US 12,600,751 B2Grant

Modified S2 subunit of the coronavirus spike protein

Issue Date:2026-04-14

•22 Claims

•2 Drawing Sheets

Abstract

A recombinant avian coronavirus spike protein or fragment thereof includes a mutation at amino acid position 865. An immunogenic composition includes an avian coronavirus with such spike protein.

Metadata

Assignee

Boehringer Ingelheim Vetmedica GMBH

Inventors

Annika Kraemer-Kuehl
Thomas Min Stephan

Application Information

Application Number:US 17/595,124

Filing Date:2020-05-06

Priority Date:2019-05-10

Art Unit:1671

Classifications

IPC:

C07K14/005A61K39/00

Field of Search:

C07K 14/005A61K 39/00A61K 2039/5258A61K 2039/5254A61K 39/12C12N 2770/20052C12N 7/00C12N 2770/20021C12N 2770/20022C12N 2770/20034

Patent Drawings (2 sheets)

Description

SEQUENCE LISTING

[0001] This application contains a sequence listing in accordance with 37 C.F.R. 1.821-1.825. The sequence listing accompanying this application is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] Avian coronavirus infectious bronchitis virus (IBV) is the prototype gammacoronavirus of the family Coronaviridae, order Nidovirales. Infectious bronchitis virus principally infects the upper respiratory epithelium of chickens, causing a respiratory disease, commonly complicated by secondary bacterial pathogens (Cook et al. 2012. Avian Pathol. 41:239-250). Some IBV strains additionally affect the renal tubuli, oviduct and parts of the gastrointestinal tract, leading to pathological lesions and clinical symptoms in these organ systems. The virus has a worldwide presence in both commercial and backyard chicken. Due to its high genomic variability IBV is discriminated in a wide variety of geno-, sero- and protectotypes. IBV is currently regarded as one of the economically most relevant viral pathogens in the poultry industry.

[0003] Infectious bronchitis virus is an enveloped virus with a positive sense single-stranded RNA genome of 27.6 kb (Cavanagh 2007. Vet. Res. 38:281-297). The first two-thirds of the viral genome comprise a large coding region (also designated as gene 1), divided into two open reading frames 1a and 1b, which encode for at least 15 nonstructural proteins involved in RNA cell tropismon, editing, and transcription. The last one-third of the viral genome codes for structural proteins: the spike protein (S, encoded by gene 2), the envelope protein (E, encoded by gene 3c), the membrane protein (M, encoded by gene 4), and the nucleocapsid protein (N, encoded by gene 6). Proteins S, E and M are part of the viral envelope while protein N forms the ribonucleoprotein core along with the viral RNA. The coronavirus spike protein determines the host species tropism (Kuo et al. 2000. J. Virol. 74:1393-1406). It is a dimeric or trimeric transmembrane protein, which is proteolytically cleaved into two subunits, S1 and S2. The glycosylated S1 domain forms the ‘head’ of the spike protein and contains the receptor binding domain that interacts with 2,3-linked sialic acids on the host cell surface (Promkuntod et al. 2014. Virology. 448:26-32). The S2 domain contains the remaining part of the ectodomain (the ‘stalk’), the transmembrane domain and an endodomain located in the cytoplasm.

[0004] The to date widely used live-attenuated IBV vaccine strains H52 and H120 were developed in the 1960s in the Netherlands, by serial passaging of a Massachusetts serotype IBV strain in embryonated chicken eggs (Bijlenga et al. 2004; Avian Pathol. 33:550-557). Said vaccine strains also have to be propagated in embroynated chicken eggs for production. Today, IBV vaccines (both inactivated and live vaccines) are still propagated in emryonated chicken eggs which is cumbersome and expensive.

[0005] The only cell-line adapted IBV described so far is the IBV strain Beaudette, which efficiently replicates in Vero and BHK cells. Casais et al 2003 (J. Virol. 77; 9084-9089) show that the S protein of Beaudette is the determinant of cell line tropism by generating recombinant IBVs using ectodomain sequences of the Beaudette spike, which were able to transfer the extended cell line tropism to another IBV (M41). WO 2011/004146 discloses that the S2 subunit from Beaudette is responsible for the extended tissue tropism. A sequence within the S2 subunit, a heparan-sulphate binding site from Beaudette, has been identified to be responsible for the extended cell line tropism. Furthermore, Bickerton et al 2018 (Journal of Virology 92 (19)) disclose a Beaudette specific motif of eight amino acids. However, recombinant IBV's with a Beaudette spike S2 subunit are not suitable as vaccines. Ellis et al 2018 (J. Virol. 92(23)) describe that recombinant Beaudette with chimeric spikes with heterologous 51 subunits from M41 or QX in combination with Beaudette spike S2 subunit do not confer sufficient protection against 51 homologous challenges. Also, Beaudette wild type does not provide procection against homologous challenge like other licensed vaccines belonging to the Massachusetts serotype (Hodgson et al 2004: J Virol 78:13804-13811 or Geilhausen et al 1973: Archiv für die gesamte Virusforschung 40: 285-290).

[0006] Fang et al 2005 (Biochemical and Biophysical Research Communication 336; pages 417 to 423) disclose that the adaption of Beaudette for propagation in Vero cells resulted in 49 amino acid modifications, 26 located within the spike protein.

[0007] Taken together, providing IBV vaccines having an extended cell or tissue tropism by exchanging the spike protein to a heterologous Beaudette Spike protein would not result in IBV vaccines providing sufficient efficacy and with the Beaudette Spike sequence would be limited to protection against a Massachusetts serotype strain challenge and missing cross protection against further genotypes. Furthermore, the prior art motifs or sites identified in Beaudette have not been transferred into IBV vaccines showing both an extended cell culture or tissue tropism and efficacy in protection (no interference between extended tropism and vaccine efficacy has been shown).

[0008] Consequently, there is a need for single amino acids or short motifs that can be transferred into IBVs or IBV vaccines without influencing vaccine efficacy but enabling an extended cell or tissue tropism for production.

DETAILED DESCRIPTION OF THE INVENTION

[0009] Before the aspects of the present invention are described, it must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “an antigen” includes a plurality of antigens, reference to the “virus” is a reference to one or more viruses and equivalents thereof known to those skilled in the art, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and methodologies as reported in the publications which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

Composition of Matter

[0010] The present invention solves the problems inherent in the prior art and provides a distinct advance in the state of the art.

[0011] Generally, the present invention provides an avian coronavirus spike protein or fragment thereof comprising an aromatic amino acid at position 865, wherein the spike protein or fragment thereof is not from IBV strain M41.

[0012] Further, the present invention provides an avian coronavirus Spike Protein or fragment thereof, wherein at least a part of the S2 subunit is from an avian coronavirus with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid.

[0013] Further, the present invention provides a recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 865.

[0014] Generally, the present invention provides an IBV spike protein or fragment thereof comprising an aromatic amino acid at position 865, wherein the spike protein or fragment thereof is not from IBV strain M41.

[0015] The present invention also provides an IBV spike protein or fragment thereof, wherein at least a part of the S2 subunit is from an IBV with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid.

[0016] Further, the present invention provides a recombinant IBV spike protein or fragment thereof comprising a mutation at amino acid position 865.

[0017] Advantageously, the experimental data show that coronavirus strains (strains such as exemplarily H52 and CR88 IBV strains) have an extended cell or tissue tropism after modifying a single position, position 865, into an aromatic amino acid (Histidine) within the spike protein.

[0018] The term “coronavirus” is well known to the person skilled in the art. In general coronaviruses are viruses of the subfamily Coronavirinae in the family Coronaviridae, in the order Nidovirales. Coronaviruses are enveloped viruses and have a positive-sense single-stranded RNA genome with a nucleocapsid of helical symmetry. The term “coronavirus” encompasses all strains, genotypes, protectotypes, and serotypes of infectious bronchitis virus. Examples of avian coronaviruses are infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus).

[0019] The term “IBV” refers to infectious bronchitis virus which is well known to the person skilled in the art. The term “IBV” encompasses all strains, genotypes, protectotypes, and serotypes of infectious bronchitis virus.

[0020] The term “mutation” comprises modifications in the viral RNA encoding proteins leading to an alteration of said encoded protein. Further, the term “mutation” comprises genetically engineered mutations. The term mutation relates to, but is not limited to, substitutions (replacement of one or several nucleotides/base pairs), deletions (removal of one, several or all nucleotides/base pairs), and/or insertions (addition of one or several nucleotides/base pairs). As used herein, a mutation may be a single mutation or several mutations, therefore, often the term “mutation(s)” used and relates to both a single mutation and several mutations. However, the term mutation is well known to the person skilled in the art and the person skilled in the art can generate mutations without further ado.

[0021] The term “spike” refers to a specific protein of the avian coronavirus or IBV that is well known by the person skilled in the art. The spike protein is the major inducer of antibodies and a protective immune response. Further, the spike (S) protein facilitates cell entry of the avian coronavirus or IBV by binding cellular receptors on the host cell and also by mediating virus-cell membrane fusion with the host cell membranes. In addition, it determines the cell and tissue tropism of the virus strain.

[0022] The terms “protein”, “amino acid” and “polypeptide” are used interchangeably. The term “protein” refers to a sequence of amino acids composed of the naturally occurring amino acids as well as derivatives thereof. The naturally occurring amino acids are well known in the art and are described in standard text books of biochemistry. Within the amino acid sequence the amino acids are connected by peptide bonds. Further, the two ends of the amino acid sequence are referred to as the carboxyl terminus (C-terminus) and the amino terminus (N-terminus). The term “protein” encompasses essentially purified proteins or protein preparations comprising other proteins in addition. Further, the term also relates to protein fragments. Moreover, it includes chemically modified proteins. Such modifications may be artificial modifications or naturally occurring modifications such as phosphorylation, glycosylation, myristylation and the like.

Mutation 865

[0023] In one aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the aromatic amino acid at amino acid position 865 is introduced by a mutation. The wording “introduced” means that the mutation has been introduced by genetic engineering (artificially, e.g., by human intervention).

[0024] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the mutation is an amino acid substitution, deletion or insertion.

[0025] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a polar amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a glutamine at amino acid position 865 is mutated into a histidine.

[0026] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the aromatic amino acid at amino acid position 865 is a histidine.

Extended Cell or Tissue Tropism

[0027] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the aromatic amino acid at amino acid position 865 or said mutation at amino acid position 865 leads to an extended cell or tissue tropism of the avian coronavirus or IBV.

[0028] The term “cell or tissue” is known by the person skilled in the art. The term cell encompasses cell lines such as the cell lines listed elsewhere herein as well as primary cells. The term tissue encompasses cells from tissues such as the ones listed elsewhere herein, exemplarily such as primary chicken embryo cells from lung or liver or primary chicken fibroblasts. The term encompasses the propagation of cells or tissue (cells) in culture outside the organism. The term “culture” relates to the propagation of cells (such as cell line cells or primary cells or tissue cells) outside an organism under defined culture conditions known by the person skilled in the art.

[0029] The term “extended tropism” means that the avian coronavirus or IBV of the invention can be propagated in cells (such as cell lines) or tissue cells (in addition to primary chicken embryo cells from kidney). In contrast, coronavirus vaccines (such as IBV vaccines) or non-cell culture adapted wildtype coronaviruses or IBVs (cell line adapted IBV Beaudette strains are described) can only be propagated in embryonated chicken eggs or primary chicken embryo cells from kidney (after adaption). Accordingly, a coronavirus (such as IBV) of the invention with extended cell or tissue tropism has the capacity to infect and/or replicate in one or more cell lines or tissue cells other than primary chicken embryo cells from kidney. Preferably, the coronavirus (such as IBV) of the invention with extended cell or tissue tropism has the capacity to infect and/or replicate in one or more cell lines as listed herein. Accordingly, a coronavirus or IBV with extended cell or tissue tropism may, for example, have the capacity to infect and/or replicate in BHK or EB66 cells.

[0030] The term “restricted tropism” means that the avian coronavirus or IBV can be propagated if at all only in primary chicken embryo cells from kidney. Accordingly, a coronavirus or IBV with restricted cell or tissue tropism does not have the capacity to infect and/or replicate in e.g. BHK or EB66 cells.

[0031] Advantageously, the experimental data show that IBV strains such as exemplarily H52 and CR88 have an extended cell or tissue tropism after modifying the single amino acid position 865 within the spike protein into an aromatic amino acid. Further, it has been shown that the modification to a Histidine at Position 865 is genetically stable.

[0032] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the avian coronavirus or IBV is infecting and/or replicating in at least one cell line or cell selected from the list consisting of: primary chicken embryo cells from lung or liver or primary chicken fibroblasts, a chicken embryo fibroblast cell line, a duck embryonic stem cell line, a human embryonic kidney cell line, a baby hamster kidney cell line, an African green monkey kidney cell line, a rabbit kidney cell line, a canine kidney cell line, a chicken liver cell line, a bovine kidney cell line, a porcine kidney cell line and an insect cell line.

[0033] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the avian coronavirus or IBV is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1 (Douglas Foster), EB66 (duck embryonic stem cell line), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).

[0034] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the avian coronavirus or IBV is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.

[0035] Preferably, the IBV is infecting and/or replicating in the EB66 or BHK cell line.

[0036] All mentioned cell lines are well known to the person skilled in the art and are commercially and/or publicly available. MDCK cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CCL-34 or ATCC CRL-2285. DF-1 cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CRL-12203). PBS-12SF cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC PTA-8565 or deposited at RRID under CVCL 1K17. BHK-21 cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CCL-10. HEK 293T cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CRL-3216. Vero cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CCL-81. MA104 and cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CRL-2378. RK13 cells are exemplarily deposited at the American Tissue Culture Collection under accession number ATCC CCL-37.

Numbering of Amino Acid Position 865

[0037] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the numbering of amino acid position 865 refers to the amino acid position 865 in the spike protein of an IBV H52, an IBV H120 or an M41.

[0038] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the numbering of amino acid position 865 refers to the amino acid position 865 in the spike protein of an IBV H52.

[0039] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the numbering of amino acid position 865 refers to the amino acid position 865 in the spike protein as exemplarily given in SEQ ID NO:1.

[0040] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein.

[0041] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention for determining the amino position 865 in a spike protein the amino acid sequence is aligned to the amino acid sequence of SEQ ID NO:1.

[0042] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 is within the S2 subunit of the spike protein.

[0043] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 867 of the spike protein sequence of IBV CR88.

[0044] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 868 of the spike protein sequence of IBV QX.

[0045] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 869 of the spike protein sequence of IBV Q1.

[0046] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 868 of the spike protein sequence of IBV Var2.

[0047] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 872 of the spike protein sequence of IBV Brazil.

[0048] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the amino acid position 865 corresponds to amino acid position 871 of the spike protein sequence of IBV Ark99.

[0049] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the spike protein has one or more of the following amino acids selected from the group consisting of:

- [0050] 862 is an alanine, and/or
- [0051] 864 is an alanine, and/or
- [0052] 866 is a valine, and/or
- [0053] 867 is an aspartate, and/or
- [0054] 868 is an arginine.
  The numbering of said amino acid positions refer to the amino acid positions within the spike protein as exemplarily given in SEQ ID NO:1.
  Spike

[0055] The present invention also provides a spike protein or fragment thereof as described above, wherein the spike protein or fragment thereof is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); Transmissible gastro-enteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), porcine haemagglutinating encephalomyelitis virus (PHEV); Severe acute respiratory syndrome coronavirus (SARS-CoV), Middle east respiratory syndrome coronavirus (MERS-CoV) Human Coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), Mouse Hepatitis Virus (MHV), Bovine coronavirus (BCV). Thus, the present invention also provides a coronavirus spike protein or fragment thereof, wherein at least a part of the S2 subunit is from a coronavirus with a restricted cell or tissue tropism, and wherein the amino acid position 865 is an aromatic amino acid and wherein the spike protein is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); Transmissible gastro-enteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), porcine haemagglutinating encephalomyelitis virus (PHEV); Severe acute respiratory syndrome coronavirus (SARS-CoV), Middle east respiratory syndrome coronavirus (MERS-CoV) Human Coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), Mouse Hepatitis Virus (MHV), Bovine coronavirus (BCV). Further, the present invention also provides a recombinant coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 865, wherein the spike protein is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV), turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus), feline infectious peritonitis virus (FIPV), feline enteric coronavirus (FECV); Transmissible gastro-enteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), porcine haemagglutinating encephalomyelitis virus (PHEV); Severe acute respiratory syndrome coronavirus (SARS-CoV), Middle east respiratory syndrome coronavirus (MERS-CoV) Human Coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), human coronavirus HKU1 (HCoV-HKU1), human coronavirus OC43 (HCoV-OC43); canine coronavirus (CCoV), canine respiratory coronavirus (CRCoV), Mouse Hepatitis Virus (MHV), Bovine coronavirus (BCV).

[0056] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention the avian coronavirus spike protein or fragment thereof is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus).

[0057] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention the avian coronavirus is IBV (infectious bronchitis virus).

[0058] IBV strains can be classified by serotype and genotype. Serotype classification involves treatment of the virus with neutralizing antibodies, whereas genotype classification generally involves examining the sequence of the S1 (spike) protein. However, the different IBV strains are well known to the person skilled in the art. Infectious bronchitis virus was first discovered in the United States in the 1930s.

[0059] The first IBV serotype identified was Massachusetts and remained the only serotype until the discovery of a different IBV serotype in 1956. Nowadays, several additional serotypes, including Arkansas and Delaware have been identified in the United States of America in addition to the originally identified Massachusetts type. Today, IBV Mass viruses can be identified in many countries of the world.

