														gous to yeast UBC4/5)	gous to yeast UBC4/5)
DDX	U90426_at	U90426	PASS	9	11.67	PASS	13	9	8.46	1.38	1.38			nuclear RNA helicase	DEAD-box family member;
															contains DECD-box,
															similar to rat liver
															nuclear protein p47 (PIR
															Accession Number
															A42881) and D.
															melanogaster DEAD-box
															RNA helicase WM6 (PIR
															Accession Number S51601)
RPS25	M64716_at	M64716	PASS	9	275.67	PASS	13	9	200.15	1.38	1.38	PRS25	11q23.3	ribosomal protein S25	ribosomal protein S25
PSMB8_rna1	Z14982_rna1	Z14982	PASS	8	30.75	PASS	12	8	22.33	1.38	1.38	MHC-		proteasome subunit LMP7	alternative splicing
												encoded
												proteasome
												subunit gene
HG3730-HT4	HG3730-HT4	HG3730-HT	PASS	8	9.75	PASS	12	8	7.08	1.38	1.38
RPL21	U25789_at	U25789	PASS	9	153.78	PASS	13	9	111.77	1.38	1.38	RPL21	13	ribosomal protein L21	ribosomal protein L21
DUT	U31930_at	U31930	PASS	9	11.11	PASS	13	9	8.08	1.38	1.38	DUT	15q15-q21.1	dUTP pyrophosphatase	duTP pyrophosphatase
EIF4G2	D86549_at	D86549	PASS	8	6.88	PASS	1	8	5.00	1.38	1.38			p97 homologous protein
K232	D86985_at	D86985	PASS	6	7.00	PASS	11	6	5.09	1.38	1.38	KIAA0232			KIAA0232 gene product
PGD	U30255_at	U30255	PASS	6	22.00	PASS	10	6	16.00	1.38	1.38	PGD	1p36.3-p36.13	phosphogluconate	phosphogluconate
														dehydrogenase	dehydrogenase
EMAPII	U10117_at	U10117	PASS	9	10.11	PASS	11	9	7.36	1.37	1.37	EMAPH		endothelial-monocyte	endothelial-monocyte
														activating polypeptide II	activating polypeptide II
DSS1	U41515_at	U41515	PASS	9	8.78	PASS	10	9	6.40	1.37	1.37	DSSI			Method: conceptual
															translation supplied by
															author.
M14199_s_at	M14199_s_at	M14199	PASS	9	302.00	PASS	13	9	220.23	1.37	1.37	LAMR1	3p21.3	laminin receptor 1 (67 kD);	laminin receptor 1 (67 kD);
														Ribosomal protein SA	Ribosomal protein SA
STXBP3	D63506_at	D63506	PASS	9	10.33	PASS	13	9	7.54	1.37	1.37	Munc-18-3		unc-18 homologue
NME1	X17620_at	X17620	PASS	8	8.38	PASS	9	8	6.11	1.37	13.7	NME1	17q22	non-metastatic cells 1,	non-metastatic cells 1,
														protein (NM23A) expressed	protein (NM23A) expressed
														in	in
RPL3	X73460_at	X73460	PASS	9	364.22	PASS	13	9	265.77	1.37	1.37	RPL3	22	ribosomal protein L3	ribosomal protein L3
APEX	D13370_at	D13370	PASS	9	20.44	PASS	13	9	14.92	1.37	1.37	APEX	14q11.2-q12	APEX nuclease (multi-	APEX nuclease (multi-
														functional DNA repair	functional DNA repair
															enzyme)
K201_HSP10	D86956_at	D86956	PASS	6	7.00	PASS	9	6	5.11	1.37	13.7	KIAA0201			KIAA0201 gene product
COX10_rna1	U82010_rna1	U82010	PASS	9	8.56	PASS	12	9	6.25	1.37	1.37	COX10	17p12-p11.2	cytochrome c oxidase	cytochrome c oxidase
														subunit X (heme A	subunit X (heme A:
															farnesyltransferase)
LYZ_f	M19045_f_at	M19045	PASS	9	155.67	PASS	13	9	113.77	1.37	1.37	LYZ			lysozyme precursor (EC
															3 2.1.17)
RPL19	X63527_at	X63527	PASS	9	379.44	PASS	13	9	277.54	1.37	1.37	RPL19	17p12-q11	ribosomal protein L19	ribosomal protein L19
DPYD	U20938_at	U20938	PASS	8	9.25	PASS	13	8	6.77	1.37	1.37			dihydropyrimidine	DPD; dihydrouracil
														dehydrogenase	dehydrogenase
Z47055_s_at	Z47055_s_at	Z47055	PASS	9	9.22	PASS	12	9	6.75	1.37	1.37	FDPS		farnesyl diphosphate	farnesyl diphosphate
														synthase (farnesyl pyro-	synthase (farnesyl pyro-
														phosphate synthetase,	phosphate synthetase,
														dimethylallyltransferase,	dimethylallyltransferase,
														geranyltranstransferase)	geranyltranstransferase)
LYN	M16038_at	M16038	PASS	9	17.11	PASS	13	9	12.54	1.36	1.36	LYN	8q13	v-yes-1 Yamaguchi	v-yes-1 Yamaguchi
														sarcoma viral related	sarcoma viral related
														oncogene homolog	oncogene homolog
hum_ala_at	hum_ala_at	hum	PASS	9	422.44	PASS	13	9	309.62	1.36	1.36
PCM1	L27841_at	L27841	PASS	6	7.83	PASS	8	6	5.75	1.36	1.36	PCM-1		pericentriol material 1
ACAA	D16294_at	D16294	PASS	8	9.13	PASS	10	8	6.70	1.36	1.36			mitochondrial 3-oxoacyl-
														CoA thiolase
PSMA3	D00760_at	D00760	PASS	8	11.00	PASS	12	8	8.08	1.36	1.36	PSMA2	6q27	proteasome (prosome,	proteasome, (prosome,
														macropain) subunit, alpha	macropain) subunit, alpha
														type, 2	type, 2
U07806_s_at	U07806_s_at	U07806	PASS	8	11.25	PASS	11	8	8.27	1.36	1.36			DNA topoisomerase I	found in the camptothecin
															resistant clone CEM/C2
A82KD	U15552_at	U15552	PASS	7	8.71	PASS	12	7	6.42	1.36	1.36			acidic 82 kDa protein
D26535_s_at	D26535_s_at	D26535	PASS	8	10.00	PASS	11	8	7.36	1.36	1.36	DLST	14q24.3	dihydrolipoamide S-	dihydrolipoamide S-
														succinyltransferase (E2-	succinyltransferase (E2-
														oxo-glutarate complex)	oxo-glutarate complex)
Z49148_s_at	49148_s_at	Z49148	PASS	9	285.33	PASS	13	9	210.23	1.36	1.36	RPL29	3q29-qter	ribosomal protein L29	ribosomal protein L29
EED	U90651_at	U90651	PASS	7	8.14	PASS	11	7	6.00	1.36	1.36	EED	11q14.2-q22.3	embryonic ectoderm	embryonic ectoderm
														development protein	development protein
														homolog	homolog
DYRK2	Y09216_at	Y09216	PASS	6	10.17	PASS	12	6	7.50	1.36	1.36	DYRK2	12	dual-specificity tyrosine-	dual-specificity tyrosine-
														(Y)-phosphorylation	(Y)-phosphorylation
														regulated kinase 2	regulated kinase 2
LLREP3	X17206_at	X17206	PASS	9	471.00	PASS	13	9	347.46	1.36	1.36	RPS2	16p13.3	ribosomal protein S2	ribosomal protein S2
UBA52_rna1	X56997_rna1	X56997	PASS	9	268.44	PASS	13	9	198.08	1.36	1.36	UbA52		ubiquitin-52 amino acid
														fusion protein
RPS18	X69150_at	X69150	PASS	9	377.78	PASS	13	9	278.77	1.36	1.36	PRS18	6p21.3		ribosomal protein S18
FCER2	M15059_at	M15059	PASS	9	9.33	PASS	9	9	6.89	1.35	1.35	FCER2	19p13.3	Fc fragment of IgE, low	Fc fragment of IgE, low
														affinity II, receptor for	affinity II, receptor for
														(CD23A)	(CD23A)
P87	L42572_at	L42572	PASS	8	8.38	PASS	11	8	6.18	1.35	1.35	p87/89		transmembrane protein	endoplasmic reticulum
															protein
BTK_rna4	U78027_rna4	U78027	PASS	7	10.71	PASS	12	7	7.92	1.35	1.35	FTP3		FTP3	lysosomal exoglycosidase
HCG8	X92110_at	X92110	PASS	5	5.80	PASS	7	5	4.29	1.35	1.35
PSKH1	U09564_at	U09564	PASS	8	7.50	PASS	11	8	5.55	1.35	1.35	SRPK1	6p21.2-p21.3	SFRS protein kinase 1	SFRS protein kinase 1
U09820_s_at	U09820_s_at	U09820	PASS	7	8.71	PASS	9	7	6.44	1.35	1.35	ATRX	Xq13.1-q21.1	helicase II	alpha thalessemia/mental
															retardation syndrome
															X-linked
U37546_s_at	U37546_s_at	U37546	PASS	8	7.13	PASS	11	8	5.27	1.35	1.35	API1	11q22	apoptosis inhibitor 1	apoptosis inhibitor 1
S54005_s_at	S54005_s_at	S54005	PASS	9	184.44	PASS	13	9	136.54	1.35	1.35	thymosin
												beta-10
LKYHYD	U57721_at	U57721	PASS	9	9.44	PASS	13	9	7.00	1.35	1.35	KYNU		kynureninase; 1-kynurenine	kynureninase; 1-kynurenine
														hydrolase	hydrolase
X95325_s_at	X95325_s_at	X95325	PASS	5	21.80	PASS	12	5	16.17	1.35	1.35	dpbAv		DNA-binding protein	variant A
RARS	S80343_at	S80343	PASS	8	7.50	PASS	7	8	5.57	1.35	1.35	RARS	5pter-q11	arginyl-tRNA synthetase	arginyl-tRNA synthetase
K148	D63482_at	D63482	PASS	5	7.80	PASS	10	5	5.80	1.34	1.34	KIAA0148			KIAA0148 gene product
K178_SMC1	D80000_at	D80000	PASS	6	6.17	PASS	10	6	4.60	1.34	1.34	KIAA0178			similar to mitosis-specific
															chromosome segregation
															protein SMC1 of S.
															cerevisiae.
