Xanthine dehydrogenase (XDH) iRNA compositions and methods of use thereof

[0001] This application is a 35 § U.S.C. 111(a) continuation application which claims the benefit of priority to PCT/US2021/037748, filed on Jun. 17, 2021, which-in turn-claims the benefit of priority to U.S. Provisional Application No. 63/040,587, filed on Jun. 18, 2020, and U.S. Provisional Application No. 63/153,983, filed on Feb. 26, 2021. The entire contents of each of the foregoing applications are incorporated herein by reference.

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 14, 2021, is named 121301_12903_SL.txt and is 714,599 bytes in size.

[0003] Reduced renal clearance of uric acid is the result of a number of factors, including defects in uric acid transporter proteins such as SLC2A9, ABCG2, and others, reduced renal excretion due to renal disease, hypothyroidism, volume contraction and volume depletion, acidosis, lead intoxication, and familial nephropathy due to uromodulin deposits; and altered renal clearance due to hyperinsulinemia or insulin resistance in diabetes. Increased synthesis of uric acid is associated with hyperuricemia plus hyperuricosuria; inborn errors of metabolism such as Lesch Nyhan/HPRT deficiency, PRPP synthetase overactivity, and glucose-6-phosphate dehydrogenase deficiency (Von Gierke disease/Glycogen Storage Disease Type Ia); certain situations of high cell turnover (e.g., tumor lysis syndrome); certain situations of high ATP turnover (e.g., glycogen storage diseases, tissue ischemia). Furthermore, conditions such as chronic kidney disease, hypertension, metabolic syndrome, and high fructose intake may result in both increased uric acid synthesis and decreased uric acid clearance.

[0004] Chronic elevated serum uric acid (chronic hyperuricemia), typically defined as serum urate levels greater than 6.8 mg/dl (greater than 360 mmol/), the level above which the physiological saturation threshold is exceeded (Mandell, Cleve. Clin. Med. 75:S5-S8, 2008), is associated with a number of diseases. For example, gout is characterized by recurrent attacks of acute inflammatory arthritis that is caused by an inflammatory reaction to uric acid crystals in the joint typically due to insufficient renal clearance of uric acid or excessive uric acid production. Fructose associated gout is associated with variants of transporters expressed in the kidney, intestine, and liver. Chronic elevated uric acid is also associated with non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), metabolic disorder, cardiovascular disease, type 2 diabetes, and conditions linked to oxidative stress, chronic low grade inflammation, and insulin resistance (Xu et al., J. Hepatol. 62:1412-1419, 2015; Cardoso et al., J. Pediatr. 89:412-418, 2013; Sertoglu et al., Clin. Biochem., 47:383-388, 2014).

[0005] Uric acid (also referred to herein as urate) is the final metabolite of endogenous and dietary purine metabolism. Xanthine oxidase (XO) (EC 1.1.3.22) and xanthine dehydrogenase (XDH) (EC 1.17.1.4), which catalyze the oxidation of hypoxanthine to xanthine, and xanthine to uric acid, respectively, are interconvertible forms of the same enzyme. The enzymes are molybdopterin-containing flavoproteins that consist of two identical subunits of approximately 145 kDa. The enzyme from mammalian sources, including man, is synthesized as the dehydrogenase form, but it can be readily converted to the oxidase form by oxidation of sulfhydryl residues or by proteolysis. XDH is primarily expressed in the intestine and the liver, but it is also expressed in other tissues including adipose tissue.

[0006] Allopurinol and febuxostat (Uloric®), inhibitors of the XDH form of the enzyme, are commonly used for the treatment of gout. However, their use is contraindicated in patients with co-morbidities common to gout, especially decreased renal function, e.g., due to chronic kidney disease or hepatic impairment. Their use may also be limited in patients with metabolic syndrome, hypertension, dyslipidemia, non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD), cardiovascular disease, or diabetes (either type 1 or type 2), due to limited organ function from the disease or condition, or due to adverse drug interactions with agents used for the treatment of such conditions.

[0007] Currently, treatments for gout do not fully meet patient needs. Therefore, there is a need for additional therapies for subjects that would benefit from reduction in the expression of an XDH gene, such as a subject having an XDH-associated disease or disorder, e.g., gout.

[0008] The present invention provides iRNA compositions which affect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a gene encoding xanthine dehydrogenase (XDH). The XDH may be within a cell, e.g., a cell within a subject, such as a human subject.

[0009] Accordingly, in one aspect the invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of XDH in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO:1 and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO:2. In certain embodiments, the sense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:1 and the antisense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:2. In certain embodiments, the sense strand comprises at least 17 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:1 and the antisense strand comprises at least 17 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:2. In certain embodiments, the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:1 and the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:2.

[0010] In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) for inhibiting expression of xanthine dehydrogenase (XDH) in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding XDH, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7. In certain embodiments, the region of complementarity comprises at least 15 contiguous nucleotides of any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7. In certain embodiments, the region of complementarity comprises at least 17 contiguous nucleotides of any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7. In certain embodiments, the region of complementarity comprises at least 19 contiguous nucleotides of any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7. In certain embodiments, the region of complementarity comprises at least 20 contiguous nucleotides of any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7. In certain embodiments, the region of complementarity comprises at least 21 contiguous nucleotides of any one of the antisense nucleotide sequences in any one of Tables 2-3 and 6-7.

[0011] In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) for inhibiting expression of xanthine dehydrogenase (XDH) in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 226-269; 1318-1352; 1953-1998; 2351-2394; 2679-2730; 3867-3916; or 4510-4574 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0012] In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) for inhibiting expression of xanthine dehydrogenase (XDH) in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 15-45; 121-162; 226-292; 306-338; 379-402; 428-458; 495-521; 873-907; 1318-1344; 1381-1407; 1604-1643; 1700-1723; 1960-1991; 1996-2029; 2044-2067; 2128-2174; 2186-2208; 2289-2345; 2359-2419; 2689-2722; 2699-2721; 2774-2797; 2930-2958; 2987-3064; 3083-3158; 3195-3221; 3248-3293; 3352-3405; 3460-3520; 3524-3571; 3575-3644; 3870-3963; 4143-4176; 4259-4315; 4355-4379; 4395-4467; 4502-4562; 4577-4648; 4658-4752; 4815-4854; 5199-5277; 5284-5310; 5358-5446; or 5677-5713 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0013] In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) for inhibiting expression of xanthine dehydrogenase (XDH) in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 123-143; 229-249; 229-251, 230-250; 237-259; 241-263; 271-291; 1320-1342; 1321-1341; 1965-1987; 1971-1993; 2130-2150; 2682-2704; 2689-2711; 2690-2710; 2699-2721; 3880-3900; or 3883-3903 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0014] In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides differing by nor more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1395794.1; AD-1136038.3; AD-1395797.1; AD-1135991.3; AD-1297597.2; AD-1395803.1; AD-1395805.1; AD-1395807.1; AD-1395811.1; AD-1297663.2; AD-1136008.2; AD-1395816.1; AD-1136061.2; AD-1135987.2; AD-1395823.1; AD-1136166.3; and AD-1136169.

[0015] In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1136091, AD-1395794, AD-1395805, AD-1136008, AD-1136038, AD-1395823, AD-1395816, AD-1136061, AD-1395811, and AD-1136166.

[0016] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequences of nucleotides 2699-2721 of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0017] In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from the antisense strand nucleotide sequence of duplex AD-1136091.

[0018] In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0019] In one embodiment, substantially all of the nucleotides of the sense strand; substantially all of the nucleotides of the antisense strand comprise a modification; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification.

[0020] In one embodiment, all of the nucleotides of the sense strand comprise a modification; all of the nucleotides of the antisense strand comprise a modification; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0021] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3′-terminal deoxythimidine (dT) nucleotide, a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-O-allyl-modified nucleotide, 2′-C-alkyl-modified nucleotide, a 2′-methoxyethyl modified nucleotide, a 2′-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5′-phosphate, a nucleotide comprising a 5′-phosphate mimic, a nucleotide comprising a 2′-phosphate, e.g., cytidine-2′-phosphate (C2p); guanosine-2′-phosphate (G2p); uridine-2′-phosphate (U2p); adenosine-2′-phosphate (A2p); a thermally destabilizing nucleotide, a glycol modified nucleotide (GNA), and a 2-O-(N-methylacetamide) modified nucleotide; and combinations thereof.

[0022] In one embodiment, the modifications on the nucleotides are selected from the group consisting of LNA, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), CeNA, 2′-methoxyethyl, 2′-O-alkyl, 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxyl, and glycol; and combinations thereof.

[0023] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a nucleotide comprising a 2′-phosphate, a glycol modified nucleotide (GNA), e.g., Ggn, Cgn, Tgn, or Agn, and, a vinyl-phosphonate nucleotide; and combinations thereof.

[0024] In another embodiment, at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification.

[0025] In one embodiment, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; and destabilizing sugar modification, a 2′-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

[0026] The double stranded region may be 19-30 nucleotide pairs in length; 19-25 nucleotide pairs in length; 19-23 nucleotide pairs in length; 23-27 nucleotide pairs in length; or 21-23 nucleotide pairs in length.

[0027] In one embodiment, each strand is independently no more than 30 nucleotides in length.

[0028] In one embodiment, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0029] The region of complementarity may be at least 17 nucleotides in length; 19-23 nucleotides in length; or 19 nucleotides in length.

[0030] In one embodiment, at least one strand comprises a 3′ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3′ overhang of at least 2 nucleotides.

[0031] In one embodiment, the dsRNA agent further comprises a ligand.

[0032] In one embodiment, the ligand is conjugated to the 3′ end of the sense strand of the dsRNA agent.

[0033] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0034] In one embodiment, the ligand is one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.

[0035] In one embodiment, the ligand is

[0036]

[0037] In one embodiment, the dsRNA agent is conjugated to the ligand as shown in the following schematic

[0038]

[0039] and, wherein X is O or S.

[0040] In one embodiment, the X is O.

[0041] In one embodiment, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0042] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3′-terminus of one strand, e.g., the antisense strand or the sense strand.

[0043] In another embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5′-terminus of one strand, e.g., the antisense strand or the sense strand.

[0044] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the both the 5′- and 3′-terminus of one strand. In one embodiment, the strand is the antisense strand.

[0045] In one embodiment, the base pair at the 1 position of the 5′-end of the antisense strand of the duplex is an AU base pair.

[0046] The present invention also provides cells containing any of the dsRNA agents of the invention and pharmaceutical compositions comprising any of the dsRNA agents of the invention.

[0047] The pharmaceutical composition of the invention may include dsRNA agent in an unbuffered solution, e.g., saline or water, or the pharmaceutical composition of the invention may include the dsRNA agent is in a buffer solution, e.g., a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof; or phosphate buffered saline (PBS).

[0048] In one aspect, the present invention provides a method of inhibiting expression of a xanthine dehydrogenase (XDH) gene in a cell. The method includes contacting the cell with any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, thereby inhibiting expression of the XDH gene in the cell.

[0049] In one embodiment, the cell is within a subject, e.g., a human subject, e.g., a subject having a xanthine dehydrogenase-(XDH)-associated disease. Such diseases are typically associated with excess uric acid, e.g., serum uric acid.

[0050] In one embodiment, the XDH-associated disease is hyperuricemia. In another embodiment, the XDH-associated disease is gout.

[0051] In one embodiment, contacting the cell with the dsRNA agent inhibits the expression of XDH by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0052] In one embodiment, inhibiting expression of XDH decreases XDH protein level in serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0053] In one aspect, the present invention provides a method of treating a subject having a disorder that would benefit from reduction in xanthine dehydrogenase (XDH) expression. The method includes administering to the subject a therapeutically effective amount of any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, thereby treating the subject having the disorder that would benefit from reduction in XDH expression.

[0054] In another aspect, the present invention provides a method of preventing development of a disorder that would benefit from reduction in xanthine dehydrogenase (XDH) expression in a subject having at least one sign or symptom of a disorder who does not yet meet the diagnostic criteria for that disorder. The method includes administering to the subject a prophylactically effective amount of any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, thereby preventing the subject progressing to meet the diagnostic criteria of the disorder that would benefit from reduction in XDH expression.

[0055] In one embodiment, the disorder is a xanthine dehydrogenase-(XDH)-associated disorder.

[0056] In one embodiment, the subject is human.

[0057] In one embodiment, the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 50 mg/kg.

[0058] In one embodiment, the dsRNA agent is administered to the subject subcutaneously.

[0059] In one embodiment, the level of XDH in the subject sample(s) is an XDH protein level in a blood or serum sample(s).

[0060] In one embodiment, the administration of the agent to the subject causes a decrease in the level of uric acid (e.g., serum uric acid) or a decrease in XDH protein accumulation.

[0061] In certain embodiments, the methods of the invention further comprise administering to the subject an additional therapeutic agent.

[0062] In certain embodiments, the compositions and methods of the invention are used in combination with other compositions and methods to treat hyperuricemia and/or gout, e.g., allopurinol, oxypurinol, febuxostat, analgesic or anti-inflammatory agents, e.g., NSAIDS.

[0063] The present invention also provides kits comprising any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, and optionally, instructions for use.

[0067] The present invention provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a xanthine dehydrogenase (XDH) gene. The gene may be within a cell, e.g., a cell within a subject, such as a human. The use of these iRNAs enables the targeted degradation of mRNAs of the corresponding gene (xanthine dehydrogenase gene) in mammals.

[0068] The iRNAs of the invention have been designed to target the human xanthine dehydrogenase gene, including portions of the gene that are conserved in the xanthine dehydrogenase orthologs of other mammalian species. Without intending to be limited by theory, it is believed that a combination or sub-combination of the foregoing properties and the specific target sites or the specific modifications in these iRNAs confer to the iRNAs of the invention improved efficacy, stability, potency, durability, and safety.

[0069] Accordingly, the present invention provides methods for treating and preventing a xanthine dehydrogenase-associated disorder, disease, or condition, e.g., a disorder, disease, or condition associated with elevated serum uric acid levels, e.g., hyperuricemia and gout, using iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a xanthine dehydrogenase gene.

[0070] The iRNAs of the invention include an RNA strand (the antisense strand) having a region which is up to about 30 nucleotides or less in length, e.g., 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a xanthine dehydrogenase gene. In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 21-23 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a xanthine dehydrogenase gene.

[0071] In certain embodiments, one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of a xanthine dehydrogenase gene. In some embodiments, such iRNA agents having longer length antisense strands can, for example, include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

[0072] The use of iRNAs of the invention enables the targeted degradation of mRNAs of the corresponding gene (xanthine dehydrogenase gene) in mammals. Using in vitro and in vivo assays, the present inventors have demonstrated that iRNAs targeting a xanthine dehydrogenase gene can potently mediate RNAi, resulting in significant inhibition of expression of a xanthine dehydrogenase gene. Thus, methods and compositions including these iRNAs are useful for treating a subject having a xanthine dehydrogenase-associated disorder, e.g., hyperuricemia and gout.

[0073] Accordingly, the present invention provides methods and combination therapies for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a xanthine dehydrogenase gene, e.g., a xanthine dehydrogenase-associated disease, such as hyperuricemia and gout, using iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of an XDH gene.

[0074] The present invention also provides methods for preventing at least one symptom in a subject having a disorder that would benefit from inhibiting or reducing the expression of a xanthine dehydrogenase gene, e.g., hyperuricemia and gout.

[0075] In certain embodiments, the administration of the dsRNA to the subject causes a decrease in XDH mRNA level, XDH protein level, and the level of serum uric acid.

[0076] The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of a xanthine dehydrogenase gene as well as compositions, uses, and methods for treating subjects that would benefit from inhibition or reduction of the expression of a xanthine dehydrogenase gene, e.g., subjects susceptible to or diagnosed with a xanthine dehydrogenase-associated disorder.

[0077] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0078] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0079] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.

[0080] The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise. For example, “sense strand or antisense strand” is understood as “sense strand or antisense strand or sense strand and antisense strand.”

[0081] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means±10%. In certain embodiments, about means±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0082] The term “at least”, “no less than”, or “or more” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleotides of a 21 nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

[0083] As used herein, “no more than” or “or less” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.

[0084] As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method.

[0085] In the event of a conflict between an indicated target site and the nucleotide sequence for a sense or antisense strand, the indicated sequence takes precedence.

[0086] In the event of a conflict between a sequence and its indicated site on a transcript or other sequence, the nucleotide sequence recited in the specification takes precedence.

[0087] As used herein, the term “xanthine dehydrogenase,” used interchangeably with the term “XDH,” refers to the well-known gene and polypeptide, also known in the art as Xanthine Dehydrogenase/Oxidase, Xanthine Oxidoreductase, XAN1, XDHA, XOR, XO, EC 1.17.1.4, and EC 1.7.2.2.

[0088] XDH belongs to the group of molybdenum-containing hydroxylases involved in the oxidative metabolism of purines. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Xanthine dehydrogenase can be converted to xanthine oxidase by reversible sulfhydryl oxidation or by irreversible proteolytic modification. As used herein, unless clear from context, xanthine dehydrogenase or XDH is understood to include both the xanthine dehydrogenase and xanthine oxidase (“XO” or “XOR”) form of the protein. The protein is expressed predominantly in the intestine and the liver, but is also expressed in adipose tissue. Two transcript variants have been identified for the human isoform of the gene.

[0089] The term “XDH” includes human XDH, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession Nos. GI:91823270, GI: 1519244313, and GI:767915203; mouse XDH, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI:575501724; rat XDH, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI:8394543; and Macaca fascicularis XDH, transcript variant X1, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession Nos. GI:544482046 and GI:544482048. Additional examples of XDH mRNA sequences are readily available using, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.

[0090] Exemplary XDH nucleotide sequences may also be found in SEQ ID NOs:1, 3, 5, 7, 9, 11, and 15. SEQ ID NOs:2, 4, 6, 8, 10, 12, and 16 are the antisense sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 15, respectively.

[0091] The term “XDH,” as used herein, also refers to naturally occurring DNA sequence variations of the XDH gene. The term“XDH,” as used herein, also refers to single nucleotide polymorphisms in the XDH gene. Numerous sequence variations within the XDH gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov/snp?LinkName=gene_snp&from_uid=7498 (which is incorporated herein by reference as of the date of filing this application) which lists over 3000 SNPs in human XDH). In certain embodiments, such naturally occurring variants are included within the scope of the XDH gene sequence.

[0092] Further information on XDH can be found, for example, at www.ncbi.nlm.nih.gov/gene/7498 (which is incorporated herein by reference as of the date of filing this application).

[0093] Additional examples of XDH mRNA sequences are readily available through publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.

[0094] The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.

[0095] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a xanthine dehydrogenase gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an XDH gene. In one embodiment, the target sequence is within the protein coding region of XDH.

[0096] The target sequence may be from about 19-36 nucleotides in length, e.g., about 19-30 nucleotides in length. For example, the target sequence can be about 19-30 nucleotides, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the target sequence is about 19 to about 30 nucleotides in length. In other embodiments, the target sequence is about 19 to about 25 nucleotides in length. In still other embodiments, the target sequence is about 19 to about 23 nucleotides in length. In some embodiments, the target sequence is about 21 to about 23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0097] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0098] “G,” “C,” “A,” “T,” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

[0099] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of a xanthine dehydrogenase gene in a cell, e.g., a cell within a subject, such as a mammalian subject.

[0100] In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., a xanthine dehydrogenase target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA (siRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a xanthine dehydrogenase (XDH) gene. Accordingly, the term “siRNA” is also used herein to refer to an iRNA as described above.

[0101] In certain embodiments, the RNAi agent may be a single-stranded siRNA (ssRNAi) that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

[0102] In certain embodiments, an “iRNA” for use in the compositions, uses, and methods of the invention is a double stranded RNA and is referred to herein as a “double stranded RNA agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a xanthine dehydrogenase (XDH) gene. In some embodiments of the invention, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0103] As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “iRNA” or “RNAi agent” for the purposes of this specification and claims.

[0104] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide—which is acknowledged as a naturally occurring form of nucleotide—if present within a RNAi agent can be considered to constitute a modified nucleotide.

[0105] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 19 to 36 base pairs in length, e.g., about 19-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex region is 19-21 base pairs in length, e.g., 21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0106] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 4, 5, 6, 7, 8, 9, 10, 20, 23 or more unpaired nucleotides. In some embodiments, the hairpin loop can be 10 or fewer nucleotides.

[0107] In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.

[0108] In certain embodiment, the two strands of double-stranded oligomeric compound can be linked together. The two strands can be linked to each other at both ends, or at one end only. By linking at one end is meant that 5′-end of first strand is linked to the 3′-end of the second strand or 3′-end of first strand is linked to 5′-end of the second strand. When the two strands are linked to each other at both ends, 5′-end of first strand is linked to 3′-end of second strand and 3′-end of first strand is linked to 5′-end of second strand. The two strands can be linked together by an oligonucleotide linker including, but not limited to, (N)n; wherein N is independently a modified or unmodified nucleotide and n is 3-23. In some embodiments, n is 3-10, e.g., 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the oligonucleotide linker is selected from the group consisting of GNRA, (G)4, (U)4, and (dT)4, wherein N is a modified or unmodified nucleotide and R is a modified or unmodified purine nucleotide. Some of the nucleotides in the linker can be involved in base-pair interactions with other nucleotides in the linker. The two strands can also be linked together by a non-nucleoside linker, e.g. a linker described herein. It will be appreciated by one of skill in the art that any oligonucleotide chemical modifications or variations describe herein can be used in the oligonucleotide linker.

[0109] Hairpin and dumbbell type oligomeric compounds will have a duplex region equal to or at least 14, 15, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region can be equal to or less than 200, 100, or 50, in length. In some embodiments, ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length.

[0110] The hairpin oligomeric compounds can have a single strand overhang or terminal unpaired region, in some embodiments at the 3′, and in some embodiments on the antisense side of the hairpin. In some embodiments, the overhangs are 1-4, more generally 2-3 nucleotides in length. The hairpin oligomeric compounds that can induce RNA interference are also referred to as “shRNA” herein.

[0111] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not be, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment of the RNAi agent, at least one strand comprises a 3′ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5′ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3′ and the 5′ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.

[0112] In certain embodiments, an iRNA agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a xanthine dehydrogenase (XDH) gene, to direct cleavage of the target RNA.

[0113] In some embodiments, an iRNA of the invention is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence, e.g., an XDH target mRNA sequence, to direct the cleavage of the target RNA.

[0114] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double stranded iRNA. For example, when a 3′-end of one strand of a dsRNA extends beyond the 5′-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end, or both ends of either an antisense or sense strand of a dsRNA.

[0115] In one embodiment of the dsRNA, at least one strand comprises a 3′ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5′ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3′ and the 5′ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.

[0116] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end or the 5′-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end or the 5′-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0117] In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotides, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end or the 5′-end. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′ end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′ end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

[0118] “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNA agent, i.e., no nucleotide overhang. A “blunt ended” double stranded RNA agent is double stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the invention include RNAi agents with no nucleotide overhang at one end (i.e., agents with one overhang and one blunt end) or with no nucleotide overhangs at either end. Most often such a molecule will be double-stranded over its entire length.