[0060] The IBV strain Beaudette is of Massachusetts serotype and was derived following at least 150 passages in chicken embryos. The IBV strain Beaudette was originally isolated by Beaudette and Hudson (J. Am. Vet. Med. A. 90, 51-60, 1937) and passaged in chicken embryos. Other Massachusetts serotype IBV strains besides Beaudette are H120, H52, and M41. The H120 strain was passaged 120 times in embryonated chickens eggs.

[0061] IBV QX is described as virulent field isolate of IBV which was originally isolated in China. However, the virus has spread towards Europe and has been identified in parts of Western Europe, predominantly in the Netherlands, but also in Germany, France, Belgium, Denmark and in the UK. In addition, the QX genotype or serotype has been described in several countries in Asia and Africa.

[0062] The strains designated “Italien-02” or “Italy-02” was isolated in the late 1990's in Italy. The sequence analysis of one of these isolates was published in 2002 (NCBI-BLAST, number AJ457137). However, studies have shown that this Italian-02 strain is widespread in Europe and that, apart from IBV variant strain 4/91 it has become one of the most predominant genotypes in the UK, Spain, France and The Netherlands.

[0063] Since 1996 a new Infectious Bronchitis virus (IBV) genotype, referred to as Q1, has circulated in China and was reported for the first time in Italy in 2011. Q1 is associated with an increase of mortality, kidney lesions and proventriculitis.

[0064] Furthermore, strains D274, B1648/D8880, D1466, V1397 and Arkansas have been identified in Europe as well.

[0065] It is in the general knowledge of a person skilled in the art where to obtain any IBV strains. IBV strains can be be commercially purchased, obtained from scientific Institutes or the genomes can be synthetical synthesized as complementary DNA as IBV strains have been sequenced and the sequences have been published and are, thus, available. Furthermore, IBV strains can be isolated from the field. The methods to isolate IBV strains and to characterize the IBV strains are well known to the person skilled in the art. Valter Leonardo de Quadros 2011 (Dissertation, Das Infektiöse Bronchitis Virus (IBV): Molekularbiologische Untersuchungen zur Diagnostik and zum Vorkommen sowie zur Pathogenität des Genotyps IBV QX in spezifisch pathogenfreien (SPF) Broilern, Freie Universität Berlin), Worthington et al. 2009 (Avian Pathology 37(3), 247-257), Liu et al. 2009 (Virus Genes 38: 56-65), Dolz et al. 2006 (Avian Pathology 35 (2): 77-85), Farsang et al. 2002 (Avian Pathology 31: 229-236) and Feng et al. 2014 (Virus Genes 49: 292-303) describe how to isolate and differentiate different IBV strains.

[0066] IBV strains are typically differentiated by the coding sequence of the 51 subunit of the spike protein (Valastro et al. 2016. Infect Genet Evol. 39:349-364) but can also be differentiated by their complete nucleotide sequence or the sequences of specific proteins such as the spike protein, nucleocapsid protein, envelope (E) protein or membrane (M) glycoprotein. Because the spike protein determines host tropism and antigenicity of IBV, the IBV genotypes are classified by the coding sequence of the subunit 1 of the spike proteins. Alternatively, IBV strains can be differentiated by their serotype. Serotype classification involves serological assays of the virus involving serotype-specific antibodies.

[0067] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV with a genotype or serotype or strain selected from a list consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (such as Maine 209), Massachusetts (such as H52, H120, excluding M41), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88).

[0068] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is not from a Beaudette genotype or serotype.

[0069] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is not from IBV strain M41.

[0070] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes or strains consisting of: Massachusetts (not M41), 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.

[0071] The wording “not M41” is used equivalent to excluding M41. Thus, the wording “Massachusetts (not Beaudette)” means that spike proteins or fragments thereof from Massachusetts strains such as H52 and H120 are comprised, but spike proteins or fragments thereof from M41 strains are excluded.

[0072] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes consisting of: Massachusetts (not M41), 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.

[0073] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41) and 4/91.

[0074] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01 and Spain/96/334.

[0075] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.

[0076] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.

[0077] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.

[0078] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Italy 02 strain is selected from a list consisting of: Spain/99/316, Italy-02, UK-L633-04, It-497-02, Spain/05/866, Spain/04/221, Spain/00/337, Spain/155/09 and Spain/03/08.

[0079] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.

[0080] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.

[0081] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013, and IBV/Brasil/351/1984.

[0082] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV of Massachusetts (not M41) or 4/91 genotype or serotype.

[0083] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV of Massachusetts (not M41) genotype or serotype.

[0084] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is from an IBV of 4/91 genotype or serotype.

[0085] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV strain is H52, H120 or CR88.

[0086] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV strain is H52 or H120.

[0087] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0088] The term “identity” or “sequence identity” is known in the art and refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis, e.g., the sequences are “identical” at a particular position if at that position, the nucleotides or amino acid residues are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to give % sequence identity. Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods to determine the sequence identity are designed to give the largest match between the sequences tested. Methods to determine sequence identity are codified in publicly available computer programs which determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally align sequences using default gap weights in order to produce the highest level of sequence identity between the given and reference sequences. As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% “sequence identity” to a reference nucleotide sequence, it is intended that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity relative to the reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 15%, preferably 10%, even more preferably 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5′ or 3′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Analogously, by a polypeptide having a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence, it is intended that the given amino acid sequence of the polypeptide is identical to the reference sequence except that the given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid alterations per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or the carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in the one or more contiguous groups within the reference sequence. Preferably, residue positions which are not identical differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.

[0089] The terms “identity”, “sequence identity” and “percent identity” are used interchangeably herein. For the purpose of this invention, it is defined here that in order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid for optimal alignment with a second amino or nucleic acid sequence). The amino acid or nucleotide residues at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical positions/total number of positions (i.e. overlapping positions)×100). Preferably, the two sequences are of the same length.

[0090] A sequence comparison may be carried out over the entire lengths of the two sequences being compared or over fragments of the two sequences. Typically, the comparison will be carried out over the full length of the two sequences being compared. However, sequence identity may be carried out over a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.

[0091] The skilled person will be aware of the fact that different computer programs are available to determine the homology between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package, using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.

[0092] The protein sequences or nucleic acid sequences of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed with the BLASTP program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTP and BLASTN) can be used. See the homepage of the National Center for Biotechnology Information.

[0093] As used herein, it is in particular understood that the term “identical to the sequence of SEQ ID NO: X” is equivalent to the term “identical to the sequence of SEQ ID NO: X over the length of SEQ ID NO: X” or to the term “identical to the sequence of SEQ ID NO: X over the whole length of SEQ ID NO: X”, respectively. In this context, “X” is any integer selected from 1 to 31 so that “SEQ ID NO: X” represents any of the SEQ ID NOs mentioned herein.

[0094] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0095] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0096] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 4 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0097] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 5 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0098] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 6 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0099] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 7 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0100] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0101] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the IBV spike protein or fragment thereof is selected from a list of genotypes consisting of: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.

[0102] Valastro et al 2016 (Infection, Genetics and Evolution 39; 349-364) describe a phylogeny-based classification system combined with a lineage nomenclature for the assignment of IBV strains. 6 genotypes (GI to GVI) are defined that together comprise 32 distinct viral lineages.

[0103] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the spike protein or fragment thereof is not from the GI-1 genotype. The GI-1 genotype relates to the Massachusetts genotype/serotype.

[0104] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit from an avian coronavirus with a restricted cell or tissue tropism is selected from the group consisting of: Infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus).

[0105] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit from an avian coronavirus with a restricted cell or tissue tropism is from IBV (infectious bronchitis virus).

[0106] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes or strains consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (such as Maine 209), Massachusetts (such as H52, H120; excluding M41), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88) or wherein said at least a part of the S2 subunit is not from IBV strain M41.

[0107] Thus, in another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is not from IBV strain M41.

[0108] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes or strains consisting of Massachusetts (not M41), 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.

[0109] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41), 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.

[0110] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01 and Spain/96/334.

[0111] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.

[0112] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.

[0113] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.

[0114] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Italy 02 strain is selected from a list consisting of: Spain/99/316, Italy-02, UK-L633-04, It-497-02, Spain/05/866, Spain/04/221, Spain/00/337, Spain/155/09 and Spain/03/08.

[0115] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.

[0116] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.

[0117] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013 and IBV/Brasil/351/1984.

[0118] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41) and 4/91.

[0119] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV Massachusetts (not M41) genotype or serotype.

[0120] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV strain H120, H52 or CR88.

[0121] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit is from an IBV strain H120 or H52.

[0122] In another specific aspect of the avian coronavirus spike protein or fragment thereof according to the present invention the at least a part of the S2 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids from a S2 subunit sequence of an avian coronavirus or IBV with a restricted cell or tissue tropism or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.

[0123] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the at least a part of the S2 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids from a S2 subunit sequence of an avian coronavirus or IBV as described herein or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.

[0124] In another specific aspect of the IBV spike protein or fragment thereof according to the present invention said at least a part of the S2 subunit from an IBV with a restricted cell or tissue tropism has at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of the amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.

[0125] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the coronavirus or IBV with restricted cell or tissue tropism is restricted to infection and/or replication in emryonated chicken eggs and/or primary chicken kidney cells.

[0126] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the coronavirus or IBV with restricted cell or tissue tropism is not infecting and/or replicating in EB66 cells.

[0127] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the coronavirus or IBV with restricted cell or tissue tropism is not infecting and/or replicating in BHK cells.

[0128] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the coronavirus or IBV with restricted cell or tissue tropism is not infecting and/or replicating in PBS-12SF and/or HEK 293T cells.

Fragment

[0129] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1077 amino acids.

[0130] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the fragment of the avian coronavirus or IBV spike protein has a length of at least 1000 amino acids.

[0131] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1075 amino acids from the N-Terminus.

[0132] The term “N-terminus” is well known to the person skilled in the art. The N-terminus is also termed amino-terminus, NH2-terminus, N-terminal end or amine-terminus. When the protein is translated from messenger RNA, it is created from N-terminus to C-terminus. Thus, the N-terminus is the start of an amino acid chain (protein or polypeptide) comprising said amine group (—NH2).

[0133] In another specific aspect of the avian coronavirus or IBV spike protein or fragment thereof according to the present invention the fragment of the avian coronavirus or IBV spike protein is the ectodomain of the spike protein.

[0134] The term “ectodomain” is well known to a person skilled in the art. The spike protein comprises different functional parts, the signal sequence, the ectodomain, the transmembrane domain and the endodomain (from N-terminus to C-terminus). Thus, after cleavage of the signal sequence, the N-terminus of the spike protein starts with the ectodoamin. The IBV spike ectodoamins has a length of about 1075 amino acids and differs by a a few amino acids in length dependent on the IBV strain.

[0135] In another specific aspect of the avian coronavirus or IBV spike protein according to the present invention the aromatic amino acid at amino acid position 865 or the mutation at amino acid position 865 to an aromatic amino acid is genetically stable. Advantageously, the experimental data show that the aromatic amino acid at amino acid position 865 or the mutation at amino acid position 865 to an aromatic amino acid is genetically stable and remains stable over time (over passage).

[0136] The term “genetically stable” means that the aromatic amino acid at amino acid position 865 or the mutation at amino acid position 865 to an aromatic amino acid remains over time (over passage). Preferably, said aromatic amino acid at amino acid position 865 or the mutation at amino acid position 865 to an aromatic amino acid is still present after at least 3 passages, more preferably after at least 6 passages, even more preferably after at least 9 passages, even more preferably after at least 12 passages, most preferred after 15 passages in cell culture or tissue culture of an IBV having said avian coronavirus or IBV spike protein according to the present invention.

Nucleotide Sequences and Plasmids

[0137] Further, the present invention provides a nucleotide sequence encoding the spike protein or fragment thereof as described herein.

[0138] Further, the present invention provides a plasmid comprising a nucleotide sequence as described herein.

[0139] The term “nucleic acid” or “nucleic acid sequence” or “nucleotide sequence” refers to polynucleotides including DNA molecules, RNA molecules, cDNA molecules or derivatives. The term encompasses single as well as double stranded polynucleotides. The nucleic acid of the present invention encompasses isolated polynucleotides (i.e. isolated from its natural context) and genetically modified forms. Moreover, comprised are also chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificially modified ones such as biotinylated polynucleotides. Further, the terms “nucleic acid” and “polynucleotide” are interchangeable and refer to any nucleic acid. The terms “nucleic acid” and “polynucleotide” also specifically include nucleic acids composed of nucleotides with the nucleobases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0140] The term “plasmid” refers to cytoplasmic DNA that replicates independently of the bacterial chromosome within a bacterial host cell. In a specific aspect of the present invention the term “plasmid” and/or “transfer plasmid” and/or “donor plasmid” refers to an element of recombinant DNA technology useful for construction of e.g. recombinant viruses or an expression cassette for insertion into a viral vector. In another specific aspect the term “plasmid” may be used to specify a plasmid useful for DNA vaccination purposes.

Cell

[0141] Further, the present invention provides a cell comprising a plasmid as described herein. The cell can be an eukaryotic or prokaryotic cell.

Viral Particle, Avian Coronavirus and IBV

[0142] Further, the present invention provides a viral particle comprising a spike protein or fragment thereof as described herein.

[0143] Further, the present invention provides an avian coronavirus comprising the spike protein or fragment thereof as described herein.

[0144] Further, the present invention provides an IBV (infectious bronchitis virus) comprising the spike protein as described herein.

[0145] In another specific aspect of the avian coronavirus or IBV according to the present invention the avian coronavirus or IBV is attenuated.

[0146] The term “attenuated” refers to a pathogen having a reduced virulence in comparison to the wildtype isolate. In the present invention, an attenuated IBV is one in which the virulence has been reduced so that it does not cause clinical signs of an IBV infection but is capable of inducing an immune response in the target animal, but may also mean that the clinical signs are reduced in incidence or severity in animals infected with the attenuated IBV in comparison with a “control group” of animals infected with non-attenuated IBV and not receiving the attenuated virus. In this context, the term “reduce/reduced” means a reduction of at least 10%, preferably 25%, even more preferably 50%, still more preferably 60%, even more preferably 70%, still more preferably 80%, still more preferably 90%, even more preferably 95% and most preferably of 100% as compared to the control group infected with non-attenuated IBV as defined above. Thus, an attenuated IBV strain is one that is suitable for incorporation into an immunogenic composition comprising a modified live IBV.

[0147] In another specific aspect of the avian coronavirus or IBV according to the present invention the avian coronavirus or IBV is inactivated.

[0148] Any conventional inactivation method can be used for purposes of the present invention. Thus, inactivation can be performed by chemical and/or physical treatments which are known to the person skilled in the art. Preferred inactivation methods include the addition of cyclized binary ethylenimine (BEI) including the addition of a solution of 2-bromoethyleneamine hydrobromide (BEA), which has been cyclized to binary ethylenimine (BEI). Preferred further chemical inactivation agents comprise but are not limited to Triton X-100, Sodium deoxycholate, Cetyltrimethylammonium bromide, β-Propiolactone, Thimerosal, Phenol and Formaldehyde (Formalin). However, the inactivation may also comprise a neutralization step. Preferred neutralization agents include but are not limited to sodium thiosulfate, sodium bisulfite and the alike.

[0149] Preferred formalin inactivation conditions include formalin concentration between from about 0.02% (v/v)-2.0% (v/v), more preferably from about 0.1% (v/v)-1.0% (v/v), still more preferably from about 0.15% (v/v)-0.8% (v/v), even more preferably from about 0.16% (v/v)-0.6% (v/v), and most preferably about 0.2% (v/v)-0.4% (v/v). Incubation time depends on the resistance of the IBV. In general, the inaction process is performed until no growth of the IBV can be detected in a suitable cultivation system.

[0150] Preferably, the inactivated IBV of the present invention is formalin inactivated, preferably using the concentrations as described hereinabove.

[0151] The inactivated IBV of the invention may be incorporated into liposomes using known technology such as that described in Nature, 1974, 252, 252-254 or Journal of Immunology, 1978, 120, 1109-13. In another embodiment of the invention, the inactivated IBV of the invention may be conjugated to suitable biological compounds such as polysaccharides, peptides, proteins, or the like, or a combination thereof.

[0152] In another specific aspect of the avian coronavirus or IBV according to the present invention the avian coronavirus or IBV is genetically engineered.

[0153] The term “genetically engineered” refers to an avian coronavirus or IBV which has been mutated by using “reverse genetics” approaches. Preferably, the avian coronavirus or IBV according to the present invention has been genetically engineered. The reverse genetics technique involves the preparation of synthetic recombinant viral RNAs and/or cDNA's. However, “reverse genetics” techniques are well known to the person skilled in the art.

[0154] In another specific aspect of the avian coronavirus or IBV according to the present invention the avian coronavirus or IBV is a recombinant.

[0155] The term “recombinant” as used herein relates to a RNA genome (or RNA sequence, cDNA sequence or protein) having any modifications that do not naturally occur to the corresponding RNA genome (or RNA sequence, cDNA sequence or protein). For instance, a RNA genome (or RNA sequence, cDNA sequence or protein) is considered “recombinant” if it contains an insertion, deletion, inversion, relocation or a point mutation introduced artificially, e.g., by human intervention. Therefore, the RNA genomic sequence (or RNA sequence, cDNA sequence or protein) is not associated with all or a portion of the sequences (or RNA sequence, cDNA sequence or protein) with which it is associated in nature. The term “recombinant” as used with respect to a virus, means a virus produced by artificial manipulation of the viral genome. The term “recombinant virus” encompasses genetically modified viruses.

[0156] In another specific aspect of the avian coronavirus or IBV according to the present invention the avian coronavirus or IBV is chimeric.

[0157] The term “chimeric” refers to an avian coronavirus or IBV comprising one or more nucleotide sequences from another coronavirus or IBV. Preferably, the term refers to an IBV virus comprising one or more nucleotide sequences from another IBV strain.