RPS11	X06617_at	X06617	PASS	9	380.22	PASS	13	9	284.08	1.34	1.34	RPS11	19q13.3	ribosomal protein S11	ribosomal protein S11
JUN	U65928_at	U65928	PASS	8	8.75	PASS	11	8	6.55	1.34	1.34	JUN	1p32-p31	Avian sarcoma virus 17	v-jun avian sarcoma virus
														(v-jun) oncogene homolog	17 oncogene homolog
INT6	U62962_at	U62962	PASS	9	52.67	PASS	13	9	39.46	1.33	1.33	EIF3S6	8q22-q23	murine mammary tumor	eukaryotic translation
														integration site 6	initiation factor 3,
														(oncogene homolog)	subunit 6 (48 kD)
RSU1	L12535_at	L12535	PASS	9	13.44	PASS	13	9	10.08	1.33	1.33	RSU-1			homologous to mouse
															Rsu-1; putative
SFRS7_rna1	L41887_rna1	L41887	PASS	6	6.33	PASS	8	6	4.75	1.33	1.33	SFRS7		splicing factor, arginine/	35 kDa protein
														serine-rich 7
K71	D31888_at	D31888	PASS	8	7.25	PASS	9	8	5.44	1.33	1.33	KIAA0071
ANT3	J03592_at	J03592	PASS	9	200.78	PASS	13	9	151.00	1.33	1.33	ANT3	Xp22.32		adenine nucleotide trans-
															locator 3 (liver)
MDH1	D55654_at	D55654	PASS	9	25.56	PASS	13	9	19.23	1.33	1.33			cytosolic malate
														dehydrogenase
RPLP2	AB002533_at	AB002533	PASS	9	355.11	PASS	13	9	267.23	1.33	1.33	KPNA4		karyopherin alpha 4	karyopherin alpha 4
														(importin alpha 3)	(importin alpha 3)
PSMA5	D00761_at	D00761	PASS	9	33.11	PASS	13	9	24.92	1.33	1.33	PSMB1	7p13-p12	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, beta	macropain) subunit, beta
														type, 1	type, 1
NPM1	M23613_at	M23613	PASS	9	103.33	PASS	13	9	77.85	1.33	1.33	NPM1	5q35	nucleophosmin	nucleophosmin (nuclear
															phosphoprotein B23,
															numatrin)
K2_TRIC5	D13627_at	D13627	PASS	9	15.78	PASS	12	9	11.92	1.32	1.32	KIAA0002			KIAA0002 gene product
GZMK	U26174_at	U26174	PASS	6	17.50	PASS	13	6	13.23	1.32	1.32	GZMK		granzyme K, (serine	granzyme K (serine
														protease, granzyme 3;	protease, granzyme 3;
														tryptase II)	tryptase II)
MRP	X78338_at	X78338	PASS	7	7.43	PASS	8	7	5.63	1.32	1.32
M16336_s_at	M16336_s_at	M16336	PASS	9	52.11	PASS	13	9	39.54	1.32	1.32	CD2	1p13	CD2 antigen (p50), sheep	CD2 antigen (p50), sheep
														red blood cell receptor	red blood cell receptor
K164_DNAB	D79986_at	D79986	PASS	8	16.63	PASS	13	8	12.62	1.32	1.32	KIAA0164			KIAA0164 gene product
RPL17	X53777_at	X53777	PASS	9	206.44	PASS	13	9	156.69	1.32	1.32	RPL17	18q	ribosomal protein L17	ribosomal protein L17
SPHAR_rna1	X82554_rna1	X82554	PASS	5	6.00	PASS	9	5	4.56	1.32	1.32	SPHAR
SRC1	U59302_at	U59302	PASS	9	11.44	PASS	13	9	8.69	1.32	1.32	SRC1	2p23	steroid receptor coactivator	steroid receptor coactivator
														1	1
FLI1	M98833_at	M98833	PASS	7	8.29	PASS	13	7	6.31	1.31	1.31	FLI1	11q24.1-q24.3	Friend leukemia virus	Friend leukemia virus
														integration 1	integration 1
K16	D13641_at	D13641	PASS	8	13.13	PASS	13	8	10.00	1.31	1.31	KIAA0016		mitochondrial outer	KIAA0016 gene product
														membrane protein 19
TFAP3S	U91932_at	U91932	PASS	9	14.33	PASS	13	9	10.92	1.31	1.31	CLAPS3	12p13.2-p13.1	clathrin-associated/	clathrin-associated/
														assembly/adaptor protein,	assembly/adaptor protein,
														small 3 (22 kD)	small 3, 22-kD; Sigma3 A
GUA5MPST	HG4716-HT5	HG4716-HT	PASS	8	7.75	PASS	11	8	5.91	1.31	1.31
RPS28	U58682_at	U58682	PASS	9	286.67	PASS	13	9	218.69	1.31	1.31	RPS28	19p13.2	ribosomal protein S28	ribosomal protein S28
RAB11A	AF000231_at	AF000231	PASS	6	6.17	PASS	7	6	4.71	1.31	1.31			rab11a	GTPase
AFFX-HUM	AFFX-HUM	AFFX-HUM	PASS	6	12.17	PASS	13	6	9.31	1.31	1.31
HPRT1	M31642_at	M31642	PASS	8	7.63	PASS	12	8	5.83	1.31	1.31	HPRT1	Xq26.1	hypoxanthine phosphori-	hypoxanthine phosphori-
														bosyltransferase 1	bosyltransferase 1
														(Lesch-Nyhan syndrome)	(Lesch-Nyhan syndrome)
PSM112	D44466_at	D44466	PASS	9	7.44	PASS	10	9	5.70	1.31	1.31	PSMD1		proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase, 1	non-ATPase, 1
PEBP2AC1	Z35278_at	Z35278	PASS	9	19.78	PASS	13	9	15.15	1.31	1.31	CBFA3	1p36	core-binding factor,	core-binding factor,
														runt domain, alpha	runt domain, alpha
														subunit 3	subunit 3
PSMCP31	D38047_at	D38047	PASS	9	31.22	PASS	13	9	23.92	1.31	1.31	PSMD8		proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														non-ATPase, 8	non-ATPase, 8
PSM42	D78275_at	D78275	PASS	8	9.25	PASS	10	8	7.10	1.30	1.30	PSMC6	12q15	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														ATPase, 6	ATPase, 6
P76	U81006_at	U81006	PASS	7	9.00	PASS	11	7	6.91	1.30	1.30	P76		76 kDa membrane protein	76 kDa membrane protein
K54_MOV10	D29677_at	D29677	PASS	7	8.29	PASS	11	7	6.36	1.30	1.30	KIAA0054
SKIP	U51432_at	U51432	PASS	6	13.00	PASS	10	6	10.00	1.30	1.30			nuclear protein Skip	similar to the Drosophila
															puff specific protein Bx42
K276	D87445_at	D87445	PASS	6	6.50	PASS	9	6	5.00	1.30	1.30	KIAA0256			KIAA0256 gene product
LGALS8	L78132_at	L78132	PASS	6	6.17	PASS	8	6	4.75	1.30	1.30	peta-1		prostate carcinoma tumor
														antigen
POLR2	U37689_at	U37689	PASS	5	9.80	PASS	9	5	7.56	1.30	1.30	hsRPB8		RNA polymerase II subunit
CASP10	U60519_at	U60519	PASS	6	6.67	PASS	7	6	5.14	1.30	1.30	CASP10	2q33-q34	caspase 10, apoptosis-	caspase 10, apoptosis-
														related cysteine protease	related cysteine protease
L14778_s_at	L14778's_at	L14778	PASS	9	9.78	PASS	11	9	7.55	1.30	1.30	PPP3CA	4q21-q24	calmodulin-dependent	protein phosphatase 3
														phosphatase catalytic	(formerly 2B), catalytic
														subunit	subunit, alpha isoform
															(calcineurin A alpha)
RAB_rna1	L42025_rna1	L42025	PASS	6	6.33	PASS	9	6	4.89	1.30	1.30	HRB	2q36	HIV-1 Rev binding protein	HIV-1 Rev binding protein
GAPDHM	AFFX-HUM	AFFX-HUM	PASS	9	162.00	PASS	13	9	125.31	1.29	1.29
E_121711DM	U92014_at	U92014	PASS	6	6.83	PASS	7	6	5.29	1.29	1.29
HRMT1L1	X99209_at	X99209	PASS	9	20.78	PASS	13	9	16.08	1.29	1.29			arginine methyltransferase
RPL10	HG4542-HT4	HG4542-HT	PASS	9	184.78	PASS	13	9	143.08	1.29	1.29
28SRNA5	AFFX-M2783	AFFX-M27	PASS	7	8.71	PASS	8	7	6.57	1.29	1.29
YWHA	X56468_at	X56468	PASS	9	23.33	PASS	13	9	18.08	1.29	1.29			14.3.3 protein
ACADM	M91432_at	M91432	PASS	8	7.50	PASS	11	8	5.82	1.29	1.29	ACADM	1p31	acyl-Coenzyme A	acyl-Coenzyme A
														dehydrogenase, C-4 to C-12	dehydrogenase, C-4 to C-12
														straight chain	straight chain
FMR1	U25165_at	U25165	PASS	7	11.00	PASS	13	7	8.54	1.29	1.29	FXR1	3q28	FXR1	fragile X mental
															retardation, autosomal
															homolog 1
HMG17_rna1	X13546_rna1	X13546	PASS	9	40.22	PASS	13	9	31.23	1.29	1.29	HMG17	1p36.1-p35	put HMG-17 protein	high-mobility group
															(nonhistone chromosomal)
															protein 17
K6_VAV1	D25304_at	D25304	PASS	9	16.11	PASS	13	9	12.54	1.28	1.28	KIAA0006			PAK-interacting exchange
															factor alpha