[0119] The term “antisense strand” or “guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an XDH mRNA.

[0120] As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a xanthine dehydrogenase nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, or 3 nucleotides of the 5′- or 3′-end of the iRNA. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand. In some embodiments, the antisense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the target mRNA, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the target mRNA. In some embodiments, the antisense strand double stranded RNA agent of the invention includes no more than 4 mismatches with the sense strand, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the sense strand. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand. In some embodiments, the sense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the antisense strand, e.g., the sense strand includes 4, 3, 2, 1, or 0 mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3′-end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3′-terminal nucleotide of the iRNA agent. In some embodiments, the mismatch(s) is not in the seed region.

[0121] Thus, an RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, a RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5′- or 3′-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of an XDH gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of an XDH gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of an XDH gene is important, especially if the particular region of complementarity in an XDH gene is known to have polymorphic sequence variation within the population.

[0122] The term “sense strand” or “passenger strand” as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0123] As used herein, “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0124] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0125] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can be, for example, “stringent conditions”, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0126] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression, in vitro or in vivo. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

[0127] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairing.

[0128] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between two oligonucleotides or polynucleotides, such as the antisense strand of a double stranded RNA agent and a target sequence, as will be understood from the context of their use.

[0129] As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a xanthine dehydrogenase gene). For example, a polynucleotide is complementary to at least a part of a xanthine dehydrogenase mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding a xanthine dehydrogenase gene.

[0130] Accordingly, in some embodiments, the antisense polynucleotides disclosed herein are fully complementary to the target XDH sequence.

[0131] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1, 3, 5, 7, 9, 11, or 15, or a fragment of any one of SEQ ID NOs:1, 3, 5, 7, 9, 11, or 15, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0132] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of Tables 2-3 and 6-7, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2-3 and 6-7, such as about 85%, about 90%, about 95%, or fully complementary.

[0133] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to a fragment of SEQ ID NO:1 selected from the group of nucleotides 226-269; 1318-1352; 1953-1998; 2351-2394; 2679-2730; 3867-3916; or 4510-4574 of SEQ ID NO: 1, such as about 85%, about 90%, about 95%, or fully complementary.

[0134] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to a fragment of SEQ ID NO:1 selected from the group of nucleotides 15-45; 121-162; 226-292; 306-338; 379-402; 428-458; 495-521; 873-907; 1318-1344; 1381-1407; 1604-1643; 1700-1723; 1960-1991; 1996-2029; 2044-2067; 2128-2174; 2186-2208; 2289-2345; 2359-2419; 2689-2722; 2699-2721; 2774-2797; 2930-2958; 2987-3064; 3083-3158; 3195-3221; 3248-3293; 3352-3405; 3460-3520; 3524-3571; 3575-3644; 3870-3963; 4143-4176; 4259-4315; 4355-4379; 4395-4467; 4502-4562; 4577-4648; 4658-4752; 4815-4854; 5199-5277; 5284-5310; 5358-5446; or 5677-5713 of SEQ ID NO: 1, such as about 85%, about 90%, about 95%, or fully complementary.

[0135] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to a fragment of SEQ ID NO:1 selected from the group of nucleotides 123-143; 229-249; 229-251, 230-250; 237-259; 241-263; 271-291; 1320-1342; 1321-1341; 1965-1987; 1971-1993; 2130-2150; 2682-2704; 2689-2711; 2690-2710; 2699-2721; 3880-3900; or 3883-3903 of SEQ ID NO: 1, such as about 85%, about 90%, about 95%, or fully complementary.

[0136] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target XDH sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to a fragment of SEQ ID NO:1, e.g., nucleotides 2699-2721 of SEQ ID NO:1, such as about 85%, about 90%, about 95%, or fully complementary.

[0137] In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is the same as a target XDH sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 16, or a fragment of any one of SEQ ID NOs:2, 4, 6, 8, 10, 12, or 16, such as about 85%, about 90%, about 95%, or fully complementary.

[0138] In some embodiments, an RNAi agent of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target xanthine dehydrogenase sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the antisense strand nucleotide sequences in any one of Tables 2-3 and 6-7, or a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 2-3 and 6-7, such as about 85%, about 90%, about 95%, or fully complementary.

[0139] In some embodiments, the double-stranded region of a double-stranded iRNA agent is equal to or at least, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotide pairs in length.

[0140] In some embodiments, the antisense strand of a double-stranded iRNA agent is equal to or at least 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0141] In some embodiments, the sense strand of a double-stranded iRNA agent is equal to or at least 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0142] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each 18 to 30 nucleotides in length.

[0143] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each 19 to 25 nucleotides in length.

[0144] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each 21 to 23 nucleotides in length.

[0145] In one embodiment, the sense strand of the iRNA agent is 21-nucleotides in length, and the antisense strand is 23-nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single stranded overhangs at the 3′-end.

[0146] In some embodiments, the majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide or a modified nucleotide. In addition, an “iRNA” may include ribonucleotides with chemical modifications. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in an iRNA molecule, are encompassed by “iRNA” for the purposes of this specification and claims.

[0147] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide if present within an RNAi agent can be considered to constitute a modified nucleotide.

[0148] In one embodiment, at least partial suppression of the expression of an XDH gene, is assessed by a reduction of the amount of XDH mRNA which can be isolated from or detected in a first cell or group of cells in which an XDH gene is transcribed and which has or have been treated such that the expression of an XDH gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of:

[0149] $\frac{\left(\mathrm{mRNA}\mathrm{in}\mathrm{control}\mathrm{cells}\right)-\left(\mathrm{mRNA}\mathrm{in}\mathrm{treated}\mathrm{cells}\right)}{\left(\mathrm{mRNA}\mathrm{in}\mathrm{control}\mathrm{cells}\right)}·100\%$

[0150] The phrase “contacting a cell with an iRNA,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an iRNA includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the iRNA may be put into physical contact with the cell by the individual performing the method, or alternatively, the iRNA may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0151] Contacting a cell in vitro may be done, for example, by incubating the cell with the iRNA. Contacting a cell in vivo may be done, for example, by injecting the iRNA into or near the tissue where the cell is located, or by injecting the iRNA into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the iRNA may contain or be coupled to a ligand, e.g., GalNAc, that directs the iRNA to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an iRNA and subsequently transplanted into a subject.

[0152] In certain embodiments, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusion or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.

[0153] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. LNPs are described in, for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0154] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a rabbit, a sheep, a hamster, a guinea pig, a dog, a rat, or a mouse), or a bird that expresses the target gene, either endogenously or heterologously. In an embodiment, the subject is a human, such as a human being treated or assessed for a disease or disorder that would benefit from reduction in XDH expression; a human at risk for a disease or disorder that would benefit from reduction in XDH expression; a human having a disease or disorder that would benefit from reduction in XDH expression; or human being treated for a disease or disorder that would benefit from reduction in XDH expression as described herein. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In another embodiment, the subject is a pediatric subject.

[0155] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result, such as reducing at least one sign or symptom of an XDH-associated disorder in a subject. Treatment also includes a reduction of one or more sign or symptoms associated with unwanted XDH expression; diminishing the extent of unwanted XDH activation or stabilization; amelioration or palliation of unwanted XDH activation or stabilization. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0156] The term “lower” in the context of the level of XDH in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%. In certain embodiments, the decrease is at least 50% in a disease marker, e.g., protein or gene expression level. “Lower” in the context of the level of XDH in a subject is a decrease to a level accepted as within the range of normal for an individual without such disorder. In certain embodiments, the expression of the target is normalized, i.e., decreased towards or to a level accepted as within the range of normal for an individual without such disorder, e.g., normalization of serum uric acid level. As used here, “lower” in a subject can refer to lowering of gene expression or protein production in a cell in a subject does not require lowering of expression in all cells or tissues of a subject. For example, as used herein, lowering in a subject can include lowering of gene expression or protein production in the liver of a subject.

[0157] The term “lower” can also be used in association with normalizing a symptom of a disease or condition, i.e. decreasing the difference between a level in a subject suffering from an XDH-associated disease towards or to a level in a normal subject not suffering from an XDH-associated disease.

[0158] As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal.

[0159] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an XDH gene or production of XDH protein, refers to preventing a subject who has at least one sign or symptom of a disease from developing further signs and symptoms thereby meeting the diagnostic criteria for that disease. In certain embodiments, prevention includes delayed progression to meeting the diagnostic criteria of the disease by days, weeks, months or years as compared to what would be predicted by natural history studies or the typical progression of the disease.

[0160] As used herein, the terms “xanthine dehydrogenase-associated disease” or “XDH-associated disease,” include a disease, disorder or condition that would benefit from a decrease in XDH gene expression, replication, or protein activity. Such disorders are caused by, or associated with elevated serum uric acid levels, such as hyperuricemia, including asymptomatic hyperuricemia.

[0161] “Hyperuricemia” is an elevated uric acid level in the blood. The normal upper limit is 6.8 mg/dL, and anything over 7 mg/dL is considered saturated, and symptoms can occur. Additional indicators of hyperuricemia include, for example, accelerated purine degradation, in high cell turnover states (hemolysis, rhabdomyolysis, and tumor lysis) and decreased excretion (renal insufficiency and metabolic acidosis). Methods to detect and monitor uric acid in serum or other subject samples are known in the art. Uric acid levels can be detected, for example using carbonate-phosphotungstate method, spectrophotometric uricase method, or chromatography methods such as HPLC or LCMS.

[0162] Hyperuricemia is associated with a number of diseases and conditions, including, but not limited to, gout NAFLD, NASH, metabolic disorder, insulin resistance, cardiovascular disease, hypertension, type 2 diabetes, and conditions linked to oxidative stress e.g., chronic low grade inflammation; or other XDH-associated disease. Thus, the compositions and methods of the invention which lower serum urine acid levels, e.g., lower serum uric acid levels to about to 6.8 mg/dl or less (the level of solubility of uric acid in serum) are also useful to treat subjects having gout, NAFLD, NASH, metabolic disorder, insulin resistance, cardiovascular disease, hypertension, type 2 diabetes, or conditions linked to oxidative, even in the absence of symptoms

[0163] “Gout” is a disorder that allows for the accumulation of uric acid in the blood and tissues. This leads to the precipitation of urate monohydrate crystals within a joint. When tissues are saturated with urate, crystals will precipitate. Precipitation is enhanced in acidic environments and cold environments, leading to increased precipitation in peripheral joints, such as the great toe. Gout has a male predominance in a 4:1 ratio of men to women. Uric acid levels can be elevated ten to 15 years before clinical manifestations of gout.

[0164] NAFLD is associated with hyperuricemia (Xu et al., J. Hepatol. 62:1412-1419, 2015). The diagnosis of “nonalcoholic fatty liver disease” (“NAFLD”) requires that (a) there is evidence of hepatic steatosis, either by imaging or by histology and (b) there are no causes for secondary hepatic fat accumulation such as significant alcohol consumption, use of steatogenic medication or hereditary disorders. In the majority of patients, NAFLD is associated with metabolic risk factors such as obesity, diabetes mellitus, and dyslipidemia. NAFLD is histologically further categorized into “nonalcoholic fatty liver” (“NAFL”) and “nonalcoholic steatohepatitis” (“NASH”). “NAFL” is defined as the presence of hepatic steatosis with no evidence of hepatocellular injury in the form of ballooning of the hepatocytes. “NASH” is defined as the presence of hepatic steatosis and inflammation with hepatocyte injury (ballooning) with or without fibrosis (Chalasani et al., Hepatol. 55:2005-2023, 2012). It is generally agreed that patients with simple steatosis have very slow, if any, histological progression, while patients with NASH can exhibit histological progression to cirrhotic-stage disease. The long term outcomes of patients with NAFLD and NASH have been reported in several studies. Their findings can be summarized as follows; (a) patients with NAFLD have increased overall mortality compared to matched control populations, (b) the most common cause of death in patients with NAFLD, NAFL, and NASH is cardiovascular disease, and (c) patients with NASH (but not NAFL) have an increased liver-related mortality rate. In a mouse model of NAFLD, treatment with allopurinol both prevented the development of hepatic steatosis, but also significantly ameliorated established hepatic steatosis in mice (Xu et al., J. Hepatol. 62:1412-1419, 2015).

[0165] Cardiovascular disease has been associated with hyperuricemia. Allopurinol has been demonstrated to be effective in the treatment of cardiovascular disease in animal models and humans including myocardial infarction, ischemia-reperfusion injury, hypoxia, ischemic heart disease, heart failure, hypercholesterolemia, and hypertension (Pacher et al., Pharma. Rev. 58:87-114, 2006). As discussed above, treatment with allopurinol is contraindicated in a number of populations, especially those with compromised renal function.

[0166] Metabolic syndrome, insulin resistance, and type 2 diabetes are associated with hyperuricemia (Cardoso et al., J. Pediatr. 89:412-418, 2013).

[0167] “Metabolic syndrome” is characterized by a cluster of conditions defined as at least three of the five following metabolic risk factors which include:large waistline (≥35 inches for women or ≥40 inches for men); high triglyceride level (≥150 mg/dl); low HDL cholesterol (≤50 mg/dl for women or ≤40 mg/dl for men); elevated blood pressure (≥130/85) or on medicine to treat high blood pressure; and high fasting blood sugar (≥100 mg/dl) or being in medicine to treat high blood sugar.

[0168] “Insulin resistance” is characterized by the presence of at least one of: a fasting blood glucose level of 100-125 mg/dL taken at two different times; or an oral glucose tolerance test with a result of a glucose level of 140-199 mg/dL at 2 hours after glucose consumption.

[0169] “Type 2 diabetes” is characterized by at least one of: a fasting blood glucose level ≥126 mg/dL taken at two different times; ahemoglobin A1c (A1C) test with a result of ≥6.5% or higher; or an oral glucose tolerance test with a result of a glucose level ≥200 mg/dL at 2 hours after glucose consumption.

Metabolic syndrome, insulin resistance, and type 2 diabetes are often associated with decreased renal function or the potential for decreased renal function.

[0170] Further details regarding signs and symptoms of the various diseases or conditions are provided herein and are well known in the art.

[0171] In one embodiment of the invention, the XDH-associated disease is hyperuricemia.

[0172] In another embodiment of the invention, the XDH-associate disease is gout.

[0173] In certain embodiments, an XDH-associated disease is NASH or NAFLD.

[0174] “Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having an XDH-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. In certain embodiments, treatment with the iRNAs of the invention will result in serum uric acid levels at 2-6.8 mg/dl, such as, 2-6 mg/dl in subjects. Maintenance of such uric acid levels will treat or prevent XDH-associated diseases.

[0175] “Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having at least one sign or symptom of an XDH-associated disorder, is sufficient to prevent or delay the subject's progression to meeting the full diagnostic criteria of the disease. Prevention of the disease includes slowing the course of progression to full blown disease. The “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0176] A “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired effect at a reasonable benefit/risk ratio applicable to any treatment. The iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

[0177] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0178] The phrase “pharmaceutically-acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0179] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to urine obtained from the subject. A “sample derived from a subject” can refer to blood or blood derived serum or plasma from the subject.

[0180] The present invention provides iRNAs which inhibit the expression of a xanthine dehydrogenase gene. In some embodiments, the iRNA includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an XDH gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human susceptible to developing a xanthine dehydrogenase-associated disorder. The dsRNAi agent includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an XDH gene. The region of complementarity is about 19-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucleotides in length). Upon contact with a cell expressing the XDH gene, the iRNA inhibits the expression of the XDH gene (e.g., a human, a primate, a non-primate, or a rat XDH gene) by at least about 50% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flow cytometric techniques. In some embodiments, inhibition of expression is determined by the qPCR method provided in the examples herein with the siRNA at, e.g., a 10 nM concentration, in an appropriate organism cell or cell line provided therein. In some embodiments, inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., a mouse or an AAV-infected mouse expressing the human target gene, e.g., when administered as single dose, e.g., at 3 mg/kg at the nadir of RNA expression.

[0181] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of an XDH gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

[0182] Generally, the duplex structure is 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-25, 20-24, 20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22-23, 23-25, 23-24 or 24-25 base pairs in length, for example, 19-21 basepairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0183] Similarly, the region of complementarity to the target sequence is 15 to 30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, for example 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0184] In some embodiments, the duplex structure is 19 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 19 to 30 nucleotides in length.

[0185] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well-known in the art that dsRNAs longer than about 21-23 nucleotides in length may serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).

[0186] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target xanthine dehydrogenase gene expression is not generated in the target cell by cleavage of a larger dsRNA.

[0187] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end, or both ends of an antisense or sense strand of a dsRNA.

[0188] A dsRNA can be synthesized by standard methods known in the art. Double stranded RNAi compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

[0189] Regardless of the method of synthesis, the siRNA preparation can be prepared in a solution (e.g., an aqueous or organic solution) that is appropriate for formulation. For example, the siRNA preparation can be precipitated and redissolved in pure double-distilled water, and lyophilized. The dried siRNA can then be resuspended in a solution appropriate for the intended formulation process.

[0190] In an aspect, a dsRNA of the invention includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence. The sense strand is selected from the group of sequences provided in any one of Tables 2-3 and 6-7, and the corresponding antisense strand of the sense strand is selected from the group of sequences of any one of Tables 2-3 and 6-7. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a xanthine dehydrogenase gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand in any one of Tables 2-3 and 6-7, and the second oligonucleotide is described as the corresponding antisense strand of the sense strand in any one of Tables 2-3 and 6-7.

[0191] In certain embodiments, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In other embodiments, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

[0192] It will be understood that, although the sequences in Tables 2 and 6 are not described as modified or conjugated sequences, the RNA of the iRNA of the invention e.g., a dsRNA of the invention, may comprise any one of the sequences set forth in any one of Tables 2-3 and 6-7 that is un-modified, un-conjugated, or modified or conjugated differently than described therein. In other words, the invention encompasses dsRNA of Tables 2-3 and 6-7 which are un-modified, un-conjugated, modified, or conjugated, as described herein.

[0193] The skilled person is well aware that dsRNAs having a duplex structure of about 20 to 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in any one of Tables 2-3 and 6-7, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes having any one of the sequences in any one of Tables 2-3 and 6-7 minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 19, 20, or more contiguous nucleotides derived from any one of the sequences of any one of Tables 2-3 and 6-7, and differing in their ability to inhibit the expression of a xanthine dehydrogenase gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present invention.

[0194] In addition, the RNAs provided in Tables 2-3 and 6-7 identify a site(s) in a xanthine dehydrogenase transcript that is susceptible to RISC-mediated cleavage. As such, the present invention further features iRNAs that target within one of these sites. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least about 19 contiguous nucleotides from any one of the sequences provided in any one of Tables 2-3 and 6-7 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a xanthine dehydrogenase gene.

[0195] An RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5′- or 3′-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of an XDH gene generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of an XDH gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of an XDH gene is important, especially if the particular region of complementarity in an XDH gene is known to have polymorphic sequence variation within the population.

[0196] In certain embodiments, the RNA of the iRNA of the invention e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In other embodiments, the RNA of an iRNA of the invention, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA or substantially all of the nucleotides of an iRNA are modified, i.e., not more than 5, 4, 3, 2, or 1 unmodified nucleotides are present in a strand of the iRNA.

[0197] The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5′-end modifications (phosphorylation, conjugation, inverted linkages) or 3′-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2′-position or 4′-position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA will have a phosphorus atom in its internucleoside backbone.

[0198] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included. In some embodiments of the invention, the dsRNA agents of the invention are in a free acid form. In other embodiments of the invention, the dsRNA agents of the invention are in a salt form. In one embodiment, the dsRNA agents of the invention are in a sodium salt form. In certain embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester or phosphorothiotate groups present in the agent. Agents in which substantially all of the phosphodiester or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester or phosphorothiotate groups present in the agent.

[0199] Representative U.S. Patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0200] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH₂ component parts.

[0201] Representative U.S. Patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0202] Suitable RNA mimetics are contemplated for use in iRNAs provided herein, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound in which an RNA mimetic that has been shown to have excellent hybridization properties is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative US patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0203] Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH₂—NH—CH₂—, —CH₂—N(CH₃)—O—CH₂—[known as a methylene (methylimino) or MMI backbone], —CH₂—O—N(CH₃)—CH₂—, —CH₂—N(CH₃)—N(CH₃)—CH₂— and —N(CH₃)—CH₂—CH₂— of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506. The native phosphodiester backbone can be represented as O—P(O)(OH)—OCH2-.

[0204] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2′-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C₁ to C₁₀ alkyl or C₂ to C₁₀ alkenyl and alkynyl. Exemplary suitable modifications include O[(CH₂)_nO]_m,CH₃, O(CH₂)._nOCH₃, O(CH₂)_nNH₂, O(CH₂)_nCH₃, O(CH₂)_nONH₂, and O(CH₂)_nON[(CH₂)_nCH₃)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2′ position: C₁ to C₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH₃, OCN, Cl, Br, CN, CF₃, OCF₃, SOCH₃, SO₂CH₃, ONO₂, NO₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH₂CH₂OCH₃, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2′-dimethylaminooxyethoxy, i.e., a O(CH₂)₂ON(CH₃)₂ group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH₂—O—CH₂—N(CH₃)₂. Further exemplary modifications include: 5′-Me-2′-F nucleotides, 5′-Me-2′-OMe nucleotides, 5′-Me-2′-deoxynucleotides, (both R and S isomers in these three families); 2′-alkoxyalkyl; and 2′-NMA (N-methylacetamide).

[0205] Other modifications include 2′-methoxy (2′-OCH₃), 2′-aminopropoxy (2′-OCH₂CH₂CH₂NH₂) and 2′-fluoro (2′-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked dsRNAs and the 5′ position of 5′ terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0206] An iRNA can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxythimidine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.

[0207] Representative U.S. Patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0208] An iRNA agent of the disclosure can also be modified to include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or non-adjacent. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridging two carbons, whether adjacent or non-adjacent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring, optionally, via the 2′-acyclic oxygen atom. Thus, in some embodiments an agent of the invention may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4′-CH₂—O-2′ bridge. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge.

[0209] A locked nucleoside can be represented by the structure (omitting stereochemistry),

[0210]

[0211] wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2′-carbon to the 4′-carbon of the ribose ring.

[0212] Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH₂)—O-2′ (LNA); 4′-(CH₂)—S-2′; 4′-(CH₂)₂—O-2′ (ENA); 4′-CH(CH₃)—O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH₂OCH₃)—O-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH₃)(CH₃)—O-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4′-CH₂—N(OCH₃)-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4′-CH₂—O—N(CH₃)-2′ (see, e.g., U.S. Patent Publication No. 2004/0171570); 4′-CH₂—N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4′-CH₂—C(H)(CH₃)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH₂—C(H₂)-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0213] Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0214] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see WO 99/14226).