[0158] In another specific aspect of the IBV according to the present invention the IBV is from an IBV with a genotype or serotype or strain selected from a list consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy (such as Italy 02), JMK, LDT3, Maine (such as Maine 209), Massachusetts (M41, H52, H120, Beaudette), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88). Thus, it has to be understood that the IBV may of M41 genotype or serotype, however, the spike protein or fragment thereof is not from IBV strain M41.

[0159] In another specific aspect of the IBV according to the present invention the IBV is selected from a list of genotypes or serotypes or strains consisting of Massachusetts, 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.

[0160] In another specific aspect of the IBV according to the present invention the IBV is selected from a list of genotypes or serotypes consisting of Massachusetts, 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.

[0161] In another specific aspect of the IBV according to the present invention the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01, Beaudette, Spain/96/334 and M41-M21883.

[0162] In another specific aspect of the IBV according to the present invention the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.

[0163] In another specific aspect of the IBV according to the present invention the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.

[0164] In another specific aspect of the IBV according to the present invention the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.

[0165] In another specific aspect of the IBV according to the present invention the Italy 02 strain is selected from a list consisting of: Spain/99/316, Italy-02, UK-L633-04, It-497-02, Spain/05/866, Spain/04/221, Spain/00/337, Spain/155/09 and Spain/03/08.

[0166] In another specific aspect of the IBV according to the present invention the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.

[0167] In another specific aspect of the IBV according to the present invention the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.

[0168] In another specific aspect of the IBV according to the present invention the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013 and IBV/Brasil/351/1984.

[0169] In another specific aspect of the IBV according to the present invention the spike protein or fragment thereof is from an IBV of Massachusetts or 4/91 genotype or serotype.

[0170] In another specific aspect of the IBV according to the present invention the spike protein or fragment thereof is from an Massachusetts IBV genotype or serotype.

[0171] In another specific aspect of the IBV according to the present invention the spike protein or fragment thereof is from an IBV of 4/91 genotype or serotype.

[0172] In another specific aspect of the IBV according to the present invention the IBV strain is H120, H52 or CR88.

[0173] In another specific aspect of the IBV according to the present invention the IBV strain is H120 or H52.

[0174] In another specific aspect of the IBV according to the present invention the IBV has a IBV spike protein or fragment thereof consisting of or comprising an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

[0175] In another specific aspect of the IBV according to the present invention the IBV has an extended cell or tissue tropism.

[0176] In another specific aspect of the IBV according to the present invention the IBV is infecting and/or replicating in at least one cell line or cell as described herein. Preferably, the IBV is infecting and/or replicating in at least one cell line as described herein.

[0177] Further, the present invention provides a cell comprising:

- [0178] the viral particle as described herein, or
- [0179] the avian coronavirus or IBV as described herein.

[0180] In another specific aspect of the cell according to the present invention the cell is a cell line or cell selected from the list consisting of: primary chicken embryo cells, a chicken embryo fibroblast cell line, a duck embryonic stem cell line, a human embryonic kidney cell line, a baby hamster kidney cell line, an african green monkey kidney cell line, a rabbit kidney cell line, a canine kidney cell line, a chicken liver cell line, a bovine kidney cell line, a porcine kidney cell line and an insect cell line.

[0181] In another specific aspect of the cell according to the present invention the cell is a cell line selected from the list consisting of: DF-1 (Douglas Foster), EB66 (duck embryonic stem cell line), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+(Spodoptera frugiperda).

[0182] In another specific aspect of the cell according to the present invention the cell is a cell line selected from the list consisting of: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.

[0183] In another specific aspect of the cell according to the present invention the primary chicken embryo cell is a fibroblast or a cell derived from liver or lung tissue.

[0184] Further, the present invention provides an immunogenic composition comprising:

- [0185] the spike protein as described herein, or
- [0186] the viral particle as described herein, or
- [0187] the avian coronavirus or IBV as described herein.

[0188] Thus, the present invention also provides an immunogenic composition comprising an avian coronavirus or IBV comprising an avian coronavirus or IBV spike protein or fragment thereof, wherein at least a part of the S2 subunit is from an avian coronavirus or IBV with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid. Further, the present invention also provides an immunogenic composition comprising an avian coronavirus or IBV comprising a recombinant avian coronavirus or IBV spike protein or fragment thereof comprising a mutation at amino acid position 865. Further, the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein. Preferably, the amino acid sequence of the spike protein is aligned to the amino acid sequence of SEQ ID NO:1

[0189] Further, the present invention provides a vaccine comprising:

- [0190] the spike protein as described herein, or
- [0191] the viral particle as described herein, or
- [0192] the coronavirus or IBV as described herein.

[0193] Further, the present invention provides a modified live vaccine with an extended cell or tissue tropism comprising:

- [0194] the spike protein as described herein, or
- [0195] the viral particle as described herein, or
- [0196] the coronavirus or IBV as described herein.

[0197] The term “immunogenic composition” refers to a composition that comprises at least one antigen, which elicits an immunological response in the host to which the immunogenic composition is administered. Such immunological response may be a cellular and/or antibody-mediated immune response to the immunogenic composition of the invention. Preferably, the immunogenic composition induces an immune response and, more preferably, confers protective immunity against one or more of the clinical signs of a IBV infection. The host is also described as “subject”. Preferably, any of the hosts or subjects described or mentioned herein is an avian or poultry.

[0198] Usually, an “immunological response” includes but is not limited to one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells and/or gamma-delta T cells, directed specifically to an antigen or antigens included in the immunogenic composition of the invention. Preferably, the host will display either a protective immunological response or a therapeutically response.

[0199] A “protective immunological response” or “protective immunity” will be demonstrated by either a reduction or lack of clinical signs normally displayed by an infected host, a quicker recovery time and/or a lowered duration of infectivity or lowered pathogen titer in the tissues or body fluids or excretions of the infected host.

[0200] In case where the host displays a protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced, the immunogenic composition is described as a “vaccine”.

[0201] The term “modified live” and “attenuated” are used interchangeable herein.

[0202] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine comprises a pharmaceutically acceptable carrier.

[0203] The term “pharmaceutical-acceptable carrier” includes any and all solvents, dispersion media, coatings, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, adjuvants, immune stimulants, and combinations thereof.

[0204] “Diluents” can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin and alkali salts of ethylendiamintetracetic acid, among others.

[0205] In another specific aspect of the immunogenic composition or vaccine according to the present invention the pharmaceutically acceptable carrier is phosphate buffered saline.

[0206] Preferably, the immunogenic composition further comprises sucrose gelatin stabilizer.

[0207] Preferably, the pharmaceutically acceptable carrier is chitosan.

[0208] Chitosan is a natural deacetylated polysaccharide from chitin in crustaceans (e.g., shrimp, crab), insects, and other invertebrates. Recently, Rauw et al. 2009 (Vet Immunol Immunop 134:249-258) demonstrated that chitosan enhanced the cellular immune response of live Newcastle disease vaccine and promoted its protective effect. Further, Wang et al., 2012 (Arch Virol (2012) 157:1451-1461) have shown results revealing the potential of chitosan as an adjuvant for use in a live attenuated influenza vaccine.

[0209] Preferably, the immunogenic composition can further include one or more other immunomodulatory agents such as, e.g. interleukins, interferons, or other cytokines. The amounts and concentrations of adjuvants and additives useful in the context of the present invention can readily be determined by the skilled artisan.

[0210] In some aspects, the immunogenic composition of the present invention contains an adjuvant. “Adjuvants” as used herein, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion. The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D. E. S.), JohnWiley and Sons, NY, pp 51-94 (1995) and Todd et al., Vaccine 15:564-570 (1997). Exemplary adjuvants are the SPT emulsion described on page 147 of “Vaccine Design, The Subunit and Adjuvant Approach” edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of this same book.

[0211] A further instance of an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative. Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Pat. No. 2,909,462 which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol; (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol 974P, 934P and 971P. Most preferred is the use of Carbopol 971P. Among the copolymers of maleic anhydride and alkenyl derivative, are the copolymers EMA (Monsanto), which are copolymers of maleic anhydride and ethylene. The dissolution of these polymers in water leads to an acid solution that will be neutralized, preferably to physiological pH, in order to give the adjuvant solution into which the immunogenic, immunological or vaccine composition itself will be incorporated.

[0212] Further suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or analogs thereof or stimulants of endogenous cytokine release, among many others.

[0213] It is expected that an adjuvant can be added in an amount of about 100 μg to about 10 mg per dose, preferably in an amount of about 100 μg to about 10 mg per dose, more preferably in an amount of about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant may be at a concentration of about 0.01 to 50%, preferably at a concentration of about 2% to 30%, more preferably at a concentration of about 5% to 25%, still more preferably at a concentration of about 7% to 22%, and most preferably at a concentration of 10% to 20% by volume of the final product.

[0214] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine is effective in the treatment and/or prophylaxis of clinical signs caused by IBV in a subject of need. The terms “treatment and/or prophylaxis”, “clinical signs” and “of need” have been defined elsewhere.

[0215] In another specific aspect of the immunogenic composition or vaccine according to the present invention said immunogenic composition or vaccine is formulated for a single-dose administration.

[0216] The volume for a single-dose has been defined elsewhere herein.

[0217] It has furthermore been shown that one dose of the immunogenic composition of the present invention is effective after the administration of such single dose of such immunogenic composition or vaccine.

[0218] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine is administered subcutaneously, intramuscularly, oral, in ovo, via spray, via drinking water or by eye drop.

[0219] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine comprises 1 to 10 log₁₀EID₅₀per dose of the IBV.

[0220] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine comprises 2 to 5 log₁₀EID₅₀per dose of the IBV.

[0221] In another specific aspect of the immunogenic composition or vaccine according to the present invention the immunogenic composition or vaccine comprises 2 to 4 log₁₀EID₅₀per dose of the IBV.

Method for Manufacture, Culturing and Modification

[0222] Further, the present invention provides a method for altering the cell or tissue tropism of an avian coronavirus comprising the use of the avian coronavirus spike protein or fragment thereof as described herein.

[0223] Further, the present invention provides a method for extending the cell or tissue tropism of an avian coronavirus comprising the use of the avian coronavirus spike protein or fragment thereof as described herein.

[0224] Further, the present invention provides a method for the production or manufacture of an avian coronavirus with an extended cell or tissue tropism comprising the use of the avian coronavirus spike protein or fragment thereof as described herein.

[0225] Further, the present invention provides a method for culturing an avian coronavirus in a cell or tissue culture comprising the use of the avian coronavirus spike protein or fragment thereof as described herein.

[0226] Further, the present invention provides a method for modifying an avian coronavirus comprising modifying the amino acid position 865 in the spike protein of said avian coronavirus.

[0227] Further, the present invention provides a method for mutating the amino acid position 865 in an avian coronavirus spike protein comprising:

- [0228] a) providing an avian coronavirus spike nucleotide or protein sequence,
- [0229] b) identifying position 865 in the spike protein by alignment with a reference sequence,
- [0230] c) mutating the position 865 of the spike protein of step b) into an aromatic amino acid,
- [0231] d) obtaining the mutated spike protein of step c).

[0232] Furthermore, the present invention provides a method for mutating the amino acid position 865 in an avian coronavirus spike protein of an avian coronavirus comprising:

- [0233] a) providing an avian coronavirus,
- [0234] b) identifying position 865 in the spike protein by alignment with a reference sequence,
- [0235] c) mutating the position 865 of the spike protein of step b) into an aromatic amino acid,
- [0236] d) obtaining the mutated avian coronavirus of step c).

[0237] The term “obtaining” comprises the harvest, isolation, purification and/or formulation (e.g. finishing, inactivation and/or blending) of said spike protein or fragment thereof. The term “harvest” refers to collecting or recovering said avian coronavirus or IBV with the modified spike protein from the transfected or infected cell or cell line. Any conventional method known in the art can be used, e.g. any separation method. Well known methods in the art comprise centrifugation or filtration, such as using a semi-permeable membrane having a certain pore size. The term “isolation” comprises an isolation step of said avian coronavirus or IBV with the modified spike protein. Methods for the isolation from the transfected or infected cell or cell line are known to a person skilled in the art. Those methods comprise physical and/or chemical methods, including but are not limited to freeze thaw cycles, treatment with ultrasound and the alike. Methods for the “purification” of said said avian coronavirus or IBV with the modified spike protein from the isolate are known to a person skilled in the art, for example by those methods described in Protein purification methods—a practical approach (E. L. V. Harris and S. Angel, eds., IRL Press at Oxford University Press). Those methods include, but are not limited to, separation by centrifugation and/or filtration, precipitation, size exclusion (gel filtration) chromatography, affinity chromatography, metal chelate chromatography, ion-exchange chromatography covalent chromatography, hydrophobic interaction chromatography, and the alike. The vector can be obtained in a purified pure form, or free or substantially free of other cellular materials or culture medium etc. After said isolation and/or purification the antigen exhibits a purity of at least 80%, preferably 80%-90%, more preferably 90%-97%, most preferred more than 97% up to an absolute pure form without any contamination.

[0238] According to a further aspect, “obtaining” as used herein may also include further finishing steps as part of the final formulation process, like the addition of buffer, inactivation, neutralization steps and the alike.

[0239] In another specific aspect of the method according to the present invention the spike protein or fragment thereof has at amino acid position 865 an aromatic amino acid.

[0240] In another specific aspect of the method according to the present invention the aromatic amino acid at position 865 is introduced by a mutation.

[0241] In another specific aspect of the method according to the present invention the mutation is an amino acid substitution, deletion or insertion.

[0242] In another specific aspect of the method according to the present invention the amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a polar amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a glutamine at amino acid position 865 is mutated into a histidine.

[0243] In another specific aspect of the method according to the present invention the avian coronavirus is an IBV as described herein.

[0244] Thus, the present invention provides a method for altering the cell or tissue tropism of an IBV comprising the use of the avian coronavirus spike protein or fragment thereof as described herein.

[0245] Thus, the present invention provides a method for extending the cell or tissue tropism of an IBV comprising the use of the IBV spike protein or fragment thereof as described herein.

[0246] Thus, the present invention provides a method for the production or manufacture of an IBV with an extended cell or tissue tropism comprising the use of the IBV spike protein or fragment thereof as described herein.

[0247] Thus, the present invention provides a method for culturing an IBV in a cell or tissue culture comprising the use of the IBV spike protein or fragment thereof as described herein.

[0248] Thus, the present invention provides a method for modifying an IBV comprising modifying the amino acid position 865 in the spike protein of said IBV.

[0249] Thus, the present invention provides a method for mutating the amino acid position 865 in an IBV spike protein comprising:

- [0250] a) providing an IBV spike nucleotide or protein sequence,
- [0251] b) identifying position 865 in the spike protein by alignment with a reference sequence,
- [0252] c) mutating the position 865 of the spike protein of step b) into an aromatic amino acid,
- [0253] d) obtaining the mutated spike protein of step c).

[0254] Thus, the present invention provides a method for mutating the amino acid position 865 in an IBV spike protein of an IBV comprising:

- [0255] a) providing an IBV,
- [0256] b) identifying position 865 in the spike protein by alignment with a reference sequence,
- [0257] c) mutating the position 865 of the spike protein of step b) into an aromatic amino acid,
- [0258] d) obtaining the mutated IBV of step c).

[0259] In another specific aspect of the method according to the present invention the coronavirus spike protein is an IBV (infectious bronchitis virus) spike protein as described herein.

[0260] In another specific aspect of the method according to the present invention the aromatic amino acid at amino acid at position 865 or said mutation at amino acid position 865 leads to an extended cell or tissue tropism.

[0261] In another specific aspect of the method according to the present invention the avian coronavirus or IBV is infecting and/or replicating in at least one cell line or cell as described herein.

[0262] In another specific aspect of the method according to the present invention the numbering of amino acid position 865 is done as described herein.

Kits

[0263] The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration preferably for administration to subjects, especially poultry. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for administration.

[0264] The present invention provides a kit comprising the viral particle, avian coronavirus, IBV, the immunogenic composition or vaccine as described herein.

[0265] In one specific aspect of the kit according to the present invention the kit further comprises an instruction letter for the treatment and/or prophylaxis of diseases of avians or an instruction letter for the treatment and/or prophylaxis of diseases of poultry or an instruction letter for the treatment and/or prophylaxis of IB.

[0266] In one specific aspect of the kit according to the present invention the kit further comprises a dispenser capable of administering a vaccine to said animal.

Method of Treatment

[0267] Further, the present invention provides a method for immunizing a subject comprising administering to such subject an immunogenic composition as described herein.

[0268] The term “immunizing” relates to an active immunization by the administration of an immunogenic composition to a subject to be immunized, thereby causing an immunological response against the antigen included in such immunogenic composition.

[0269] Preferably, immunization results in lessening of the incidence of the particular avian coronavirus or IBV infection in a flock or in the reduction in the severity of clinical signs caused by or associated with the particular avian coronavirus or IBV infection.

[0270] Further, the immunization of a subject in need with the immunogenic compositions as provided herewith, results in preventing infection of a subject by avian coronavirus or IBV infection. Even more preferably, immunization results in an effective, long-lasting, immunological-response against IBV infection. It will be understood that the said period of time will last more than 1 month, preferably more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, more preferably more than 6 months. It is to be understood that immunization may not be effective in all subjects immunized. However, the term requires that a significant portion of subjects of a flock are effectively immunized.