SNRPD2	U15008_at	U15008	PASS	9	140.33	PASS	13	9	109.23	1.28	1.28	SNRPD2		small nuclear ribonucleo-	small nuclear ribonucleo-
														protein D2 polypeptide	protein D2 polypeptide
														(16.5 kD)	(16.5 kD)
COX5A	M22760_at	M22760	PASS	9	16.89	PASS	13	9	13.15	1.28	1.28	COX5A	15q25	cytochrome c oxidase	cytochrome c oxidase
														subunit Va	subunit Va
VRK1	AB000449_at	AB000449	PASS	7	7.57	PASS	10	7	5.90	1.28	1.28	VRK1	14q32	vaccinia related kinase 1	vaccinia related kinase 1
M31516_s_at	M31516_s_at	M31516	PASS	5	6.20	PASS	12	5	4.83	1.28	1.28	DAF	1q32	decay-accelerating factor	decay accelerating factor
															for complement (CD55,
															Cromer blood group
															system)
TRPOSL	M23161_at	M23161	PASS	7	6.29	PASS	11	7	4.91	1.28	1.28
PSMC5	L38810_at	L38810	PASS	9	14.67	PASS	11	9	11.45	1.28	1.28	PSMC5	17q23-q25	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														ATPase, 5	ATPase, 5
UROD	M14016_at	M14016	PASS	7	7.86	PASS	7	7	6.14	1.28	1.28	UROD	1p34	uroporphyrinogen	uroporphyrinogen
														decarboxylase	decarboxylase
POLR2	HG2274-HT2	HG2274-HT	PASS	6	10.33	PASS	12	6	8.08	1.28	1.28
M96954_s_at	M96954_s_at	M96954	PASS	9	7.67	PASS	13	9	6.00	1.28	1.28			Nuclelysin TIAR
TRP185	U38847_at	U38847	PASS	5	6.20	PASS	7	5	4.86	1.28	1.28	TRP-185		TAR RNA loop binding	TRP-185
														protein;
GCNT1	U77413_at	U77413	PASS	5	7.40	PASS	10	5	5.80	1.28	1.28	OGT		O-GlcNAc transferase	O-linked N-acetyl-
														(uridine diphospho-N-	glucosamine (GlcNAc)
														acetylglucosamine:poly-	transferase (UDP-N-
														peptide beta-N-acetyl-	acetylglucosamine:poly-
														glucosaminyl transferase)	peptide-N-acetyl-
															glucosaminyl transferase)
RAN	HG1112-HT1	HG1112-HT	PASS	9	21.44	PASS	13	9	16.85	1.27	1.27
INDPOLABP	U33818_at	U33818	PASS	8	14.88	PASS	13	8	11.69	1.27	1.27	IPABP		inducible poly(A)-binding	inducible poly(A)-binding
														protein	protein
DPM1	AF007875_at	AF007875	PASS	8	8.38	PASS	12	8	6.58	1.27	1.27	DPM1		dolichyl-phosphate	dolichyl-phosphate
														mannosyltransferase poly-	mannosyltransferase poly-
														peptide 1, catalytic subunit	peptide 1, catalytic subunit
TCP3	M31523'at	M31523	PASS	9	6.89	PASS	12	9	5.42	1.27	1.27	TCF3	19		transcription factor 3
															(E2A immunoglobulin
															enhancer binding factors
															E12/E47)
Z26491_s_at	Z26491_s_at	Z26491	PASS	9	13.89	PASS	13	9	10.92	1.27	1.27			catechol O-methyl-
														transferase
HNRNPCL	M94630_at	M94630	PASS	9	27.56	PASS	13	9	21.69	1.27	1.27	HNRPD	4q21	heterogeneous nuclear	heterogeneous nuclear
														ribonucleoprotein D	ribonucleoprotein D
K212_COSC	D86967_at	D86967	PASS	7	11.43	PASS	12	7	9.00	1.27	1.27	KIAA0212			KIAA0212 gene product
EIF2A	U26032_at	U26032	PASS	5	5.80	PASS	7	5	4.57	1.27	1.27
TGFBR2	D50683_at	D50683	PASS	9	24.00	PASS	13	9	18.92	1.27	1.27	TGFBR2	3p22	transforming growth factor,	transforming growth factor,
														beta receptor II (70-80 kD)	beta receptor II (70-80 kD)
PPP2R2A	M64929_at	M64929	PASS	7	7.29	PASS	8	7	5.75	1.27	1.27	PPP2R2A		protein phosphatase 2	protein phosphatase 2
														(formerly 2A), regulatory	(formerly 2A), regulatory
														subunit B (PR 52), alpha	subunit B (PR 52), alpha
														isoform	isoform
GPRK5	L15388_at	L15388	PASS	6	6.33	PASS	7	6	5.00	1.27	1.27	GPRK5	10q24-qter	G protein-coupled	G protein-coupled
														receptor kinase	receptor kinase
PPP3CB2	M29551_at	M29551	PASS	5	7.60	PASS	9	5	6.00	1.27	1.27				calcineurin A2
HG3484-HT3	HG3484-HT3	HG3484-HT	PASS	7	8.86	PASS	12	7	7.00	1.27	1.27
CCNH	U11791_at	U11791	PASS	7	6.43	PASS	12	7	5.08	1.26	1.26	CCNH	5q13.3-q14	cyclin H	cyclin H
H2B_rna2	X57985_rna2	X57985	PASS	9	9.11	PASS	13	9	7.23	1.26	1.26	H2AFQ	1q21-q23	histone H2A	H2A histone family,
															member Q
NFKB1	M58603_at	M58603	PASS	6	16.17	PASS	12	6	12.83	1.26	1.26	NFKB1	4q24	nuclear factor kappa-B	nuclear factor of kappa
														DNA binding subunit	light polypeptide gene
															enhancer in B-cells 1
															(p105)
G22P1	J04611_at	J04611	PASS	9	23.44	PASS	13	9	18.62	1.26	1.26	G22P1	22q11-q13	thyroid autoantigen 70 kD	thyroid autoantigen 70 kD
														(Ku antigen)	(Ku antigen)
RABGGTB	X98001_at	X98001	PASS	6	6.67	PASS	10	6	5.30	1.26	1.26	RABGGTB	1p31-p22	Rab geranylgeranyl-	Rab geranylgeranyl-
														transferase, beta subunit	transferase, beta subunit
ECH1	U16660_at	U16660	PASS	7	20.57	PASS	13	7	16.38	1.26	1.26	ECH1	19q13.1	enoyl Coenzyme A	enoyl Coenzyme A
														hydratase 1, peroximal	hydratase 1, peroximal
K276_HYPLK	D87466_at	D87466	PASS	7	5.71	PASS	9	7	4.56	1.25	1.25	KIAA0276			Similar to S. cerevisiae
															hypothetical protein L3111
															(S59316)
K78_RAD21	D38551_at	D38551	PASS	8	10.63	PASS	12	8	8.50	1.25	1.25	RAD21			RAD21 (S. pombe)
															homolog
ECGF1	M31210_at	M31210	PASS	8	6.38	PASS	10	8	5.10	1.25	1.25	EDG1	1pter-qter	endothelial differentiation,	endothelial differentiation,
														sphingolipid G-protein-	sphingolipid G-protein-
														coupled receptor, 1	coupled receptor, 1
M58525_s_at	M58525_s_at	M58525	PASS	5	10.40	PASS	12	5	8.33	1.25	1.25	COMT	22q11.21-	catechol-O-methyl-	catechol-O-methyl-
														transferase	transferase
HG2639-HT2	HG2639-HT2	HG2639-HT	PASS	9	11.89	PASS	13	9	95.4	1.25	1.25
ZNF43_f	X59244_f_at	X59244	PASS	5	5.60	PASS	10	5	4.50	1.24	1.24	ZNF43	19p13.1-p12	zinc finger protein 43	zinc finger protein 43
														(HTF6)	(HTF6)
D79984_s_at	D79984_s_at	D79984	PASS	5	6.40	PASS	7	5	5.14	1.24	1.24	KIAA0162			similar to emb-5 protein
															of C. elegans.
MIF_rna1	L19686_rna1	L19686	PASS	9	43.33	PASS	13	9	34.85	1.24	1.24	MIF	22q11.2	macrophage migration	macrophage migration
														inhibitory factor (glcosyla-	inhibitory factor (glcosyla-
														tion-inhibiting factor)	tion-inhibiting factor)
CBF	M37197_at	M37197	PASS	8	6.75	PASS	7	8	5.43	1.24	1.24	CEBP		CCAAT-box-binding factor
M90391_s_at	M90391_s_at	M90391	PASS	7	7.71	PASS	9	7	6.22	1.24	1.24	IL16		interleukin 16 (lymphocyte	interleukin 16 (lymphocyte
														chemoattractant factor)	chemoattractant factor)
K29	D21852_at	D21852	PASS	9	7.33	PASS	12	9	5.92	1.24	1.24	KIAA0029
CTSS	M90696_at	M90696	PASS	8	12.38	PASS	11	8	10.00	1.24	1.24	CTSS	1q21	cathepsin S	cathepsin S
X15673_s_at	X15673_s_at	X15673	PASS	5	9.40	PASS	10	5	7.60	1.24	1.24
ERH	D85758_at	D85758	PASS	7	21.86	PASS	13	7	17.69	1.24	1.24	ERH	7q34	enhancer of rudimentary	enhancer of rudimentary
														(Drosophila) homolog	(Drosophila) homolog
HUM31	U30521_at	U30521	PASS	5	6.00	PASS	7	5	4.86	1.24	1.24	P311		P311 protein	P311 protein
K244_TCEA	D87685_at	D87685	PASS	8	5.63	PASS	9	8	4.56	1.23	1.23	KIAA0244			similar to human
															transcription factor TFHS
															(S34159).