[0215] The RNA of an iRNA can also be modified to include one or more constrained ethyl nucleotides. As used herein, a “constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4′-CH(CH₃)—O-2′ bridge (i.e., L in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”

[0216] An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2′ and C4′ carbons of ribose or the C3 and —C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0217] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US2013/0190383; and WO2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

[0218] In some embodiments, an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses monomer with bonds between C1′-C4′ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1′ and C4′ carbons). In another example, the C2′-C3′ bond (i.e. the covalent carbon-carbon bond between the C2′ and C3′ carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0219] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US2013/0096289; US2013/0011922; and US2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0220] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in WO2011/005861.

[0221] Other modifications of the nucleotides of an iRNA of the invention include a 5′ phosphate or 5′ phosphate mimic, e.g., a 5′-terminal phosphate or phosphate mimic on the antisense strand of an iRNA. Suitable phosphate mimics are disclosed in, for example US2012/0157511, the entire contents of which are incorporated herein by reference.

[0222] A. Modified iRNAs Comprising Motifs of the Invention

[0223] In certain aspects of the invention, the double stranded RNA agents of the invention include agents with chemical modifications as disclosed, for example, in WO2013/075035, the entire contents of each of which are incorporated herein by reference. As shown herein and in WO2013/075035, one or more motifs of three identical modifications on three consecutive nucleotides may be introduced into a sense strand or antisense strand of a dsRNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the dsRNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense or antisense strand. The dsRNAi agent may be optionally conjugated with a GalNAc derivative ligand, for instance on the sense strand.

[0224] More specifically, when the sense strand and antisense strand of the double stranded RNA agent are completely modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of a dsRNAi agent, the gene silencing activity of the dsRNAi agent was observed.

[0225] Accordingly, the invention provides double stranded RNA agents capable of inhibiting the expression of a target gene (i.e., XDH gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may be, for example, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0226] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as “dsRNAi agent.” The duplex region of a dsRNAi agent may be, for example, the duplex region can be 27-30 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0227] In certain embodiments, the dsRNAi agent may contain one or more overhang regions or capping groups at the 3′-end, 5′-end, or both ends of one or both strands. The overhang can be, independently, 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. In certain embodiments, the overhang regions can include extended overhang regions as provided above. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

[0228] In certain embodiments, the nucleotides in the overhang region of the dsRNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2′-sugar modified, such as, 2′-F, 2′-O-methyl, thymidine (T), 2′-O-methoxyethyl-5-methyluridine (Teo), 2′-O-methoxyethyladenosine (Aeo), 2′-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.

[0229] For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

[0230] The 5′- or 3′-overhangs at the sense strand, antisense strand, or both strands of the dsRNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In some embodiments, the overhang is present at the 3′-end of the sense strand, antisense strand, or both strands. In some embodiments, this 3′-overhang is present in the antisense strand. In some embodiments, this 3′-overhang is present in the sense strand.

[0231] The dsRNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3′-end of the sense strand or, alternatively, at the 3′-end of the antisense strand. The RNAi may also have a blunt end, located at the 5′-end of the antisense strand (or the 3′-end of the sense strand) or vice versa. Generally, the antisense strand of the dsRNAi agent has a nucleotide overhang at the 3′-end, and the 5′-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5′-end of the antisense strand and 3′-end overhang of the antisense strand favor the guide strand loading into RISC process.

[0232] In certain embodiments, the dsRNAi agent is a double blunt-ended of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5′end.

[0233] In other embodiments, the dsRNAi agent is a double blunt-ended of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5′ end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5′ end.

[0234] In yet other embodiments, the dsRNAi agent is a double blunt-ended of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5′end.

[0235] In certain embodiments, the dsRNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5′end; the antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5′end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. In some embodiments, the 2 nucleotide overhang is at the 3′-end of the antisense strand.

[0236] When the 2 nucleotide overhang is at the 3′-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5′-end of the sense strand and at the 5′-end of the antisense strand. In certain embodiments, every nucleotide in the sense strand and the antisense strand of the dsRNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In certain embodiments each residue is independently modified with a 2′-O-methyl or 3′-fluoro, e.g., in an alternating motif. Optionally, the dsRNAi agent further comprises a ligand (such as, GalNAc).

[0237] In certain embodiments, the dsRNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5′ terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3′ terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3 ‘ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3’ terminal nucleotides are unpaired with sense strand, thereby forming a 3′ single stranded overhang of 1-6 nucleotides; wherein the 5′ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5′ overhang; wherein at least the sense strand 5′ terminal and 3′ terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

[0238] In certain embodiments, the dsRNAi agent comprises sense and antisense strands, wherein the dsRNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at position 11, 12, and 13 from the 5′ end; wherein the 3′ end of the first strand and the 5′ end of the second strand form a blunt end and the second strand is 1˜4 nucleotides longer at its 3′ end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein Dicer cleavage of the dsRNAi agent results in an siRNA comprising the 3′-end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the dsRNAi agent further comprises a ligand.

[0239] In certain embodiments, the sense strand of the dsRNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

[0240] In certain embodiments, the antisense strand of the dsRNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.

[0241] For a dsRNAi agent having a duplex region of 19-23 nucleotides in length, the cleavage site of the antisense strand is typically around the 10, 11, and 12 positions from the 5′-end. Thus the motifs of three identical modifications may occur at the 9, 10, and 11 positions; the 10, 11, and 12 positions; the 11, 12, and 13 positions; the 12, 13, and 14 positions; or the 13, 14, and 15 positions of the antisense strand, the count starting from the first nucleotide from the 5′-end of the antisense strand, or, the count starting from the first paired nucleotide within the duplex region from the 5′-end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the dsRNAi agent from the 5′-end.

[0242] The sense strand of the dsRNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0243] In some embodiments, the sense strand of the dsRNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistries of the motifs are distinct from each other, and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

[0244] Like the sense strand, the antisense strand of the dsRNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

[0245] In some embodiments, the wing modification on the sense strand or antisense strand of the dsRNAi agent typically does not include the first one or two terminal nucleotides at the 3′-end, 5′-end, or both ends of the strand.

[0246] In other embodiments, the wing modification on the sense strand or antisense strand of the dsRNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3′-end, 5′-end, or both ends of the strand.

[0247] When the sense strand and the antisense strand of the dsRNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two, or three nucleotides.

[0248] When the sense strand and the antisense strand of the dsRNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two, or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.

[0249] In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2′-hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

[0250] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3′- or 5′ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of an RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5′-end or ends can be phosphorylated.

[0251] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5′- or 3′-overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3′- or 5′-overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2′ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2′-deoxy-2′-fluoro (2′-F) or 2′-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

[0252] In some embodiments, each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′-O-allyl, 2′-C-allyl, 2′-deoxy, 2′-hydroxyl, or 2′-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro.

[0253] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2′-O-methyl or 2′-fluoro modifications, or others.

[0254] In certain embodiments, the N_a or N_b comprise modifications of an alternating pattern. The term “alternating motif” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “ABABABABABAB . . . ,” “AABBAABBAABB . . . ,” “AABAABAABAAB . . . ,” “AAABAAABAAAB . . . ,” “AAABBBAAABBB . . . ,” or “ABCABCABCABC . . . ,” etc.

[0255] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB . . . ”, “ACACAC . . . ” “BDBDBD . . . ” or “CDCDCD . . . ,” etc.

[0256] In some embodiments, the dsRNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5′ to 3′ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 5′ to 3′ of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5′ to 3′ of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 5′ to 3′ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.

[0257] In some embodiments, the dsRNAi agent comprises the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the antisense strand initially, i.e., the 2′-O-methyl modified nucleotide on the sense strand base pairs with a 2′-F modified nucleotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2′-F modification, and the 1 position of the antisense strand may start with the 2′-O-methyl modification.

[0258] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand or antisense strand interrupts the initial modification pattern present in the sense strand or antisense strand. This interruption of the modification pattern of the sense or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense or antisense strand may enhance the gene silencing activity against the target gene.

[0259] In some embodiments, when the motif of three identical modifications on three consecutive nucleotides is introduced to any of the strands, the modification of the nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “ . . . N_aYYYN_b . . . ,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “N_a” and “N_b” represent a modification to the nucleotide next to the motif “YYY” that is different than the modification of Y, and where N_a and N_b can be the same or different modifications. Alternatively, N_a or N_b may be present or absent when there is a wing modification present.

[0260] The iRNA may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand, antisense strand, or both strands in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In one embodiment, a double-stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5′-end and two phosphorothioate internucleotide linkages at the 3′-end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5′-end or the 3′-end.

[0261] In some embodiments, the dsRNAi agent comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. These terminal three nucleotides may be at the 3′-end of the antisense strand, the 3′-end of the sense strand, the 5′-end of the antisense strand, or the 5′ end of the antisense strand.

[0262] In some embodiments, the 2-nucleotide overhang is at the 3′-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the dsRNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5′-end of the sense strand and at the 5′-end of the antisense strand.

[0263] In one embodiment, the dsRNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

[0264] In certain embodiments, the dsRNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5′-end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5′-end of the duplex.

[0265] In certain embodiments, the nucleotide at the 1 position within the duplex region from the 5′-end in the antisense strand is selected from A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair.

[0266] In other embodiments, the nucleotide at the 3′-end of the sense strand is deoxythimidine (dT) or the nucleotide at the 3′-end of the antisense strand is deoxythimidine (dT). For example, there is a short sequence of deoxythimidine nucleotides, for example, two dT nucleotides on the 3′-end of the sense, antisense strand, or both strands.

[0267] In certain embodiments, the sense strand sequence may be represented by formula (I):
5′n_p-N_a-(XXX)_i—N_b-YYY-N_b-(ZZZ)_j—N_a-n_q3′  (I)

[0268] wherein:

[0269] i and j are each independently 0 or 1;

[0270] p and q are each independently 0-6;

[0271] each N_a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0272] each N_b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0273] each n_p and n_q independently represent an overhang nucleotide;

[0274] wherein N_b and Y do not have the same modification; and

[0275] XXX, YYY, and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. In some embodiments, YYY is all 2′-F modified nucleotides.

[0276] In some embodiments, the N_a or N_b comprises modifications of alternating pattern.

[0277] In some embodiments, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the dsRNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11,12; or 11, 12, 13) of the sense strand, the count starting from the first nucleotide, from the 5′-end; or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5′-end.

[0278] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:
5′n_p-N_a-YYY-N_b-ZZZ-N_a-n_q3′  (Ib);
5′n_p-N_a-XXX-N_b-YYY-N_a-n_q3′  (Ic); or
5′n_p-N_a-XXX-N_b-YYY-N_b-ZZZ-N_a-n_q3′  (Id).

[0279] When the sense strand is represented by formula (Ib), N_b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0280] When the sense strand is represented as formula (Ic), N_b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0281] When the sense strand is represented as formula (Id), each N_b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. In some embodiments, N_b is 0, 1, 2, 3, 4, 5, or 6. Each N_a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0282] Each of X, Y and Z may be the same or different from each other.

[0283] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:
5′n_p-N_a-YYY-N_a-n_q3′  (Ia).

[0284] When the sense strand is represented by formula (Ia), each N_a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0285] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):
5′n_q′-N_a′-(Z′Z′Z′)_k—N_b′-Y′Y′Y′-N_b′-(X′X′X′)_l-N′_a-n_p′3′  (II)

[0286] wherein:

[0287] k and l are each independently 0 or 1;

[0288] p′ and q′ are each independently 0-6;

[0289] each N_a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0290] each N_b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0291] each n_p′ and n_q′ independently represent an overhang nucleotide;

[0292] wherein N_b′ and Y′ do not have the same modification; and

[0293] X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0294] In some embodiments, the N_a′ or N_b′ comprises modifications of alternating pattern.

[0295] The Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand. For example, when the dsRNAi agent has a duplex region of 17-23 nucleotides in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the first nucleotide, from the 5′-end; or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5′-end. In some embodiments, the Y′Y′Y′ motif occurs at positions 11, 12, 13.

[0296] In certain embodiments, Y′Y′Y′ motif is all 2′-OMe modified nucleotides.

[0297] In certain embodiments, k is 1 and 1 is 0, or k is 0 and l is 1, or both k and l are 1.

[0298] The antisense strand can therefore be represented by the following formulas:
5′n_q′-N_a′-Z′Z′Z′-N_b′-Y′Y′Y′-N_a′-n_p′,3′  (IIb);
5′n_q′-N_a′-Y′Y′Y′-N_b′-X′X′X′-n_p′3′  (IIc); or
5′n_q′-N_a′-Z′Z′Z′-N_b′-Y′Y′Y′-N_b′-X′X′X′-N_a′-n_p′3′  (IId).

[0299] When the antisense strand is represented by formula (IIb), N_b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0300] When the antisense strand is represented as formula (IIc), N_b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0301] When the antisense strand is represented as formula (IId), each N_b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. In some embodiments, N_b is 0, 1, 2, 3, 4, 5, or 6.

[0302] In other embodiments, k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
5′n_p′-N_a′-Y′Y′Y′-N_a′-n_q′3′  (Ia).

[0303] When the antisense strand is represented as formula (IIa), each N_a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

Each of X′, Y′ and Z′ may be the same or different from each other.

[0304] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′-O-allyl, 2′-C-allyl, 2′-hydroxyl, or 2′-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro. Each X, Y, Z, X′, Y′, and Z′, in particular, may represent a 2′-O-methyl modification or a 2′-fluoro modification.

[0305] In some embodiments, the sense strand of the dsRNAi agent may contain YYY motif occurring at 9, 10, and 11 positions of the strand when the duplex region is 21 nt, the count starting from the first nucleotide from the 5′-end, or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5′-end; and Y represents 2′-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2′-OMe modification or 2′-F modification.

[0306] In some embodiments the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the first nucleotide from the 5′-end, or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5′-end; and Y′ represents 2′-O-methyl modification. The antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2′-OMe modification or 2′-F modification.

[0307] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with an antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.

[0308] Accordingly, the dsRNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the iRNA duplex represented by formula (III):
sense: 5′n_p-N_a-(XXX)_i-N_b-YYY-N_b-(ZZZ)_j—N_a-n_q3′
antisense: 3′n_p′-N_a′-(X′X′X′)_k-N_b′-Y′Y′Y′-N_b′-(Z′Z′Z′)_l—N_a′-n_q′5′  (III)

[0309] wherein:

[0310] j, k, and l are each independently 0 or 1;

[0311] p, p′, q, and q′ are each independently 0-6;

[0312] each N_a and N_a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0313] each N_b and N_b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0314] wherein each n_p′, n_p, n_q′, and n_q, each of which may or may not be present, independently represents an overhang nucleotide; and

[0315] XXX, YYY, ZZZ, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0316] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0317] Exemplary combinations of the sense strand and antisense strand forming an iRNA duplex include the formulas below:
5′n_p-N_a-YYY-N_a-n_q3′
3′n_p′-N_a-Y′Y′Y′-N_a′n_q′5′  (IIIa)
5′n_p-N_a-YYY-N_b-ZZZ-N_a-n_q3′
3′n_p′-N_a′-Y′Y′Y′-N_b′-Z′Z′Z′-N_a′n_q′5′  (IIIb)
5′n_p-N_a-XXX-N_b-YYY-N_a-n_q3′
3′n_p′-N_a′-X′X′X′-N_b′-Y′Y′Y′-N_a′-n_q′5′   (IIIc)
5′n_p-N_a-XXX-N_b-YYY-N_b-ZZZ-N_a-n_q3′
3′n_p′-N_a′-X¹X¹X¹-N_b′-Y¹Y¹Y¹-N_b′-Z¹Z¹Z¹-N_a-n_q′5′   (IIId)

[0318] When the dsRNAi agent is represented by formula (IIIa), each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0319] When the dsRNAi agent is represented by formula (IIIb), each N_b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5, or 1-4 modified nucleotides. Each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0320] When the dsRNAi agent is represented as formula (IIIc), each N_b, N_b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0321] When the dsRNAi agent is represented as formula (IIId), each N_b, N_b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Each N_a, N_a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N_a, N_a′, N_b, and N_b′; independently comprises modifications of alternating pattern.

[0322] Each of X, Y, and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from each other.

[0323] When the dsRNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y′ nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y′ nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y′ nucleotides.

[0324] When the dsRNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z′ nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z′ nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z′ nucleotides.

[0325] When the dsRNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X′ nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X′ nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X′ nucleotides.

[0326] In certain embodiments, the modification on the Y nucleotide is different than the modification on the Y′ nucleotide, the modification on the Z nucleotide is different than the modification on the Z′ nucleotide, or the modification on the X nucleotide is different than the modification on the X′ nucleotide.

[0327] In certain embodiments, when the dsRNAi agent is represented by formula (IIId), the N_a modifications are 2′-O-methyl or 2′-fluoro modifications. In other embodiments, when the RNAi agent is represented by formula (IIId), the N_a modifications are 2′-O-methyl or 2′-fluoro modifications and n_p′>0 and at least one n_p′ is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet other embodiments, when the RNAi agent is represented by formula (IIId), the N_a modifications are 2′-O-methyl or 2′-fluoro modifications, n_p′>0 and at least one n_p′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker (described below). In other embodiments, when the RNAi agent is represented by formula (IIId), the N_a modifications are 2′-O-methyl or 2′-fluoro modifications, n_p′>0 and at least one n_p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0328] In some embodiments, when the dsRNAi agent is represented by formula (IIIa), the N_a modifications are 2′-O-methyl or 2′-fluoro modifications, n_p′>0 and at least one n_p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0329] In some embodiments, the dsRNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0330] In some embodiments, the dsRNAi agent is a multimer containing three, four, five, six, or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0331] In one embodiment, two dsRNAi agents represented by at least one of formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5′ end, and one or both of the 3′ ends, and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

[0332] In certain embodiments, an RNAi agent of the invention may contain a low number of nucleotides containing a 2′-fluoro modification, e.g., 10 or fewer nucleotides with 2′-fluoro modification. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2′-fluoro modification. In a specific embodiment, the RNAi agent of the invention contains 10 nucleotides with a 2′-fluoro modification, e.g., 4 nucleotides with a 2′-fluoro modification in the sense strand and 6 nucleotides with a 2′-fluoro modification in the antisense strand. In another specific embodiment, the RNAi agent of the invention contains 6 nucleotides with a 2′-fluoro modification, e.g., 4 nucleotides with a 2′-fluoro modification in the sense strand and 2 nucleotides with a 2′-fluoro modification in the antisense strand.

[0333] In other embodiments, an RNAi agent of the invention may contain an ultra low number of nucleotides containing a 2′-fluoro modification, e.g., 2 or fewer nucleotides containing a 2′-fluoro modification. For example, the RNAi agent may contain 2, 1 of 0 nucleotides with a 2′-fluoro modification. In a specific embodiment, the RNAi agent may contain 2 nucleotides with a 2′-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2′-fluoro modification in the antisense strand.

[0334] Various publications describe multimeric iRNAs that can be used in the methods of the invention. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887, and WO2011/031520 the entire contents of each of which are hereby incorporated herein by reference.

[0335] In certain embodiments, the compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a 5′-vinyl phosphonate modified nucleotide of the disclosure has the structure:

[0336]
wherein X is O or S;

[0337] R is hydrogen, hydroxy, fluoro, or C_1-20alkoxy (e.g., methoxy or n-hexadecyloxy);

[0338] R^5′ is ═C(H)-P(O)(OH)₂ and the double bond between the C5′ carbon and R^5′ is in the E or Z orientation (e.g., E orientation); and

[0339] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.

[0340] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5′ end of the antisense strand of the dsRNA.

[0341] Vinyl phosphonate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphonate structure includes the preceding structure, where R5′ is ═C(H)—OP(O)(OH)2 and the double bond between the C5′ carbon and R5′ is in the E or Z orientation (e.g., E orientation).

[0342] As described in more detail below, the iRNA that contains conjugations of one or more carbohydrate moieties to an iRNA can optimize one or more properties of the iRNA. In many cases, the carbohydrate moiety will be attached to a modified subunit of the iRNA. For example, the ribose sugar of one or more ribonucleotide subunits of an iRNA can be replaced with another moiety, e.g., a non-carbohydrate (such as, cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0343] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” such as, two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

[0344] The iRNA may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group. In some embodiments, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin. In some embodiments, the acyclic group is a serinol backbone or diethanolamine backbone.

[0345] i. Thermally Destabilizing Modifications

[0346] In certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand. As used herein “seed region” means at positions 2-9 of the 5′-end of the referenced strand. For example, thermally destabilizing modifications can be incorporated in the seed region of the antisense strand to reduce or inhibit off-target gene silencing.

[0347] The term “thermally destabilizing modification(s)” includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) than the Tm of the dsRNA without having such modification(s). For example, the thermally destabilizing modification(s) can decrease the Tm of the dsRNA by 1-4° C., such as one, two, three or four degrees Celcius. And, the term “thermally destabilizing nucleotide” refers to a nucleotide containing one or more thermally destabilizing modifications.

[0348] It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5′ end, of the antisense strand have reduced off-target gene silencing activity. Accordingly, in some embodiments, the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5′ region of the antisense strand. In some embodiments, one or more thermally destabilizing modification(s) of the duplex is/are located in positions 2-9, such as, positions 4-8, from the 5′-end of the antisense strand. In some further embodiments, the thermally destabilizing modification(s) of the duplex is/are located at position 6, 7 or 8 from the 5′-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5′-end of the antisense strand. In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5′-end of the antisense strand.

[0349] An iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides. The RNAi agent may be represented by formula (L):

[0350]
In formula (L), B1, B2, B3, B1′, B2′, B3′, and B4′ each are independently a nucleotide containing a modification selected from the group consisting of 2′-O-alkyl, 2′-substituted alkoxy, 2′-substituted alkyl, 2′-halo, ENA, and BNA/LNA. In one embodiment, B1, B2, B3, B1′, B2′, B3′, and B4′ each contain 2′-OMe modifications. In one embodiment, B1, B2, B3, B1′, B2′, B3′, and B4′ each contain 2′-OMe or 2′-F modifications. In one embodiment, at least one of B1, B2, B3, B1′, B2′, B3′, and B4′ contain 2′-O-N-methylacetamido (2′-O-NMA, 2′O-CH₂C(O)N(Me)H) modification.

[0351] C1 is a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5′-end of the antisense strand). For example, C1 is at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5′-end of the antisense strand. In one example, C1 is at position 15 from the 5′-end of the sense strand. C1 nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2′-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA). In one embodiment, C1 has thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of:

[0352]
and iii) sugar modification selected from the group consisting of:

[0353]
wherein B is a modified or unmodified nucleobase, R¹ and R² independently are H, halogen, OR₃, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar. In one embodiment, the thermally destabilizing modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2′-deoxy nucleobase. In one example, the thermally destabilizing modification in C1 is GNA or

[0354]
T1, T1′, T2′, and T3′ each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less or equal to the steric bulk of a 2′-OMe modification. A steric bulk refers to the sum of steric effects of a modification. Methods for determining steric effects of a modification of a nucleotide are known to one skilled in the art. The modification can be at the 2′ position of a ribose sugar of the nucleotide, or a modification to a non-ribose nucleotide, acyclic nucleotide, or the backbone of the nucleotide that is similar or equivalent to the 2′ position of the ribose sugar, and provides the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2′-OMe modification. For example, T1, T1′, T2′, and T3′ are each independently selected from DNA, RNA, LNA, 2′-F, and 2′-F-5′-methyl. In one embodiment, T1 is DNA. In one embodiment, T1′ is DNA, RNA or LNA. In one embodiment, T2′ is DNA or RNA. In one embodiment, T3′ is DNA or RNA.
n¹, n³, and q¹ are independently 4 to 15 nucleotides in length.
n⁵, q³, and q⁷ are independently 1-6 nucleotide(s) in length.
n⁴, q², and q⁶ are independently 1-3 nucleotide(s) in length; alternatively, n⁴ is 0.
q⁵ is independently 0-10 nucleotide(s) in length.
n² and q⁴ are independently 0-3 nucleotide(s) in length.