[0271] Preferably, a flock of subjects is envisaged in this context which normally, i.e. without immunization, would develop clinical signs normally caused by or associated with an avian coronavirus or IBV infection. Whether the subjects of a flock are effectively immunized can be determined without further ado by the person skilled in the art. Preferably, the immunization shall be effective if clinical signs in at least 33%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, still more preferably in at least 95% and most preferably in 100% of the subjects of a given flock are lessened in incidence or severity by at least 10%, more preferably by at least 20%, still more preferably by at least 30%, even more preferably by at least 40%, still more preferably by at least 50%, even more preferably by at least 60%, still more preferably by at least 70%, even more preferably by at least 80%, still more preferably by at least 90%, still more preferably by at least 95% and most preferably by 100% in comparison to subjects that are either not immunized or immunized with an immunogenic composition that was available prior to the present invention but subsequently infected by the particular avian coronavirus or IBV.

[0272] Further, the present invention provides a method of treating or preventing clinical signs caused by IBV in a subject of need, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine as described herein.

[0273] As shown in the Examples, the immunogenic composition or vaccine as provided herein has been proven to be efficacious in treating or preventing clinical signs caused by IBV in a subject. Therefore, the experimental data show that the modification of the amino acid at amino acid position 865 into an aromatic amino acid does not have any impact on the efficacy of the vaccine.

[0274] The term “treating or preventing” refers to the lessening of the incidence of the particular IBV infection in a flock or the reduction in the severity of clinical signs caused by or associated with the particular IBV infection. Thus, the term “treating or preventing” also refers to the reduction of the number of subjects in a flock that become infected with the particular IBV (=lessening of the incidence of the particular IBV infection) or to the reduction of the severity of clinical signs normally associated with or caused by a IBV infection or the reduction of virus shedding after infection with the particular IBV or preventing or lessening egg drop in laying hens after infection with the particular IBV in a group of subjects which subjects have received an effective amount of the immunogenic composition as provided herein in comparison to a group of subjects which subjects have not received such immunogenic composition.

[0275] The “treating or preventing” generally involves the administration of an effective amount of the immunogenic composition of the present invention to a subject or flock of subjects in need of or that could benefit from such a treatment/prophylaxis. The term “treatment” refers to the administration of the effective amount of the immunogenic composition once the subject or at least some subjects of the flock is/are already infected with such IBV and wherein such subjects already show some clinical signs caused by or associated with such IBV infection. The term “prophylaxis” refers to the administration of a subject prior to any infection of such subject with IBV or at least where such subject or none of the subjects in a group of subjects do not show any clinical signs caused by or associated with the infection by such IBV. The terms “prophylaxis” and “preventing” are used interchangeable in this application.

[0276] The term “an effective amount” as used herein means, but is not limited to an amount of antigen, that elicits or is able to elicit an immune response in a subject. Such effective amount is able to lessen the incidence of the particular IBV infection in a flock or to reduce the severity of clinical signs of the particular IBV infection.

[0277] Preferably, clinical signs are lessened in incidence or severity by at least 10%, more preferably by at least 20%, still more preferably by at least 30%, even more preferably by at least 40%, still more preferably by at least 50%, even more preferably by at least 60%, still more preferably by at least 70%, even more preferably by at least 80%, still more preferably by at least 90%, still more preferably by at least 95% and most preferably by 100% in comparison to subjects that are either not treated or treated with an immunogenic composition that was available prior to the present invention but subsequently infected by the particular IBV.

[0278] The term “clinical signs” as used herein refers to signs of infection of a subject from IBV. The clinical signs of infection depend on the pathogen selected. Examples for such clinical signs include but are not limited to respiratory distress, nephritis, salphingitis, abnormal egg production, ruffled feathers, depression, reduced growth rates and reduced appetite. Signs of respiratory distress encompass respiratory signs including gasping, coughing, sneezing, tracheal rales, nasal and ocular discharge, tracheal lesions and ciliostasis in the trachea. Signs of nephritis encompass kidney lesions and watery diarrhea. Signs of abnormal egg production encompass egg drop, eggs of smaller size, inferior shell, reduced internal egg quality, eggs with thin albumen and ciliostasis in the oviduct. However, the clinical signs also include but are not limited to clinical signs that are directly observable from a live animal. Examples for clinical signs that are directly observable from a live animal include nasal and ocular discharge, coughing, gasping, sneezing, tracheal rales, ruffled feathers, conjunctivitis, weight loss, reduced growth rates, reduced appetite, dehydration, watery diarrhea, lameness, lethargy, wasting and unthriftiness and the like.

[0279] Preferably, the clinical signs lessened in incidence or severity in a treated subject compared to subjects that are either not treated or treated with an immunogenic composition that was available prior to the present invention but subsequently infected by the particular IBV refer to a reduction of ciliostasis, a reduction of rales, a reduction of egg drop, a reduction of kidney lesions, a reduction of watery diarrhea, a reduction in weight loss, a lower virus load, a reduced viral shedding, or combinations thereof.

[0280] The term “in need” or “of need”, as used herein means that the administration/treatment is associated with the boosting or improvement in health or clinical signs or any other positive medicinal effect on health of the subjects which receive the immunogenic composition in accordance with the present invention.

[0281] Further, the present invention provides a method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine as described herein.

[0282] As shown in the Examples, the immunogenic composition or vaccine as provided herein has been proven to be efficacious in reducing ciliostasis.

[0283] The term “ciliostasis” refers to a reduced movement of the cilia in the trachea. Thus, ciliostasis may be determined by examining the inner lining of the tracheal rings for the movement of the cilia. It is in the general knowledge of a person skilled in the art how to determine the movement of the cilia in the trachea.

[0284] Preferably, the movement of the cilia is not reduced from day 10 after challenge or infection, more preferably from day 5 after challenge or infection, more preferably from day 4 after challenge or infection, more preferably from day 3 after challenge or infection and most preferably from day 1 or 2 after challenge or infection with the IBV as compared to a subject of a non-immunized control group of the same species.

[0285] The term “reduction of ciliostasis” means, that the ciliostasis is reduced by at least 10%, preferably by at least 20%, more preferably by at least 30%, even more preferably by at least 40%, even more preferably by at least 50%, even more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, even more preferably by at least 90%, even more preferably by at least 95% and most preferably by 100% as compared to a subject of a non-immunized control group of the same species. It is in the general knowledge of a person skilled in the art how to measure the reduction of the ciliostasis.

[0286] Further, the present invention provides the immunogenic composition or vaccine as described herein for use in a method for immunizing a subject, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.

[0287] Further, the present invention provides the immunogenic composition or vaccine as described herein for use in a method of treating or preventing clinical signs caused by IBV in a subject of need, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.

[0288] Further, the present invention provides the immunogenic composition or vaccine as described herein for use in a method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.

[0289] In one specific aspect of the method or use according to the present invention said subject is avian.

[0290] The term “avian” is well known to the person skilled in the art. The term “avian” encompasses all birds including poultry.

[0291] In one specific aspect of the method or use according to the present invention said subject is poultry.

[0292] The term “poultry” is well known to the person skilled in the art. The term “poultry” encompasses chickens, turkeys, quails, pheasants, guineafowl, geese, and ducks. Further, the term “chicken” includes broiler, laying hens, and reproductive stocks for both also referred as breeders.

[0293] In one specific aspect of the method or use according to the present invention said subject is selected from the list consisting of chicken, turkey, quail, or pheasant.

[0294] In one specific aspect of the method or use according to the present invention said subject is chicken.

[0295] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine is administered once.

[0296] It is understood, that a single-dose is administered only once. As shown in the Examples the immunogenic composition as provided herein has been proven to be efficacious after the administration of a single dose to a subject of need.

[0297] The dose volume per poultry depends on the route of vaccination and the age of the poultry.

[0298] Typically, eye drop vaccines are administered in a volume of 1 to 100 μl per dose at any age. Preferably, the single-dose for eye drop vaccines has a total volume between about 5 μl and 70 μl and more preferably between about 20 μl and 50 μl with a single 20 μl, 25 μl, 30 μl, 35 μl, 40 μl, 45 μl or 50 μl dose being preferred. Most preferred, the single-dose for eye drop vaccines has a total volume between between about 30 μl and 50 μl with a single 30 μl, 35 μl, 40 μl, 45 μl or 50 μl dose being preferred.

[0299] Spray vaccines may contain the dose in a volume of 25 to 1000 μl for day-old poultry. Preferably, the single-dose for spray vaccines has a total volume between about 50 μl and 5000 μl, more preferably between about 75 μl and 2000 μl, more preferably between about 100 μl and 1000 μl, even more preferably between about 200 μl and 900 μl, even more preferably between about 300 μl and 800 μl and even more preferably between about 400 μl and 700 μl with a single 400 μl, 425 μl, 450 μl, 475 μl, 500 μl, 525 μl, 550 μl, 575 μl, 600 μl, 625 μl, 650 μl, 675 μl or 700 μl dose being preferred. Most preferred the single-dose has a total volume of 400 μl, 450 μl 500 μl, 550 μl, 600 μl, 650 μl or 700 μl.

[0300] The vaccine for in ovo vaccination may contain the dose in a volume of 50 to 100 μl, preferably 50 μl. Preferably, the single-dose for in ovo vaccines has a total volume between about 10 μl and 250 μl, more preferably between about 15 μl and 200 μl, even more preferably between about 20 μl and 150 μl, even more preferably between about 30 μl and 100 μl, even more preferably between about 30 μl and 75 μl and with a single 30 μl, 35 μl, 40 μl, 45 μl, 50 μl, 55 μl, 60 μl, 65 μl, 70 μl or 75 μl dose being preferred. Most preferred the single-dose has a total volume of 40 μl, 45 μl, 50 μl, 55 μl or 60 μl.

[0301] The vaccine for intramuscular or subcutaneous vaccination or one dose of a drinking water vaccine may contain the dose in a volume of 30 μl to 1000 μl. Preferably, the single-dose has a total volume between about 30 μl and 1000 μl, more preferably between about 50 μl and 500 μl, more preferably between about 75 μl and 250 μl and even more preferably between about 100 μl and 200 μl with a single 100 μl, 110 μl, 120 μl, 125 μl, 130 μl, 135 μl, 140 μl, 145 μl, 150 μl, 160 μl, 170 μl, 175 μl, 180 μl, 190 μl, 155 μl, or 200 μl dose being the most preferred.

[0302] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine is administered at two or more doses.

[0303] However, the immunogenic composition can be administered at two or more doses, with a first dose being administered prior to the administration of a second (booster) dose.

[0304] In a preferred aspect of the two-time administration regimen, both the first and second doses of the immunogenic composition are administered in the same amount. Preferably, each dose is in the preferred amounts specified above. In addition to the first and second dose regimen, an alternate embodiment comprises further subsequent doses. For example, a third, fourth, or fifth dose could be administered in these aspects. Preferably, subsequent third, fourth, and fifth dose regimens are administered in the same amount as the first dose, with the time frame between the doses being consistent with the timing between the first and second doses mentioned above.

[0305] Preferably, the first administration of the vaccine is performed within the first three weeks of age, more preferably within the first week of age and most preferred at one day-of-age by methods as described below. A second administration can be performed within the first 20 weeks of age, preferably within 16-18 weeks of age, more preferably between 6-12 weeks of age. Exemplary, the initial (first) vaccination is performed at 1-10 days of age and the second vaccination (booster) is performed with a live or inactivated vaccine at 6-12 or 16-18 weeks of age. More preferably, the initial (first) vaccination is performed at one day-of-age and the second vaccination (booster) is performed with a live or inactivated vaccine at 6-12 or 16-18 weeks of age.

[0306] In case in ovo vaccination is used, preferably the first administration is performed when embryos are between 15 to 19 days old, preferably at day 17, 18 or 19, most preferably at day 18 of age. A second administration can be performed within the first three weeks of age, preferably within the first 10 days of age.

[0307] In one specific aspect of the method or use according to the present invention said immunogenic composition or vaccine is administered subcutaneously, intramuscularly, oral, in ovo, via spray, via drinking water or by eye drop.

[0308] The immunogenic composition is, preferably, administered topically or systemically. Suitable routes of administration conventionally used are oral or parenteral administration, such as intranasal, intravenous, intradermal, transdermal, intramuscular, intraperitoneal, subcutaneous, as well as inhalation, in ovo, via spray, via drinking water or by eye drop. However, depending on the nature and mode of action of a compound, the immunogenic composition may be administered by other routes as well. For example, such other routes include intracutaneously, intravenously, intravascularly, intraarterially, intraperitnoeally, intrathecally, intratracheally, intracutaneously, intracardially, intralobally, intralobarly, intramedullarly, intrapulmonarily, intrarectally, and intravaginally. However, most preferred the immunogenic composition is administered subcutaneously, intramuscularly, oral, in ovo, via spray, via drinking water or by eye drop.

[0309] Live IBV vaccines are preferably administered individually by eye drop, intranasal, intramuscular or subcutaneous.

[0310] More preferably, mass application methods, including drinking water and aerosol spray vaccination, are used. Also preferred is the use of vaccines as embryo vaccines (so-called in ovo vaccines) as described further below.

[0311] For example, broilers may be vaccinated at one-day of age or at 1-3 weeks of age, particularly for broilers with high levels of MDA. Laying stock or reproduction stock may be vaccinated initially at 1-10 days of age and boosted with the vaccine at 7-12 or 16-18 weeks of age.

In Ovo Administration

[0312] As outlined above, the present invention also provides an IBV vaccine that can be safely administered via the in ovo route and at the same time is able to induce a protective immune response. The in ovo administration is well known to the person skilled in the art and the person skilled in the art can perform in ovo administration without further ado. The in ovo administration of the vaccine involves the administration of the vaccine to an avian embryo while contained in the egg (for a review on in ovo vaccination see: Ricks et al., Advances in Vet. Med. 495-515, 1999). The vaccine may be administered to any suitable compartment of the egg (e.g. allantois fluid, yolk sac, amnion, air cell or into the embryo) as described in the art (Sharma; Am. J. Vet. Res. 45 1619-1623, 1984). Preferably the vaccine is administered below the shell (aircell) membrane and chorioallantoic membrane.

[0313] Preferably, the vaccine is injected into embryonated eggs during late stages of the embryonation, generally during the final quarter of the incubation period, preferably 3-4 days prior to hatch. Preferably, the administration is performed when embryos are between 15 to 19 days old, preferably at day 17, 18 or 19, most preferably at day 18 of age. Subsequently, the vaccinated embryonated eggs are transferred to an incubator for hatch. The process of in ovo administration can be automated using a robotic injection process as described in the prior art.

[0314] Usually conventional vaccines for post-hatch vaccination of poultry cannot be used for in ovo vaccination, because late stage embryos are highly susceptible to infection with most vaccine viruses examined. However, International patent application WO 01/64244 discloses that IBV vaccines can be used for in ovo administration provided it is applied at a very low doses. Further, Wakenell et al. 1986 (Am. J. Vet. Res., 47 933-938) discloses that passaging an IB vaccine virus in tissue culture rendered the virus apathogenic for embryos.

[0315] In one specific aspect of the method or use according to the present invention said immunogenic composition or vaccine is administered via eye drop.

[0316] Typically, the live vaccine for post-hatch administration comprises the attenuated IBV with a viral titer of 10¹to 10⁸EID₅₀(50% Egg Infective Dose) per dose, preferably with a viral titer of 10²to 10⁵EID₅₀per dose and, more preferably, with a viral titer of 10²to 10⁴EID₅₀per unit dose and, even more preferably, with a viral titer of 10²to 10³EID₅₀per dose.

[0317] The live vaccine for in ovo administration typically comprises an amount of the attenuated IBV of 10²to 10⁷EID₅₀/embryo, preferably 10²to 10³EID₅₀/embryo in a volume of 50 to 100 μl, preferably 50 μl.

[0318] Preferably, the immunogenic composition of the present invention comprises the IBV of the present invention in amounts of about 1 to about 10 lop) EID (egg infective dose)₅₀/m1 per dose, preferably about 2 to about 8 log₁₀EID₅₀per dose, preferably in an amount of about 2 to about 7 log₁₀EID₅₀per dose, more preferably in an amount of about 2 to about 6 lop) EID₅₀per dose, even more preferably in an amount of about 2 to about 5 lop) EID₅₀per dose, even more preferably in an amount of about 2 to about 4 log₁₀EID₅₀per dose, most preferably in an amount of about 2 to about 3 log₁₀EID₅₀per dose. More preferably, the immunogenic composition of the present invention comprises the IBV of the present invention in amounts of about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5 or lop) EID₅₀per dose.

[0319] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine comprises 1 to 10 lop) EID₅₀per dose of the IBV.

[0320] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine comprises 2 to 5 log₁₀EID₅₀per dose of the IBV.

[0321] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine comprises 2 to 4 log₁₀EID₅₀per dose of the IBV.

[0322] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine is administered to subjects within the first week of age, within the first three days of age, within the first two days of age, or within the first day of age.

[0323] Preferably, the subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 days of age. More preferably, said subject to be immunized is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days of age. Most preferably, said subject to be immunized is 1, 2, 3, 4, 5, 6 or 7 days of age.

[0324] However, it has to be understood that after vaccination of the subject being a few days of age, it does need several days for the immune system of the poultry to build up immunity against an IBV infection. Therefore, preferably, the subjects are immunized within the first 24 h of age.

[0325] In one specific aspect of the method or use according to the present invention the immunogenic composition or vaccine is administered to subjects within the first day of age. As shown in the Examples the immunogenic composition as provided herein has been proven to be safe and efficacious when administered to 1-day old poultry.

[0326] In one specific aspect of the method or use according to the present invention said method results in an improvement in an efficacy parameter selected from the group consisting of: prevention or reduction of ciliostasis, prevention or reduction of rales, prevention or reduction of egg drop, prevention or reduction of kidney lesions, prevention or reduction of watery diarrhea, prevention or reduction in weight loss, a lower virus load, a reduced viral shedding or combinations thereof, in comparison to a subject of a non-treated control group of the same species.