PSM1131	D88378_at	D88378	PASS	6	6.00	PASS	8	6	4.88	1.23	1.23			proteasome inhibitor hP131
														subunit
SRI	M32886_at	M32886	PASS	8	7.00	PASS	13	8	5.69	1.23	1.23	SR1	7	sorcin	sorcin
PRKAR1A	M33336_at	M33336	PASS	7	25.71	PASS	13	7	20.92	1.23	1.23	PRKAR1A	17q23-q24	protein kinase, cAMP-	protein kinase, cAMP-
														dependent, regulatory, type	dependent, regulatory, type
														I, alpha (tissue specific	1, alpha (tissue specific
														extingisher 1)	extinguisher 1)
AMD1	M21154_at	M21154	PASS	8	8.50	PASS	12	8	6.92	1.23	1.23	AMD1	6q21-q22	S-adenosylmethionine	S-adenosylmethionine
														decarboxylase 1	decarboxylase 1
HG884-HT88	HG884-HT88	HG884-HT	PASS	5	6.00	PASS	9	5	4.89	1.23	1.23
RAB5IP	S83364_at	S83364	PASS	7	11.86	PASS	12	7	9.67	1.23	1.23	putative			This sequence comes from
												Rab5-			FIG. 4.
												interacting
												protein
K35_NOPP1	D21262_at	D21262	PASS	9	7.11	PASS	10	9	5.80	1.23	1.23	P130		nucleolar phosphoprotein	nucleolar phosphoprotein
														p130	p130
CD36	Z32765_at	Z32765	PASS	8	26.88	PASS	13	8	21.92	1.23	1.23
ETFA	J04058_at	J04058	PASS	7	6.57	PASS	11	7	5.36	1.23	1.23	ETFA	15q23-q25	electron-transfer-flavo-	electron-transfer-flavo-
														protein, alpha polypeptide	protein, alpha polypeptide
														(glutaric aciduria II)	(glutaric aciduria II)
TCEA1	M81601_at	M81601	PASS	8	18.75	PASS	13	8	15.31	1.22	1.22	transcription		transcription elongation
												elongation	factor SII
GSN	S65738_at	S65738	PASS	9	10.00	PASS	12	9	8.17	1.22	1.22	actin depoly-		actin depolymerizing factor	This sequence comes from
												merizing			FIG. 1B, destrin; ADF
												factor,
												destrin, ADF
D78132_s_at	D78132_s_at	D78132	PASS	8	7.63	PASS	13	8	6.23	1.22	1.22	Rheb		ras-related GTP-binding	Ras homologue encriched
														protein	in brain; similar to rat
															Rheb gene
ITPR2	D26070_at	D26070	PASS	5	5.80	PASS	12	5	4.75	1.22	1.22	ITPR1	3p26-p25	human type 1 inositol	inositol 1,4,5-triphosphate
														1,4,5-trisphosphate receptor	receptor, type 1
HG210-HT21	HG210-HT21	HG210-HT	PASS	5	5.80	PASS	8	5	4.75	1.22	1.22
U28488_s_at	U28488_s_at	U28488	PASS	5	7.20	PASS	10	5	5.90	1.22	1.22	C3AR1		complement component 3a	complement component 3a
														receptor 1	receptor 1
EGR1	S81439_at	S81439	PASS	7	5.86	PASS	10	7	4.80	1.22	1.22	TIEG			TGFB inducible early
															growth response
TSC22	U35048_at	U35048	PASS	9	15.11	PASS	13	9	12.38	1.22	1.22	TSC22	TSC-22 protein	transforming growth factor
															beta-stimulated protein
															TSC-22
DCN	M14219_at	M14219	PASS	7	7.43	PASS	11	7	6.09	1.22	1.22	DCN	12q23	decorin	decorin
U00947_s_at	U00947_s_at	U00947	PASS	9	88.89	PASS	13	9	72.92	1.22	1.22
K155_COSB	D63875_at	D63875	PASS	8	7.88	PASS	13	8	6.46	1.22	1.22	KIAA0155			KIAA0155 gene product
X57152_rna1	X57152_rna1	X57152	PASS	9	28.00	PASS	13	9	23.00	1.22	1.22			casein kinase II subunit	protein kinase
														beta
Y00451_s_at	Y00451_s_at	Y00451	PASS	8	5.75	PASS	11	8	4.73	1.22	1.22	ALAS2	Xp11.21	aminolevulinate, delta-,	aminolevulinate, delta-,
														synthase 2 *sideroblastic/	synthase 2 (sideroblastic/
														hypochromic anemia)	hypochromic anemia)
HADHB	D16481_at	D16481	PASS	6	9.17	PASS	13	6	7.54	1.22	1.22	HADHB	2p23	hydroxyacyl-Coenzyme A	hydroxyacyl-Coenzyme A
														dehydrogenase/3-ketoacyl-	dehydrogenase/3-ketoacyl-
														Coenzyme A thiolase/	Coenzyme A thiolase/
														enoyl-Coenzyme A	enoyl-Coenzyme A
														hydratase (trifunctional	hydratase (trifunctional
														protein), beta subunit	protein), beta subunit
PCSK4	HG4297-HT4	HG4297-HT	PASS	9	24.00	PASS	13	9	19.77	1.21	1.21
ATM	U33841_at	U33841	PASS	5	6.20	PASS	9	5	5.11	1.21	1.21	ATM	11q22-q23	ataxia telangiectasia	ataxia telangiectasia
														mutated (includes com-	mutated (includes com-
														plementation groups A,	plementation groups A,
														C and D)	C and D)
RPL31	X15940_at	X15940	PASS	9	354.56	PASS	13	9	292.46	1.21	1.21	RPL31	2	ribosomal protein L31	ribosomnal protein L31
BTK_rna3	U78027_rna3	U78027	PASS	9	174.44	PASS	13	9	144.08	1.21	1.21	FTP3		FTP3	Lysosomal exoglycosidase
X15729_s_at	X15729_s_at	X15729	PASS	9	36.56	PASS	13	9	30.23	1.21	1.21	DDX5	17q21	DEAD/H (Asp-Glu-Ala-	DEAD/H (Asp-Glu-Ala-
														Asp/His) box polypeptide 5	Asp/His) box polypeptide 5
														(RNA helicase, 68 kD)	RNA helicase, 68 kD)
DNAPKCS	U47077_at	U47077	PASS	7	5.29	PASS	8	7	4.38	1.21	1.21	PRKDC	8q11	DNA-dependent protein	protein kinase, DNA-
														kinase catalytic subunit	activated, catalytic poly-
															peptide
CUL3	U58089_at	U58089	PASS	8	9.75	PASS	13	8	8.08	1.21	1.21	CUL3	Chr. 2	cullin 3	cullin 3
D28473_s_at	D28473_s_at	D28473	PASS	6	6.33	PASS	12	6	5.25	1.21	1.21	IARS	9q21	isoleucine-tRNA synthetase	isoleucine-tRNA synthetase
J04029_s_at	J04029_s_at	J04029	PASS	9	9.56	PASS	13	9	7.92	1.21	1.21	KRT10	17q21-q23	keratin 10	keratin 10 (epidermolytic
															hyperkeratosis; keratosis
															palmaris et plantaris)
CDC16HS	U18291_at	U18291	PASS	6	6.83	PASS	12	6	5.67	1.21	1.21	CDC16		cell vidision cycle 16;	cell division cycle 16;
														anaphase promoting	anaphase promoting
														complex 6	complex 6
HSPE1	U07550_at	U07550	PASS	7	7.43	PASS	11	7	6.18	1.20	1.20	HSPE1		heat shock 10 kD protein 1	heat shock 10 kD protein 1
														(chaperonin 10)	chaperonin 10)
BTF3_f	HG1515-HT1	HG1515-HT	PASS	9	63.44	PASS	13	9	52.85	1.20	1.20
CD86	U04343_at	U04343	PASS	8	6.00	PASS	9	8	5.00	1.20	1.20	CD86		CD86 antigen	common synonyms are
															B7-2 and B70; B70 antigen;
															B7-2
K11	D13636_at	D13636	PASS	6	7.50	PASS	8	6	6.25	1.20	1.20	GTF3C2	2	general transcription	general transcription
														factor IIIC, polypeptide 2	factor IIIC, polypeptide 2
														(beta subunit, 110 kD)	(beta subunit, 110 kD)
SEMAE	AB000220_at	AB000220	PASS	5	6.00	PASS	8	5	5.00	1.20	1.20			semaphorin E
TRANSP1	D87127_at	D87127	PASS	5	6.60	PASS	8	5	5.50	1.20	1.20	TLOC1		translocation protein 1	translocation protein 1
X75755_rna1	X75755_rna1	X75755	PASS	7	6.43	PASS	11	7	5.36	1.20	1.20	SFRS2	17	splicing factor, arginine/	splicing factor, arginine/
														serine-rich 2	serine-rich 2
PTPN4	M68941_at	M68941	PASS	7	7.86	PASS	9	7	6.56	1.20	1.20	PTPN4		protein tyrosine	protein tyrosine
														phosphatase, non-receptor	phosphatase, non-receptor
														type 4 (megakaryocyte)	type 4 (megakaryocyte)
TAF2G	U21858_at	U21858	PASS	8	7.00	PASS	13	8	5.85	1.20	1.20	TAF2G		TATA box binding protein	TATA box binding protein
														(TBP)-associated factor,	(TBP)-associated factor,
														RNA polymerase II, G,	RNA polymerase II, G,
														32 kD	32 kD
PIGB	D42138_at	D42138	PASS	6	5.83	PASS	8	6	4.88	1.20	1.20	PIGB	15q21-q22	phosphatidylinositol	phosphatidylinositiol
														glycan, class B	glycan, class B
U50527_s_at	U50527_s_at	U50527	PASS	6	5.67	PASS	8	6	4.75	1.19	1.19
PYGL	M14636_at	M14636	PASS	7	5.71	PASS	10	7	4.80	1.19	1.19	PYGL	14q11.2-q24.3	phosphorylase, glycogen;	phosphorylase, glycogen;
														liver (Hers disease,	liver (Hers disease,
														glycogen storage disease	glycogen storage disease
														type VI)	type VI)
PSMZ	D38048_at	D38048	PASS	9	10.89	PASS	13	9	9.15	1.19	1.19	PSMB7	9q34.11-	proteasome (prosome,	proteasome (prosome,
													q34.12	macropain) subunit,	macropain) subunit,
														beta type, 7	beta type, 7