[0355] Alternatively, n⁴ is 0-3 nucleotide(s) in length.

[0356] In one embodiment, n⁴ can be 0. In one example, n⁴ is 0, and q² and q⁶ are 1. In another example, n⁴ is 0, and q² and q⁶ are 1, with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0357] In one embodiment, n⁴, q², and q⁶ are each 1.

[0358] In one embodiment, n², n⁴, q², q⁴, and q⁶ are each 1.

[0359] In one embodiment, C1 is at position 14-17 of the 5′-end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n⁴ is 1. In one embodiment, C1 is at position 15 of the 5′-end of the sense strand

[0360] In one embodiment, T3′ starts at position 2 from the 5′ end of the antisense strand. In one example, T3′ is at position 2 from the 5′ end of the antisense strand and q⁶ is equal to 1.

[0361] In one embodiment, T1′ starts at position 14 from the 5′ end of the antisense strand. In one example, T1′ is at position 14 from the 5′ end of the antisense strand and q² is equal to 1.

[0362] In an exemplary embodiment, T3′ starts from position 2 from the 5′ end of the antisense strand and T1′ starts from position 14 from the 5′ end of the antisense strand. In one example, T3′ starts from position 2 from the 5′ end of the antisense strand and q⁶ is equal to 1 and T1′ starts from position 14 from the 5′ end of the antisense strand and q² is equal to 1.

[0363] In one embodiment, T1′ and T3′ are separated by 11 nucleotides in length (i.e. not counting the T1′ and T3′ nucleotides).

[0364] In one embodiment, T1′ is at position 14 from the 5′ end of the antisense strand. In one example, T1′ is at position 14 from the 5′ end of the antisense strand and q² is equal to 1, and the modification at the 2′ position or positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2′-OMe ribose.

[0365] In one embodiment, T3′ is at position 2 from the 5′ end of the antisense strand. In one example, T3′ is at position 2 from the 5′ end of the antisense strand and q⁶ is equal to 1, and the modification at the 2′ position or positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2′-OMe ribose.

[0366] In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n² is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n² is 1, In one embodiment, T2′ starts at position 6 from the 5′ end of the antisense strand. In one example, T2′ is at positions 6-10 from the 5′ end of the antisense strand, and q⁴ is 1.

[0367] In an exemplary embodiment, T1 is at the cleavage site of the sense strand, for instance, at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n² is 1; T1′ is at position 14 from the 5′ end of the antisense strand, and q² is equal to 1, and the modification to T1′ is at the 2′ position of a ribose sugar or at positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2′-OMe ribose; T2′ is at positions 6-10 from the 5′ end of the antisense strand, and q⁴ is 1; and T3′ is at position 2 from the 5′ end of the antisense strand, and q⁶ is equal to 1, and the modification to T3′ is at the 2′ position or at positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2′-OMe ribose.

[0368] In one embodiment, T2′ starts at position 8 from the 5′ end of the antisense strand. In one example, T2′ starts at position 8 from the 5′ end of the antisense strand, and q⁴ is 2.

[0369] In one embodiment, T2′ starts at position 9 from the 5′ end of the antisense strand. In one example, T2′ is at position 9 from the 5′ end of the antisense strand, and q⁴ is 1. In one embodiment, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 6, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0370] In one embodiment, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 6, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0371] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1.

[0372] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0373] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 6, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 7, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1.

[0374] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 6, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 7, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0375] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 6, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1.

[0376] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 6, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0377] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 5, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; optionally with at least 2 additional TT at the 3′-end of the antisense strand.

[0378] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 5, T2′ is 2′-F, q⁴ is 1, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; optionally with at least 2 additional TT at the 3′-end of the antisense strand; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0379] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).

[0380] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1.

[0381] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0382] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1.

[0383] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

[0384] The RNAi agent can comprise a phosphorus-containing group at the 5′-end of the sense strand or antisense strand. The 5′-end phosphorus-containing group can be 5′-end phosphate (5′-P), 5′-end phosphorothioate (5′-PS), 5′-end phosphorodithioate (5′-PS₂), 5′-end vinylphosphonate (5′-VP), 5′-end methylphosphonate (MePhos), or 5′-deoxy-5′-C-malonyl

[0385]
When the 5′-end phosphorus-containing group is 5′-end vinylphosphonate (5′-VP), the 5′-VP can be either 5′-E-VP isomer (i.e., trans-vinylphosphonate,

[0386]
5′-Z-VP isomer (i.e., cis-vinylphosphonate,

[0387]
or mixtures thereof.
In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5′-end of the sense strand. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5′-end of the antisense strand.

[0388] In one embodiment, the RNAi agent comprises a 5′-P. In one embodiment, the RNAi agent comprises a 5′-P in the antisense strand.

[0389] In one embodiment, the RNAi agent comprises a 5′-PS. In one embodiment, the RNAi agent comprises a 5′-PS in the antisense strand.

[0390] In one embodiment, the RNAi agent comprises a 5′-VP. In one embodiment, the RNAi agent comprises a 5′-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5′-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5′-Z-VP in the antisense strand.

[0391] In one embodiment, the RNAi agent comprises a 5′-PS₂. In one embodiment, the RNAi agent comprises a 5′-PS₂ in the antisense strand.

[0392] In one embodiment, the RNAi agent comprises a 5′-PS₂. In one embodiment, the RNAi agent comprises a 5′-deoxy-5′-C-malonyl in the antisense strand.

[0393] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-PS.

[0394] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-P.

[0395] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0396] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-PS₂.

[0397] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0398] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

[0399] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

[0400] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0401] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂.

[0402] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0403] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-P.

[0404] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The dsRNA agent also comprises a 5′-PS.

[0405] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0406] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-PS₂.

[0407] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0408] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-P.

[0409] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS.

[0410] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0411] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS₂.

[0412] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0413] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-P.

[0414] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-PS.

[0415] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0416] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The dsRNAi RNA agent also comprises a 5′-PS₂.

[0417] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0418] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

[0419] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

[0420] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0421] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂.

[0422] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0423] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-P.

[0424] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-PS.

[0425] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0426] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-PS₂.

[0427] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0428] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

[0429] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

[0430] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

[0431] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂.

[0432] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

[0433] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0434] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0435] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof), and a targeting ligand.

[0436] In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0437] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂ and a targeting ligand. In one embodiment, the 5′-PS₂ is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0438] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0439] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0440] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0441] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0442] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS₂ and a targeting ligand. In one embodiment, the 5′-PS₂ is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0443] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-OMe, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0444] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0445] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0446] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0447] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂ and a targeting ligand. In one embodiment, the 5′-PS₂ is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0448] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, BF is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′- F, q³ is 4, T2′ is 2′-F, q⁴ is 2, B3′ is 2′-OMe or 2′-F, q⁵ is 5, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0449] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0450] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0451] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0452] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS₂ and a targeting ligand. In one embodiment, the 5′-PS₂ is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0453] In one embodiment, B1 is 2′-OMe or 2′-F, n¹ is 8, T1 is 2′F, n² is 3, B2 is 2′-OMe, n³ is 7, n⁴ is 0, B3 is 2′-OMe, n⁵ is 3, B1′ is 2′-OMe or 2′-F, q¹ is 9, T1′ is 2′-F, q² is 1, B2′ is 2′-OMe or 2′-F, q³ is 4, q⁴ is 0, B3′ is 2′-OMe or 2′-F, q⁵ is 7, T3′ is 2′-F, q⁶ is 1, B4′ is 2′-F, and q⁷ is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

[0454] In a particular embodiment, an RNAi agent of the present invention comprises:

• • [0455] (a) a sense strand having:
    • [0456] (i) a length of 21 nucleotides;
    • [0457] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; and
    • [0458] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5′ end); and
  • [0459] (b) an antisense strand having:
    • [0460] (i) a length of 23 nucleotides;
    • [0461] (ii) 2′-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2′F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5′ end); and
    • [0462] (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22,
    • [0463] and between nucleotide positions 22 and 23 (counting from the 5′ end);
  • [0464] wherein the dsRNA agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0465] In another particular embodiment, an RNAi agent of the present invention comprises:

• • [0466] (a) a sense strand having:
    • [0467] (i) a length of 21 nucleotides;
    • [0468] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0469] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 15, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5′ end); and
    • [0470] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0471] (b) an antisense strand having:
    • [0472] (i) a length of 23 nucleotides;
    • [0473] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2′F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5′ end); and
    • [0474] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0475] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0476] (a) a sense strand having:
    • [0477] (i) a length of 21 nucleotides;
    • [0478] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0479] (iii) 2′-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2′-F modifications at positions 7, and 9, and a deoxy-nucleotide (e.g. dT) at position 11 (counting from the 5′ end); and
    • [0480] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0481] (b) an antisense strand having:
    • [0482] (i) a length of 23 nucleotides;
    • [0483] (ii) 2′-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19 to 23, and 2′-F modifications at positions 2, 4 to 6, 8, 10, 12, 14, 16, and 18 (counting from the 5′ end); and
    • [0484] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0485] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0486] (a) a sense strand having:
    • [0487] (i) a length of 21 nucleotides;
    • [0488] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0489] (iii) 2′-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2′-F modifications at positions 7, 9, 11, 13, and 15; and
    • [0490] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0491] (b) an antisense strand having:
    • [0492] (i) a length of 23 nucleotides;
    • [0493] (ii) 2′-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21 to 23, and 2′-F modifications at positions 2 to 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5′ end); and
    • [0494] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0495] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0496] (a) a sense strand having:
    • [0497] (i) a length of 21 nucleotides;
    • [0498] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0499] (iii) 2′-OMe modifications at positions 1 to 9, and 12 to 21, and 2′-F modifications at positions 10, and 11; and
    • [0500] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0501] (b) an antisense strand having:
    • [0502] (i) a length of 23 nucleotides;
    • [0503] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2′-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5′ end); and
    • [0504] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0505] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0506] (a) a sense strand having:
    • [0507] (i) a length of 21 nucleotides;
    • [0508] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0509] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, and 13, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, and 14 to 21; and
    • [0510] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0511] (b) an antisense strand having:
    • [0512] (i) a length of 23 nucleotides;
    • [0513] (ii) 2′-OMe modifications at positions 1, 3, 5 to 7, 9, 11 to 13, 15, 17 to 19, and 21 to 23, and 2′-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (counting from the 5′ end); and
    • [0514] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0515] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0516] (a) a sense strand having:
    • [0517] (i) a length of 21 nucleotides;
    • [0518] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0519] (iii) 2′-OMe modifications at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, and 19 to 21, and 2′-F modifications at positions 3, 5, 7, 9 to 11, 13, 16, and 18; and
    • [0520] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0521] (b) an antisense strand having:
    • [0522] (i) a length of 25 nucleotides;
    • [0523] (ii) 2′-OMe modifications at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, and 19 to 23, 2′-F modifications at positions 2, 3, 5, 8, 10, 14, 16, and 18, and desoxy-nucleotides (e.g. dT) at positions 24 and 25 (counting from the 5′ end); and
    • [0524] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a four nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0525] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0526] (a) a sense strand having:
    • [0527] (i) a length of 21 nucleotides;
    • [0528] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0529] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and
    • [0530] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0531] (b) an antisense strand having:
    • [0532] (i) a length of 23 nucleotides;
    • [0533] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2′-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5′ end); and
    • [0534] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0535] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0536] (a) a sense strand having:
    • [0537] (i) a length of 21 nucleotides;
    • [0538] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0539] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and
    • [0540] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0541] (b) an antisense strand having:
    • [0542] (i) a length of 23 nucleotides;
    • [0543] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2′-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and
    • [0544] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0545] In another particular embodiment, a RNAi agent of the present invention comprises:

• • [0546] (a) a sense strand having:
    • [0547] (i) a length of 19 nucleotides;
    • [0548] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
    • [0549] (iii) 2′-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2′-F modifications at positions 5, and 7 to 9; and
    • [0550] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); and
  • [0551] (b) an antisense strand having:
    • [0552] (i) a length of 21 nucleotides;
    • [0553] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2′-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and
    • [0554] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5′ end);
      wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

[0555] In certain embodiments, the iRNA for use in the methods of the invention is an agent selected from agents listed in any one of Tables 2-3 and 6-7. These agents may further comprise a ligand.

[0556] Another modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA e.g., into a cell. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556). In other embodiments, the ligand is cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0557] In certain embodiments, a ligand alters the distribution, targeting, or lifetime of an iRNA agent into which it is incorporated. In some embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. In some embodiments, ligands do not take part in duplex pairing in a duplexed nucleic acid.

[0558] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0559] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.

[0560] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0561] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

[0562] The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0563] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0564] Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

[0565] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). Any other methods for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[0566] In the ligand-conjugated iRNAs and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0567] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0568] A. Lipid Conjugates

[0569] In certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule. In some embodiments, such a lipid or lipid-based molecule binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[0570] A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0571] In certain embodiments, the lipid based ligand binds HSA. In some embodiments, it binds HSA with a sufficient affinity such that the conjugate will be distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

[0572] In other embodiments, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be distributed to the kidney. Other moieties that target to kidney cells can also be used in place of, or in addition to, the lipid based ligand.

[0573] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).

[0574] B. Cell Permeation Agents

[0575] In another aspect, the ligand is a cell-permeation agent, such as, a helical cell-permeation agent. In some embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. In some embodiments, the helical agent is an alpha-helical agent, which has a lipophilic and a lipophobic phase.

[0576] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0577] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 17). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 18) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 19) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 20) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

[0578] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand, e.g., PECAM-1 or VEGF.

[0579] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0580] C. Carbohydrate Conjugates

[0581] In some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri-, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0582] In certain embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.

[0583] In certain embodiments, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates, which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in U.S. Pat. No. 8,106,022, the entire content of which is hereby incorporated herein by reference.

[0584] In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).

[0585] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3′ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3′ end of the sense strand) via a linker, e.g., a linker as described herein. In some embodiments the GalNAc conjugate is conjugated to the 5′ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5′ end of the sense strand) via a linker, e.g., a linker as described herein.

[0586] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a tetravalent linker.

[0587] In certain embodiments, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent. In certain embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

[0588] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex.

[0589] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex.

[0590] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

[0591]
wherein Y is O or S and n is 3-6 (Formula XXIV);

[0592]
wherein Y is O or S and n is 3-6 (Formula XXV);

[0593]
wherein X is O or S (Formula XXVII);

[0594]

[0595] In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as

[0596]

[0597] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S

[0598]

[0599] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below:

[0600]

[0601] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

[0602]
(Formula XXXVI), when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0603] In some embodiments, a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference. In one embodiment the ligand comprises the structure below:

[0604] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

[0605] In one embodiment, the double stranded RNAi agents of the invention comprise one or more GalNAc or GalNAc derivative attached to the iRNA agent. The GalNAc may be attached to any nucleotide via a linker on the sense strand or antsisense strand. The GalNac may be attached to the 5′-end of the sense strand, the 3′ end of the sense strand, the 5′-end of the antisense strand, or the 3′-end of the antisense strand. In one embodiment, the GalNAc is attached to the 3′ end of the sense strand, e.g., via a trivalent linker.

[0606] In other embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of linkers, e.g., monovalent linkers.

[0607] In some embodiments, for example, when the two strands of an iRNA agent of the invention is part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.

[0608] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.

[0609] Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

[0610] D. Linkers

[0611] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

[0612] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NRB, C(O), C(O)NH, SO, SO₂, SO₂NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO₂, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

[0613] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In one embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0614] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0615] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0616] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[0617] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0618] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In some embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0619] i. Redox cleavable linking groups

[0620] In certain embodiments, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

[0621] ii. Phosphate-based cleavable linking groups

[0622] In other embodiments, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—, wherein Rk at each occurrence can be, independently, C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl. Exemplary embodiments include are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O, —S—P(S)(H)—O—, —S—P(O)(H)—S—, and —O—P(S)(H)—S—. In certain embodiments, a phosphate-based linking group is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above.

[0623] iii. Acid cleavable linking groups

[0624] In other embodiments, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In some embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). An exemplary embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[0625] iv. Ester-based linking groups

[0626] In other embodiments, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.

[0627] v. Peptide-based cleaving groups

[0628] In yet other embodiments, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

[0629] In some embodiments, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

[0630]
(Formula XLIV), when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0631] In certain embodiments of the compositions and methods of the invention, a ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

[0632] In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV)-(XLVIII):

[0633]
wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5 q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
p^2A, p^2B, p^3A, p^3B, p^4A, p^4B, p^5A, p^5B, p^5C, T^2A, T^2B, T^3A, T^3B, T^4A, T^4B, T^4A, T^5B, T^5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH₂, CH₂NH or CH₂O;
Q^2A, Q^2B, Q^3A, Q^3B, Q^4A, Q^4B, Q^5A, Q^5B, Q^5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO₂, N(R^N), C(R′)═C(R″), CEC or C(O);
R^2A, R^2B, R^3A, R^3B, R^4A, R^4B, R^5A, R^5B, R^5C are each independently for each occurrence absent, NH, O, S, CH₂, C(O)O, C(O)NH, NHCH(R^a)C(O), —C(O)—CH(R^a)—NH—, CO, CH═N—O.

[0634]
or heterocyclyl; L^2A, L^2B, L^3A, L^3B, L^4A, L^4B, L^5A, L^5B and L^5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R^a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX):

[0635]
wherein L^5A, L^5B and L^5C represent a monosaccharide, such as GalNAc derivative.

[0636] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

[0637] Representative U.S. Patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928; 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

[0638] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0639] “Chimeric” iRNA compounds or “chimeras,” in the context of this invention, are iRNA compounds, such as, dsRNAi agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0640] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

[0641] The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject susceptible to or diagnosed with a xanthine dehydrogenase-associated disorder) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

[0642] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602). Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178).

[0643] In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim S H, et al (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R, et al (2003) J. Mol. Biol 327:761-766; Verma, U N, et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N, et al (2003), supra), “solid nucleic acid lipid particles” (Zimmermann, T S, et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y, et al (2005) Cancer Gene Ther. 12:321-328; Pal, A, et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E, et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A, et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

[0644] A. Vector encoded iRNAs of the Invention

[0645] iRNA targeting the xanthine dehydrogenase gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A, et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0646] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art.

[0647] The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for preventing or treating a xanthine dehydrogenase-associated disorder. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a xanthine dehydrogenase gene.

[0648] In some embodiments, the pharmaceutical compositions of the invention are sterile. In another embodiment, the pharmaceutical compositions of the invention are pyrogen free.

[0649] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a xanthine dehydrogenase gene. In general, a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of an iRNA of the invention will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, or about 0.3 mg/kg to about 3.0 mg/kg. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, once every 3-6 months, or once a year. In certain embodiments, the iRNA is administered about once per month to about once per six months.

[0650] After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease.

[0651] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that doses are administered at not more than 1, 2, 3, or 4 month intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered about once per month. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered quarterly (i.e., about every three months). In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered twice per year (i.e., about once every six months).

[0652] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments.

[0653] The iRNA can be delivered in a manner to target a particular tissue (e.g., hepatocytes).

[0654] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver.

[0655] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers.

[0656] A. Additional Formulations

[0657] i. Emulsions

[0658] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution either in the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

[0659] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0660] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0661] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0662] The application of emulsion formulations via dermatological, oral, and parenteral routes, and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0663] ii. Microemulsions

[0664] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil, and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215).

[0665] iii. Microparticles

[0666] An iRNA of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

[0667] iv. Penetration Enhancers

[0668] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0669] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers and their use in manufacture of pharmaceutical compositions and delivery of pharmaceutical agents are well known in the art.

[0670] v. Excipients

[0671] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Such agent are well known in the art.

[0672] vi. Other Components

[0673] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings, or aromatic substances, and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0674] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, or dextran. The suspension can also contain stabilizers.

[0675] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA and (b) one or more agents which function by a non-iRNA mechanism and which are useful in treating a xanthine dehydrogenase-associated disorder.

[0676] Toxicity and prophylactic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose prophylactically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred.

[0677] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED50, such as, an ED80 or ED90, with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the prophylactically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) or higher levels of inhibition as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0678] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents used for the prevention or treatment of a xanthine dehydrogenase-associated disorder. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

[0679] The present invention also provides methods of inhibiting expression of an XDH gene in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNA agent, in an amount effective to inhibit expression of XDH in the cell, thereby inhibiting expression of XDH in the cell.

[0680] Contacting of a cell with an iRNA, e.g., a double stranded RNA agent, may be done in vitro or in vivo. Contacting a cell in vivo with the iRNA includes contacting a cell or group of cells within a subject, e.g., a human subject, with the iRNA. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc ligand, or any other ligand that directs the RNAi agent to a site of interest.

[0681] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.

[0682] The phrase “inhibiting expression of a xanthine dehydrogenase gene” is intended to refer to inhibition of expression of any xanthine dehydrogenase gene (such as, e.g., a mouse xanthine dehydrogenase gene, a rat xanthine dehydrogenase gene, a monkey xanthine dehydrogenase gene, or a human xanthine dehydrogenase gene) as well as variants or mutants of a xanthine dehydrogenase gene. Thus, the xanthine dehydrogenase gene may be a wild-type xanthine dehydrogenase gene, a mutant xanthine dehydrogenase gene, or a transgenic xanthine dehydrogenase gene in the context of a genetically manipulated cell, group of cells, or organism.

[0683] “Inhibiting expression of a xanthine dehydrogenase gene” includes any level of inhibition of a xanthine dehydrogenase gene, e.g., at least partial suppression of the expression of a xanthine dehydrogenase gene, such as, a clinically relevant level of supression. The expression of the xanthine dehydrogenase gene may be assessed based on the level, or the change in the level, of any variable associated with xanthine dehydrogenase gene expression, e.g., xanthine dehydrogenase mRNA level or xanthine dehydrogenase protein level, or, for example, serum uric acid levels. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject. It is understood that xanthine dehydrogenase is expressed predominantly in the liver, and is present in circulation.

[0684] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with xanthine dehydrogenase expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0685] In some embodiments of the methods of the invention, expression of a xanthine dehydrogenase gene is inhibited by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In some embodiments, expression of a xanthine dehydrogenase gene is inhibited by at least 70%. It is further understood that inhibition of xanthine dehydrogenase expression in certain tissues, e.g., in gall bladder, without a significant inhibition of expression in other tissues, e.g., brain, may be desirable. In some embodiments, expression level is determined using the assay method provided in Example 2 with a 10 nM siRNA concentration in the appropriate species matched cell line.