[0327] The terms “treatment and/or prophylaxis” have been defined elsewhere, wherein the terms “prophylaxis” and “preventing” or “prevention” are used interchangeable in this application. Further, the terms “shedding” has been defined elsewhere, too.

[0328] The term “reducing”, “reduced”, “reduction” or “lower” means, that the efficacy parameter (ciliostasis, rales, egg drop, kidney lesions, watery diarrhea, weight loss, virus load, viral shedding) is reduced by at least 10%, preferably by at least 20%, more preferably by at least 30%, even more preferably by at least 40%, even more preferably by at least 50%, even more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, even more preferably by at least 90%, even more preferably by at least 95% and most preferably by 100% as compared to a subject of a non-immunized control group of the same species. It is in the general knowledge of a person skilled in the art how to measure the improvement in the efficacy parameters.

[0329] The term “virus load” or “virus titer” is a measure of the severity of an active viral infection, and can be determined by methods known to the person skilled in the art. The term “viral titre” is a measure of infectious units per volume of a virus preparation. Viral titre is an endpoint in a biological procedure and is defined as the dilution at which a certain proportion of tests carried out in parallel show an effect (Reed and Muench, 1938). The determination can be based on the detection of viral proteins such as by antibody binding to the viral proteins and further detection or, alternatively, by detection of viral RNA by amplification methods such as RT-PCR. Monitoring of virion associated viral RNA in plasma by nucleic acid amplification methods is a widely used parameter to assess the status and progression of retroviral disease, and to evaluate the effectiveness of prophylactic and therapeutic interventions. Exemplary, the virus load or virus titer can be calculated by estimating the live amount of virus in an involved body fluid such as a number of RNA copies per milliliter of blood plasma.

[0330] The term “ciliostasis” is well known to the person skilled in that art. The surface of the trachea is covered with specialised epithelial cells, which are lined with numerous, motile, hair-like structures called cilia. The term “ciliostasis” encompasses the reduction or loss of cilia and/or loss or partial loss of ciliary activity. Ciliostasis can be determined without further ado by the person skilled in the art.

[0331] The term “rales” is well known to the person skilled in that art. However, the term “rales” encompasses tracheal rales and refers to sounds emanating from the bronchi. Rales can be determined without further ado by the person skilled in the art.

[0332] The term “egg drop” is well known to the person skilled in that art. The term “egg drop” encompasses a decreased egg production.

[0333] In one specific aspect of the method or use according to the present invention the treatment or prevention results in a prevention or reduction of ciliostasis as compared to subjects of a non-treated control group of the same species.

[0334] In one specific aspect of the method or use according to the present invention the treatment or prevention results in a prevention or reduction of kidney lesions as compared to subjects of a non-treated control group of the same species.

[0335] In one specific aspect of the method or use according to the present invention the treatment or prevention results in a prevention or reduction of egg drop as compared to subjects of a non-treated control group of the same species.

[0336] The present invention further provides the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for therapeutic use.

[0337] The present invention further provides the viral particle, avian coronavirus or IBV as described herein for use as an immunogen or vaccine.

[0338] The present invention further provides the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for use as a medicament.

[0339] The present invention further provides the use of the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for the manufacture of a medicament.

[0340] The present invention further provides the use of the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine as described herein for the treatment and/or prophylaxis of IBV infections in a subject.

CLAUSES

The following clauses are also described herein:

- [0341] 1. An avian coronavirus spike protein or fragment thereof comprising an aromatic amino acid at position 865, wherein the spike protein or fragment thereof is not from IBV strain M41.
- [0342] 2. An avian coronavirus spike protein or fragment thereof, wherein at least a part of the S2 subunit is from an avian coronavirus with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid.
- [0343] 3. A recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 865.
- [0344] 4. An IBV spike protein or fragment thereof comprising an aromatic amino acid at position 865, wherein the spike protein or fragment thereof is not from IBV strain M41.
- [0345] 5. An IBV spike protein or fragment thereof, wherein at least a part of the S2 subunit is from an IBV with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid.
- [0346] 6. A recombinant IBV spike protein or fragment thereof comprising a mutation at amino acid position 865.
  Mutation 865
- [0347] 7. The avian coronavirus or IBV spike protein or fragment thereof of clause 1, 2, 4 or 5, wherein the aromatic amino acid at amino acid position 865 is introduced by a mutation.
- [0348] 8. The avian coronavirus or IBV spike protein or fragment thereof of clause 3, 6 or 7, wherein the mutation is an amino acid substitution, deletion or insertion.
- [0349] 9. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 3 and 6 to 8, wherein the amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a polar amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a glutamine at amino acid position 865 is mutated into a histidine.
- [0350] 10. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1, 2, 4, 5 and 7, wherein the aromatic amino acid at amino acid position 865 is a histidine.
  Extended Cell or Tissue Tropism
- [0351] 11. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 10, wherein the aromatic amino acid at amino acid position 865 or said mutation at amino acid position 865 leads to an extended cell or tissue tropism of the avian coronavirus or IBV.
- [0352] 12. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 11, wherein the avian coronavirus or IBV is infecting and/or replicating in at least one cell line or cell selected from the list consisting of: primary chicken embryo cells from lung or liver or primary chicken fibroblasts, a chicken embryo fibroblast cell line, a duck embryonic stem cell line, a human embryonic kidney cell line, a baby hamster kidney cell line, an African green monkey kidney cell line, a rabbit kidney cell line, a canine kidney cell line, a chicken liver cell line, a bovine kidney cell line, a porcine kidney cell line and an insect cell line.
- [0353] 13. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 12, wherein the avian coronavirus or IBV is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1 (Douglas Foster), EB66 (duck embryonic stem cell line), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+(Spodoptera frugiperda).
- [0354] 14. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 13, wherein the avian coronavirus or IBV is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
  Numbering of Amino Acid Position 865
- [0355] 15. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 14, wherein the numbering of amino acid position 865 refers to the amino acid position 865 in the spike protein of an IBV H52, an IBV H120 or an M41.
- [0356] 16. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 14, wherein the numbering of amino acid position 865 refers to the amino acid position 865 in the spike protein as exemplarily given in SEQ ID NO:1.
- [0357] 17. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 14, wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein.
- [0358] 18. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 14, wherein for determining the amino position 865 in a spike protein the amino acid sequence is aligned to the amino acid sequence of SEQ ID NO:1.
- [0359] 19. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 18, wherein the amino acid position 865 is within the S2 subunit of the spike protein.
- [0360] 20. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 19, wherein the spike protein or fragment thereof has one or more of the following amino acids selected from the group consisting of:
- [0361] 862 is an alanine, and/or
- [0362] 864 is an alanine, and/or
- [0363] 866 is a valine, and/or
- [0364] 867 is an aspartate, and/or
- [0365] 868 is an arginine.
  Spike
- [0366] 21. The avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 3 and 7 to 20, wherein the avian coronavirus spike protein or fragment thereof is selected from the group consisting of: infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus).
- [0367] 22. The avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 3 and 7 to 21, wherein the avian coronavirus is IBV (infectious bronchitis virus).
- [0368] 23. The IBV spike protein or fragment thereof of any one of clauses 4 to 22, wherein the spike protein or fragment thereof is from an IBV with a genotype or serotype or strain selected from a list consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (such as Maine 209), Massachusetts (such as H52, H120, excluding M41), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88).
- [0369] 24. The IBV spike protein or fragment thereof of any one of clauses 4 to 22, wherein the spike protein or fragment thereof is not from a Beaudette genotype or serotype.
- [0370] 25. IBV spike protein or fragment thereof of any one of clauses 4 to 24, wherein the spike protein or fragment thereof is not from IBV strain M41.
- [0371] 26. The IBV spike protein or fragment thereof of any one of clauses 4 to 25, wherein the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes or strains consisting of: Massachusetts (not M41), 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.
- [0372] 27. The IBV spike protein or fragment thereof of any one of clauses 4 to 26, wherein the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41), 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.
- [0373] 28. The IBV spike protein or fragment thereof of any one of clauses 4 to 27, wherein the spike protein or fragment thereof is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41) and 4/91.
- [0374] 29. The IBV spike protein or fragment thereof of clause 27, wherein the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01, Beaudette and Spain/96/334.
- [0375] 30. The IBV spike protein or fragment thereof of clause 27, wherein the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.
- [0376] 31. The IBV spike protein or fragment thereof of clause 27, wherein the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.
- [0377] 32. The IBV spike protein or fragment thereof of clause 27, wherein the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
- [0378] 33. The IBV spike protein or fragment thereof of clause 27, wherein the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.
- [0379] 34. The IBV spike protein or fragment thereof of clause 27, wherein the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.
- [0380] 35. The IBV spike protein or fragment thereof of clause 27, wherein the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013, and IBV/Brasil/351/1984.
- [0381] 36. The IBV spike protein or fragment thereof of any one of clauses 4 to 27, wherein the spike protein or fragment thereof is from an IBV of Massachusetts (not M41) or 4/91 genotype or serotype.
- [0382] 37. The IBV spike protein or fragment thereof of any one of clauses 4 to 27, wherein the IBV strain is H52, H120 or CR88.
- [0383] 38. The IBV spike protein or fragment thereof of any one of clauses 4 to 37, wherein the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
- [0384] 39. The IBV spike protein or fragment thereof of any one of clauses 4 to 38, wherein the IBV spike protein or fragment thereof is selected from a list of genotypes consisting of: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.
- [0385] 40. The IBV spike protein or fragment thereof of any one of clauses 4 to 39, wherein the spike protein or fragment thereof is not from the GI-1 genotype.
- [0386] 41. The avian coronavirus spike protein or fragment thereof of any one of clauses 2 and 7 to 40, wherein said at least a part of the S2 subunit from an avian coronavirus with a restricted cell or tissue tropism is selected from the group consisting of: Infectious bronchitis virus (IBV); guinea fowl coronavirus (GfCoV) and turkey coronavirus (TCoV; turkey enteritis virus and bluecomb disease virus).
- [0387] 42. The avian coronavirus spike protein or fragment thereof of any one of clauses 2 and 7 to 40, wherein said at least a part of the S2 subunit from an avian coronavirus with a restricted cell or tissue tropism is from IBV (infectious bronchitis virus).
- [0388] 43. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 42, wherein said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes or strains consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy 02, JMK, LDT3, Maine (such as Maine 209), Massachusetts (such as H52, H120; excluding M41), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88) or wherein said at least a part of the S2 subunit is not from IBV strain M41.
- [0389] 44. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 43, wherein said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes or strains consisting of Massachusetts (not M41), 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.
- [0390] 45. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 43, wherein said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41), 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.
- [0391] 46. The IBV spike protein or fragment thereof of clause 45, wherein the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01 and Spain/96/334
- [0392] 47. The IBV spike protein or fragment thereof of clause 45, wherein the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.
- [0393] 48. The IBV spike protein or fragment thereof of clause 45, wherein the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.
- [0394] 49. The IBV spike protein or fragment thereof of clause 45, wherein the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
- [0395] 50. The IBV spike protein or fragment thereof of clause 45, wherein the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.
- [0396] 51. The IBV spike protein or fragment thereof of clause 45, wherein the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.
- [0397] 52. The IBV spike protein or fragment thereof of clause 45, wherein the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013 and IBV/Brasil/351/1984.
- [0398] 53. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 45, wherein said at least a part of the S2 subunit is from an IBV selected from a list of genotypes or serotypes consisting of Massachusetts (not M41) and 4/91.
- [0399] 54. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 45, wherein said at least a part of the S2 subunit is from an IBV strain H120, H52 or CR88.
- [0400] 55. The avian coronavirus spike protein or fragment thereof of any one of clauses 2 and 5 and 7 to 54, wherein the at least a part of the S2 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids from a S2 subunit sequence of an avian coronavirus or IBV with a restricted cell or tissue tropism or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.
- [0401] 56. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 2 and 5 and 7 to 54, wherein the at least a part of the S2 subunit is at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids from a S2 subunit sequence of an avian coronavirus or IBV of any one of clauses 36 to 50 or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.
- [0402] 57. The IBV spike protein or fragment thereof of any one of clauses 5 and 7 to 54, wherein said at least a part of the S2 subunit from an IBV with a restricted cell or tissue tropism has at least 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400 or 500 contiguous amino acids of the amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.
- [0403] 58. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 2 and 5 and 7 to 57, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is restricted to infection and/or replication in emryonated chicken eggs and/or primary chicken kidney cells.
- [0404] 59. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 2 and 5 and 7 to 57, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is not infecting and/or replicating in EB66 and/or BHK cells.
- [0405] 60. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 2 and 5 and 7 to 57, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is not infecting and/or replicating in PBS-12 and/or HEK 293T cells.
  Fragment
- [0406] 61. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 60, wherein the fragment of the avian coronavirus or IBV spike protein has a length of at least 500, 750, 1000 or 1077 amino acids.
- [0407] 62. The avian coronavirus or IBV spike protein or fragment thereof of any one of clauses 1 to 61, wherein the fragment of the avian coronavirus or IBV spike protein has a length of at least 1000 amino acids.
- [0408] 63. The avian coronavirus or IBV spike protein of any one of clauses 1 to 62, wherein the the aromatic amino acid at amino acid position 865 or the mutation at amino acid position 865 to an aromatic amino acid is genetically stable.
- [0409] 64. A nucleotide sequence encoding the spike protein or fragment thereof of any one of clauses 1 to 63.
- [0410] 65. A plasmid comprising a nucleotide sequence of clause 64.
- [0411] 66. A cell comprising a plasmid of clause 65.
- [0412] 67. A viral particle comprising a spike protein or fragment thereof of any one of clauses 1 to 63.
- [0413] 68. An avian coronavirus comprising the spike protein or fragment thereof of any one of clauses 1 to 63.
- [0414] 69. An IBV (infectious bronchitis virus) comprising the spike protein of any one of clauses 4 to 63.
- [0415] 70. The avian coronavirus or IBV of clauses 68 or 69, wherein the avian coronavirus or IBV is attenuated.
- [0416] 71. The avian coronavirus or IBV of any one of clauses 68 to 70, wherein the avian coronavirus or IBV is genetically engineered.
- [0417] 72. The avian coronavirus or IBV of any one of clauses 68 to 71, wherein the avian coronavirus or IBV is recombinant.
- [0418] 73. The avian coronavirus or IBV of any one of clauses 68 to 72, wherein the avian coronavirus or IBV is chimeric.
- [0419] 74. The IBV of any one of clauses 69 to 73, wherein the IBV is from an IBV with a genotype or serotype or strain selected from a list consisting of: Arkansas (such as Arkansas 99), Brazil (such as BR-1, BR-2, 23/2013, IBV/Brasil/351/1984), California (such as California 1734/04, California 99), Connecticut, Delaware (such as Delaware 98), Dutch (such as D207, D212, D274, D3128, D3896, D8880, D1466), Florida, Georgia (such as Georgia GA-07, GA-08, GA-12, GA-13), Gray, Holte, Iowa (such as Iowa 97 and Iowa 69), Italy (such as Italy 02), JMK, LDT3, Maine (such as Maine 209), Massachusetts (M41, H52, H120, Beaudette), Pennsylvania (such as Pennsylvania 1220/98, Pennsylvania Wolg/98), PL84084, Qu (such as Qu-mv), QX (such as GB341/96), Q1, SE 17, Variant 2 (such as IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016) and 4/91 (793B, CR88).
- [0420] 75. The IBV of any one of clauses 69 to 74, wherein the IBV is selected from a list of genotypes or serotypes or strains consisting of Massachusetts, 4/91, QX, Q1, Italy 02, Arkansas, Connecticut, Georgia, LDT3, PL84084, Variant 2 and Brazil.
- [0421] 76. The IBV of any one of clauses 69 to 75, wherein the IBV is selected from a list of genotypes or serotypes consisting of Massachusetts, 4/91, QX, Q1, Arkansas, Variant 2 and Brazil.
- [0422] 77. The IBV of clause 76, wherein the Massachusetts strain is selected from a list consisting of: H120, H52, Spain/98/308, IBMA5-1, SD/97/01, Beaudette, Spain/96/334 and M41-M21883.
- [0423] 78. The IBV of clause 76, wherein the 4/91 strain is selected from a list consisting of: Spain/98/328, Spain/92/35, IR-3654-VM, FR-CR88061-88, FR-85131-85, UK-1233-95, UK/3/91, Spain/00/336, UK/7/91, 4/91-pathogenic, 4/91 attenuated and IB4-91.
- [0424] 79. The IBV of clause 76, wherein the QX strain is selected from a list consisting of: FR-L1450T-05, FR-L1450L-05, NL-L1449T-04, NL-L1449K-04, IBV/Ck/SP/170/09, IBV/Ck/SP/79/08, IBV/Ck/SP/248/09, HBN, IBVQX, LX4, BJQ, CK/CH/LGD/03 and GB341/96.
- [0425] 80. The IBV of clause 76, wherein the Q1 strain is selected from a list consisting of: CK/CH/LDL/98I, CK/CH/LSD/08-10, J2, Q1, AR08ER22, AR08BA21 and Chile-295-10.
- [0426] 81. The IBV of clause 76, wherein the Italy 02 strain is selected from a list consisting of: Spain/99/316, Italy-02, UK-L633-04, It-497-02, Spain/05/866, Spain/04/221, Spain/00/337, Spain/155/09 and Spain/03/08.
- [0427] 82. The IBV of clause 76, wherein the Arkansas strain is selected from a list consisting of: Ark99, ArkGA, ArkDPI, AL/5364/00, ARKDPI11, AL/0803/01, AL/7149/00, ArkDPI101, AL/1221/01, AL/1793/01 and AL/4614/98.
- [0428] 83. The IBV of clause 76, wherein the Variant 2 strain is selected from a list consisting of: IS/1494/06, IBV/Ck/EG/CU/4/2014, gammaCoV/Ck/Poland/G052/2016, Eg/CLEVB-2/IBV/012, D1344/2/4/10 EG, TR8 and IB VAR2-06.
- [0429] 84. The IBV of clause 76, wherein the Brazil strain is selected from a list consisting of: BR-1, BR-2, 23/2013 and IBV/Brasil/351/1984.
- [0430] 85. The IBV of any one of clauses 69 to 76, wherein the Spike protein or fragment thereof is from an IBV of Massachusetts or 4/91 genotype or serotype.
- [0431] 86. The IBV of any one of clauses 69 to 76, wherein the IBV strain is H120, H52 or CR88.
- [0432] 87. The IBV of any one of clauses 69 to 86, wherein the IBV has a IBV Spike Protein or fragment thereof consisting of or comprising an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
- [0433] 88. The IBV of any one of clauses 69 to 87, wherein the IBV has an extended cell or tissue tropism.
- [0434] 89. The IBV of any one of clauses 69 to 88, wherein the IBV is infecting and/or replicating in at least one cell line or cell of any one of clauses 12 to 14.
- [0435] 90. A cell comprising:
  - [0436] the viral particle of clause 67, or
  - [0437] the avian coronavirus or IBV of any one of clauses 68 to 89.
- [0438] 91. The cell of clause 90, wherein the cell is a cell line or cell selected from the list consisting of: primary chicken embryo cells, a chicken embryo fibroblast cell line, a duck embryonic stem cell line, a human embryonic kidney cell line, a baby hamster kidney cell line, an African green monkey kidney cell line, a rabbit kidney cell line, a canine kidney cell line, a chicken liver cell line, a bovine kidney cell line, a porcine kidney cell line and an insect cell line.
- [0439] 92. The cell of clauses 90 or 91, wherein the cell is a cell line selected from the list consisting of: DF-1 (Douglas Foster), EB66 (duck embryonic stem cell line), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+(Spodoptera frugiperda).
- [0440] 93. The cell of any one of clauses 90 to 92, wherein the cell is a cell line selected from the list consisting of: DF-1, EB66, PBS-12, PBS-12SF, BHK, HEK 293T, Vero, MA104 and RK13.
- [0441] 94. The cell of clause 91, wherein the primary chicken embryo cell is a fibroblast or a cell derived from liver or lung tissue.
- [0442] 95. An immunogenic composition comprising:
  - [0443] the spike protein of any one of clauses 1 to 63, or
  - [0444] the viral particle of clause 67, or
  - [0445] the avian coronavirus or IBV of any one of clauses 68 to 89.
- [0446] 96. A vaccine comprising:
  - [0447] the spike protein of any one of clauses 1 to 63, or
  - [0448] the viral particle of clause 67, or
  - [0449] the coronavirus or IBV of any one of clauses 68 to 89.
- [0450] 97. A modified live vaccine with an extended cell or tissue tropism comprising:
  - [0451] the spike protein of any one of clauses 1 to 63, or
  - [0452] the viral particle of clause 67, or
  - [0453] the coronavirus or IBV of any one of clauses 68 to 89.
- [0454] 98. The immunogenic composition or vaccine of any one of clauses 95 to 97, wherein the immunogenic composition or vaccine comprises a pharmaceutically acceptable carrier.
- [0455] 99. The immunogenic composition or vaccine of clause 98, wherein the pharmaceutically acceptable carrier is phosphate buffered saline.
- [0456] 100. The immunogenic composition or vaccine of any one of clauses 95 to 99, wherein the immunogenic composition or vaccine is effective in the treatment and/or prophylaxis of clinical signs caused by IBV in a subject of need.
- [0457] 101. The immunogenic composition or vaccine of any one of clauses 95 to 100, wherein the immunogenic composition or vaccine comprises 1 to 10 log₁₀EID₅₀of the IBV.
- [0458] 102. The immunogenic composition or vaccine of any one of clauses 95 to 101, wherein the immunogenic composition or vaccine comprises 2 to 5 log₁₀EID₅₀of the IBV.
- [0459] 103. The immunogenic composition or vaccine of any one of clauses 95 to 102, wherein the immunogenic composition or vaccine comprises 2 to 4 log₁₀EID₅₀of the IBV.
- [0460] 104. A method for altering the cell or tissue tropism of an avian coronavirus comprising the use of the avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 63.
- [0461] 105. A method for extending the cell or tissue tropism of an avian coronavirus comprising the use of the avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 63.
- [0462] 106. A method for the production or manufacture of an avian coronavirus with an extended cell or tissue tropism comprising the use of the avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 63.
- [0463] 107. A method for culturing an avian coronavirus in a cell or tissue culture comprising the use of the avian coronavirus spike protein or fragment thereof of any one of clauses 1 to 63.
- [0464] 108. A method for modifying an avian coronavirus comprising modifying the amino acid position 865 in the spike protein of said avian coronavirus.
- [0465] 109. A method for mutating the amino acid position 865 in an avian coronavirus spike protein comprising:
- [0466] a) providing an avian coronavirus spike nucleotide or protein sequence,
- [0467] b) identifying position 865 in the spike protein by alignment with a reference sequence,
- [0468] c) mutating the position 865 of the spike protein of step b) into an aromatic amino acid,
- [0469] d) obtaining the mutated spike protein of step c).
- [0470] 110. The method of any one of clauses 104 to 108, wherein the spike protein or fragment thereof has at amino acid position 865 an aromatic amino acid.
- [0471] 111. The method of any one of clause 108 to 110, wherein the aromatic amino acid at position 865 is introduced by a mutation.
- [0472] 112. The method of clause 111, wherein the mutation is an amino acid substitution, deletion or insertion.
- [0473] 113. The method of any one of clause 108 to 112, wherein the amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a polar amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a Glutamine at amino acid position 865 is mutated into a Histidine.
- [0474] 114. The method of any one of clauses 104 to 113, wherein the avian coronavirus is an IBV of any one of clauses 63 to 83.
- [0475] 115. The method of any one of clauses 104 to 114, wherein the coronavirus spike protein is an IBV (infectious bronchitis virus) spike protein of any one of clauses 3 to 57.
- [0476] 116. The method of any one of clauses 104 to 115, wherein the aromatic amino acid at amino acid at position 865 or said mutation at amino acid position 865 leads to an extended cell or tissue tropism.
- [0477] 117. The method of any one of clauses 104 to 116, wherein the avian coronavirus or IBV is infecting and/or replicating in at least one cell line or cell of any one of clauses 12 to 14.
- [0478] 118. The method of to any one of clause 108 to 117, wherein the numbering of amino acid position 865 is done according to any one of clauses 15 to 20.
- [0479] Kit Clauses
- [0480] 119. A kit comprising the viral particle, avian coronavirus, IBV, the immunogenic composition or vaccine of any one of clauses 67 to 89 and 95 to 103.
- [0481] 120. The kit of clause 119, wherein the kit further comprises an instruction letter for the treatment and/or prophylaxis of diseases of avians or an instruction letter for the treatment and/or prophylaxis of diseases of poultry or an instruction letter for the treatment and/or prophylaxis of IB.
- [0482] 121. The kit of clauses 119 or 120, wherein the kit further comprises a dispenser capable of administering a vaccine to said animal.
  Method of Treatment Clauses
- [0483] 122. A method for immunizing a subject comprising administering to such subject an immunogenic composition or vaccine of any one of clauses 95 to 103.
- [0484] 123. A method of treating or preventing clinical signs caused by IBV in a subject of need, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine of any one of clauses 95 to 103.
- [0485] 124. A method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition or vaccine of any one of clauses 95 to 103.
- [0486] 125. The immunogenic composition or vaccine of any one of clauses 95 to 103 for use in a method for immunizing a subject, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.
- [0487] 126. The immunogenic composition or vaccine of any one of clauses 95 to 103 for use in a method of treating or preventing clinical signs caused by IBV in a subject of need, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.
- [0488] 127. The immunogenic composition or vaccine of any one of clauses 95 to 103 for use in a method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of said immunogenic composition or vaccine.
- [0489] 128. The method or use of any one of clauses 122 to 127, wherein said subject is avian.
- [0490] 129. The method or use of any one of clauses 122 to 128, wherein said subject is poultry.
- [0491] 130. The method or use of any one of clauses 122 to 129, wherein said subject is selected from the list consisting of chicken, turkey, quail, or pheasant.
- [0492] 131. The method or use of any one of clauses 122 to 130, wherein said subject is chicken.
- [0493] 132. The method or use of any one of clauses 122 to 131, wherein the immunogenic composition or vaccine is administered once.
- [0494] 133. The method or use of any one of clauses 122 to 131, wherein the immunogenic composition or vaccine is administered at two or more doses.
- [0495] 134. The method or use of any one of clauses 122 to 133, wherein said immunogenic composition or vaccine is administered subcutaneously, intramuscularly, oral, in ovo, via spray, via drinking water or by eye drop.
- [0496] 135. The method or use of any one of clauses 122 to 134, wherein said immunogenic composition or vaccine is administered via eye drop.
- [0497] 136. The method or use of any one of clauses 122 to 135, wherein the immunogenic composition or vaccine comprises 1 to 10 log₁₀EID₅₀per dose of the IBV.
- [0498] 137. The method or use of any one of clauses 122 to 136, wherein the immunogenic composition or vaccine comprises 2 to 5 log₁₀EID₅₀per dose of the IBV.
- [0499] 138. The method or use of any one of clauses 122 to 137, wherein the immunogenic composition or vaccine comprises 2 to 4 log₁₀EID₅₀per dose of the IBV.
- [0500] 139. The method or use of any one of clauses 122 to 138, wherein the immunogenic composition or vaccine is administered to subjects within the first week of age, within the first three days of age, within the first two days of age, or within the first day of age.
- [0501] 140. The method or use of any one of clauses 122 to 139, wherein the immunogenic composition or vaccine is administered to subjects within the first day of age.
- [0502] 141. The method or use of any one of clauses 122 to 140, wherein said method results in an improvement in an efficacy parameter selected from the group consisting of: prevention or reduction of ciliostasis, prevention or reduction of rales, prevention or reduction of egg drop, prevention or reduction of kidney lesions, prevention or reduction of watery diarrhea, prevention or reduction in weight loss, a lower virus load, a reduced viral shedding or combinations thereof, in comparison to a subject of a non-treated control group of the same species.
- [0503] 142. The method or use of any one of clauses 122 to 141, wherein the treatment or prevention results in a prevention or reduction of ciliostasis as compared to subjects of a non-treated control group of the same species.
- [0504] 143. The method or use of any one of clauses 122 to 142, wherein the treatment or prevention results in a prevention or reduction of kidney lesions as compared to subjects of a non-treated control group of the same species.
- [0505] 144. The method or use of any one of clauses 122 to 143, wherein the treatment or prevention results in a prevention or reduction of egg drop as compared to subjects of a non-treated control group of the same species.
- [0506] 145. The viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of clauses 67 to 89 and 95 to 103 for therapeutic use.
- [0507] 146. The viral particle, avian coronavirus, IBV of any one of clauses 67 to 89 for use as an immunogen or vaccine.
- [0508] 147. The viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of clauses 67 to 89 and 95 to 103 for use as a medicament.
- [0509] 148. Use of the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of clauses 67 to 89 and 95 to 103 for the manufacture of a medicament.
- [0510] 149. Use of the viral particle, avian coronavirus, IBV, immunogenic composition or vaccine of any one of clauses 67 to 89 and 95 to 103 for the treatment and/or prophylaxis of IBV infections in a subject.