CASP4	U28014_at	U28014	PASS	9	23.33	PASS	13	9	19.62	1.19	1.19	CASP4	11q22.2-q22.3	caspase 4, apoptosis-	caspase 4, apoptosis-
														related cysteine protease	related cysteine protease
IGFBP7	HG987-HT98	HG987-HT	PASS	7	8.14	PASS	13	7	6.85	1.19	1.19
P23	L24804_at	l24804	PASS	5	11.00	PASS	12	5	9.25	1.19	1.19	p23
PDHB	D90086_at	D90086	PASS	9	16.56	PASS	13	9	13.92	1.19	1.19	PDHB	3p21.1-p14.2	pyruvate dehydrogenase	pyruvate dehydrogenase
														(lipoamide) beta	(lipoamide) beta
ENTDFPF	U62136_at	U62136	PASS	6	7.00	PASS	9	6	5.89	1.19	1.19			enterocyte differentiation	EDPF-1; putative
														associated factor EDAF-1	enterocyte differentiation
															promoting factor
TRGGP230	U41740_at	U41740	PASS	6	6.33	PASS	9	6	5.33	1.19	1.19	GOLGA4	6p22-p12	golgi autoantigen, golgin	golgi autoantigen, golgin
														subfamily a, 4	subfamily a, 4
PDE4B	L20971_at	L20971	PASS	7	6.29	PASS	10	7	5.30	1.19	1.19	PDE4B	1p31	phosphodiesterase 4B,	phosphodiesterase 4B,
														cAMP-specific (dunce	cAMP-specific (dunce
														(Drosophila)-homolog	(Drosophila)-homolog
														phosphodiesterase	phosphodiesterase
MLH1	U07418_at	U07418	PASS	9	7.11	PASS	12	9	6.00	1.19	1.19	hmlh1			human homolog of E. coli
															mutL gene product, Swiss-
															Prot Accession Number
															P23367
CTNNA1	U03100_at	U03100	PASS	5	6.40	PASS	10	5	5.40	1.19	1.19	CTNNA1	5q31	catenin (cadherin-associated	catenin (cadherin-associated
														protein), alpha 1 (102 kD)	protein), alpha 1 (102 kD)
BAP	U72511_at	U72511	PASS	9	29.78	PASS	13	9	25.15	1.18	1.18	hBAP		B-cell receptor associated	BAP; prohibitin related
														protein	protein, similar to EST with
															GenBank Accession
															Number H45225; see
															corresponding genomic
															sequence in GenBank
															Accession Number U72506
PSMA2	M64992_at	M64992	PASS	9	14.11	PASS	13	9	11.92	1.18	1.18	PSMA1	11p15.1	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, alpha	macropain) subunit, alpha
														type, 1	type, 1
HINT	U51004_at	U51004	PASS	9	49.89	PASS	13	9	42.15	1.18	1.18	PKCI-1		protein kinase C inhibitor	putative protein kinase C
															inhibitor
MPP11	X98260_at	X98260	PASS	5	7.00	PASS	12	5	5.92	1.18	1.18	mpp11		M-phase phosphoprotein 11
PAM	M37721_at	M37721	PASS	9	5.56	PASS	10	9	4.70	1.18	1.18	PAM	5q	peptidylglycine alpha-	peptidylglycine alpha-
														amidating monooxygenase	amidating monoxygenase
K143_COSC	D63477_at	D63477	PASS	8	6.00	PASS	13	8	5.08	1.18	1.18	KIAA0143			The KIAA0143 gene
															product is related to a
															putative C. elegans gene
															encoded on cosmid C32D5
BRG1	U29175_at	U29175	PASS	9	7.78	PASS	12	9	6.58	1.18	1.18	BRG1		transcriptional activator	similar to product encoded
															by GenBank Accession
															Number D26156
H2B_f	M60750_f_at	M60750	PASS	7	10.71	PASS	13	7	9.08	1.18	1.18	H2BFL	6p21.3	H2B histone family,	H2B histone family,
														member L	member L
SAS	U01160_at	U01160	PASS	9	5.56	PASS	7	9	4.71	1.18	1.18	SAS		SAS
TP53BP2	U50078_at	U50078	PASS	7	8.14	PASS	13	7	6.92	1.18	1.18	HERC1	15qter-pter	hect (homologous to the	hect (homologous to the
														A6-AP (UBE3A) carboxyl	E6-AP (UBE3A) carboxyl
														terminus) domain and	terminus) domain and
														RCC1 (CHC1)-like domain	RCC1 (CHC1)-like domain
														(RLD) 1	(RLD) 1
CRE5	AFFX-CreX-	AFFX-CreX	PASS	9	199.44	PASS	13	9	170.00	1.17	1.17
GRL	M10901_at	M10901	PASS	8	7.13	PASS	13	8	6.08	1.17	1.17	GRL	5q31-q32	glucocorticoid receptor	glucocorticoid receptor
PGE2R	U19487_at	U19487	PASS	5	5.60	PASS	9	5	4.78	1.17	1.17	PTGER2	5p13.1	prostaglandin E receptor 2	prostaglandin E receptor 2
														(subtype EP2), 53 kD	(subtype EP2), 53 kD
DNAJ	L08069_at	L08069	PASS	8	11.63	PASS	13	8	9.92	1.17	1.17	HSJ2		heat shock protein, DNAJ-	heat shock protein, DNAJ-
														like 2	like 2
HG2815-HT2	HG2815-HT2	HG2815-HT	PASS	9	37.67	PASS	13	9	32.15	1.17	1.17
GAPDH5	AFFX-HUM	AFFX-HUM	PASS	9	124.78	PASS	13	9	1.17	1.17
U30827_s_at	U30827_s_at	U30827	PASS	9	21.33	PASS	13	9	18.23	1.17	1.17	SRp40		SRp40-3	member of the family of SR
															protein pre-mRNA splicing
															factors; alternatively spliced
ERP31	X94910_at	X94910	PASS	8	19.25	PASS	13	8	16.46	1.17	1.17			ERp28	Similar to ULA 5 product,
															AC P30040
TCP1	X52882_at	X52882	PASS	8	11.38	PASS	12	8	9.75	1.17	1.17				t-complex polypeptide 1
															(AA 1-556)
DAP5	AFFX-DapX-	AFFX-Dap	PASS	9	242.44	PASS	13	9	207.85	1.17	1.17
SGTPBP	U57094_at	U57094	PASS	6	11.00	PASS	9	6	9.44	1.16	1.16	RAB27A		RAB27A, member RAS	RAB27A, member RAS
														oncogene family	oncogene family
SF2P32	M69039_at	M69039	PASS	8	9.13	PASS	13	8	7.85	1.16	1.16	CIQBP	17p13.3	complement component 1,	complement component 1,
														q subcomponent binding	q subcomponent binding
														protein	protein
UBE2A	M74524_at	M74524	PASS	7	6.00	PASS	12	7	5.17	1.16	1.16	UBE2A	Xq24-q25	ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E2A (RAD6	enzyme E2A (RAD6
														homolog)	homolog)
CCT4	U38846_at	U38846	PASS	9	30.67	PASS	13	9	26.46	1.16	1.16	SRB		stimulator of TAR RNA
														binding
FRG1	L76159_at	L76159	PASS	6	7.67	PASS	13	6	6.62	1.16	1.16	FRG1	4q35	FSHD region gene 1	FSHD region gene 1
M57466_s_at	M57466_s_at	M57466	PASS	9	70.67	PASS	13	9	61.08	1.16	1.16	HLA-DPB1	6p21.3	major histocompatibility	major histocompatibility
														complex, class II, DP	complex, class II, DP
														beta 1	beta 1
U44799_s_at	U44799_s_at	U44799	PASS	6	6.00	PASS	10	6	5.20	1.15	1.15			U1-snRNP binding protein
														homolog
RASA1	M23379_at	M23379	PASS	5	6.00	PASS	10	5	5.20	1.15	1.15	RASA1	5q13	RAS p21 protein activator	RAS p21 protein activator
														(GTPase activating protein)	(GTPase activating protein)
														1	1
J0621_s_at	J02621_s_at	J02621	PASS	9	26.44	PASS	13	9	22.92	1.15	1.15	HMG14	21q22.3		high-mobility group
															(nonhistone chromosomal)
															protein 14
YES1	M15990_at	M15990	PASS	7	5.43	PASS	7	7	4.71	1.15	1.15	YES1	18p11.31-		v-yes-1 Yamaguchi
													p11.21		sarcoma viral oncogene
															homolog 1
CTSL	X12451_at	X12451	PASS	6	6.33	PASS	10	6	5.50	1.15	1.15	CTSL	9q21-q22	cathepsin L	cathepsin L
WI9119	M24069_at	M24069	PASS	7	6.71	PASS	12	7	5.83	1.15	1.15	CSDA	12p13.1	cold shock domain protein	cold shock domain protein
														A	A
Z25521_s_at	Z25521_s_at	Z25521	PASS	9	16.11	PASS	13	9	14.00	1.15	1.15			integrin associated protein
CISACTS	M82882_at	M82882	PASS	7	7.86	PASS	12	7	6.83	1.15	1.15	ELF1			E74-like factor 1 (ets
															domain transcription factor)
K181	D80003_at	D80003	PASS	8	6.13	PASS	12	8	5.33	1.15	1.15	KIAA0181
CAMLG	U18242_at	U18242	PASS	7	6.57	PASS	11	7	5.73	1.15	1.15	CAMLG	5q23	calcium modulating ligand	calcium modulating ligand
RANBP1	D38076_at	D38076	PASS	7	9.00	PASS	13	7	7.85	1.15	1.15	RANBP1		RAN binding protein 1	RAN binding protein 1
ICT1	X81788_at	X81788	PASS	7	6.14	PASS	11	7	5.36	1.15	1.15	ICT1		immature colon carcinoma	immature colon carcinoma
														transcript 1	transcript 1
RB1	L41870_at	L41870	PASS	7	5.86	PASS	8	7	5.13	1.14	1.14	RB1	13q14.2	retinoblastoma 1 (including	retinoblastoma 1 (including
														osteosarcoma)	osteosarcoma)
K254	D87443_at	D87443	PASS	7	4.57	PASS	7	7	4.00	1.14	1.14	KIAA0254			KIAA0254 gene product