[0686] In certain embodiments, inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., an AAV-infected mouse expressing the human target gene (i.e., xanthine dehydrogenase), e.g., when administered as a single dose, e.g., at 3 mg/kg at the nadir of RNA expression. Knockdown of expression of an endogenous gene in a model animal system can also be determined, e.g., after administration of a single dose at, e.g., 3 mg/kg at the nadir of RNA expression. Such systems are useful when the nucleic acid sequence of the human gene and the model animal gene are sufficiently close such that the human iRNA provides effective knockdown of the model animal gene. RNA expression in liver is determined using the PCR methods provided in Example 2.

[0687] Inhibition of the expression of a xanthine dehydrogenase gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a xanthine dehydrogenase gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an iRNA of the invention, or by administering an iRNA of the invention to a subject in which the cells are or were present) such that the expression of a xanthine dehydrogenase gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an iRNA or not treated with an iRNA targeted to the gene of interest). In some embodiments, the inhibition is assessed by the method provided in Example 2 using, e.g., a 10 nM siRNA concentration in the species matched cell line and expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

[0688] $\frac{\left(\mathrm{mRNA}\mathrm{in}\mathrm{control}\mathrm{cells}\right)-\left(\mathrm{mRNA}\mathrm{in}\mathrm{treated}\mathrm{cells}\right)}{\left(\mathrm{mRNA}\mathrm{in}\mathrm{control}\mathrm{cells}\right)}·100\%$

[0689] In other embodiments, inhibition of the expression of a xanthine dehydrogenase gene may be assessed in terms of a reduction of a parameter that is functionally linked to xanthine dehydrogenase gene expression, e.g., xanthine dehydrogenase protein level in blood or serum from a subject. Xanthine dehydrogenase gene silencing may be determined in any cell expressing xanthine dehydrogenase, either endogenous or heterologous from an expression construct, and by any assay known in the art.

[0690] Inhibition of the expression of a xanthine dehydrogenase protein may be manifested by a reduction in the level of the xanthine dehydrogenase protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom.

[0691] A control cell, a group of cells, or subject sample that may be used to assess the inhibition of the expression of a xanthine dehydrogenase gene includes a cell, group of cells, or subject sample that has not yet been contacted with an RNAi agent of the invention. For example, the control cell, group of cells, or subject sample may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent or an appropriately matched population control.

[0692] The level of xanthine dehydrogenase mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of xanthine dehydrogenase in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the xanthine dehydrogenase gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy™ RNA preparation kits (Qiagen®) or PAXgene™ (PreAnalytix™, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis.

[0693] In some embodiments, the level of expression of xanthine dehydrogenase is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific xanthine dehydrogenase. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0694] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to xanthine dehydrogenase mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of xanthine dehydrogenase mRNA.

[0695] An alternative method for determining the level of expression of xanthine dehydrogenase in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of XDH is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan™ System).

[0696] In some embodiments, expression level is determined by the method provided in Example 2 using, e.g., a 10 nM siRNA concentration, in the species matched cell line.

[0697] The expression levels of xanthine dehydrogenase mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of xanthine dehydrogenase expression level may also comprise using nucleic acid probes in solution.

[0698] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein. In some embodiments, expression level is determined by the method provided in Example 2 using a 10 nM siRNA concentration in the species matched cell line.

[0699] The level of XDH protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.

[0700] In some embodiments, the efficacy of the methods of the invention are assessed by a decrease in XDH mRNA or protein level (e.g., in a liver biopsy).

[0701] In some embodiments of the methods of the invention, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. The inhibition of expression of xanthine dehydrogenase may be assessed using measurements of the level or change in the level of xanthine dehydrogenase mRNA or xanthine dehydrogenase protein in a sample derived from fluid or tissue from the specific site within the subject (e.g., liver or blood).

[0702] As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used.

[0703] The present invention also provides methods of using an iRNA of the invention or a composition containing an iRNA of the invention to inhibit expression of xanthine dehydrogenase, thereby preventing or treating a xanthine dehydrogenase-associated disorder, e.g., hyperuricemia, gout NAFLD, NASH, metabolic disorder, insulin resistance, cardiovascular disease, hypertension, type 2 diabetes, and conditions linked to oxidative stress e.g., chronic low grade inflammation.

[0704] In one embodiment, the xanthine dehydrogenase-associate disease is hyperuricemia.

[0705] In another embodiment, the xanthine dehydrogenase-associate disease is gout.

[0706] In the methods of the invention the cell may be contacted with the siRNA in vitro or in vivo, i.e., the cell may be within a subject.

[0707] A cell suitable for treatment using the methods of the invention may be any cell that expresses a xanthine dehydrogenase gene, e.g., a liver cell, a brain cell, a gall bladder cell, a heart cell, or a kidney cell. In some embodiment, the cell is a liver cell. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell, including human cell in a chimeric non-human animal, or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), or a non-primate cell. In certain embodiments, the cell is a human cell, e.g., a human liver cell. In the methods of the invention, xanthine dehydrogenase expression is inhibited in the cell by at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95, or to a level below the level of detection of the assay.

[0708] The in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the xanthine dehydrogenase gene of the mammal to which the RNAi agent is to be administered. The composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered by intramuscular injection.

[0709] In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of XDH, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In some embodiments, the depot injection is a subcutaneous injection.

[0710] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In some embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA to the liver.

[0711] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

[0712] In one aspect, the present invention also provides methods for inhibiting the expression of a xanthine dehydrogenase gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a xanthine dehydrogenase gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain degradation of the mRNA transcript of the xanthine dehydrogenase gene, thereby inhibiting expression of the xanthine dehydrogenase gene in the cell. Reduction in gene expression can be assessed by any methods known in the art and by methods, e.g. qRT-PCR, described herein, e.g., in Example 2. Reduction in protein production can be assessed by any methods known it the art, e.g. ELISA. In certain embodiments, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the xanthine dehydrogenase gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the xanthine dehydrogenase protein expression.

[0713] The present invention further provides methods of treatment in a subject in need thereof, e.g., a subject diagnosed with a xanthine dehydrogenase-associated disorder, such as, hyperuricemia, gout NAFLD, NASH, metabolic disorder, insulin resistance, cardiovascular disease, hypertension, type 2 diabetes, and conditions linked to oxidative stress e.g., chronic low grade inflammation.

[0714] The present invention further provides methods of prophylaxis in a subject in need thereof. The treatment methods of the invention include administering an iRNA of the invention to a subject, e.g., a subject that would benefit from a reduction of xanthine dehydrogenase expression, in a prophylactically effective amount of an iRNA targeting a xanthine dehydrogenase gene or a pharmaceutical composition comprising an iRNA targeting a xanthine dehydrogenase gene.

[0715] In one embodiment, the xanthine dehydrogenase-associate disease is hyperuricemia.

[0716] In another embodiment, the xanthine dehydrogenase-associate disease is gout.

[0717] An iRNA of the invention may be administered as a “free iRNA.” A free iRNA is administered in the absence of a pharmaceutical composition. The naked iRNA may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject.

[0718] Alternatively, an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

[0719] Subjects that would benefit from an inhibition of xanthine dehydrogenase expression are subjects susceptible to or diagnosed with an XDH-associated disorder, e.g., hyperuricemia or gout.

[0720] In an embodiment, the method includes administering a composition featured herein such that expression of the target xanthine dehydrogenase gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose. In certain embodiments, the composition is administered once every 3-6 months.

[0721] In some embodiments, the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target xanthine dehydrogenase gene. Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein.

[0722] Administration of the iRNA according to the methods of the invention may result prevention or treatment of a xanthine dehydrogenase-associated disorder, e.g., hyperuricemia and gout.

[0723] Subjects can be administered a therapeutic amount of iRNA, such as about 0.01 mg/kg to about 200 mg/kg. Subjects can be administered a therapeutic amount of iRNA, such as about 5 mg to about 1000 mg as a fixed dose, regardless of body weight.

[0724] In some embodiments, the iRNA is administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired dose of iRNA to a subject. The injections may be repeated over a period of time.

[0725] The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as once per month to once a year. In certain embodiments, the iRNA is administered about once per month to about once every three months, or about once every three months to about once every six months.

[0726] The invention further provides methods and uses of an iRNA agent or a pharmaceutical composition thereof for treating a subject that would benefit from reduction or inhibition of XDH gene expression, e.g., a subject having an XDH-associated disease, in combination with other pharmaceuticals or other therapeutic methods, e.g., with known pharmaceuticals or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. Exemplary pharmaceuticals include, for example, allopurinol, oxypurinol, Probenecid, Rasburicase, febuxostat, analgesic or anti-inflammatory agents, e.g., NSAIDS.

[0727] Accordingly, in some aspects of the invention, the methods which include either a single iRNA agent of the invention, further include administering to the subject one or more additional therapeutic agents. The iRNA agent and an additional therapeutic agent or treatment may be administered at the same time or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times or by another method known in the art or described herein.

[0728] In one embodiment, an iRNA agent is administered in combination with allopurinol. In one embodiment, the iRNA agent is administered to the patient, and then the additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the iRNA agent and the additional therapeutic agent are administered at the same time.

[0729] The iRNA agent and an additional therapeutic agent or treatment may be administered at the same time or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times or by another method known in the art or described herein.

[0730] In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a ssiRNA compound, or a DNA which encodes an siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, or precursor thereof).

[0731] Such kits include one or more dsRNA agent(s) and instructions for use, e.g., instructions for administering a prophylactically or therapeutically effective amount of a dsRNA agent(s). The dsRNA agent may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the dsRNA agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of XDH (e.g., means for measuring the inhibition of XDH mRNA, XDH protein, or XDH activity). Such means for measuring the inhibition of XDH may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount.

[0732] In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container, e.g., a vial or a pre-filled syringe. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for a siRNA compound preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.

[0733] This invention is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, patents and published patent applications cited throughout this application, as well as the informal Sequence Listing and Figures, are hereby incorporated herein by reference.

Source of Reagents

[0734] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

siRNA Design

[0735] siRNAs targeting the xanthine dehydrogenase (XDH) gene, (human: NCBI refseqID NM_000379; NCBI GeneID: 7498) were designed using custom R and Python scripts. The human NM_000379 REFSEQ mRNA, version 4, has a length of 5715 bases. Detailed lists of the unmodified XDH sense and antisense strand nucleotide sequences are shown in Table 2. Detailed lists of the modified XDH sense and antisense strand nucleotide sequences are shown in Table 3.

[0736] It is to be understood that, throughout the application, a duplex name without a decimal is equivalent to a duplex name with a decimal which merely references the batch number of the duplex. For example, AD-959917 is equivalent to AD-959917.1.

siRNA Synthesis

[0737] siRNAs were synthesized and annealed using routine methods known in the art.

[0738] Briefly, siRNA sequences were synthesized on a 1 μmol scale using a Mermade 192 synthesizer (BioAutomation) with phosphoramidite chemistry on solid supports. The solid support was controlled pore glass (500-1000 Å) loaded with a custom GalNAc ligand (3′-GalNAc conjugates), universal solid support (AM Chemicals), or the first nucleotide of interest. Ancillary synthesis reagents and standard 2-cyanoethyl phosphoramidite monomers (2′-deoxy-2′-fluoro, 2′-O-methyl, RNA, DNA) were obtained from Thermo-Fisher (Milwaukee, Wis.), Hongene (China), or Chemgenes (Wilmington, Mass., USA). Additional phosphoramidite monomers were procured from commercial suppliers, prepared in-house, or procured using custom synthesis from various CMOs. Phosphoramidites were prepared at a concentration of 100 mM in either acetonitrile or 9:1 acetonitrile:DMF and were coupled using 5-Ethylthio-1H-tetrazole (ETT, 0.25 M in acetonitrile) with a reaction time of 400 s. Phosphorothioate linkages were generated using a 100 mM solution of 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, Mass., USA)) in anhydrous acetonitrile/pyridine (9:1 v/v). Oxidation time was 5 minutes. All sequences were synthesized with final removal of the DMT group (“DMT-Off”).

[0739] Upon completion of the solid phase synthesis, solid-supported oligoribonucleotides were treated with 300 μL of Methylamine (40% aqueous) at room temperature in 96 well plates for approximately 2 hours to afford cleavage from the solid support and subsequent removal of all additional base-labile protecting groups. For sequences containing any natural ribonucleotide linkages (2′-OH) protected with a tert-butyl dimethyl silyl (TBDMS) group, a second deprotection step was performed using TEA.3HF (triethylamine trihydrofluoride). To each oligonucleotide solution in aqueous methylamine was added 200 μL of dimethyl sulfoxide (DMSO) and 300 μL TEA.3HF and the solution was incubated for approximately 30 mins at 60° C. After incubation, the plate was allowed to come to room temperature and crude oligonucleotides were precipitated by the addition of 1 mL of 9:1 acetontrile:ethanol or 1:1 ethanol:isopropanol. The plates were then centrifuged at 4° C. for 45 mins and the supernatant carefully decanted with the aid of a multichannel pipette. The oligonucleotide pellet was resuspended in 20 mM NaOAc and subsequently desalted using a HiTrap size exclusion column (5 mL, GE Healthcare) on an Agilent LC system equipped with an autosampler, UV detector, conductivity meter, and fraction collector. Desalted samples were collected in 96 well plates and then analyzed by LC-MS and UV spectrometry to confirm identity and quantify the amount of material, respectively.

[0740] Duplexing of single strands was performed on a Tecan liquid handling robot. Sense and antisense single strands were combined in an equimolar ratio to a final concentration of 10 μM in 1×PBS in 96 well plates, the plate sealed, incubated at 100° C. for 10 minutes, and subsequently allowed to return slowly to room temperature over a period of 2-3 hours. The concentration and identity of each duplex was confirmed and then subsequently utilized for in vitro screening assays.

Cell culture and Free Uptake Experiments

[0741] Primary mouse hepatocytes (PMH) or primary human hepatocytes (PHH) were freshly isolated less than 1 hour prior to transfection and grown in primary hepatocyte media.

[0742] Free uptake experiments were performed by adding 2.5 μl of siRNA duplexes in PBS per well into a 96 well plate. Complete growth media (47.5 μl) containing about 1.5×10⁴ PMH or PHH was then added to the siRNA. Cells were incubated for 48 hours prior to RNA purification and RT-qPCR. Single dose experiments in PHH were performed at 500 nM, 100 nM, 10 nM and/or 0.1 nM in PHH and in PMH at 500 nM, 100 nM, nM, and 1 nM final duplex concentration.

[0743] Total RNA isolation was performed using DYNABEADS. Briefly, cells were lysed in 10 μl of Lysis/Binding Buffer containing 3 μL of beads per well and mixed for 10 minutes on an electrostatic shaker. The washing steps were automated on a Biotek EL406, using a magnetic plate support. Beads were washed (in 3 μL) once in Buffer A, once in Buffer B, and twice in Buffer E, with aspiration steps in between. Following a final aspiration, complete 12 μL RT mixture was added to each well, as described below.

[0744] For cDNA synthesis, a master mix of 1.5 μl 10× Buffer, 0.6 μl 10×dNTPs, 1.5 μl Random primers, 0.75 μl Reverse Transcriptase, 0.75 μl RNase inhibitor and 9.9 μl of H₂O per reaction were added per well. Plates were sealed, agitated for 10 minutes on an electrostatic shaker, and then incubated at 37 degrees C. for 2 hours. Following this, the plates were agitated at 80 degrees C. for 8 minutes.

[0745] For RT-qPCR, two microlitre (μ1) of cDNA were added to a master mix containing 0.5 μl of human GAPDH TaqMan Probe (4326317E), 0.5 μl human APOC3, 41 nuclease-free water and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche).

[0746] To calculate relative fold change, data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC₅₀s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 or mock-transfected. The sense and antisense sequences of AD-1955 are: sense: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 21) and antisense UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO: 22).

[0747] The results of the free uptake experiments of the dsRNA agents listed in Tables 2 and 3 in PHH are shown in Table 4 and the results of the free uptake experiments of the dsRNA agents listed in Tables 2 and 3 in PMH are shown in Table 5.

[0748]

TABLE 1
Abbreviations of nucleotide monomers used in nucleic acid sequence
representation. It will be understood that these monomers, when present in an
oligonucleotide, are mutually linked by 5′-3′-phosphodiester bonds;
and it is understood that when the nucleotide contains a 2′-fluoro modification,
then the fluoro replaces the hydroxy at that position in the parent nucleotide
(i.e., it is a 2′-deoxy-2′-fluoronucleotide).
Abbreviation	Nucleotide(s)
A	Adenosine-3′-phosphate
Ab	beta-L-adenosine-3′-phosphate
Abs	beta-L-adenosine-3′-phosphorothioate
Af	2′-fluoroadenosine-3′-phosphate
Afs	2′-fluoroadenosine-3′-phosphorothioate
As	adenosine-3′-phosphorothioate
C	cytidine-3′-phosphate
Cb	beta-L-cytidine-3′-phosphate
Cbs	beta-L-cytidine-3′-phosphorothioate
Cf	2′-fluorocytidine-3′-phosphate
Cfs	2′-fluorocytidine-3′-phosphorothioate
Cs	cytidine-3′-phosphorothioate
G	guanosine-3′-phosphate
Gb	beta-L-guanosine-3′-phosphate
Gbs	beta-L-guanosine-3′-phosphorothioate
Gf	2′-fluoroguanosine-3′-phosphate
Gfs	2′-fluoroguanosine-3′-phosphorothioate
Gs	guanosine-3′-phosphorothioate
T	5′-methyluridine-3′-phosphate
Tf	2′-fluoro-5-methyluridine-3′-phosphate
Tfs	2′-fluoro-5-methyluridine-3′-phosphorothioate
Ts	5-methyluridine-3′-phosphorothioate
U	Uridine-3′-phosphate
Uf	2′-fluorouridine-3′-phosphate
Ufs	2′-fluorouridine -3′-phosphorothioate
Us	uridine -3′-phosphorothioate
N	any nucleotide, modified or unmodified
a	2′-O-methyladenosine-3′-phosphate
as	2′-O-methyladenosine-3′- phosphorothioate
c	2′-O-methylcytidine-3′-phosphate
cs	2′-O-methylcytidine-3′- phosphorothioate
g	2′-O-methylguanosine-3′-phosphate
gs	2′-O-methylguanosine-3′- phosphorothioate
t	2′-O-methyl-5-methyluridine-3′-phosphate
ts	2′-O-methyl-5-methyluridine-3′-phosphorothioate
u	2′-O-methyluridine-3′-phosphate
us	2′-O-methyluridine-3′-phosphorothioate
s	phosphorothioate linkage
L10	N-(cholesterylcarboxamidocaproyl)-4-hydroxyprolinol (Hyp-C6-Chol)
L96	N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol (Hyp-(GalNAc-alkyl)3)
Y34	2-hydroxymethyl-tetrahydrofurane-4-methoxy-3-phosphate (abasic 2′-OMe furanose)
Y44	inverted abasic DNA (2-hydroxymethyl-tetrahydrofurane-5-phosphate)
(Agn)	Adenosine-glycol nucleic acid (GNA)
(Cgn)	Cytidine-glycol nucleic acid (GNA)
(Ggn)	Guanosine-glycol nucleic acid (GNA)
(Tgn)	Thymidine-glycol nucleic acid (GNA) S-Isomer
P	Phosphate
VP	Vinyl-phosphonate
dA	2′-deoxyadenosine-3′-phosphate
dAs	2′-deoxyadenosine-3′-phosphorothioate
dC	2′-deoxycytidine-3′-phosphate
dCs	2′-deoxycytidine-3′-phosphorothioate
dG	2′-deoxyguanosine-3′-phosphate
dGs	2′-deoxyguanosine-3′-phosphorothioate
dT	2′- deoxythimidine -3′-phosphate
dTs	2′- deoxythimidine -3′-phosphorothioate
dU	2′-deoxyuridine
dUs	2′-deoxyuridine-3′-phosphorothioate
(C2p)	cytidine-2′-phosphate
(G2p)	guanosine-2′-phosphate
(U2p)	uridine-2′-phosphate
(A2p)	adenosine-2′-phosphate
(Ahd)	2′-O-hexadecyl-adenosine-3′-phosphate
(Chd)	2′-O-hexadecyl-cytidine-3′-phosphate
(Ghd)	2′-O-hexadecyl-guanosine-3′-phosphate
(Uhd)	2′-O-hexadecyl-uridine-3′-phosphate
(Aams)	2′-O-(N-methylacetamide)adenosine-3′-phosphorothioate
(Gams)	2′-O-(N-methylacetamide)guanosine-3′-phosphorothioate
(Tams)	2′-O-(N-methylacetamide)thymidine-3′-phosphorothioate

[0749]