BRIEF DESCRIPTION OF THE DRAWINGS

[0511] FIG. 1. Three blind passages of H52 rIBV S Q865H in EB66® cells. Assessment of replication via IBV-specific RT-qPCR at time points 0 and 72 hours post infection for all three passages.

[0512] FIG. 2. Immunoflurescence staining of EB66® cells infected by H52 rIBV S Q865H in comparison to an uninfected negative control.

[0513] FIG. 3. Immunoflurescence staining of BHK cell infection by passage 3 of H52 rIBV S Q865H in comparison to an uninfected negative control.

[0514] FIG. 4. Immunoflurescence staining of BHK cell infection by passage 3 of H52 rIBV S Q865H in comparison to an uninfected negative control and infection with H52rIBV wild type.

SEQUENCES OVERVIEW

SEQ ID NO:1 IBV H52 spike protein

SEQ ID NO:2 IBV H52 spike protein with Q865H mutation

SEQ ID NO:3 IBV CR88 spike with Q867H mutation

SEQ ID NO:4 IBV QX spike protein with Q868H mutation

SEQ ID NO:5 IBV Q1 spike protein with Q869H mutation

SEQ ID NO:6 IBV Var 2 spike protein with Q868H mutation

SEQ ID NO:7 IBV BR-I spike protein with Q872H mutation

SEQ ID NO:8 IBV Ark spike protein with Q871H mutation

SED ID NO:9 pUC57-s H52 rIBV S Q865H donor plasmid

SEQ ID NO:10 pUC57-s H52 rIBV S donor plasmid

SEQ ID NO:11 IBV CR88 spike protein

SEQ ID NO:12 pUC57-s CR88 mIBV donor plasmid

SEQ ID NO:13 pGEM-T CR88 S

SEQ ID NO:14 pUC57-s CR88 rIBV S Q867H donor plasmid

SEQ ID NO:15 pGEM-T CR88 S Q867H

SEQ ID NO:16-31 primers

EXAMPLES

[0515] The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are merely illustrative and are understood not to limit the scope or the underlying principles of the present invention.

Example 1

Generation of a Recombinant IBV H52 in which the Amino Acid 865 of the Spike Protein is Mutated to a Histidine

[0516] For the generation of recombinant IBV the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1):109) is applied.

Donor Plasmid Construction

[0517] The H52 spike protein sequence (SEQ ID NO:1) is amplified via PCR using primers 1044 and 1045 (table 1) and cloned into pGEM®-T vector system (Promega) yielding the plasmid pGEM-T IBV H52 spike. The QuikChangeMulti Site-Directed Mutagenesis Kit (Agilent Technologies) with primer PO2079 (table 1) is used according to kit protocol to introduce a mutation from glutamine to histidine at the position 865 in H52 spike S2 subunit (SEQ ID NO:2). Positive plasmids are identified via NcoI and NsiI restriction digest prepared from clonal bacterial cultures after transformation. To identify plasmids with the targeted mutation, Sanger sequencing of plasmids with the expected restriction pattern is performed using primers PO617 and PO634 (table 1).

[0518]

TABLE 1

Primers for cloning, site directed mutagenesis
and characterization of the pGEM-T
IBV H52 spike plasmid.
SEQ ID NO:	Name	Sequence

16	PO1044	ttaattaagtgtggtaa
		gttgcttgtaagag
		atgttggtaacacc
		tc

17	PO1045	ctcgagcgacttattcaat
		aaattcatcattaaa
		cagactttttagg

18	PO2079	ccatacaagcaaatgct
		cacgtggatcgtc
		ttataactg

19	PO619	tgctgcttcctttaataag

20	PO634	aacactataccattaggtgc

[0519] To generate the H52 donor plasmid pUC57-s H52 rIBV S Q865H (SEQ ID NO:9) the NEBuilder HiFi DNA Assembly Cloning Kit (NEB) is used according to the kit protocol. For Gibson assembly, the H52 S Q865H sequence is amplified from the pGEM-T IBV H52 S Q865H plasmid via PCR. Further, two PCRs are performed to generate the flanking sequences of the spike in the context of the IBV H52 viral genome including a EcoRV and BlpI restriction site, respectively (table 2). For this, the pUC57-s IBV-5-1b-S-SIR-3T donor plasmid described by van Beurden et al., hereafter referred to as pUC57-s H52 rIBV donor plasmid (SEQ ID NO:10) is used as template. The correct size and purity of the PCR are products is determined via agarose gel, subsequently the PCR products are purified with the QIA quick PCR purification kit (QIAGEN). In parallel, the pUC57-s H52 rIBV donor plasmid is digested with EcoRV and BlpI to obtain the donor plasmid backbone sequence of roughly 7000 base pairs for Gibson assembly. Positive plasmids are identified by restriction digest with EcoRV and XbaI. Positive plasmids are sequences with primers PO619 and PO634 (table 1) to confirm the presence of the Q865H mutation in the spike S2 subunit.

[0520]

TABLE 2

Setup for generation of PCR products to obtain
the pUC57-s H52 rIBV S Q865H donor plasmid with
Gibson HiFi assembly.
			SEQ
			ID	Primer	Primer
PCR	product	Template	NO:	name	sequence

1	5′ spike	pUC57-s	21	PO1783	cagagcacaagtttg
	flank	H52			atcttgtgatatctg
		rIBV			atatgtatacagaca
					atgattc

			22	PO1762	gtgttaccaacatct
					cttaccagtaactta
					cc

2	spike	pGEM-T	23	PO1765	ttactggtaagagat
		IBV			gttggtaacacctct
		H52 S			tttac
		Q865H

			24	PO1766	ggactttggatcatt
					aaacagactttttag
					gtctg

3	3′ spike	pUC57-s	25	PO1763	aaagtctgtttaatg
	flank	H52			atccaaagtcccact
		rIBV			ag

			26	PO1788	cttaactcctggaat
					tactaaccacgtgta
					ccaaaataaacaaca
					agc

Targeted RNA Recombination and Rescue of Recombinant IBV

[0521] The H52 murinized (m)IBV helper virus and recombinant IBV are generated as described by van Beurden et al. (Virol J. 2017; 14(1):109). Briefly, for the generation of H52 rIBV S Q865H, LR7 cells are infected with H52 mIBV and electroporated with an in vitro transcript generated from the pUC57-s H52 S Q865H donor plasmid (SEQ ID NO:9) and subsequently injected into 8-day-old embryonated SPF chicken eggs (VALO BioMedia). After up to eight days of incubation, the allantoic fluids of all eggs are analyzed separately for rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO765 and PO1324 (table 3) binding in H52 IBV lab and H52 IBV S spike are used to distinguish recombinant IBV from mIBV. The positive allantoic fluid of one egg inoculated with the infected and electroporated LR7 cells is used for an end-point dilution in 8-day-old embryonated SPF eggs. Nucleic acids isolation and sample analysis is conducted as described above. The same procedure is applied for a second end-point dilution procedure. Afterwards, one positive-tested allantoic fluid is used for propagation in 10-day-old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:1000 in 1×PBS and 100 μl are injected per egg, which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested 48 hours post inoculation, pooled, cleared from debris by centrifugation and stored at −80° C.