HG1428-HT1	HG1428-HT1	HG1428-HT	PASS	9	286.67	PASS	13	9	250.92	1.14	1.14
M31520_rna1	M31520_rna1	M31520	PASS	9	154.78	PASS	13	9	135.54	1.14	1.14	rps24		ribosomal protein S24	unknown protein
NAP1L1	M86667_at	M86667	PASS	9	33.78	PASS	13	9	29.62	1.14	1.14	NAP1L1		nucleosome assembly	nucleosome assembly
														protein 1-like 1	protein 1-like 1
RBM3	U28686_at	U28686	PASS	8	12.13	PASS	11	8	10.64	1.14	1.14	RBM3	Xp11.2	RNPL	RNA binding motif protein
															3
U58046_s_at	U58046_s_at	U58046	PASS	5	5.80	PASS	10	5	5.10	1.14	1.14	EIFS310	10q26	eukaryotic translation	eukaryotic translation
														initiation factor 3, subunit	initiation factor 3, subunit
														10, (theta, 170 kD)	10, (theta, 170 kD)
VBP1	U56833_at	U56833	PASS	8	6.38	PASS	13	8	5.62	1.14	1.14	VBP1	Xq28	von Hippel-Lindau	von Hippel-Lindau
														binding protein 1	binding protein 1
TCLLYM_rna	X82240_rna1	X82240	PASS	5	15.20	PASS	12	5	13.42	1.13	1.13	TCL1A	14q32.1	T cell leukemia/lymphoma	T cell leukemia/lymphoma
														1	1
ACP1	U25849_at	bU25849	PASS	6	9.83	PASS	13	6	8.69	1.13	1.13	ACP1	2p25	acid phosphatase 1,	acid phosphatase 1,
														soluble	soluble
M60483_rna	M60483_rna	M60483	PASS	8	6.50	PASS	12	8	5.75	1.13	1.13	PPP2CA	5q23-q31	protein phosphatase 2	protein phosphatase 2
														(formerly 2A), catalytic	(formerly 2A), catalytic
														subunit, alpha isoform	subunit, alpha isoform
PSMHC8	D00762_at	D00762	PASS	7	11.43	PASS	9	7	10.11	1.13	1.13	PSMA3	14q23	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, alpha	macropain) subunit, alpha
														type, 3	type, 3
LGALS2	M87860_at	M87860	PASS	7	26.71	PASS	11	7	23.64	1.13	1.13	LGALS2		S-lac lectin
D11327_s_at	D11327_s_at	D11327	PASS	8	5.75	PASS	10	8	5.10	1.13	1.13	PTPN7	1q32.1	protein tyrosine	protein tyrosine
														phosphatase, non-receptor	phosphatase, non-receptor
														type 7	type 7
EPS3	L34587_at	L34587	PASS	9	13.78	PASS	13	9	12.23	1.13	1.13			RNA polymerase II elonga-	putative
														tion factor SIII, p15 subunit
FEZ2	U60061_at	U60061	PASS	6	5.83	PASS	11	6	5.18	1.13	1.13	FEZ2		FEZ2	zygin 2
U49020_cds2	U49020_cds2	U49020	PASS	8	5.75	PASS	9	8	5.11	1.13	1.13	MEF2A		myocyte-specific enhancer
														factor 2A, C4 form
PPM1A	S87759_at	S87759	PASS	7	6.00	PASS	9	7	5.33	1.13	1.13	PPM1B		protein phosphatase 1B	protein phosphatase 1B
														(formerly 2C), magnesium-	(formerly 2C), magnesium-
														dependent, beta isoform	dependent, beta isoform
EIF4A2	D30655_at	D30655	PASS	9	60.56	PASS	13	9	53.85	1.12	1.12	EIF4A2	18p11.2	eukaryotic translation	eukaryotic translation
														initiation factor 4A,	initiation factor 4A,
														isoform 2	isoform 2
GRLB	HG4582-HT4	HG4582-HT	PASS	5	5.60	PASS	11	5	5.00	1.12	1.12
U12387_s_at	U12387_s_at	U12387	PASS	5	6.60	PASS	10	5	5.90	1.12	1.12	TPMT		thiopurine methyl-	35 kDa monomer, cytosolic
														transferase	protein
AICL	X96719_at	X96719	PASS	5	18.40	PASS	13	5	16.46	1.12	1.12	CLECSF2	12p	C-type lectin	C-type (calcium dependent,
															carbohydrate-recognition
															domain) lectin, superfamily
															member 2 (activation-
															induced)
K69_DS0556	D31885_at	D31885	PASS	9	16.56	PASS	13	9	14.85	1.12	1.12	KIAA0069
PSMA5	X61970_at	X61970	PASS	9	13.11	PASS	13	9	11.77	1.11	1.11	PSMA5	1p13	proteasome (prosome,	proteasome (prosome,
														macropain) subunit, alpha	macropain) subunit, alpha
														type, 5	type, 5
PRPS1	D00860_at	D00860	PASS	9	6.11	PASS	12	9	5.50	1.11	1.11	PRPS1	Xq21-q27	phosphoribosyl pyro-	phosphoribosyl pyro-
														phosphate synthetase 1	phosphate synthetase 1
U33936_s_at	U33936_s_at	U33936	PASS	7	5.86	PASS	11	7	5.27	1.11	1.11	ADK	10cen-q24	adenosine kinase	adenosine kinase
LCP2	U20158_at	U20158	PASS	9	17.00	PASS	13	9	15.31	1.11	1.11			SLP-76	76 kDa tyrosine phospho-
															protein
HG2981-HT3	HG2981-HT3	HG2981-HT	PASS	7	10.29	PASS	11	7	9.27	1.11	1.11
PPIB	M63573_at	M63573	PASS	7	17.29	PASS	12	7	15.58	1.11	1.11	PPIB	15	peptidylprolyl isomerase B	peptidylprolyl isomerase B
														(cyclophilin B)	(cyclophilin B)
B56E	L76703_at	L76703	PASS	6	5.17	PASS	9	6	4.67	1.11	1.11	PPP2R5E	7p11.2-p12	protein phosphatase B56-	protein phosphatase 2,
														epsilon	regulatory subunit B (B56),
															epsilon isoform
E_23801	U79282_at	U79282	PASS	5	5.20	PASS	10	5	4.70	1.11	1.11
HSPA8	HG2855-HT2	HG2855-HT	PASS	9	38.56	PASS	13	9	35.00	1.10	1.10
H2AZ	M37583_at	M37583	PASS	9	18.11	PASS	13	9	16.46	1.10	1.10	H2AFZ	4q24	H2A histone family,	H2A histone family,
														member Z	member Z
PHCII	J04973_at	J04973	PASS	9	12.78	PASS	13	9	11.62	1.10	1.10	UQCRC2	16p12	ubiquinol-cytochrome c	ubiquinol-cytochrome c
														reductase core protein II	reductase core protein II
TCRD	M21624_at	M21624	PASS	9	17.33	PASS	13	9	15.77	1.10	1.10	TCRD	14q11.2	T-cell receptor, delta	T-cell receptor, delta
														(V, D, J, C)	(V, D, J, C)
TNFAIP3	M59465_at	M59465	PASS	9	13.33	PASS	13	9	12.15	1.10	1.10	TNFAIP1	17q22-q23	A20	tumor necrosis factor,
															alpha-induced protein 1
															(endothelial)
APBB1	U50939_at	U50939	PASS	7	6.57	PASS	12	7	6.00	1.10	1.10	APPBP1	16q22	Amyloid beta precursor	amyloid beta precursor
														protein binding protein 1	protein-binding protein 1,
															59 kD
BACTINM	AFFX-HSAC	AFFX-HSA	PASS	9	330.67	PASS	13	9	302.92	1.09	1.09
D13S824E	U47635_at	U47635	PASS	6	6.67	PASS	9	6	6.11	1.09	1.09
RAD23B	D21090_at	D21090	PASS	7	6.00	PASS	12	7	5.50	1.09	1.09	RAD23B	3p25.1	RAD23 (S. cerevisiae)	RAD23 (S. cerevisiae)
														homolog B	homolog B
PSMD4	U24704_at	U24704	PASS	7	11.29	PASS	11	7	10.36	1.09	1.09			antisecretory factor-1	similar to Human S5a
															protosome subunit,
															GenBank Accession
															Number U51007
PRKMK1	L11284_at	L11284	PASS	7	10.29	PASS	13	7	9.46	1.09	1.09	PRKMK1	15q22.1-		protein kinase, mitogen-
													q22.33		activated, kinase 1 (MAP)
															kinase kinase 1)
BIOB5	AFFX-BioB-	AFFX-BioB	PASS	9	113.56	PASS	13	9	104.69	1.08	1.08
LKP	L13848_at	L13848	PASS	6	10.83	PASS	10	6	10.00	1.08	1.08	DDX9	1q25	DEAD/H (Asp-Glu-Ala-	DEAD/H (Asp-Glu-Ala-
														Asp/His) box polypeptide 9	Asp/His) box polypeptide 9
														(RNA helicase A, nuclear	(RNA helicase A, nuclear
														DNA helicase II)	DNA helicase II);
															leukophysin)
EFTS	L37936_at	L37936	PASS	8	10.38	PASS	12	8	9.58	1.08	1.08			elongation factor Ts
CBX	U35451_at	U35451	PASS	6	6.17	PASS	10	6	5.70	1.08	1.08	p25beta		heterochromatin protein
															p25
SMN1_rna3	U80017_rna3	U80017	PASS	7	6.00	PASS	9	7	5.56	1.08	1.08	btf2p44		basic transcription factor 2	NAIP
														p44
X03689_s_at	X03689_s_at	X03689	PASS	9	224.56	PASS	13	9	208.08	1.08	1.08	EEF1A2	20q13.3	eukaryotic translation	eukaryotic translation
														elongation factor 1 alpha 2	elongation factor 1 alpha 2
PRPS2	Y00971_at	Y00971	PASS	5	5.00	PASS	11	5	4.64	1.08	1.08	PRPS2	Xpter-q21	phosphoribosyl pyro-	phosphoribosyl pyro-
														phosphate synthetase 2	phosphate synthetase 2
ATP5C1	D16562_at	D16562	PASS	9	29.67	PASS	13	9	27.54	1.08	1.08			ATP synthase gamma-	L(liver)-type ATP synthase
														subunit	gamma-subunit
K191	D83776_at	D83776	PASS	5	6.00	PASS	7	5	5.57	1.08	1.08	KIAA0191			The KIAA0191 gene is
															expressed ubiquitously.;
															The KIAA0191 protein
															retains the C2H2 zinc-
															finger at its N-terminal
															region.