TABLE 2
Unmodified Sense and Antisense Strand Sequences of Xanthine Dehydrogenase dsRNA Agents
		SEQ			SEQ
		ID	Range in		ID	Range in
Duplex Name	Sense Sequence 5′ to 3′	NO:	NM_000379.4	Antisense Sequence 5′ to 3′	NO:	NM_000379.4
AD-1135979.1	UACCUGCCAGUGUCUCUUAGU	23	17-37	ACUAAGAGACACUGGCAGGUAGU	382	15-37
AD-1135980.1	ACCUGCCAGUGUCUCUUAGGU	24	18-38	ACCUAAGAGACACUGGCAGGUAG	383	16-38
AD-1135981.1	CCUGCCAGUGUCUCUUAGGAU	25	19-39	AUCCUAAGAGACACUGGCAGGUA	384	17-39
AD-1135982.1	UGCCAGUGUCUCUUAGGAGUU	26	21-41	AACUCCUAAGAGACACUGGCAGG	385	19-41
AD-1135983.1	GCCAGUGUCUCUUAGGAGUGU	27	22-42	ACACTCCUAAGAGACACUGGCAG	386	20-42
AD-1135984.1	CCAGUGUCUCUUAGGAGUGAU	28	23-43	AUCACUCCUAAGAGACACUGGCA	387	21-43
AD-1135985.1	CAGUGUCUCUUAGGAGUGAGU	29	24-44	ACUCACUCCUAAGAGACACUGGC	388	22-44
AD-1135986.1	AGUGUCUCUUAGGAGUGAGGU	30	25-45	ACCUCACUCCUAAGAGACACUGG	389	23-45
AD-1135987.1	UGGAGAAAAAUGCAGAUCCAU	31	123-143	AUGGAUCUGCAUUUUUCUCCACC	390	121-143
AD-1135988.1	CCAGAGACAACCCUUUUGGCU	32	140-160	AGCCAAAAGGGUUGUCUCUGGAU	391	138-160
AD-1135989.1	AGAGACAACCCUUUUGGCCUU	33	142-162	AAGGCCAAAAGGGUUGUCUCUGG	392	140-162
AD-1135990.1	GCACAGUGAUGCUCUCCAAGU	34	228-248	ACUUGGAGAGCAUCACUGUGCAA	393	226-248
AD-1135991.1	CACAGUGAUGCUCUCCAAGUU	35	229-249	AACUTGGAGAGCAUCACUGUGCA	394	227-249
AD-1135992.1	GAUGCUCUCCAAGUAUGAUCU	36	235-255	AGAUCAUACUUGGAGAGCAUCAC	395	233-255
AD-1135993.1	AUGCUCUCCAAGUAUGAUCGU	37	236-256	ACGAUCAUACUUGGAGAGCAUCA	396	234-256
AD-1135994.1	UGCUCUCCAAGUAUGAUCGUU	38	237-257	AACGAUCAUACUUGGAGAGCAUC	397	235-257
AD-1135995.1	GCUCUCCAAGUAUGAUCGUCU	39	238-258	AGACGAUCAUACUUGGAGAGCAU	398	236-258
AD-1135996.1	CUCUCCAAGUAUGAUCGUCUU	40	239-259	AAGACGAUCAUACUUGGAGAGCA	399	237-259
AD-1135997.1	GAUCGUCUGCAGAACAAGAUU	41	251-271	AAUCTUGUUCUGCAGACGAUCAU	400	249-271
AD-1135998.1	CGUCUGCAGAACAAGAUCGUU	42	254-274	AACGAUCUUGUUCUGCAGACGAU	401	252-274
AD-1135999.1	GUCUGCAGAACAAGAUCGUCU	43	255-275	AGACGAUCUUGUUCUGCAGACGA	402	253-275
AD-1136000.1	UCUGCAGAACAAGAUCGUCCU	44	256-276	AGGACGAUCUUGUUCUGCAGACG	403	254-276
AD-1136001.1	GCAGAACAAGAUCGUCCACUU	45	259-279	AAGUGGACGAUCUUGUUCUGCAG	404	257-279
AD-1136002.1	CAGAACAAGAUCGUCCACUUU	46	260-280	AAAGTGGACGAUCUUGUUCUGCA	405	258-280
AD-1136003.1	GAACAAGAUCGUCCACUUUUU	47	262-282	AAAAAGTGGACGAUCUUGUUCUG	406	260-282
AD-1136004.1	AACAAGAUCGUCCACUUUUCU	48	263-283	AGAAAAGUGGACGAUCUUGUUCU	407	261-283
AD-1136005.1	ACAAGAUCGUCCACUUUUCUU	49	264-284	AAGAAAAGUGGACGAUCUUGUUC	408	262-284
AD-1136006.1	CAAGAUCGUCCACUUUUCUGU	50	265-285	ACAGAAAAGUGGACGAUCUUGUU	409	263-285
AD-1136007.1	AAGAUCGUCCACUUUUCUGCU	51	266-286	AGCAGAAAAGUGGACGAUCUUGU	410	264-286
AD-1136008.1	CGUCCACUUUUCUGCCAAUGU	52	271-291	ACAUTGGCAGAAAAGUGGACGAU	411	269-291
AD-1136009.1	GUCCACUUUUCUGCCAAUGCU	53	272-292	AGCATUGGCAGAAAAGUGGACGA	412	270-292
AD-1136010.1	UGCUCCUUGCACCAUGUUGCU	54	308-328	AGCAACAUGGUGCAAGGAGCAGA	413	306-328
AD-1136011.1	UCCUUGCACCAUGUUGCAGUU	55	311-331	AACUGCAACAUGGUGCAAGGAGC	414	309-331
AD-1136012.1	UUGCACCAUGUUGCAGUGACU	56	314-334	AGUCACTGCAACAUGGUGCAAGG	415	312-334
AD-1136013.1	CACCAUGUUGCAGUGACAACU	57	317-337	AGUUGUCACUGCAACAUGGUGCA	416	315-337
AD-1136014.1	ACCAUGUUGCAGUGACAACUU	58	318-338	AAGUTGTCACUGCAACAUGGUGC	417	316-338
AD-1136015.1	AGGAGAGAAUUGCCAAAAGCU	59	381-401	AGCUTUTGGCAAUUCUCUCCUGC	418	379-401
AD-1136016.1	GGAGAGAAUUGCCAAAAGCCU	60	382-402	AGGCTUTUGGCAAUUCUCUCCUG	419	380-402
AD-1136017.1	UGGCAUCGUCAUGAGUAUGUU	61	430-450	AACAUACUCAUGACGAUGCCAGG	420	428-450
AD-1136018.1	GGCAUCGUCAUGAGUAUGUAU	62	431-451	AUACAUACUCAUGACGAUGCCAG	421	429-451
AD-1136019.1	GCAUCGUCAUGAGUAUGUACU	63	432-452	AGUACAUACUCAUGACGAUGCCA	422	430-452
AD-1136020.1	CAUCGUCAUGAGUAUGUACAU	64	433-453	AUGUACAUACUCAUGACGAUGCC	423	431-453
AD-1136021.1	AUCGUCAUGAGUAUGUACACU	65	434-454	AGUGTACAUACUCAUGACGAUGC	424	432-454
AD-1136022.1	CGUCAUGAGUAUGUACACACU	66	436-456	AGUGTGTACAUACUCAUGACGAU	425	434-456
AD-1136023.1	GUCAUGAGUAUGUACACACUU	67	437-457	AAGUGUGUACAUACUCAUGACGA	426	435-457
AD-1136024.1	UCAUGAGUAUGUACACACUGU	68	438-458	ACAGTGTGUACAUACUCAUGACG	427	436-458
AD-1136025.1	AAUGCCUUCCAAGGAAAUCUU	69	497-517	AAGATUTCCUUGGAAGGCAUUCU	428	495-517
AD-1136026.1	AUGCCUUCCAAGGAAAUCUGU	70	498-518	ACAGAUUUCCUUGGAAGGCAUUC	429	496-518
AD-1136027.1	UGCCUUCCAAGGAAAUCUGUU	71	499-519	AACAGAUUUCCUUGGAAGGCAUU	430	497-519
AD-1136028.1	GCCUUCCAAGGAAAUCUGUGU	72	500-520	ACACAGAUUUCCUUGGAAGGCAU	431	498-520
AD-1136029.1	CCUUCCAAGGAAAUCUGUGCU	73	501-521	AGCACAGAUUUCCUUGGAAGGCA	432	499-521
AD-1136030.1	GAGAUGAAGUUCAAGAAUAUU	74	875-895	AAUATUCUUGAACUUCAUCUCAA	433	873-895
AD-1136031.1	GAUGAAGUUCAAGAAUAUGCU	75	877-897	AGCAUAUUCUUGAACUUCAUCUC	434	875-897
AD-1136032.1	AAGUUCAAGAAUAUGCUGUUU	76	881-901	AAACAGCAUAUUCUUGAACUUCA	435	879-901
AD-1136033.1	AGUUCAAGAAUAUGCUGUUUU	77	882-902	AAAACAGCAUAUUCUUGAACUUC	436	880-902
AD-1136034.1	GUUCAAGAAUAUGCUGUUUCU	78	883-903	AGAAACAGCAUAUUCUUGAACUU	437	881-903
AD-1136035.1	UUCAAGAAUAUGCUGUUUCCU	79	884-904	AGGAAACAGCAUAUUCUUGAACU	438	882-904
AD-1136036.1	AAGAAUAUGCUGUUUCCUAUU	80	887-907	AAUAGGAAACAGCAUAUUCUUGA	439	885-907
AD-1136037.1	GGGAGUAUUUCUCAGCAUUCU	81	1320-1340	AGAATGCUGAGAAAUACUCCCCC	440	1318-1340
AD-1136038.1	GGAGUAUUUCUCAGCAUUCAU	82	1321-1341	AUGAAUGCUGAGAAAUACUCCCC	441	1319-1341
AD-1136039.1	GAGUAUUUCUCAGCAUUCAAU	83	1322-1342	AUUGAAUGCUGAGAAAUACUCCC	442	1320-1342
AD-1136040.1	AGUAUUUCUCAGCAUUCAAGU	84	1323-1343	ACUUGAAUGCUGAGAAAUACUCC	443	1321-1343
AD-1136041.1	GUAUUUCUCAGCAUUCAAGCU	85	1324-1344	AGCUTGAAUGCUGAGAAAUACUC	444	1322-1344
AD-1136042.1	GUGGCAUGAGAGUUUUAUUCU	86	1383-1403	AGAAUAAAACUCUCAUGCCACUG	445	1381-1403
AD-1136043.1	GGCAUGAGAGUUUUAUUCAAU	87	1385-1405	AUUGAAUAAAACUCUCAUGCCAC	446	1383-1405
AD-1136044.1	CAUGAGAGUUUUAUUCAAGCU	88	1387-1407	AGCUTGAAUAAAACUCUCAUGCC	447	1385-1407
AD-1136045.1	CCUCACCCUCAGCUUCUUCUU	89	1606-1626	AAGAAGAAGCUGAGGGUGAGGGU	448	1604-1626
AD-1136046.1	UCACCCUCAGCUUCUUCUUCU	90	1608-1628	AGAAGAAGAAGCUGAGGGUGAGG	449	1606-1628
AD-1136047.1	UCUUCAAGUUCUACCUGACAU	91	1623-1643	AUGUCAGGUAGAACUUGAAGAAG	450	1621-1643
AD-1136048.1	UUUCGCCAGUGCAACUUUACU	92	1702-1722	AGUAAAGUUGCACUGGCGAAAGU	451	1700-1722
AD-1136049.1	UUCGCCAGUGCAACUUUACUU	93	1703-1723	AAGUAAAGUUGCACUGGCGAAAG	452	1701-1723
AD-1136050.1	UUCCAGGGUUUGUUUGUUUCU	94	1962-1982	AGAAACAAACAAACCCUGGAACC	453	1960-1982
AD-1136051.1	CAGGGUUUGUUUGUUUCAUUU	95	1965-1985	AAAUGAAACAAACAAACCCUGGA	454	1963-1985
AD-1136052.1	GGGUUUGUUUGUUUCAUUUCU	96	1967-1987	AGAAAUGAAACAAACAAACCCUG	455	1965-1987
AD-1136053.1	GGUUUGUUUGUUUCAUUUCCU	97	1968-1988	AGGAAAUGAAACAAACAAACCCU	456	1966-1988
AD-1136054.1	UUGUUUGUUUCAUUUCCGCUU	98	1971-1991	AAGCGGAAAUGAAACAAACAAAC	457	1969-1991
AD-1136055.1	UUCCUGGGAGUAACAUAACUU	99	1998-2018	AAGUUAUGUUACUCCCAGGAACA	458	1996-2018
AD-1136056.1	GGGAGUAACAUAACUGGAAUU	100	2003-2023	AAUUCCAGUUAUGUUACUCCCAG	459	2001-2023
AD-1136057.1	UAACAUAACUGGAAUUUGUAU	101	2008-2028	AUACAAAUUCCAGUUAUGUUACU	460	2006-2028
AD-1136058.1	AACAUAACUGGAAUUUGUAAU	102	2009-2029	AUUACAAAUUCCAGUUAUGUUAC	461	2007-2029
AD-1136059.1	CGAAGGAUAAGGUUACUUGUU	103	2046-2066	AACAAGUAACCUUAUCCUUCGCA	462	2044-2066
AD-1136060.1	GAAGGAUAAGGUUACUUGUGU	104	2047-2067	ACACAAGUAACCUUAUCCUUCGC	463	2045-2067
AD-1136061.1	GGGUGAAAAUCACCUAUGAAU	105	2130-2150	AUUCAUAGGUGAUUUUCACCCCU	464	2128-2150
AD-1136062.1	AAUCACCUAUGAAGAACUACU	106	2137-2157	AGUAGUTCUUCAUAGGUGAUUUU	465	2135-2157
AD-1136063.1	AUCACCUAUGAAGAACUACCU	107	2138-2158	AGGUAGTUCUUCAUAGGUGAUUU	466	2136-2158
AD-1136064.1	UACCAGCCAUUAUCACAAUUU	108	2154-2174	AAAUTGTGAUAAUGGCUGGUAGU	467	2152-2174
AD-1136065.1	GAACAACUCCUUUUAUGGACU	109	2188-2208	AGUCCAUAAAAGGAGUUGUUCUU	468	2186-2208
AD-1136066.1	GGCCAAGAGCACUUCUACCUU	110	2291-2311	AAGGTAGAAGUGCUCUUGGCCAC	469	2289-2311
AD-1136067.1	GAGCACUUCUACCUGGAGACU	111	2297-2317	AGUCTCCAGGUAGAAGUGCUCUU	470	2295-2317
AD-1136068.1	GCACUUCUACCUGGAGACUCU	112	2299-2319	AGAGTCTCCAGGUAGAAGUGCUC	471	2297-2319
AD-1136069.1	CACUUCUACCUGGAGACUCAU	113	2300-2320	AUGAGUCUCCAGGUAGAAGUGCU	472	2298-2320
AD-1136070.1	UCACUGCACCAUUGCUGUUCU	114	2317-2337	AGAACAGCAAUGGUGCAGUGAGU	473	2315-2337
AD-1136071.1	CACUGCACCAUUGCUGUUCCU	115	2318-2338	AGGAACAGCAAUGGUGCAGUGAG	474	2316-2338
AD-1136072.1	CCAUUGCUGUUCCAAAAGGCU	116	2325-2345	AGCCUUUUGGAACAGCAAUGGUG	475	2323-2345
AD-1136073.1	AGCUCUUUGUGUCUACACAGU	117	2361-2381	ACUGTGTAGACACAAAGAGCUCC	476	2359-2381
AD-1136074.1	GCUCUUUGUGUCUACACAGAU	118	2362-2382	AUCUGUGUAGACACAAAGAGCUC	477	2360-2382
AD-1136075.1	CUCUUUGUGUCUACACAGAAU	119	2363-2383	AUUCTGTGUAGACACAAAGAGCU	478	2361-2383
AD-1136076.1	UCUUUGUGUCUACACAGAACU	120	2364-2384	AGUUCUGUGUAGACACAAAGAGC	479	2362-2384
AD-1136077.1	CUUUGUGUCUACACAGAACAU	121	2365-2385	AUGUTCTGUGUAGACACAAAGAG	480	2363-2385
AD-1136078.1	UUUGUGUCUACACAGAACACU	122	2366-2386	AGUGTUCUGUGUAGACACAAAGA	481	2364-2386
AD-1136079.1	ACACAGAACACCAUGAAGACU	123	2375-2395	AGUCTUCAUGGUGUUCUGUGUAG	482	2373-2395
AD-1136080.1	GAGCUUUGUUGCAAAAAUGUU	124	2398-2418	AACAUUUUUGCAACAAAGCUCUG	483	2396-2418
AD-1136081.1	AGCUUUGUUGCAAAAAUGUUU	125	2399-2419	AAACAUUUUUGCAACAAAGCUCU	484	2397-2419
AD-1136082.1	AGGAUCUCUCUCAGAGUAUUU	126	2691-2711	AAAUACTCUGAGAGAGAUCCUGG	485	2689-2711
AD-1136083.1	GGAUCUCUCUCAGAGUAUUAU	127	2692-2712	AUAATACUCUGAGAGAGAUCCUG	486	2690-2712
AD-1136084.1	GAUCUCUCUCAGAGUAUUAUU	128	2693-2713	AAUAAUACUCUGAGAGAGAUCCU	487	2691-2713
AD-1136085.1	AUCUCUCUCAGAGUAUUAUGU	129	2694-2714	ACAUAAUACUCUGAGAGAGAUCC	488	2692-2714
AD-1136086.1	UCUCUCUCAGAGUAUUAUGGU	130	2695-2715	ACCAUAAUACUCUGAGAGAGAUC	489	2693-2715
AD-1136087.1	CUCUCUCAGAGUAUUAUGGAU	131	2696-2716	AUCCAUAAUACUCUGAGAGAGAU	490	2694-2716
AD-1136088.1	UCUCUCAGAGUAUUAUGGAAU	132	2697-2717	AUUCCAUAAUACUCUGAGAGAGA	491	2695-2717
AD-1136089.1	CUCUCAGAGUAUUAUGGAACU	133	2698-2718	AGUUCCAUAAUACUCUGAGAGAG	492	2696-2718
AD-1136090.1	UCUCAGAGUAUUAUGGAACGU	134	2699-2719	ACGUUCCAUAAUACUCUGAGAGA	493	2697-2719
AD-1136091.1	UCAGAGUAUUAUGGAACGAGU	135	2701-2721	ACUCGUUCCAUAAUACUCUGAGA	494	2699-2721
AD-1136092.1	CAGAGUAUUAUGGAACGAGCU	136	2702-2722	AGCUCGUUCCAUAAUACUCUGAG	495	2700-2722
AD-1136093.1	GCUGUGCAAAACCAACCUUCU	137	2776-2796	AGAAGGTUGGUUUUGCACAGCCG	496	2774-2796
AD-1136094.1	CUGUGCAAAACCAACCUUCCU	138	2777-2797	AGGAAGGUUGGUUUUGCACAGCC	497	2775-2797
AD-1136095.1	CCUGACACACUUCAACCAGAU	139	2932-2952	AUCUGGTUGAAGUGUGUCAGGUC	498	2930-2952
AD-1136096.1	UGACACACUUCAACCAGAAGU	140	2934-2954	ACUUCUGGUUGAAGUGUGUCAGG	499	2932-2954
AD-1136097.1	GACACACUUCAACCAGAAGCU	141	2935-2955	AGCUTCTGGUUGAAGUGUGUCAG	500	2933-2955
AD-1136098.1	ACACUUCAACCAGAAGCUUGU	142	2938-2958	ACAAGCUUCUGGUUGAAGUGUGU	501	2936-2958
AD-1136099.1	AUGCCUAGCAAGCUCUCAGUU	143	2989-3009	AACUGAGAGCUUGCUAGGCAUUC	502	2987-3009
AD-1136100.1	CCUAGCAAGCUCUCAGUAUCU	144	2992-3012	AGAUACTGAGAGCUUGCUAGGCA	503	2990-3012
AD-1136101.1	CUAGCAAGCUCUCAGUAUCAU	145	2993-3013	AUGATACUGAGAGCUUGCUAGGC	504	2991-3013
AD-1136102.1	UAGCAAGCUCUCAGUAUCAUU	146	2994-3014	AAUGAUACUGAGAGCUUGCUAGG	505	2992-3014
AD-1136103.1	AGCAAGCUCUCAGUAUCAUGU	147	2995-3015	ACAUGAUACUGAGAGCUUGCUAG	506	2993-3015
AD-1136104.1	CAAGCUCUCAGUAUCAUGCUU	148	2997-3017	AAGCAUGAUACUGAGAGCUUGCU	507	2995-3017
AD-1136105.1	CUCGGAAGAGUGAGGUUGACU	149	3015-3035	AGUCAACCUCACUCUUCCGAGCA	508	3013-3035
AD-1136106.1	AAGGAGAAUUGUUGGAAAAAU	150	3044-3064	AUUUTUCCAACAAUUCUCCUUGU	509	3042-3064
AD-1136107.1	CACCAAGUUUGGAAUAAGCUU	151	3085-3105	AAGCUUAUUCCAAACUUGGUGGG	510	3083-3105
AD-1136108.1	ACCAAGUUUGGAAUAAGCUUU	152	3089-3109	AAAGCUUAUUCCAAACUUGGUGG	511	3087-3109
AD-1136109.1	AGUUCCUUUUCUGAAUCAGGU	153	3109-3129	ACCUGAUUCAGAAAAGGAACUGU	512	3107-3129
AD-1136110.1	GUUCCUUUUCUGAAUCAGGCU	154	3110-3130	AGCCTGAUUCAGAAAAGGAACUG	513	3108-3130
AD-1136111.1	UUCCUUUUCUGAAUCAGGCAU	155	3111-3131	AUGCCUGAUUCAGAAAAGGAACU	514	3109-3131
AD-1136112.1	UACUUCAUGUGUACACAGAUU	156	3138-3158	AAUCTGTGUACACAUGAAGUAGG	515	3136-3158
AD-1136114.1	CAAGGCCUUCAUACCAAAAUU	157	3197-3217	AAUUTUGGUAUGAAGGCCUUGGC	516	3195-3217
AD-1136115.1	AAGGCCUUCAUACCAAAAUGU	158	3198-3218	ACAUUUUGGUAUGAAGGCCUUGG	517	3196-3218
AD-1136116.1	GCCUUCAUACCAAAAUGGUCU	159	3201-3221	AGACCAUUUUGGUAUGAAGGCCU	518	3199-3221
AD-1136117.1	CACCUCUAAGAUUUAUAUCAU	160	3250-3270	AUGAUAUAAAUCUUAGAGGUGGG	519	3248-3270
AD-1136118.1	ACCUCUAAGAUUUAUAUCAGU	161	3251-3271	ACUGAUAUAAAUCUUAGAGGUGG	520	3249-3271
AD-1136119.1	GCGAGACAAGCACUAACACUU	162	3270-3290	AAGUGUTAGUGCUUGUCUCGCUG	521	3268-3290
AD-1136120.1	CGAGACAAGCACUAACACUGU	163	3271-3291	ACAGTGTUAGUGCUUGUCUCGCU	522	3269-3291
AD-1136121.1	GAGACAAGCACUAACACUGUU	164	3272-3292	AACAGUGUUAGUGCUUGUCUCGC	523	3270-3292
AD-1136122.1	AGACAAGCACUAACACUGUGU	165	3273-3293	ACACAGTGUUAGUGCUUGUCUCG	524	3271-3293
AD-1136123.1	CGGCUUGUCAGACCAUCUUGU	166	3354-3374	ACAAGAUGGUCUGACAAGCCGCA	525	3352-3374
AD-1136124.1	GGCUUGUCAGACCAUCUUGAU	167	3355-3375	AUCAAGAUGGUCUGACAAGCCGC	526	3353-3375
AD-1136125.1	GCUUGUCAGACCAUCUUGAAU	168	3356-3376	AUUCAAGAUGGUCUGACAAGCCG	527	3354-3376
AD-1136126.1	CUUGUCAGACCAUCUUGAAAU	169	3357-3377	AUUUCAAGAUGGUCUGACAAGCC	528	3355-3377
AD-1136127.1	UUGUCAGACCAUCUUGAAAAU	170	3358-3378	AUUUTCAAGAUGGUCUGACAAGC	529	3356-3378
AD-1136128.1	UGUCAGACCAUCUUGAAAAGU	171	3359-3379	ACUUUUCAAGAUGGUCUGACAAG	530	3357-3379
AD-1136129.1	GUCAGACCAUCUUGAAAAGGU	172	3360-3380	ACCUUUUCAAGAUGGUCUGACAA	531	3358-3380
AD-1136130.1	UCAGACCAUCUUGAAAAGGCU	173	3361-3381	AGCCUUUUCAAGAUGGUCUGACA	532	3359-3381
AD-1136131.1	ACCCUACAAGAAGAAGAAUCU	174	3385-3405	AGAUTCTUCUUCUUGUAGGGUUC	533	3383-3405
AD-1136132.1	CUGCCACUGGGUUUUAUAGAU	175	3462-3482	AUCUAUAAAACCCAGUGGCAGAC	534	3460-3482
AD-1136133.1	UGCCACUGGGUUUUAUAGAAU	176	3463-3483	AUUCUAUAAAACCCAGUGGCAGA	535	3461-3483
AD-1136134.1	CACUGGGUUUUAUAGAACACU	177	3466-3486	AGUGTUCUAUAAAACCCAGUGGC	536	3464-3486
AD-1136135.1	ACUGGGUUUUAUAGAACACCU	178	3467-3487	AGGUGUTCUAUAAAACCCAGUGG	537	3465-3487
AD-1136136.1	GGGUUUUAUAGAACACCCAAU	179	3470-3490	AUUGGGTGUUCUAUAAAACCCAG	538	3468-3490
AD-1136137.1	GGUUUUAUAGAACACCCAAUU	180	3471-3491	AAUUGGGUGUUCUAUAAAACCCA	539	3469-3491
AD-1136138.1	UGGGCUACAGCUUUGAGACUU	181	3492-3512	AAGUCUCAAAGCUGUAGCCCAGA	540	3490-3512
AD-1136139.1	GGGCUACAGCUUUGAGACUAU	182	3493-3513	AUAGTCTCAAAGCUGUAGCCCAG	541	3491-3513
AD-1136140.1	GCUACAGCUUUGAGACUAACU	183	3495-3515	AGUUAGTCUCAAAGCUGUAGCCC	542	3493-3515
AD-1136141.1	CUACAGCUUUGAGACUAACUU	184	3496-3516	AAGUTAGUCUCAAAGCUGUAGCC	543	3494-3516
AD-1136142.1	UACAGCUUUGAGACUAACUCU	185	3497-3517	AGAGTUAGUCUCAAAGCUGUAGC	544	3495-3517
AD-1136143.1	ACAGCUUUGAGACUAACUCAU	186	3498-3518	AUGAGUTAGUCUCAAAGCUGUAG	545	3496-3518
AD-1136144.1	CAGCUUUGAGACUAACUCAGU	187	3499-3519	ACUGAGUUAGUCUCAAAGCUGUA	546	3497-3519
AD-1136145.1	AGCUUUGAGACUAACUCAGGU	188	3500-3520	ACCUGAGUUAGUCUCAAAGCUGU	547	3498-3520
AD-1136146.1	CUUCCACUACUUCAGCUAUGU	189	3526-3546	ACAUAGCUGAAGUAGUGGAAGGG	548	3524-3546
AD-1136147.1	UUCCACUACUUCAGCUAUGGU	190	3527-3547	ACCAUAGCUGAAGUAGUGGAAGG	549	3525-3547
AD-1136148.1	GUGGCUUGCUCUGAAGUAGAU	191	3548-3568	AUCUACTUCAGAGCAAGCCACCC	550	3546-3568
AD-1136149.1	UGGCUUGCUCUGAAGUAGAAU	192	3549-3569	AUUCTACUUCAGAGCAAGCCACC	551	3547-3569
AD-1136150.1	GGCUUGCUCUGAAGUAGAAAU	193	3550-3570	AUUUCUACUUCAGAGCAAGCCAC	552	3548-3570
AD-1136151.1	GCUUGCUCUGAAGUAGAAAUU	194	3551-3571	AAUUTCTACUUCAGAGCAAGCCA	553	3549-3571
AD-1136152.1	CCUAACAGGAGAUCAUAAGAU	195	3577-3597	AUCUUAUGAUCUCCUGUUAGGCA	554	3575-3597
AD-1136153.1	CUAACAGGAGAUCAUAAGAAU	196	3578-3598	AUUCTUAUGAUCUCCUGUUAGGC	555	3576-3598
AD-1136154.1	UAACAGGAGAUCAUAAGAACU	197	3579-3599	AGUUCUUAUGAUCUCCUGUUAGG	556	3577-3599
AD-1136155.1	AACAGGAGAUCAUAAGAACCU	198	3580-3600	AGGUTCTUAUGAUCUCCUGUUAG	557	3578-3600
AD-1136156.1	CCUCCGCACAGAUAUUGUCAU	199	3598-3618	AUGACAAUAUCUGUGCGGAGGUU	558	3596-3618
AD-1136157.1	CUCCGCACAGAUAUUGUCAUU	200	3599-3619	AAUGACAAUAUCUGUGCGGAGGU	559	3597-3619
AD-1136158.1	UUGGCUCCAGUCUAAACCCUU	201	3624-3644	AAGGGUTUAGACUGGAGCCAACA	560	3622-3644
AD-1136159.1	UUCCUGGCUGCUUCUAUCUUU	202	3872-3892	AAAGAUAGAAGCAGCCAGGAAGA	561	3870-3892