[0522]

TABLE 3

Primers for confirmation of H52
rIBV S Q865H rescue after
targeted RNA recombination.
	SEQ
	ID NO:	name	sequence

	27	PO765	tgacttggtttgaagatggc

	28	PO1324	ccccatgtaaatgccaacca

Conclusion Example 1: A Recombinant H52 IBV with a Mutation from Glutamine to Histidine at Position 865 of the Spike is Rescued

In Vitro and in Ovo Characterization of Recombinant IBV

Determination of Embryo Infectious Dose 50% (EID₅₀)

[0523] An aliquot of the virus stock is thawed and 10-fold diluted in 1×PBS to determine the 50% embryo infectious dose (EID₅₀) by inoculation of 100 μl into the allantoic cavity of five 8-day old embryonated chicken eggs per dilution. Eggs are incubated at 36.5° C., 60% humidity until 7 days post inoculation. Eggs with dead embryos after 24 hours are excluded from the experiment. All other eggs with dead embryos at 7 days post inoculation are considered positive. All eggs with living embryos are canceled from the bottom at 7 days post inoculation to identify dwarfs, which are considered positive. The EID₅₀/ml is calculated with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).

Tissue Culture Infectious Dose 50% (TCID₅₀)

[0524] Eb66® cell viability is analyzed with BioRad TC20 and trypan blue with the gate set to 6-13 μm. Per 96 well 2×10⁶living Eb66® cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine are seeded 1 day prior to inoculation and incubated at 37° C. and 7.5% CO2. A 10-fold serial dilution of the virus in Eb66® cell medium is performed and 100 μl per dilution (at least 4 replicates per dilution) are added to Eb66® cells after removing the culture medium. If allantoic fluid is used for infection it is passed though a 0.45 μm pore sized filter prior to dilution. Infected cells are incubated for 72 hours followed by immunofluorescence staining to identify positive wells. Medium is aspirated from all wells, which are subsequently washed with 1×PBS before the addition of 100 μl ethanol per well for cell fixation for 10 min at RT and subsequent air drying of the cells. The cells are incubated with 100 μl of primary chicken anti-IBV Mass serum (Boehringer Ingelheim), diluted 1:250 in 1×PBS, for 45 min at room temperature. After removal of the primary antibody each well is washed three times with 1×PBS. 100 μl of secondary Alexa Fluor 488 goat anti-chicken IgG antibody (ThermoFisher Scientific, 1:500 dilution in 1×PBS) are added and incubated for 45 min at room temperature in the dark. After removal of the secondary antibody, each well is washed three times with 1×PBS, leaving the final wash on the cells. Positive wells are identified by fluorescence microscopy and recorded to calculate the TCID₅₀/ml with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).

Passaging of rIBV in Eb66® Cells

[0525] To analyze if H52 rIBV S Q865H is able to replicate in cells, three consecutive blind passages are performed in EB66®. The cells are seeded at a density of 4×10⁵cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine into T25 flasks with a total volume of 5 ml and are infected with a 1/100 dilution of H52 rIBV S Q865H. The cultures are incubated for 72 hours at 37° C. and 7.5% CO2 and shaking at 100 rpm. The culture is harvested and stored at −80° C. For passages 1, 2, and 3 virus replication is assessed via RT-qPCR for the For this, 250 μl of the cell suspension are removed directly after inoculation (time point 0 h) and after harvest (time point 72 h) for nucleic acid isolation. Nucleic acids are isolated with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). The RT-qPCR to detect the relative amount of IBV RNA is performed with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138 (1-2):60-5) as described above. Indeed the Q865H mutation in the spike of H52 IBV is sufficient to enable cell culture replication of the egg-restricted H52. The H52 rIBV S Q865H replicated efficiently in all three passages, as represented by the decrease in the ct value between time point of infection (0h) and harvest (72) as depicted in FIG. 1. Thus, it is apparent that the modification to an Histidine at position 865 is genetically stable. Further, the IBV retains its extended cell culture/tissue tropism after 3 passages.

[0526] In addition, the infectious titers for the allantoic fluid stock (10^7.32EID₅₀/ml) and Eb66® passage P3 (10^5.25TCID₅₀/ml, 10^8.13EID₅₀/ml) are determined via immunofluorescence staining (FIG. 2). They confirm efficient replication of H52 rIBV S Q865H during the Eb66® passaging process and sustained infectivity in SPF eggs. The Q865H mutation therefore enables replication in cell lines without disturbing the ability to replicate in ovo.

Infection of BHK Cells with H52 rIBV S Q865H

[0527] The ability to infect BHK cells is analyzed for the allantoic fluid stocks of H52 rIBV S Q865H and H52 rIBV or an uninfected negative control. BHK cells are seeded in MEM (SAFC)+5% FCS (SAFC)+25 μg/ml L-Gentamicin (Gibco) medium into 12-well plates to reach 80 to 90% confluence on the next day. The cells are incubated at 37° C. and 5% CO2. Before infection the allantoic fluid virus stocks are set to 10⁶to 10⁷EID₅₀/ml and passed through a 0.45 μm pore sized filter. Afterwards, they are diluted 1/10 in medium and BHK cells are infected with 100 μl/well after aspiration of medium. After 72 hours the supernatant is taken off and the immunofluorescence assay as described for the TCID₅₀assay above is performed and the stained cells are analyzed by fluorescence microscopy (FIG. 3).

[0528] In a second experiment, the infection procedure described above is repeated. 72 hours post infection the supernatant is taken off and the cells are washed with 1×PBS and 50 μl TrypLE Select (ThermoFisher Scientific) are added to detach cells. Cells are resuspended in supernatant and transferred to a T25 flask with 80-90% confluent BHK cells and 5 ml fresh medium (P2), which is incubated for 72 hours. Again, the supernatant and cells are collected and transferred to a T75 flask with 80-90% confluent BHK cells and 10 ml fresh medium, which is incubated for 72 hours (P3). The supernatant is harvested. The cells are detached by trypsin treatment and seeded into 12 well plates at a ratio of 1 to 3 in fresh medium and incubated until the next day. Medium is aspirated, and the immunofluorescence assay as described above is performed (FIG. 4). In both experiments, infected BHK cells are detected for H52 rIBV S Q865H, while cells infected with H52 rIBV wild type and the uninfected negative control remain negative as expected.

[0529] Conclusion Example 1: The data show that the mutation to Histidine at the position 865 of the spike sequence (reference sequence for the numbering is SEQ ID NO:1) in an IBV leads to an extended cell culture and tissue tropism. An H52 recombinant IBV having the Q865H mutation in the spike protein can be efficiently cultured in different cell lines such as EB66 and BHK cells. It is assumed that said IBV can be cultured in other cell lines as well. Further, said mutation has no impact on in ovo replication of the virus.

Example 2

Generation of Recombinant IBV CR88 in which the Amino Acid 867 of the Spike Protein is Mutated to a Histidine

[0530] In order to determine if the change to a histidine at position 865 in the IBV spike can also be applied to other genotypes or serotypes, the spike amino acid sequence (SEQ ID NO:11) of the CR88 IBV strain is aligned to the H52 Spike amino acid sequence (SEQ ID NO:1) to determine the position equivalent to amino acid position 865 of H52 spike for IBV CR88 spike, which is determined as the glutamine at position 867 of the CR88 spike.

Construction of an IBV CR88 Murinized Donor Plasmid

[0531] To generate the CR88 murinized (m)IBV donor plasmid the donor sequence is synthesized by a commercial supplier: 497 nucleotides of the 5′ UTR of the CR88 genome are fused to the 3′ part of the lab region (752 bases) and the first 72 nucleotides coding for the CR88 IBV spike, followed by 3753 nucleotides of the MHV spike ectodomain, continuing with the terminal 210 nucleotides of the CR88 IBV spike and the following sequence until the 3′ end of the genome. In addition, a SacI restriction site and the sequence of the T7 promoter are added to the 5′ end of the donor region, as well as a 100× polyA sequence, followed by a Nod restriction site for linearization at the 3′ end, respectively. A silent A to C mutation at position 5634 of the assembled sequence is introduced to generate an XhoI restriction site. The synthesized sequence is inserted into pUC57-simple to yield the pUC57-s CR88 mIBV donor plasmid (SEQ ID NO:12).

Rescue of CR88 mIBV

[0532] CR88 mIBV is rescued in analogy to H52 mIBV (van Beurden et al. Virol J. 2017; 14(1):109) with some alterations: The virus allantoic fluid stock is concentrated via ultracentrifugation before isolation of the viral RNA for electroporation. 18 ml of viral allantoic fluid are centrifuged at 50,000×g for 2 hours through a 2 ml 20% Sucrose cushion in TNE (Tris, NaCl, EDTA) buffer. The supernatant is discarded and the pellet resuspended in 150 μl TNE buffer followed by RNA isolation with QIAamp viral RNA mini kit (Qiagen). Further, chicken embryo fibroblasts (CEFs) instead of BHK cells are used for electroporation (2 pulses 250 V/300 μF, 10 sec break) and 1.25% DMSO is added to the electroporation mixture.

Donor Plasmid Construction

[0533] The CR88 spike nucleic acid sequence with flanking sequences is synthesized by a commercial supplier and cloned into pGEM-T (SEQ ID NO:13). It is used as a template for site directed mutagenesis to change the glutamine at amino acid position 867 of the IBV CR88 spike (SEQ ID NO:11) into a histidine (SEQ ID NO:3). For this, the QuikChangeMulti Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer's protocol and the primer PO1884 (table 4) designed by the corresponding online tool are used. Positive plasmids are identified by restriction digest and analyzed for the presence of the desired mutation by Sanger sequencing with primer PO619 and PO634 (table 4). For the generation of the pUC57-s CR88 rIBV S Q867H donor plasmid (SEQ ID NO:14), the pGEM-T CR88 S Q867H plasmid containing the mutated CR88 spike sequence (SEQ ID NO:15) is digested with PacI, XhoI and PvuI. The band corresponding to the spike is cut from the gel and purified with the QIAquick gel extraction kit (Qiagen). Further, the CR88 mIBV donor plasmid (SEQ ID NO:12) is digested with PacI, XhoI and KpnI to obtain the donor plasmid backbone. The band with the highest molecular weight is cut from the gel and purified via QIAquick Gel Extraction Kit (Qiagen). The purified spike insert and CR88 donor plasmid backbone are ligated using T4 DNA ligase (ThermoFisher Scientific) at 16° C. over night. The ligation mixture is transformed into NEB 5-α competent E. coli (NEB) by heat shock. After GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific), positive plasmids are identified by restriction digest and characterized for the targeted mutation by Sanger sequencing with primers PO619 and PO634 (table 4).

Targeted RNA Recombination and Rescue of Recombinant IBV

[0534] For rescue of CR88 rIBV S Q867H, LR7 cells are infected with CR88 mIBV and electroporated with in vitro transcript generated from the NotI linearized pUC57-s CR88 S Q867H donor plasmid, and subsequently injected into 8-day-old embryonated SPF chicken eggs (VALO BioMedia). After up to eight days of incubation, the allantoic fluids of all eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1728 and PO1729 (Table 4) binding in CR88 IBV lab and CR88 IBV S spike are used to distinguish recombinant IBV from mIBV. The positive allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day-old embryonated SPF eggs. Nucleic acid isolation is conducted as described above. Samples are analyzed via RT-qPCR conducted according to the protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the StepOnePlus or the ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific). Afterwards, one positive-tested allantoic fluid of a high dilution is used for propagation in 8-day-old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl is injected per egg which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested at 48 hours post inoculation, cleared from debris by centrifugation and stored at −80° C.

[0535]

TABLE 4

SDM primer to obtain the CR88 S Q867H
mutation and sequencing primers for
confirmation of the targeted mutation
and confirmation of CR88 rIBV rescue.
	SEQ ID NO:	Name	Sequence

	29	PO1884	ctattcaggcagatgctcat
			gttgatcgtcttattacag

	19	PO619	tgctgcttcctttaataag

	20	PO634	aacactataccattaggtgc

	30	PO1728	tcagcgtggacatgtggtta

	31	PO1729	ccccatataggtgccaacct

In Vitro and in Ovo Characterization of Recombinant IBV

[0536] The determination of EID50, TCID50 as well as the passaging procedure in Eb66 or BHK cells are performed as described in example 1 and similar results are obtained with CR88 rIBV S Q865H.

[0537] Conclusion example 2: The data show that the mutation to Histidine at the position 867 of the CR88 spike sequence (reference sequence for the numbering is SEQ ID NO:1) in an IBV leads to an extended cell culture and tissue tropism. An CR88 recombinant IBV having the Q867H mutation in the spike protein can be efficiently cultured in different cell lines such as EB66 and BHK cells. It is assumed that said IBV can be cultured in other cell lines as well. Further, said mutation has no impact on in ovo replication of the virus.

Claims

The invention claimed is:

1. An avian coronavirus spike protein comprising an aromatic amino acid at position 865, wherein the spike protein provides extended cell or tissue tropism without requiring a change to the Beaudette specific motif, wherein the spike protein is not from infectious bronchitis virus (IBV) strain M41, and wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein.

2. An avian coronavirus spike protein, wherein at least a part of the S2 subunit is from an avian coronavirus with a restricted cell or tissue tropism, wherein the amino acid at position 865 is an aromatic amino acid, wherein the spike protein provides extended cell or tissue tropism without requiring a change to the Beaudette specific motif, and wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein.

3. The avian coronavirus spike protein of claim 1, wherein the avian coronavirus is IBV (infectious bronchitis virus).

4. The avian coronavirus spike protein of claim 1, wherein the aromatic amino acid at amino acid position 865 is introduced by a mutation.

5. The avian coronavirus spike protein of claim 4, wherein amino acid at amino acid position 865 is a polar amino acid or a glutamine before the mutation.

6. The avian coronavirus spike protein of claim 1, wherein the aromatic amino acid at amino acid position 865 is a histidine.

7. The avian coronavirus spike protein of claim 1, wherein the spike protein is within an avian coronavirus, and wherein the avian coronavirus is capable of infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1 (Douglas Foster), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).

8. The avian coronavirus spike protein of claim 1, wherein the amino acid position 865 is within the S2 subunit of the spike protein.

9. The IBV spike protein of claim 3, wherein the spike protein is selected from a list of genotypes selected from the list of: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.

10. The IBV spike protein of claim 3, wherein the spike protein is from an IBV with a genotype or serotype or a strain selected from the group consisting of: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy-02, JMK, LDT3, Maine, H52, H120, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, Variant 2 and 4/91.

11. The IBV spike protein of claim 3, wherein the IBV spike protein consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto, and wherein the IBV spike protein contains the aromatic amino acid at position 865.

12. The avian coronavirus spike protein of claim 2, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is restricted to infection and/or replication in embryonated chicken eggs and/or in primary chicken kidney cells.

13. A nucleotide sequence encoding the spike protein of claim 1.

14. A plasmid comprising the nucleotide sequence of claim 13.

15. A viral particle comprising the spike protein of claim 1.

16. An avian coronavirus comprising the spike protein of claim 1 or an IBV (infectious bronchitis virus) comprising the spike protein of claim 3.

17. The avian coronavirus or IBV of claim 16, wherein the avian coronavirus or IBV is attenuated.

18. An isolated cell comprising:

the plasmid of claim 14, or

the viral particle of claim 15, or

the avian coronavirus or IBV of claim 16.

19. An immunogenic composition comprising:

the spike protein of claim 1, or

the viral particle of claim 15, or

the avian coronavirus or IBV of claim 16.

20. A method for immunizing a subject comprising administering to the subject the immunogenic composition of claim 19.

21. A method of treating or preventing clinical signs caused by IBV in a subject of need, comprising administering to the subject a therapeutically effective amount of the immunogenic composition of claim 19.