M67468_s_at	M67468_s_at	M67468	PASS	7	5.14	PASS	9	7	4.78	1.08	1.08	FMR1	Xq27.3	fragile X mental retarda-	fragile X mental retarda-
														tion 1	tion 1
ANX7	J04543_at	J04543	PASS	8	8.25	PASS	12	8	7.67	1.08	1.08	ANX7	10q21.1-q21.2	annexin VII	annexin VII (synexin)
CMKBR7	L08177_at	L08177	PASS	8	5.38	PASS	10	8	5.00	1.08	1.08	EB12	13	EB1 2: EBV induced G-	Epstein-Barr virus induced
														protein coupled receptor	gene 2 (lymphocyte-
															specific G protein-coupled
															receptor)
NIFUL	U47101_at	U47101	PASS	9	26.78	PASS	13	9	24.92	1.07	1.07	hNifU		NifU-like protein	Similar to N-terminal
															regions of diazatroph NiFU
															proteins
K242_HYP5	D87684_at	D87684	PASS	8	8.13	PASS	10	8	7.60	1.07	1.07	KIAA0242			similar to a C. elegans
															ZK353.8 protein (S44655)
LCP1	J02923_at	J02923	PASS	9	45.67	PASS	13	9	42.77	1.07	1.07	LCP1	13q14.3	lymphocyte cytosolic	lymphocyte cytosolic
														protein 1 (L-plastin)	protein 1 (L-plastin)
S203_15	L40395_at	L40395	PASS	8	6.50	PASS	9	8	6.11	1.06	1.06				ORF; putative
LAML	HG1078-HT1	HG1078-HT	PASS	7	13.00	PASS	13	7	12.23	1.06	1.06
PBX3	X59841_at	X59841	PASS	6	5.67	PASS	9	6	5.33	1.06	1.06	PBX3	9q33-q34	homeobox protein	pre-B-cell leukemia
															transcription factor 3
SRP9	U20998_at	U20998	PASS	9	15.44	PASS	13	9	14.54	1.06	1.06	SRP9		signal recognition particle	signal recognition particle
														9 kD	9 kD
L33930_s_at	L33930_s_at	L33930	PASS	6	4.67	PASS	10	6	4.40	1.06	1.06			signal transducer CD24
CGR19	U66469_at	U66469	PASS	5	5.40	PASS	10	5	5.10	1.06	1.06			cell growth regulator
														CGR19
SRPK2	U88666_at	U88666	PASS	8	5.38	PASS	12	8	5.08	1.06	1.06	SRPK2	7q22-q31.1	SFRS protein kinase 2	SFRS protein kinase 2
B2M	S82297_at	S82297	PASS	9	164.00	PASS	13	9	155.15	1.06	1.06	B2M	15q21-q22.2	beta-2-microglobulin	beta-2-microglobulin
SRP54	U51920_at	U51920	PASS	6	5.17	PASS	10	6	4.90	1.05	1.05	SRP54		signal recognition particle	signal recognition particle
															54 kD
U84011_s_at	U84011_s_at	U84011	PASS	5	4.80	PASS	9	5	4.56	1.05	1.05	AGL	1p21	amylo-1,6-glucosidase, 4-	amyl-1,6-glucosidase,4-
														alpha-glucanotransferase,	alpha-glucanotransferase,
														isoform 3	(glycogen debranching
															enzyme, glycogen storage
															disease type III)
E_23865	U90912_at	U90912	PASS	7	5.71	PASS	7	7	5.43	1.05	1.05
SFRS3	U30825_at	U30825	PASS	9	31.44	PASS	13	9	29.92	1.05	1.05	SFRS9		splicing factor, arginine/	splicing factor, arginine/
														serine-rich 9	serine-rich 9
HNRPH2	U01923_at	U01923	PASS	7	6.71	PASS	10	7	6.40	1.05	1.05
RPL14	D87735_at	D87735	PASS	9	150.33	PASS	13	9	143.31	1.05	1.05	RPL14		ribosomal protein L14	ribosomal protein L14
W52B_f	HG3576-HT3	HG3576-HT	PASS	9	106.89	PASS	13	9	102.08	1.05	1.05
AMFR	M63175_at	M63175	PASS	5	6.80	PASS	8	5	6.50	1.05	1.05	AMFR	16q21	autocrine motility factor	autocrine motility factor
														receptor	receptor
K73_CYCRP	D38552_at	D38552	PASS	6	6.83	PASS	13	6	6.54	1.05	1.05	KIAA0073			The ha1539 protein is
															related to cyclophilin
MCM3	D38073_at	D38073	PASS	8	6.88	PASS	10	8	6.60	1.04	1.04	MCM3	6p12	minichromosome main-	minichromosome main-
														tenance deficient (S.	tenance deficient (S.
														cerevisiae) 3	cerevisiae) 3
PAK3	U25975_at	U25975	PASS	5	5.60	PASS	10	5	5.40	1.04	1.04	hPAK65		hPAK65	rac/CDC42Hs activated
															kinase; serine kinase;
															Method: conceptual trans-
															lation supplied by author
U67122_s_at	U67122_s_at	U67122	PASS	7	11.00	PASS	13	7	10.62	1.04	1.04			SUMO-1	conjugated post-transla-
															tionally to RanGAP1;
															ubiquitin-related protein;
															similar to UBL1 encoded
															by GenBank Accession
															Number U38784, PIC1
															encoded by GenBank
															Accession Number U61397
															and GMP1 encoded by
															GenBank Accession
															Number U72722
L06797_s_at	L06797_s_at	L06797	PASS	9	33.67	PASS	13	9	32.54	1.03	1.03	CXCR4	2q21	Neuropeptide Y receptor	chemokine (C-X-C motif),
														Y3	receptor 4 (fusin)
CAT_rna1	X04085_rna1	X04085	PASS	7	15.43	PASS	13	7	14.92	1.03	1.03			catalase
SFRS3	D28423_at	D28423	PASS	6	17.33	PASS	12	6	16.83	1.03	1.03			pre-mRNA splicing factor
														SRp20
J02683_s_at	J02683_s_at	J02683	PASS	9	31.56	PASS	13	9	30.69	1.03	1.03	ANT2	Xq24-q26	adenine nucleotide trans-	adenine nucleotide trans-
														locator 2 (fibroblast)	locator 2 (fibroblast)
RPS7_rna1	Z25749_rna1	Z25749	PASS	9	136.56	PASS	13	9	132.85	1.03	1.03	RPS7	2p25	ribosomal protein S7	ribosomal protein S7
HDAC2	U31814_at	U31814	PASS	9	6.78	PASS	10	9	6.60	1.03	1.03	HDAC2	6q21	histone deacetylase 2	histone deacetylase 2
M60974_s_at	M60974_s_at	M60974	PASS	5	5.60	PASS	10	5	5.50	1.02	1.02	DDIT1	1p34-p12	DNA-damage-inducible	DNA-damage-inducible
														transcript 1	transcript 1
SEMA	U60800_at	U60800	PASS	9	22.22	PASS	13	9	21.85	1.02	1.02	CD100		semaphorin
D13631_s_at	D13631_s_at	D13631	PASS	7	11.00	PASS	12	7	10.83	1.02	1.02	KIAA0006
PRKACB	M34181_at	M34181	PASS	5	6.80	PASS	10	5	6.70	1.01	1.01	PRKACB	1	protein kinase, cAMP-	protein kinase, cAMP-
														dependent, catalytic, beta	dependent, catalytic, beta
M26730_s_at	M26730_s_at	M26730	PASS	9	33.78	PASS	13	9	33.31	1.01	1.01	UQBP			ubiquinone-binding protein
															(QP)
GD12	D13988_at	D13988	PASS	6	18.17	PASS	13	6	18.00	1.01	1.01	GD12	10p15	GDP dissociation inhibitor	GDP dissociation inhibitor
														2	2
RPL44	M15661_at	M15661	PASS	9	51.44	PASS	13	9	51.08	1.01	1.01	RPL44		ribosomal protein L44	ribosomal protein L44
ZFPRES24_2	AB000468_at	AB000468	PASS	8	18.75	PASS	13	8	18.69	1.00	1.00	RNF4	4p16.3	ring finger protein 4	ring finger protein 4
BACTIN5	AFFX-HSAC	AFFX-HSA	PASS	9	240.44	PASS	13	9	240.00	1.00	1.00
M87507_s_at	M87507_s_at	M87507	PASS	6	7.50	PASS	12	6	7.50	1.00	1.00	CASP1	11q23	caspase 1, apoptosis-related	caspase 1, apoptosis-related
														cysteine protease	cysteine protease
														(interleukin 1, beta,	(interleukin 1, beta,
														convertase)	convertase)
UVRAG_rna1	X99050_rna1	X99050	PASS	6	5.00	PASS	11	6	5.00	1.00	1.00	UVRAG	11q13	UV radiation resistance	UV radiation resistance
														associated gene	associated gene
RP3	U02556_at	U025556	PASS	5	6.00	PASS	12	5	6.00	1.00	1.00			RP3 candidate gene
X58528_s_at	X58528_s_at	X58528	PASS	5	5.20	PASS	10	5	5.20	1.00	1.00	PMP70		70 kDa peroxisomal
														membrane protein
SFRS3	L10838_at	L10838	PASS	8	17.13	PASS	13	8	17.23	0.99	1.01	SFRS3		splicing factor, arginine/	splicing factor, arginine/
														serine-rich 3	serine-rich 3
METPEP	U29607_at	U29607	PASS	9	27.22	PASS	13	9	27.69	0.98	1.02			methionine aminopeptidase
K253	D87442_at	D87442	PASS	6	8.17	PASS	9	6	8.33	0.98	1.02	KIAA0253
CRE3	AFFX-CreX-	AFFX-CreX	PASS	9	27.78	PASS	13	9	28.46	0.98	1.02
UBE2D3	U39318_at	U39318	PASS	8	19.00	PASS	13	8	19.54	0.97	1.03	UBCH5C		UbcH5C	Transcript is widely
															expressed. Related to S.