AD-1136160.1	UCCUGGCUGCUUCUAUCUUCU	203	3873-3893	AGAAGAUAGAAGCAGCCAGGAAG	562	3871-3893
AD-1136161.1	CCUGGCUGCUUCUAUCUUCUU	204	3874-3894	AAGAAGAUAGAAGCAGCCAGGAA	563	3872-3894
AD-1136162.1	CUGGCUGCUUCUAUCUUCUUU	205	3875-3895	AAAGAAGAUAGAAGCAGCCAGGA	564	3873-3895
AD-1136163.1	UGGCUGCUUCUAUCUUCUUUU	206	3876-3896	AAAAGAAGAUAGAAGCAGCCAGG	565	3874-3896
AD-1136164.1	GCUGCUUCUAUCUUCUUUGCU	207	3878-3898	AGCAAAGAAGAUAGAAGCAGCCA	566	3876-3898
AD-1136165.1	CUGCUUCUAUCUUCUUUGCCU	208	3879-3899	AGGCAAAGAAGAUAGAAGCAGCC	567	3877-3899
AD-1136166.1	UGCUUCUAUCUUCUUUGCCAU	209	3880-3900	AUGGCAAAGAAGAUAGAAGCAGC	568	3878-3900
AD-1136167.1	GCUUCUAUCUUCUUUGCCAUU	210	3881-3901	AAUGGCAAAGAAGAUAGAAGCAG	569	3879-3901
AD-1136168.1	CUUCUAUCUUCUUUGCCAUCU	211	3882-3902	AGAUGGCAAAGAAGAUAGAAGCA	570	3880-3902
AD-1136169.1	UUCUAUCUUCUUUGCCAUCAU	212	3883-3903	AUGATGGCAAAGAAGAUAGAAGC	571	3881-3903
AD-1136170.1	UCUAUCUUCUUUGCCAUCAAU	213	3884-3904	AUUGAUGGCAAAGAAGAUAGAAG	572	3882-3904
AD-1136171.1	CUAUCUUCUUUGCCAUCAAAU	214	3885-3905	AUUUGATGGCAAAGAAGAUAGAA	573	3883-3905
AD-1136172.1	UAUCUUCUUUGCCAUCAAAGU	215	3886-3906	ACUUUGAUGGCAAAGAAGAUAGA	574	3884-3906
AD-1136173.1	AUCUUCUUUGCCAUCAAAGAU	216	3887-3907	AUCUTUGAUGGCAAAGAAGAUAG	575	3885-3907
AD-1136174.1	CUUCUUUGCCAUCAAAGAUGU	217	3889-3909	ACAUCUUUGAUGGCAAAGAAGAU	576	3887-3909
AD-1136175.1	GAGCUCAGCACACAGGUAAUU	218	3924-3944	AAUUACCUGUGUGCUGAGCUCGA	577	3922-3944
AD-1136176.1	CUCAGCACACAGGUAAUAACU	219	3927-3947	AGUUAUUACCUGUGUGCUGAGCU	578	3925-3947
AD-1136177.1	UCAGCACACAGGUAAUAACGU	220	3928-3948	ACGUUAUUACCUGUGUGCUGAGC	579	3926-3948
AD-1136178.1	CAGCACACAGGUAAUAACGUU	221	3929-3949	AACGUUAUUACCUGUGUGCUGAG	580	3927-3949
AD-1136179.1	ACAGGUAAUAACGUGAAGGAU	222	3935-3955	AUCCTUCACGUUAUUACCUGUGU	581	3933-3955
AD-1136180.1	CAGGUAAUAACGUGAAGGAAU	223	3936-3956	AUUCCUTCACGUUAUUACCUGUG	582	3934-3956
AD-1136181.1	AGGUAAUAACGUGAAGGAACU	224	3937-3957	AGUUCCTUCACGUUAUUACCUGU	583	3935-3957
AD-1136182.1	AUAACGUGAAGGAACUCUUCU	225	3942-3962	AGAAGAGUUCCUUCACGUUAUUA	584	3940-3962
AD-1136183.1	UAACGUGAAGGAACUCUUCCU	226	3943-3963	AGGAAGAGUUCCUUCACGUUAUU	585	3941-3963
AD-1136184.1	CCCAGAAAACUGCAAACCCUU	227	4042-4062	AAGGGUTUGCAGUUUUCUGGGAC	586	4040-4062
AD-1136185.1	CACAGAACAUGGAUCUAUUAU	228	4145-4165	AUAATAGAUCCAUGUUCUGUGGU	587	4143-4165
AD-1136186.1	ACAGAACAUGGAUCUAUUAAU	229	4146-4166	AUUAAUAGAUCCAUGUUCUGUGG	588	4144-4166
AD-1136187.1	CAGAACAUGGAUCUAUUAAAU	230	4147-4167	AUUUAAUAGAUCCAUGUUCUGUG	589	4145-4167
AD-1136188.1	AGAACAUGGAUCUAUUAAAGU	231	4148-4168	ACUUUAAUAGAUCCAUGUUCUGU	590	4146-4168
AD-1136189.1	GAACAUGGAUCUAUUAAAGUU	232	4149-4169	AACUUUAAUAGAUCCAUGUUCUG	591	4147-4169
AD-1136190.1	AACAUGGAUCUAUUAAAGUCU	233	4150-4170	AGACUUUAAUAGAUCCAUGUUCU	592	4148-4170
AD-1136191.1	ACAUGGAUCUAUUAAAGUCAU	234	4151-4171	AUGACUTUAAUAGAUCCAUGUUC	593	4149-4171
AD-1136192.1	CAUGGAUCUAUUAAAGUCACU	235	4152-4172	AGUGACTUUAAUAGAUCCAUGUU	594	4150-4172
AD-1136193.1	AUGGAUCUAUUAAAGUCACAU	236	4153-4173	AUGUGACUUUAAUAGAUCCAUGU	595	4151-4173
AD-1136194.1	UGGAUCUAUUAAAGUCACAGU	237	4154-4174	ACUGTGACUUUAAUAGAUCCAUG	596	4152-4174
AD-1136195.1	GGAUCUAUUAAAGUCACAGAU	238	4155-4175	AUCUGUGACUUUAAUAGAUCCAU	597	4153-4175
AD-1136196.1	GAUCUAUUAAAGUCACAGAAU	239	4156-4176	AUUCTGTGACUUUAAUAGAUCCA	598	4154-4176
AD-1136197.1	ACAAUGAUAAGCAAAUUCAAU	240	4261-4281	AUUGAAUUUGCUUAUCAUUGUGU	599	4259-4281
AD-1136198.1	CAAUGAUAAGCAAAUUCAAAU	241	4262-4282	AUUUGAAUUUGCUUAUCAUUGUG	600	4260-4282
AD-1136199.1	AUGAUAAGCAAAUUCAAAACU	242	4264-4284	AGUUTUGAAUUUGCUUAUCAUUG	601	4262-4284
AD-1136200.1	AUGCCUAAAUGGUGAAUAUGU	243	4288-4308	ACAUAUUCACCAUUUAGGCAUAA	602	4286-4308
AD-1136201.1	UGCCUAAAUGGUGAAUAUGCU	244	4289-4309	AGCAUAUUCACCAUUUAGGCAUA	603	4287-4309
AD-1136202.1	GCCUAAAUGGUGAAUAUGCAU	245	4290-4310	AUGCAUAUUCACCAUUUAGGCAU	604	4288-4310
AD-1136203.1	CCUAAAUGGUGAAUAUGCAAU	246	4291-4311	AUUGCATAUUCACCAUUUAGGCA	605	4289-4311
AD-1136204.1	CUAAAUGGUGAAUAUGCAAUU	247	4292-4312	AAUUGCAUAUUCACCAUUUAGGC	606	4290-4312
AD-1136205.1	AAUGGUGAAUAUGCAAUUAGU	248	4295-4315	ACUAAUUGCAUAUUCACCAUUUA	607	4293-4315
AD-1136206.1	CGGGAAGGGUUUGUGCUAUUU	249	4357-4377	AAAUAGCACAAACCCUUCCCGAC	608	4355-4377
AD-1136207.1	GGGAAGGGUUUGUGCUAUUCU	250	4358-4378	AGAATAGCACAAACCCUUCCCGA	609	4356-4378
AD-1136208.1	GGAAGGGUUUGUGCUAUUCCU	251	4359-4379	AGGAAUAGCACAAACCCUUCCCG	610	4357-4379
AD-1136209.1	GUAUAACCUCAAGUUCUGAUU	252	4397-4417	AAUCAGAACUUGAGGUUAUACAG	611	4395-4417
AD-1136210.1	UAUAACCUCAAGUUCUGAUGU	253	4398-4418	ACAUCAGAACUUGAGGUUAUACA	612	4396-4418
AD-1136211.1	CCUCAAGUUCUGAUGGUGUCU	254	4403-4423	AGACACCAUCAGAACUUGAGGUU	613	4401-4423
AD-1136212.1	CAAGUUCUGAUGGUGUCUGUU	255	4406-4426	AACAGACACCAUCAGAACUUGAG	614	4404-4426
AD-1136213.1	CCACAAACCUCUAGAAGCUUU	256	4442-4462	AAAGCUTCUAGAGGUUUGUGGGA	615	4440-4462
AD-1136214.1	ACAAACCUCUAGAAGCUUAAU	257	4444-4464	AUUAAGCUUCUAGAGGUUUGUGG	616	4442-4464
AD-1136215.1	AAACCUCUAGAAGCUUAAACU	258	4446-4466	AGUUUAAGCUUCUAGAGGUUUGU	617	4444-4466
AD-1136216.1	AACCUCUAGAAGCUUAAACCU	259	4447-4467	AGGUUUAAGCUUCUAGAGGUUUG	618	4445-4467
AD-1136217.1	UGGCCUUCAAACCAAUGAACU	260	4504-4524	AGUUCAUUGGUUUGAAGGCCAGG	619	4502-4524
AD-1136218.1	GGCCUUCAAACCAAUGAACAU	261	4505-4525	AUGUTCAUUGGUUUGAAGGCCAG	620	4503-4525
AD-1136219.1	GCCUUCAAACCAAUGAACAGU	262	4506-4526	ACUGUUCAUUGGUUUGAAGGCCA	621	4504-4526
AD-1136220.1	UCAAACCAAUGAACAGCAAAU	263	4510-4530	AUUUGCTGUUCAUUGGUUUGAAG	622	4508-4530
AD-1136221.1	GAACAGCAAAGCAUAACCUUU	264	4520-4540	AAAGGUUAUGCUUUGCUGUUCAU	623	4518-4540
AD-1136222.1	AACAGCAAAGCAUAACCUUGU	265	4521-4541	ACAAGGTUAUGCUUUGCUGUUCA	624	4519-4541
AD-1136223.1	AGCAAAGCAUAACCUUGAAUU	266	4524-4544	AAUUCAAGGUUAUGCUUUGCUGU	625	4522-4544
AD-1136224.1	GCAAAGCAUAACCUUGAAUCU	267	4525-4545	AGAUTCAAGGUUAUGCUUUGCUG	626	4523-4545
AD-1136225.1	CAAAGCAUAACCUUGAAUCUU	268	4526-4546	AAGATUCAAGGUUAUGCUUUGCU	627	4524-4546
AD-1136226.1	GCAUAACCUUGAAUCUAUACU	269	4530-4550	AGUAUAGAUUCAAGGUUAUGCUU	628	4528-4550
AD-1136227.1	CAUAACCUUGAAUCUAUACUU	270	4531-4551	AAGUAUAGAUUCAAGGUUAUGCU	629	4529-4551
AD-1136228.1	AUAACCUUGAAUCUAUACUCU	271	4532-4552	AGAGUAUAGAUUCAAGGUUAUGC	630	4530-4552
AD-1136229.1	UAACCUUGAAUCUAUACUCAU	272	4533-4553	AUGAGUAUAGAUUCAAGGUUAUG	631	4531-4553
AD-1136230.1	AACCUUGAAUCUAUACUCAAU	273	4534-4554	AUUGAGTAUAGAUUCAAGGUUAU	632	4532-4554
AD-1136231.1	ACCUUGAAUCUAUACUCAAAU	274	4535-4555	AUUUGAGUAUAGAUUCAAGGUUA	633	4533-4555
AD-1136232.1	CCUUGAAUCUAUACUCAAAUU	275	4536-4556	AAUUTGAGUAUAGAUUCAAGGUU	634	4534-4556
AD-1136233.1	AAUCUAUACUCAAAUUUUGCU	276	4541-4561	AGCAAAAUUUGAGUAUAGAUUCA	635	4539-4561
AD-1136234.1	AUCUAUACUCAAAUUUUGCAU	277	4542-4562	AUGCAAAAUUUGAGUAUAGAUUC	636	4540-4562
AD-1136235.1	GGUUAAAUCCUCUAACCAUCU	278	4579-4599	AGAUGGTUAGAGGAUUUAACCUU	637	4577-4599
AD-1136236.1	UAAAUCCUCUAACCAUCUUUU	279	4582-4602	AAAAGATGGUUAGAGGAUUUAAC	638	4580-4602
AD-1136237.1	AAAUCCUCUAACCAUCUUUGU	280	4583-4603	ACAAAGAUGGUUAGAGGAUUUAA	639	4581-4603
AD-1136238.1	AAUCCUCUAACCAUCUUUGAU	281	4584-4604	AUCAAAGAUGGUUAGAGGAUUUA	640	4582-4604
AD-1136239.1	AUCCUCUAACCAUCUUUGAAU	282	4585-4605	AUUCAAAGAUGGUUAGAGGAUUU	641	4583-4605
AD-1136240.1	UCCUCUAACCAUCUUUGAAUU	283	4586-4606	AAUUCAAAGAUGGUUAGAGGAUU	642	4584-4606
AD-1136241.1	CCUCUAACCAUCUUUGAAUCU	284	4587-4607	AGAUTCAAAGAUGGUUAGAGGAU	643	4585-4607
AD-1136242.1	CUCUAACCAUCUUUGAAUCAU	285	4588-4608	AUGATUCAAAGAUGGUUAGAGGA	644	4586-4608
AD-1136243.1	UCUAACCAUCUUUGAAUCAUU	286	4589-4609	AAUGAUUCAAAGAUGGUUAGAGG	645	4587-4609
AD-1136244.1	CUAACCAUCUUUGAAUCAUUU	287	4590-4610	AAAUGATUCAAAGAUGGUUAGAG	646	4588-4610
AD-1136245.1	UAACCAUCUUUGAAUCAUUGU	288	4591-4611	ACAATGAUUCAAAGAUGGUUAGA	647	4589-4611
AD-1136246.1	AACCAUCUUUGAAUCAUUGGU	289	4592-4612	ACCAAUGAUUCAAAGAUGGUUAG	648	4590-4612
AD-1136247.1	CCAUCUUUGAAUCAUUGGAAU	290	4594-4614	AUUCCAAUGAUUCAAAGAUGGUU	649	4592-4614
AD-1136248.1	CAUCUUUGAAUCAUUGGAAAU	291	4595-4615	AUUUCCAAUGAUUCAAAGAUGGU	650	4593-4615
AD-1136249.1	AUCUUUGAAUCAUUGGAAAGU	292	4596-4616	ACUUTCCAAUGAUUCAAAGAUGG	651	4594-4616
AD-1136250.1	CUUUGAAUCAUUGGAAAGAAU	293	4598-4618	AUUCTUTCCAAUGAUUCAAAGAU	652	4596-4618
AD-1136251.1	GAAAGAAUAAAGAAUGAAACU	294	4611-4631	AGUUTCAUUCUUUAUUCUUUCCA	653	4609-4631
AD-1136252.1	AAAGAAUAAAGAAUGAAACAU	295	4612-4632	AUGUTUCAUUCUUUAUUCUUUCC	654	4610-4632
AD-1136253.1	GAAUGAAACAAAUUCAAGGUU	296	4622-4642	AACCUUGAAUUUGUUUCAUUCUU	655	4620-4642
AD-1136254.1	AUGAAACAAAUUCAAGGUUAU	297	4624-4644	AUAACCTUGAAUUUGUUUCAUUC	656	4622-4644
AD-1136255.1	AACAAAUUCAAGGUUAAUUGU	298	4628-4648	ACAAUUAACCUUGAAUUUGUUUC	657	4626-4648
AD-1136256.1	UGAAGCUGCAUAAAGCAAGAU	299	4660-4680	AUCUTGCUUUAUGCAGCUUCACA	658	4658-4680
AD-1136257.1	AAGCUGCAUAAAGCAAGAUUU	300	4662-4682	AAAUCUTGCUUUAUGCAGCUUCA	659	4660-4682
AD-1136258.1	AGCUGCAUAAAGCAAGAUUAU	301	4663-4683	AUAATCTUGCUUUAUGCAGCUUC	660	4661-4683
AD-1136259.1	GCUGCAUAAAGCAAGAUUACU	302	4664-4684	AGUAAUCUUGCUUUAUGCAGCUU	661	4662-4684
AD-1136260.1	CUGCAUAAAGCAAGAUUACUU	303	4665-4685	AAGUAAUCUUGCUUUAUGCAGCU	662	4663-4685
AD-1136261.1	UGCAUAAAGCAAGAUUACUCU	304	4666-4686	AGAGUAAUCUUGCUUUAUGCAGC	663	4664-4686
AD-1136262.1	CAUAAAGCAAGAUUACUCUAU	305	4668-4688	AUAGAGTAAUCUUGCUUUAUGCA	664	4666-4688
AD-1136263.1	UAAAGCAAGAUUACUCUAUAU	306	4670-4690	AUAUAGAGUAAUCUUGCUUUAUG	665	4668-4690
AD-1136264.1	AUACAAAAAUCCAACCAACUU	307	4690-4710	AAGUTGGUUGGAUUUUUGUAUUA	666	4688-4710
AD-1136265.1	UACAAAAAUCCAACCAACUCU	308	4691-4711	AGAGTUGGUUGGAUUUUUGUAUU	667	4689-4711
AD-1136266.1	ACAAAAAUCCAACCAACUCAU	309	4692-4712	AUGAGUTGGUUGGAUUUUUGUAU	668	4690-4712
AD-1136267.1	CAAAAAUCCAACCAACUCAAU	310	4693-4713	AUUGAGTUGGUUGGAUUUUUGUA	669	4691-4713
AD-1136268.1	AAAAAUCCAACCAACUCAAUU	311	4694-4714	AAUUGAGUUGGUUGGAUUUUUGU	670	4692-4714
AD-1136269.1	AAAAUCCAACCAACUCAAUUU	312	4695-4715	AAAUTGAGUUGGUUGGAUUUUUG	671	4693-4715
AD-1136270.1	AAAUCCAACCAACUCAAUUAU	313	4696-4716	AUAATUGAGUUGGUUGGAUUUUU	672	4694-4716
AD-1136271.1	AAUCCAACCAACUCAAUUAUU	314	4697-4717	AAUAAUUGAGUUGGUUGGAUUUU	673	4695-4717
AD-1136272.1	AUCCAACCAACUCAAUUAUUU	315	4698-4718	AAAUAAUUGAGUUGGUUGGAUUU	674	4696-4718
AD-1136273.1	UCCAACCAACUCAAUUAUUGU	316	4699-4719	ACAAUAAUUGAGUUGGUUGGAUU	675	4697-4719
AD-1136274.1	CCAACCAACUCAAUUAUUGAU	317	4700-4720	AUCAAUAAUUGAGUUGGUUGGAU	676	4698-4720
AD-1136275.1	CAACCAACUCAAUUAUUGAGU	318	4701-4721	ACUCAAUAAUUGAGUUGGUUGGA	677	4699-4721
AD-1136276.1	AACCAACUCAAUUAUUGAGCU	319	4702-4722	AGCUCAAUAAUUGAGUUGGUUGG	678	4700-4722
AD-1136277.1	ACCAACUCAAUUAUUGAGCAU	320	4703-4723	AUGCTCAAUAAUUGAGUUGGUUG	679	4701-4723
AD-1136278.1	CCAACUCAAUUAUUGAGCACU	321	4704-4724	AGUGCUCAAUAAUUGAGUUGGUU	680	4702-4724
AD-1136279.1	CGUACAAUGUUCUAGAUUUCU	322	4723-4743	AGAAAUCUAGAACAUUGUACGUG	681	4721-4743
AD-1136280.1	GUACAAUGUUCUAGAUUUCUU	323	4724-4744	AAGAAAUCUAGAACAUUGUACGU	682	4722-4744
AD-1136281.1	UACAAUGUUCUAGAUUUCUUU	324	4725-4745	AAAGAAAUCUAGAACAUUGUACG	683	4723-4745
AD-1136282.1	ACAAUGUUCUAGAUUUCUUUU	325	4726-4746	AAAAGAAAUCUAGAACAUUGUAC	684	4724-4746
AD-1136283.1	CAAUGUUCUAGAUUUCUUUCU	326	4727-4747	AGAAAGAAAUCUAGAACAUUGUA	685	4725-4747
AD-1136284.1	AAUGUUCUAGAUUUCUUUCCU	327	4728-4748	AGGAAAGAAAUCUAGAACAUUGU	686	4726-4748
AD-1136285.1	GUUCUAGAUUUCUUUCCCUUU	328	4731-4751	AAAGGGAAAGAAAUCUAGAACAU	687	4729-4751
AD-1136286.1	UUCUAGAUUUCUUUCCCUUCU	329	4732-4752	AGAAGGGAAAGAAAUCUAGAACA	688	4730-4752
AD-1136287.1	UCUUUACAUUUGAAGCCAAAU	330	4817-4837	AUUUGGCUUCAAAUGUAAAGAUU	689	4815-4837
AD-1136288.1	CUUUACAUUUGAAGCCAAAGU	331	4818-4838	ACUUTGGCUUCAAAUGUAAAGAU	690	4816-4838
AD-1136289.1	UUUACAUUUGAAGCCAAAGUU	332	4819-4839	AACUTUGGCUUCAAAUGUAAAGA	691	4817-4839
AD-1136290.1	ACAUUUGAAGCCAAAGUAAUU	333	4822-4842	AAUUACTUUGGCUUCAAAUGUAA	692	4820-4842
AD-1136291.1	AUUUGAAGCCAAAGUAAUUUU	334	4824-4844	AAAAUUACUUUGGCUUCAAAUGU	693	4822-4844
AD-1136292.1	GAAGCCAAAGUAAUUUCCACU	335	4828-4848	AGUGGAAAUUACUUUGGCUUCAA	694	4826-4848
AD-1136293.1	AAGCCAAAGUAAUUUCCACCU	336	4829-4849	AGGUGGAAAUUACUUUGGCUUCA	695	4827-4849
AD-1136294.1	CCAAAGUAAUUUCCACCUAGU	337	4832-4852	ACUAGGTGGAAAUUACUUUGGCU	696	4830-4852
AD-1136295.1	CAAAGUAAUUUCCACCUAGAU	338	4833-4853	AUCUAGGUGGAAAUUACUUUGGC	697	4831-4853
AD-1136296.1	AAAGUAAUUUCCACCUAGAAU	339	4834-4854	AUUCTAGGUGGAAAUUACUUUGG	698	4832-4854
AD-1136297.1	GCAAGAUCUUGUCUCUGAAGU	340	5134-5154	ACUUCAGAGACAAGAUCUUGCUC	699	5132-5154
AD-1136298.1	AGGUAGAAGAGCCAAGAAGCU	341	5201-5221	AGCUTCTUGGCUCUUCUACCUCU	700	5199-5221
AD-1136299.1	CUAGCUCUGUCUCUUCUGUCU	342	5234-5254	AGACAGAAGAGACAGAGCUAGGA	701	5232-5254
AD-1136300.1	UAGCUCUGUCUCUUCUGUCUU	343	5235-5255	AAGACAGAAGAGACAGAGCUAGG	702	5233-5255
AD-1136301.1	AGCUCUGUCUCUUCUGUCUCU	344	5236-5256	AGAGACAGAAGAGACAGAGCUAG	703	5234-5256
AD-1136302.1	AUCUUUGUGAUCUUGGACUGU	345	5257-5277	ACAGUCCAAGAUCACAAAGAUAG	704	5255-5277
AD-1136303.1	CUUCCUGUGAUCCAUUUUACU	346	5286-5306	AGUAAAAUGGAUCACAGGAAGGG	705	5284-5306
AD-1136304.1	UUCCUGUGAUCCAUUUUACUU	347	5287-5307	AAGUAAAAUGGAUCACAGGAAGG	706	5285-5307
AD-1136305.1	UCCUGUGAUCCAUUUUACUGU	348	5288-5308	ACAGUAAAAUGGAUCACAGGAAG	707	5286-5308
AD-1136306.1	CCUGUGAUCCAUUUUACUGCU	349	5289-5309	AGCAGUAAAAUGGAUCACAGGAA	708	5287-5309
AD-1136307.1	CUGUGAUCCAUUUUACUGCAU	350	5290-5310	AUGCAGTAAAAUGGAUCACAGGA	709	5288-5310
AD-1136308.1	CUAUAAAUAUAUGACCUGAAU	351	5360-5380	AUUCAGGUCAUAUAUUUAUAGGC	710	5358-5380
AD-1136309.1	UGACCUGAAAACUCCAGUUAU	352	5371-5391	AUAACUGGAGUUUUCAGGUCAUA	711	5369-5391
AD-1136310.1	GACCUGAAAACUCCAGUUACU	353	5372-5392	AGUAACTGGAGUUUUCAGGUCAU	712	5370-5392
AD-1136311.1	AAGGAUCUGCAGCUAUCUAAU	354	5395-5415	AUUAGATAGCUGCAGAUCCUUUA	713	5393-5415
AD-1136312.1	AGGAUCUGCAGCUAUCUAAGU	355	5396-5416	ACUUAGAUAGCUGCAGAUCCUUU	714	5394-5416
AD-1136313.1	GCUAUCUAAGGCUUGGUUUUU	356	5406-5426	AAAAACCAAGCCUUAGAUAGCUG	715	5404-5426
AD-1136314.1	CUAUCUAAGGCUUGGUUUUCU	357	5407-5427	AGAAAACCAAGCCUUAGAUAGCU	716	5405-5427
AD-1136315.1	AUCUAAGGCUUGGUUUUCUUU	358	5409-5429	AAAGAAAACCAAGCCUUAGAUAG	717	5407-5429
AD-1136316.1	UCUAAGGCUUGGUUUUCUUAU	359	5410-5430	AUAAGAAAACCAAGCCUUAGAUA	718	5408-5430
AD-1136317.1	CUAAGGCUUGGUUUUCUUACU	360	5411-5431	AGUAAGAAAACCAAGCCUUAGAU	719	5409-5431
AD-1136318.1	UAAGGCUUGGUUUUCUUACUU	361	5412-5432	AAGUAAGAAAACCAAGCCUUAGA	720	5410-5432
AD-1136319.1	GGCUUGGUUUUCUUACUGUCU	362	5415-5435	AGACAGTAAGAAAACCAAGCCUU	721	5413-5435
AD-1136320.1	GCUUGGUUUUCUUACUGUCAU	363	5416-5436	AUGACAGUAAGAAAACCAAGCCU	722	5414-5436
AD-1136321.1	CUUGGUUUUCUUACUGUCAUU	364	5417-5437	AAUGACAGUAAGAAAACCAAGCC	723	5415-5437
AD-1136322.1	UUGGUUUUCUUACUGUCAUAU	365	5418-5438	AUAUGACAGUAAGAAAACCAAGC	724	5416-5438
AD-1136323.1	UGGUUUUCUUACUGUCAUAUU	366	5419-5439	AAUATGACAGUAAGAAAACCAAG	725	5417-5439
AD-1136324.1	GGUUUUCUUACUGUCAUAUGU	367	5420-5440	ACAUAUGACAGUAAGAAAACCAA	726	5418-5440
AD-1136325.1	UUUUCUUACUGUCAUAUGAUU	368	5422-5442	AAUCAUAUGACAGUAAGAAAACC	727	5420-5442
AD-1136326.1	UUUCUUACUGUCAUAUGAUAU	369	5423-5443	AUAUCAUAUGACAGUAAGAAAAC	728	5421-5443
AD-1136327.1	UCUUACUGUCAUAUGAUACCU	370	5425-5445	AGGUAUCAUAUGACAGUAAGAAA	729	5423-5445
AD-1136328.1	CUUACUGUCAUAUGAUACCUU	371	5426-5446	AAGGUAUCAUAUGACAGUAAGAA	730	5424-5446
AD-1136329.1	UCUGCGGUUGGUAAAGAGAAU	372	5481-5501	AUUCTCTUUACCAACCGCAGAAA	731	5479-5501
AD-1136330.1	UGGUGAUUUAAUCCCUACAUU	373	5537-5557	AAUGTAGGGAUUAAAUCACCAUU	732	5535-5557
AD-1136331.1	GGUGAUUUAAUCCCUACAUGU	374	5538-5558	ACAUGUAGGGAUUAAAUCACCAU	733	5536-5558
AD-1136332.1	UGUAUAAAUCCAACCUUCUGU	375	5597-5617	ACAGAAGGUUGGAUUUAUACAGU	734	5595-5617
AD-1136333.1	GUGCUUGAUGUCACUAAUAAU	376	5679-5699	AUUATUAGUGACAUCAAGCACCA	735	5677-5699
AD-1136334.1	UGCUUGAUGUCACUAAUAAAU	377	5680-5700	AUUUAUUAGUGACAUCAAGCACC	736	5678-5700
AD-1136335.1	GCUUGAUGUCACUAAUAAAUU	378	5681-5701	AAUUUAUUAGUGACAUCAAGCAC	737	5679-5701
AD-1136336.1	AUGUCACUAAUAAAUGAAACU	379	5686-5706	AGUUTCAUUUAUUAGUGACAUCA	738	5684-5706
AD-1136337.1	UGUCACUAAUAAAUGAAACUU	380	5687-5707	AAGUTUCAUUUAUUAGUGACAUC	739	5685-5707
AD-1136338.1	UAAUAAAUGAAACUGUCAGCU	381	5693-5713	AGCUGACAGUUUCAUUUAUUAGU	740	5691-5713