22. A method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of the immunogenic composition of claim 19.

Patent Citations (53)

Patent	Date	Inventor	Cited By
US2909462(A)	1959-10-01	Warfield	Applicant
US5750113(A)	1998-05-01	Cook	Applicant
US8828407(B2)	2014-09-01	Britton et al.	Applicant
US9296991(B2)	2016-03-01	Geerligs et al.	Applicant
US10772953(B2)	2020-09-01	van Santen et al.	Applicant
US11065328(B2)	2021-07-01	Rottier et al.	Applicant
US11224649(B2)	2022-01-01	Kraemer-Kuehl et al.	Applicant
US11512115(B2)	2022-11-01	Kraemer-Kuehl et al.	Applicant
US11696947(B2)	2023-07-01	Kraemer-Kuehl et al.	Applicant
US11744888(B2)	2023-09-01	Kraemer-Kuehl et al.	Applicant
US11999766(B2)	2024-06-01	Kraemer-Kuehl et al.	Applicant
US2006/0257852(A1)	2006-11-01	Rappuoli et al.	Applicant
US2007/0154489(A1)	2007-07-01	Cavanagh et al.	Applicant
US2011/0097353(A1)	2011-04-01	Sellers et al.	Applicant
US2012/0177675(A1)	2012-07-01	Britton et al.	Applicant
US2014/0141043(A1)	2014-05-01	Toro Guzman et al.	Applicant
US2016/0030550(A1)	2016-02-01	Toro Guzman et al.	Applicant
US2016/0032253(A1)	2016-02-01	Sellers	Applicant
US2016/0060303(A1)	2016-03-01	Britton	Examiner
US2016/0106828(A1)	2016-04-01	Toro	Applicant
US2017/0096455(A1)	2017-04-01	Baric et al.	Applicant
US2018/0216082(A1)	2018-08-01	Jordan et al.	Applicant
US2019/0046634(A1)	2019-02-01	van Santen et al.	Applicant
US2022/0202931(A1)	2022-06-01	Mundt et al.	Applicant
US2023/0158138(A1)	2023-05-01	Talaat et al.	Applicant
US2025/0064920(A1)	2025-02-01	Albanese et al.	Applicant
CN101948812(A)	2011-01-01		Applicant
CN102574897(A)	2012-07-01		Applicant
CN103642759(A)	2014-03-01		Applicant
CN104353070(A)	2015-02-01		Applicant
CN104694488(A)	2015-06-01		Applicant
CN108300704(A)	2018-07-01		Applicant
CO2019000214(A2)	2019-01-01		Applicant
CO2021005066(A2)	2021-04-01		Applicant
CO2021005069(A2)	2021-04-01		Applicant
WO1986005806(A1)	1986-10-01		Applicant
WO2001000234(A2)	2001-01-01		Applicant
WO2001009290(A2)	2001-02-01		Applicant
WO1/64244(A2)	2001-09-01		Applicant
WO2004078203(A2)	2004-09-01		Applicant
WO2004092360(A2)	2004-10-01		Applicant
WO11/004146(A1)	2011-01-01		Applicant
WO2011004146(A1)	2011-01-01		Applicant
WO2014177873(A1)	2014-11-01		Applicant
WO2016012793(A1)	2016-01-01		Applicant
WO2019046634(A1)	2019-03-01		Applicant
WO2020089164(A1)	2020-05-01		Applicant
WO2020089166(A1)	2020-05-01		Applicant
WO2020229248(A1)	2020-11-01		Applicant
WO2020229249(A1)	2020-11-01		Applicant
WO2020229257(A1)	2020-11-01		Applicant
WO2022066683(A1)	2022-03-01		Applicant
WO2025027551(A2)	2025-02-01		Applicant

Non-Patent Literature (79)

Bickerton, Erica, Giulia Dowgier, and Paul Britton. “Recombinant infectious bronchitis viruses expressing heterologous S1 subunits: potential for a new generation of vaccines that replicate in Vero cells.” Journal of General Virology 99.12 (2018): 1681-1685.Applicant
Bickerton et al. 2018 The S2 Subunit of Infectious Bronchitis Virus Beaudette is a Determinant of Cellular Tropism 2018 J Virology 92:1-18.Applicant
Bijlenga et al. Development and use of the H strain of avian Infectious bronchitis virus from the Netherlands as a vaccine: a review 2004. Avian Pathol. 33:550-557.Applicant
Casais et al. Recombinant Avian Infectious Bronchitis Virus Expressing a Heterologous Spike Gene Demonstrates that the Spike Protein Is a Determinant of Cell Tropism 2003. J. Virol. 77; 9084-9089.Applicant
Cavanagh Coronavirus avian infectious bronchitis virus 2007. Vet. Res. 38:281-297.Applicant
Cook et al. The long view: 40 years of infectious bronchitis research 2012. Avian Pathol. 41:239-250.Applicant
Dolz et al. Antigenic and molecular characterization of isolates of the Italy 02 infectious bronchitis virus genotype 2006. Avian Pathology 35(2), 77-85.Applicant
Ellis et al. Recombinant Infectious Bronchitis Viruses Expressing Chimeric Spike Glycoproteins Induce Partial Protective Immunity against Homologous Challenge despite Limited Replication In Vivo 2018. J. Virol. 92(23):1-18.Applicant
Fang et al. Selection of and recombination between minor variants lead to the adaptation of an avian coronavirus to primate cells 2005. Biochemical and Biophysical Research Communication 336:417 to 423.Applicant
Farsang et al. Molecular epizootiology of infectious bronchitis virus in Sweden indicating the involvement of a vaccine strain 2002. Avian Pathology 31:229-236.Applicant
Feng et al. Analysis of S1 gene of avian infectious bronchitis virus isolated in southern China during 2011-2012. 2014 Virus Genes 49:292-303.Applicant
Hodgson et al. Recombinant Infectious Bronchitis Coronavirus Beaudette with the Spike Protein Gene of the Pathogenic M41 Strain Remains Attenuated but Induces Protective Immunity 2004. J Virol 78:13804-13811.Applicant
Kuo et al. Retargeting of Coronavirus by Substitution of the Spike Glycoprotein Ectodomain: Crossing the Host Cell Species Barrier 2000. J. Virol. 74:1393-1406.Applicant
Liu et al. Complete genome sequence analysis of a predominant infectious bronchitis virus (IBV) strain in China. 2009 Virus Genes 38:56-65.Applicant
Promkuntod et al. Mapping of the receptor-binding domain and amino acids critical for attachment in the spike protein of avian coronavirus infectious bronchitis virus 2014. Virology. 448:26-32.Applicant
Rauw et al. The positive adjuvant effect of chitosan on antigen-specific cell-mediated immunity after chickens vaccination with live Newcastle disease vaccine 2009. Vet Immunol Immunop 134:249-258.Applicant
Todd et al. Development of an adjuvant-active nonionic block copolymer for use in oil-free subunit vaccines formulations 1997. Vaccine 15:564-570.Applicant
Valastro et al. S1 gene-based phylogeny of infectious bronchitis virus: An attempt to harmonize virus classification. 2016. Infection, Genetics and Evolution 39:349-364.Applicant
Quatros Das Infektiose Bronchitis Virus (IBV): Molekularbiologische Untersuchungen zur Diagnostik und zum Vorkommen sowie zur Pathogenität des Genotyps IBV QX in spezifisch pathogenfreien (SPF) Broilern. 2011 Dissertation. Journal-Nr: 3518.Applicant
Wang et al. Intranasal immunization with live attenuated influenza vaccine plus chitosan as an adjuvant protects mice against homologous and heterologous virus challenge 2012. Arch Virol 157:1451-1461.Applicant
Worthington et al. A reverse transcriptase-polymerase chain reaction survey of infectious bronchitis virus genotypes in Western Europe from 2002 to 2006. 2008 Avian Pathology 37(3):247-257.Applicant
Shang, J. et al., Cryo-EM structure of infectious bronchitis coronavirus spike protein reveals structural and functional evolution of coronavirus spike proteins, PLoS Pathog, 2018, 14(4):e1007009. PDB ID 6CV0, Database: Protein Data Bank (PDB), https://doi.org/10.2210/pdb6CV0/pdb.Applicant
Niesters, H.G.M. et al., The peplomer protein sequence of the M41 strain of coronavirus IBV and its comparison with Beaudette strains, Virus Research, 5, 1986, 253-63, Sequence ID: P12651, Database: Uniprot, https://www.uniprot.org/uniprotkb/P12651/entry.Applicant
Rutten, L. et al. Impact of SARS-CoV-2 spike stability and RBD exposure on antigenicity and immunogenicity, Scientific Rep, 2024, 14, 5735.Applicant
Armesto, Maria, et al. “A recombinant avian infectious bronchitis virus expressing a heterologous spike gene belonging to the 4/91 serotype.” PLoS One 6(8), 2011: e24352.Applicant
Abbas, Ghulam, et al. “Molecular characterization of infectious bronchitis virus strain HH06 isolated in a poultry farm in Northeastern China.” Frontiers in Veterinary Science, 8, 2021: 794228.Applicant
Abstract in English for CN101948812A, 2011.Applicant
Abstract in English for CN103642759A, 2014.Applicant
Abstract in English for CN104694488A, 2015.Applicant
Abstract in English for CN108300704A, 2018.Applicant
Abstract in English for CO2019000214A2, 2019.Applicant
Abstract in English for CO2021005066A2, 2021.Applicant
Abstract in English for CO2021005069A2, 2021.Applicant
Abstract in English for WO01009290A2, 2001.Applicant
Ali, Ahmed, et al. “Safety and efficacy of attenuated classic and variant 2 infectious bronchitis virus candidate vaccines.” Poultry science, 97(12), 2018: 4238-4244.Applicant
Britton, Paul, et al. “Generation of a recombinant avian coronavirus infectious bronchitis virus using transient dominant selection.” J. Virol Methods 123(2), 2005: 203-11.Applicant
Britton, Paul, et al. “Modification of the avian coronavirus infectious bronchitis virus for vaccine development.” Bioengineered Bugs, 3(2), 2012: 114-119.Applicant
Callison A, Scott et al. “Development and evaluation of a real-lime Taqman RT-PCR assay for the detection of infectious bronchitis virus from infected chickens.” Journal of Virological Methods, 138, 2006:60-65.Applicant
Cavanagh, David et al. “Variation in the spike protein of the 793/B type of infectious bronchitis virus, in the field and during alternate passage in chickens and embryonated eggs.” Avian Pathology, 34(1), 2005: 20-25.Applicant
Cevac: “Cevac Ibron”, Jan. 1, 2017 (Jan. 1, 2017), XP093125209.Applicant
Chen, HY et al. “Infection of HeLa cells by avian infectious bronchitis virus is dependent on cell status.” Avian Pathology, 36(4), 2007: 269-274.Applicant
Communication/Extended Search Report, PCT/EP2020/062526, Oct. 4, 2019.Applicant
Dancey, G F et al. “Effect of liposomal model membrane composition on immunogenicity.” J Immunol., 120, 1978: 1109-13.Applicant
Franzo, Giovanni et al. “Molecular investigation of a full-length genome of a Q1-like IBV strain isolated in Italy in 2013.” Virus Res., 2(2), 2015: 77-80.Applicant
Geerligs, Harm et al. “Efficacy and safety of an attenuated live QX-like infectious bronchitis virus strain as a vaccine for chickens.” Avian Pathology, 40(1), 2011: 93-102.Applicant
Geilhausen, H E et al. The pathogenesis of virulent and avirulent avian infectious bronchitis virus. Archiv fur die gesamte Virusforschung, 40, 1973: 285-290.Applicant
GenBank: AKV60429.1. “Spike protein [Infectious bronchitis virus].” Dated Aug. 16, 2015.Applicant
GenBank: ATE90980.1. “Spike protein {Avian Coronavirus).” Dated Oct. 2, 2017.Applicant
GenBank: CAZ866699. 1. “Spike protein {Infectious bronchitis virus ITA/90254/2005).” Dated Oct. 23, 2009.Applicant
Goraichuk, I. V. et al. “First complete genome sequence of currently circulating infectious bronchitis virus strain DMV/1639 of the GI-17 lineage.” Microbiology Resource Announcements, 8(34), 2019: doi: 10-1128.Applicant
Handberg, K J et al. ,,Detection and strain differentiation of infectious bronchitis virus in tracheal tissues from experimentally infected chickens by reverse transcription-polymerase chain reaction. Comparison with an immunohistochemical technique. Avian Pathology, 28, 1999: 327-335.Applicant
Hulswit, R. J. G. et al. “Coronavirus spike protein and tropism changes.” Advances in Virus Research, 96, 2016: 29-57.Applicant
International Search Report and Written Opinion for PCT/EP2019/079389 (WO2020089164) mailed Feb. 6, 2020.Applicant
International Search Report and Written Opinion for PCT/EP2019/079393 (WO2020/089166) mailed Feb. 18, 2019.Applicant
International Search Report and Written Opinion, PCT/EP2020/062526 (WO2020229248A1), Jun. 24, 2020.Applicant
International Search Report for PCT/IB2024/057434 (WO2025027551A2), mailed mailed on Apr. 25, 2025.Applicant
Jackwood, Mark W. et al. “Molecular evolution of infectious bronchitis virus and the emergence of variant viruses circulating in the United States.” Avian Diseases, 65(4), 2021: 631-636.Applicant
Kalokhoran, Ali Yousefzadeh, et al. “Co-circulation of three clusters of 793/B-like avian infectious bronchitis virus genotypes in Iranian chicken flocks.” Archives of virology, 162, 2017: 3183-3189.Applicant
Khanh, NP et al. “Molecular characterization of QX-like and variant infectious bronchitis virus strains in Malaysia based in partial genomic sequences comprising the S-3a/3b-E-M-intergenic region-5a/5b-N gene order.” Avian Dis., 61(4), 2017: 442-452.Applicant
Li, Hua et al. “Sequence analysis of nephropathogenic infectious bronchitis virus strains of the Massachusetts genotype in Beijing.” Avian Pathology, 30(5), 2001: 535-541.Applicant
Macdonald, J W et al. “An inverse age resistance of chicken kidneys to infectious bronchitis virus.” Avian Pathology, 9, 1980: 245-259.Applicant
Merck Animal Health. “Utility and performance of Mildvac-Ma5 for IBV vaccination of broilers with DMV/1639 field challenge.” 2022, US-MVC-220100001.Applicant
Moore, Kristi M., et al. “Sequence comparison of avian infectious bronchitis virus S1 glycoproteins of the Florida serotype and five variant isolates from Georgia and California.” Virus Genes, 17, 1998: 63-83.Applicant
Rohaim, Mohammed A. et al. “Evolutionary analysis of infectious bronchitis virus reveals marked genetic diversity and recombination events.” Genes, 11(6), 2020: 605.Applicant
Shan, Dan, et al. “Effects of hypervariable regions in spike protein on pathogenicity, tropism, and serotypes of infectious bronchitis virus.” Virus research, 250, 2018: 104-113.Applicant
Shimazaki et al. “Isolation of 4/91 type of infectious bronchitis virus as a new variant in Japan and efficacy of vaccination against 4/91 type field isolate.” Avian Diseases, 52, 2008: 618-622.Applicant
Song Chang-Seon, “Characteristics and prevention strategies of domestic avian infectious bronchitis (IB).” Feed Journal, 4(1), 2006: 126-133.Applicant
The Free Dictionary [Internet] “heterologous protein”. Farlex Partner Medical Dictionary,; Farlex, 2012 [retrieved on Dec. 21, 2022].Applicant
Van Beurden et al. “Recombinant live attenuated avian coronavirus vaccines with deletions in the accessory genes 3ab and/or 5ab protect against infectious bronchitis in chickens.” Vaccine, 36(8), 2018: 1085-1092.Applicant
Van Beurden, Steven J et al. “A reverse genetics system for avian coronavirus infectious bronchitis virus based on targeted RNA recombination.” Virology Journal, 14, 2017: 1-13.Applicant
Wei, Yan-Quan, et al. “Development and characterization of a recombinant infectious bronchitis virus expressing the ectodomain region of S1 gene of H120 strain.” Applied Microbiology and Biotechnology, 98(4), 2014: 1727-1735.Applicant
Written Opinion of the International Search Authority PCT/EP2020/062528 (WO2020229249A1), mailed on Jul. 17, 2020.Applicant
Written Opinion of the International Search Authority PCT/EP2020/062563 (WO2020229257A1), mailed on Jul. 31, 2020.Applicant
Written Opinion of the International Search Authority PCT/IB2024/057434 (WO2025027551A2), mailed on Apr. 25, 2025.Applicant
Xu, Peng-wei, et al. “Assembly and immunogenicity of baculovirus-derived infectious bronchitis virus-like particles carrying membrane, envelope and the recombinant spike proteins.” Biotechnology letters, 38, 2016: 299-304.Applicant
Zhang, Tingting et al. “Serotype shift of a 793/B genotype infectious bronchitis coronavirus by natural recombination.” Infect Genet Evol., 32, 2015: 377-387.Applicant
Zhou, Ying Shun, et al. “Establishment of reverse genetics system for infectious bronchitis virus attenuated vaccine Strain H120.” Veterinary Microbiology, 162(1), 2013: 53-61.Applicant
Zhou, Yingshun, et al. “The establishment and characteristics of cell-adapted IBV strain H120.” Archives of virology, 161(11), 2016: 3179-3187.Applicant
Zwaagstra, K. A. et al. “Rapid detection and identification of avian infectious bronchitis virus.” Journal of Clinical Microbiology, 30(1), 1992: 79-84.Applicant

Abstract

A recombinant avian coronavirus spike protein or fragment thereof includes a mutation at amino acid position 865. An immunogenic composition includes an avian coronavirus with such spike protein.

Description

SEQUENCE LISTING

[0001] This application contains a sequence listing in accordance with 37 C.F.R. 1.821-1.825. The sequence listing accompanying this application is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

DETAILED DESCRIPTION OF THE INVENTION

Composition of Matter

[0010] The present invention solves the problems inherent in the prior art and provides a distinct advance in the state of the art.

[0013] Further, the present invention provides a recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 865.

[0016] Further, the present invention provides a recombinant IBV spike protein or fragment thereof comprising a mutation at amino acid position 865.

Mutation 865

Extended Cell or Tissue Tropism

[0035] Preferably, the IBV is infecting and/or replicating in the EB66 or BHK cell line.

Numbering of Amino Acid Position 865

- [0050] 862 is an alanine, and/or
- [0051] 864 is an alanine, and/or
- [0052] 866 is a valine, and/or
- [0053] 867 is an aspartate, and/or
- [0054] 868 is an arginine.
  The numbering of said amino acid positions refer to the amino acid positions within the spike protein as exemplarily given in SEQ ID NO:1.
  Spike