															Cerevisiae UBC4 and
															UBC5. Closely related to
															human UbcH5(A) and to
															UbcH5B
U26312_s_at	U26312_s_at	U26312	PASS	6	5.67	PASS	12	6	5.83	0.97	1.03			HP1Hs gamma	similar to Drosphila
															heterochromatin protein
															HP1 Swiss-Prot Accession
															Accession Number P29227,
															and to human hetero-
															chromatin protein HP1Hs-
															alpha encoded by GenBank
															Accession Number
															U26311; contains chromo
															domain; recognized by
															autoantibodies from some
															patients with scleroderma;
															heterochromatin protein
H33B	Z48950_at	Z48950	PASS	9	66.78	PASS	13	9	68.85	0.97	1.03	H3F3B	17q25	histone H3.3	H3 histone, family 3B
															(H3.3B)
NHRPF	L28010_at	L28010	PASS	9	14.89	PASS	13	9	15.38	0.97	1.03	NHRPF	10q11.21	HuRNP F protein	heterogeneous nuclear
															ribonucleoprotein F
E_23665	U90913_at	U90913	PASS	7	6.00	PASS	10	7	6.20	0.97	1.03
YB1	J03827_at	J03827	PASS	9	70.00	PASS	13	9	72.38	0.97	1.03	YB1	1p34		Major histocompatibility
															complex, class II, Y box-
															binding protein I; DNA-
															binding protein B
ID2B	M96843_at	M96843	PASS	9	7.33	PASS	13	9	7.62	0.96	1.04	Id2B		contractile protein
MGC24	D14043_at	D14043	PASS	9	14.22	PASS	13	9	14.77	0.96	1.04			MGC-24 precursor
NDUFV3	X99728_at	X99728	PASS	8	8.63	PASS	13	8	9.00	0.96	1.04
MTND1	L04490_at	L04490	PASS	7	5.86	PASS	8	7	6.13	0.96	1.05	NDUFA9	12p	NADH dehydrogenase	NADH dehydrogenase
														(ubiquinone)	(ubiquinone) 1 alpha
															subcomplex, 9 (39 kD)
STATH	U51678'at	U51678	PASS	8	10.88	PASS	13	8	11.38	0.96	1.05			small acidic protein
X83416_s_at	X83416_s_at	X83416	PASS	7	6.00	PASS	13	7	6.31	0.95	1.05	PRNP	20pter-p12	prion protein (p 27-30)	prion protein (p 27-30)
														(Creutzfeld-Jacob disease,	(Creutzfeld-Jacob disease,
														Gerstmann-Strausler-	Gerstmann-Strausler-
														Scheinker syndrome, fatal	Scheinker syndrome, fatal
														familial insomnia)	familial insomnia)
UBE2L1	S81003_at	S81003	PASS	9	14.00	PASS	13	9	14.77	0.95	1.05	UBE2L3	22q11.2	ubiquitin-conjugating	ubiquitin-conjugating
														enzyme E2L 3	enzyme E2L 3
EIF2A	J02645_at	J02645	PASS	5	7.80	PASS	8	5	8.25	0.95	1.06	EIF2A		eukaryotic translation	eukaryotic translation
														initiation factor 2A	initiation factor 2A
DLD_rna1	L13761_rna1	L13761	PASS	9	6.67	PASS	12	9	7.08	0.94	1.06	DLD	7q31-q32	dihydrolipoamide dehydro-	dihydrolipoamide dehydro-
														genase (E3 component of	genase (E3 component of
														pyruvate dehydrogenase	pyruvate dehydrogenase
														complex, 2-oxo-glutarate	complex, 2-oxo-glutarate
														complex, branched chain	complex, branched chain
														keto acid dehydrogenase	keto acid dehydrogenase
														complex)	complex)
OCLSF	U63717_at	U63717	PASS	7	7.00	PASS	8	7	7.50	0.93	1.07			osteoclast stimulating	OSF; contains SH3 domain
														factor	and ankyrin repeat
GNAO1	U01833_at	U01833	PASS	5	5.60	PASS	9	5	6.00	0.93	1.07	NBP1		nucleotide binding protein	nucleotide binding protein
														1 (E. coli MinD like)	1 (E. coli MinD like)
M63838_s_at	M63838_s_at	M63838	PASS	9	12.33	PASS	13	9	13.23	0.93	1.07	IF116	1q13-qter	interferon-gamma induced	interferon, gamma-
														protein	inducible protein 16
ADD3	U37122_at	U37122	PASS	7	20.71	PASS	13	7	22.23	0.93	1.07	ADD3	10q24.2-q24.3	adducin gamma subunit	adducin 3 (gamma)
MLLT2	L13773_at	L13773	PASS	9	6.00	PASS	12	9	6.50	0.92	1.08	AF-4
Z69030_s_at	Z69030_s_at	Z69030	PASS	7	12.71	PASS	12	7	13.83	0.92	1.09			gamma 1 isoform of 61
														kDa regulatory subunit
														of PP2A
T1G1_xpt1	U49973_xpt1	U49973	PASS	9	7.56	PASS	13	9	8.23	0.92	1.09				ORF1; MER37; putative
															transposase similar to
															pogo element
BTKAP135	U77948_at	U77948	PASS	5	8.40	PASS	13	5	9.15	0.92	1.09	GTF2I	7q11.23	general transcription	general transcription
														factor, H, i	factor, H, i
HOU	U32849_at	U32849	PASS	9	10.00	PASS	12	9	10.92	0.92	1.09	NMI	22q13.3	N-myc (and STAT)	N-myc (and STAT)
														interactor	interactor
KLRB1	HG4263-HT4	HG4263-HT	PASS	9	14.78	PASS	13	9	16.15	0.91	1.09
AHNAK	M80899_at	M80899	PASS	7	18.14	PASS	12	7	19.83	0.91	1.09	AHNAK	11q12-q13		AHNAK nucleoprotein
															(desmoyokin)
NA	X80909_at	X80909	PASS	9	129.22	PASS	13	9	142.69	0.91	1.10	alpha NAC		Nascent polypeptide
														associated complex alpha
														subunit
JAK1	M64174_at	M64174	PASS	5	8.80	PASS	13	5	9.85	0.89	1.12	JAK1	1p32.3-p31.3	Janus kinase 1 (a protein	Janus kinase 1 (a protein
														tyrosine kinase)	tyrosine kinase)
Z49501_s_at	Z48501_s_at	Z48501	PASS	9	113.67	PASS	13	9	127.77	0.89	1.12	PABPL1	3q22-q25	poly(A)-binding protein-	poly(A)-binding protein-
														like 1	like 1
PRTKHT31	HG2167-HT2	HG2167-H	PASS	5	7.00	PASS	9	5	7.89	0.89	1.13
K192_MOPA	D83783_at	D83783	PASS	6	6.00	PASS	13	6	6.77	0.89	1.13	TRAP230	Xq13		thyroid hormone receptor-
														protein, 230 kDa subunit
PRF1	M31951_at	M31951	PASS	6	23.33	PASS	12	6	26.67	0.88	1.14	PRF1	10q22		perforin 1 (preforming
															protein)
PSMC2	D11094_at	D11094	PASS	7	9.71	PASS	12	7	11.17	0.87	1.15	PSMC2	7q22.1-q22.3	proteasome (prosome,	proteasome (prosome,
														macropain) 26S subunit,	macropain) 26S subunit,
														ATPase, 2	ATPase, 2
SDHB	U17886_at	U17886	PASS	5	8.00	PASS	12	5	9.25	0.86	1.16	sdhB		succinate dehydrogenase
														iron-protein subunit B
M21119_s_at	M21119_s_at	M21119	PASS	8	59.00	PASS	13	8	69.15	0.85	1.17				lysozyme precursor (EC
															3.2.1.17)
S31I125	L40397_at	L40397	PASS	9	10.78	PASS	13	9	12.77	0.84	1.18				ORF; putative
RNASE6	U64998_at	U64998	PASS	6	13.33	PASS	10	6	15.80	0.84	1.19			ribonuclease k6 precursor	RNase k6
IK	S74221_at	S74221	PASS	8	10.13	PASS	12	8	12.08	0.84	1.19	IK	2p15-p14	IK cytokine, down-	IK cytokine, down-
														regulator of HLA II	regulator of HLA II
U73477's_at	U73477_s_at	U73477	PASS	6	6.00	PASS	10	6	7.20	0.83	1.20			acidic nuclear phospho-	LANP; PHAPI; I-1pp2a
														protein pp32
M97796_s_at	M97796_s_at	M97796	PASS	6	17.83	PASS	13	6	21.62	0.83	1.21	ID2	2p25	inhibitor of DNA binding 2,	inhibitor of DNA binding 2,
														dominant negative helix-	dominant negative helix-
														loop-helix protein	loop-helix protein
NIP2	U15173_at	U15173	PASS	8	4.88	PASS	12	8	5.92	0.82	1.21	VNIP2		BCL2/adenovirus E1B 19	BCL2/adenovirus E1B 19
														kD-interacting protein 2	kD-interacting protein 2
POLR2B	X63563_at	X63563	PASS	7	6.71	PASS	12	7	8.17	0.82	1.22	POLR2B	4q12	polymerase (RNA) II	polymerase (RNA) II
														(DNA directed) polypeptide	(DNA directed) polypeptide
														B (140 kD)	B (140 kD)
AFX-CreX-	AFFX-CreX-	AFFX-CreX	PASS	8	15.38	PASS	13	8	18.77	0.82	1.22
TRAMP	X63679_at	X63679	PASS	6	8.50	PASS	13	6	10.38	0.82	1.22	TRAM		TRAM protein
SAP18	U96915_at	U96915	PASS	8	13.13	PASS	13	8	16.08	0.82	1.22	SAP18		sin3 associated poly-	SAP 18p
															peptide p18
BIOC5	AFFX-BioC-	AFFX-BioC	PASS	9	16.00	PASS	13	9	19.62	0.82	1.23
RB1	HG4036-HT4	HG4036-HT	PASS	8	11.13	PASS	13	8	14.31	0.78	1.29
TFA	L06633_at	L06633	PASS	8	6.75	PASS	13	8	8.85	0.76	1.31	HE	2	cytohesin binding protein	cytohesin binding protein
														HE	HE
IL7R	M29696_at	M29696	PASS	8	26.38	PASS	11	8	34.73	0.76	1.32	IL7R	5p13	interleukin 7 receptor	interleukin 7 receptor
ZFP20	HG3454-HT3	HG3454-HT	PASS	7	5.43	PASS	9	7	7.22	0.75	1.33
COPB	X70476_at	X70476	PASS	8	6.38	PASS	13	8	8.92	0.71	1.40	COPB2	3q23	coatomer protein complex,	coatomer protein complex,
														subunit beta 2 (beta prime)	subunit beta 2 (beta prime)
RAP1B	HG3521-HT3	HG3521-HT	PASS	9	17.56	PASS	13	9	25.62	0.69	1.46
BIOB3	AFFX-BioB-3	AFFX-BioB	PASS	9	27.11	PASS	13	9	39.77	0.68	1.47
PROGBP	Y12711_at	Y12711	PASS	6	9.33	PASS	13	6	14.00	0.67	1.50			putative progesterone
														binding protein
M27394_s_at	M27394_s_at	M27394	PASS	6	6.00	PASS	11	6	9.73	0.62	1.62			cell surface antigen B1
DAP3	AFFX-DapX-	AFFX-DapX	PASS	9	6.56	PASS	13	9	10.69	0.61	1.63
M14483_rna1	M14483_rna1	M14483	PASS	9	65.89	PASS	13	9	109.31	0.60	1.66	PTMA	2	prothymosin, alpha (gene	prothymosin, alpha (gene
														sequence 28)	sequence 28)
BIOD3	AFFX-BioDn	AFFX-BioD	PASS	9	29.56	PASS	13	9	65.62	0.45	2.22