[0750]

TABLE 3
Modified Sense and Antisense Strand Sequences of Xanthine Dehydrogenase dsRNA Agents
		SEQ		SEQ		SEQ
Duplex		ID		ID		ID
Name	Sense Sequence 5′ to 3′	NO:	Antisense Sequence 5′ to 3′	NO:	mRNA Target Sequence	NO:
AD-	usasccugCfcAfGfUfgucucuua	741	asCfsuaaGfagacacuGfgCfagguasgs	1100	ACUACCUGCCAGUGUCUCUUA	1459
1135979.1	guL96		u		GG
AD-	ascscugcCfaGfUfGfucucuuag	742	asCfscuaAfgagacacUfgGfcaggusas	1101	CUACCUGCCAGUGUCUCUUAG	1460
1135980.1	guL96		g		GA
AD-	cscsugccAfgUfGfUfcucuuagg	743	asUfsccuAfagagacaCfuGfgcaggsus	1102	UACCUGCCAGUGUCUCUUAGG	1461
1135981.1	auL96		a		AG
AD-	usgsccagUfgUfCfUfcuuaggag	744	asAfscucCfuaagagaCfaCfuggcasgs	1103	CCUGCCAGUGUCUCUUAGGAG	1462
1135982.1	uuL96		g		UG
AD-	gscscaguGfuCfUfCfuuaggagu	745	asCfsacdTc(C2p)uaagagAfcAfcugg	1104	CUGCCAGUGUCUCUUAGGAGU	1463
1135983.1	guL96		csasg		GA
AD-	cscsagugUfcUfCfUfuaggagug	746	asUfscadCu(C2p)cuaagaGfaCfacug	1105	UGCCAGUGUCUCUUAGGAGUG	1464
1135984.1	auL96		gscsa		AG
AD-	csasguguCfuCfUfUfaggaguga	747	asCfsucaCfuccuaagAfgAfcacugsgs	1106	GCCAGUGUCUCUUAGGAGUGA	1465
1135985.1	guL96		c		GG
AD-	asgsugucUfcUfUfAfggaguga	748	asCfscucAfcuccuaaGfaGfacacusgs	1107	CCAGUGUCUCUUAGGAGUGAG	1466
1135986.1	gguL96		g		GU
AD-	usgsgagaAfaAfAfUfgcagaucc	749	asUfsggdAu(C2p)ugcauuUfuUfcuc	1108	GGUGGAGAAAAAUGCAGAUC	1467
1135987.1	auL96		cascsc		CAG
AD-	cscsagagAfcAfAfCfccuuuugg	750	asGfsccaAfaaggguuGfuCfucuggsas	1109	AUCCAGAGACAACCCUUUUGG	1468
1135988.1	cuL96		u		CC
AD-	asgsagacAfaCfCfCfuuuuggcc	751	asAfsggdCc(Agn)aaagggUfuGfucu	1110	CCAGAGACAACCCUUUUGGCC	1469
1135989.1	uuL96		cusgsg		UA
AD-	gscsacagUfgAfUfGfcucuccaa	752	asCfsuudGg(Agn)gagcauCfaCfugu	1111	UUGCACAGUGAUGCUCUCCAA	1470
1135990.1	guL96		gcsasa		GU
AD-	csascaguGfaUfGfCfucuccaag	753	asAfscudTg(G2p)agagcaUfcAfcug	1112	UGCACAGUGAUGCUCUCCAAG	1471
1135991.1	uuL96		ugscsa		UA
AD-	gsasugcuCfuCfCfAfaguaugau	754	asGfsaucAfuacuuggAfgAfgcaucsas	1113	GUGAUGCUCUCCAAGUAUGAU	1472
1135992.1	cuL96		c		CG
AD-	asusgcucUfcCfAfAfguaugauc	755	asCfsgauCfauacuugGfaGfagcauscs	1114	UGAUGCUCUCCAAGUAUGAUC	1473
1135993.1	guL96		a		GU
AD-	usgscucuCfcAfAfGfuaugaucg	756	asAfscgaUfcauacuuGfgAfgagcasus	1115	GAUGCUCUCCAAGUAUGAUCG	1474
1135994.1	uuL96		c		UC
AD-	gscsucucCfaAfGfUfaugaucgu	757	asGfsacgAfucauacuUfgGfagagcsas	1116	AUGCUCUCCAAGUAUGAUCGU	1475
1135995.1	cuL96		u		CU
AD-	csuscuccAfaGfUfAfugaucguc	758	asAfsgacGfaucauacUfuGfgagagscs	1117	UGCUCUCCAAGUAUGAUCGUC	1476
1135996.1	uuL96		a		UG
AD-	gsasucguCfuGfCfAfgaacaaga	759	asAfsucdTu(G2p)uucugcAfgAfcga	1118	AUGAUCGUCUGCAGAACAAGA	1477
1135997.1	uuL96		ucsasu		UC
AD-	csgsucugCfaGfAfAfcaagaucg	760	asAfscgaUfcuuguucUfgCfagacgsas	1119	AUCGUCUGCAGAACAAGAUCG	1478
1135998.1	uuL96		u		UC
AD-	gsuscugcAfgAfAfCfaagaucgu	761	asGfsacgAfucuuguuCfuGfcagacsgs	1120	UCGUCUGCAGAACAAGAUCGU	1479
1135999.1	cuL96		a		CC
AD-	uscsugcaGfaAfCfAfagaucguc	762	asGfsgacGfaucuuguUfcUfgcagascs	1121	CGUCUGCAGAACAAGAUCGUC	1480
1136000.1	cuL96		g		CA
AD-	gscsagaaCfaAfGfAfucguccac	763	asAfsgudGg(Agn)cgaucuUfgUfucu	1122	CUGCAGAACAAGAUCGUCCAC	1481
1136001.1	uuL96		gcsasg		UU
AD-	csasgaacAfaGfAfUfcguccacu	764	asAfsagdTg(G2p)acgaucUfuGfuuc	1123	UGCAGAACAAGAUCGUCCACU	1482
1136002.1	uuL96		ugscsa		UU
AD-	gsasacaaGfaUfCfGfuccacuuu	765	asAfsaadAg(Tgn)ggacgaUfcUfugu	1124	CAGAACAAGAUCGUCCACUUU	1483
1136003.1	uuL96		ucsusg		UC
AD-	asascaagAfuCfGfUfccacuuuu	766	asGfsaaaAfguggacgAfuCfuuguuscs	1125	AGAACAAGAUCGUCCACUUUU	1484
1136004.1	cuL96		u		CU
AD-	ascsaagaUfcGfUfCfcacuuuuc	767	asAfsgaaAfaguggacGfaUfcuugusus	1126	GAACAAGAUCGUCCACUUUUC	1485
1136005.1	uuL96		c		UG
AD-	csasagauCfgUfCfCfacuuuucu	768	asCfsagaAfaaguggaCfgAfucuugsus	1127	AACAAGAUCGUCCACUUUUCU	1486
1136006.1	guL96		u		GC
AD-	asasgaucGfuCfCfAfcuuuucug	769	asGfscagAfaaaguggAfcGfaucuusgs	1128	ACAAGAUCGUCCACUUUUCUG	1487
1136007.1	cuL96		u		CC
AD-	csgsuccaCfuUfUfUfcugccaau	770	asCfsaudTg(G2p)cagaaaAfgUfggac	1129	AUCGUCCACUUUUCUGCCAAU	1488
1136008.1	guL96		gsasu		GC
AD-	gsusccacUfuUfUfCfugccaaug	771	asGfscadTu(G2p)gcagaaAfaGfugg	1130	UCGUCCACUUUUCUGCCAAUG	1489
1136009.1	cuL96		acsgsa		CC
AD-	usgscuccUfuGfCfAfccauguug	772	asGfscaaCfauggugcAfaGfgagcasgs	1131	UCUGCUCCUUGCACCAUGUUG	1490
1136010.1	cuL96		a		CA
AD-	uscscuugCfaCfCfAfuguugcag	773	asAfscudGc(Agn)acauggUfgCfaag	1132	GCUCCUUGCACCAUGUUGCAG	1491
1136011.1	uuL96		gasgsc		UG
AD-	ususgcacCfaUfGfUfugcaguga	774	asGfsucdAc(Tgn)gcaacaUfgGfugca	1133	CCUUGCACCAUGUUGCAGUGA	1492
1136012.1	cuL96		asgsg		CA
AD-	csasccauGfuUfGfCfagugacaa	775	asGfsuudGu(C2p)acugcaAfcAfugg	1134	UGCACCAUGUUGCAGUGACAA	1493
1136013.1	cuL96		ugscsa		CU
AD-	ascscaugUfuGfCfAfgugacaac	776	asAfsgudTg(Tgn)cacugcAfaCfaugg	1135	GCACCAUGUUGCAGUGACAAC	1494
1136014.1	uuL96		usgsc		UG
AD-	asgsgagaGfaAfUfUfgccaaaag	777	asGfscudTu(Tgn)ggcaauUfcUfcucc	1136	GCAGGAGAGAAUUGCCAAAA	1495
1136015.1	cuL96		usgsc		GCC
AD-	gsgsagagAfaUfUfGfccaaaagc	778	asGfsgcdTu(Tgn)uggcaaUfuCfucuc	1137	CAGGAGAGAAUUGCCAAAAGC	1496
1136016.1	cuL96		csusg		CA
AD-	usgsgcauCfgUfCfAfugaguau	779	asAfscauAfcucaugaCfgAfugccasgs	1138	CCUGGCAUCGUCAUGAGUAUG	1497
1136017.1	guuL96		g		UA
AD-	gsgscaucGfuCfAfUfgaguaug	780	asUfsacdAu(Agn)cucaugAfcGfaug	1139	CUGGCAUCGUCAUGAGUAUGU	1498
1136018.1	uauL96		ccsasg		AC
AD-	gscsaucgUfcAfUfGfaguaugua	781	asGfsuacAfuacucauGfaCfgaugcscs	1140	UGGCAUCGUCAUGAGUAUGU	1499
1136019.1	cuL96		a		ACA
AD-	csasucguCfaUfGfAfguauguac	782	asUfsgudAc(Agn)uacucaUfgAfcga	1141	GGCAUCGUCAUGAGUAUGUAC	1500
1136020.1	auL96		ugscsc		AC
AD-	asuscgucAfuGfAfGfuauguaca	783	asGfsugdTa(C2p)auacucAfuGfacga	1142	GCAUCGUCAUGAGUAUGUACA	1501
1136021.1	cuL96		usgsc		CA
AD-	csgsucauGfaGfUfAfuguacaca	784	asGfsugdTg(Tgn)acauacUfcAfugac	1143	AUCGUCAUGAGUAUGUACACA	1502
1136022.1	cuL96		gsasu		CU
AD-	gsuscaugAfgUfAfUfguacacac	785	asAfsgudGu(G2p)uacauaCfuCfaug	1144	UCGUCAUGAGUAUGUACACAC	1503
1136023.1	uuL96		acsgsa		UG
AD-	uscsaugaGfuAfUfGfuacacacu	786	asCfsagdTg(Tgn)guacauAfcUfcaug	1145	CGUCAUGAGUAUGUACACACU	1504
1136024.1	guL96		ascsg		GC
AD-	asasugccUfuCfCfAfaggaaauc	787	asAfsgadTu(Tgn)ccuuggAfaGfgca	1146	AGAAUGCCUUCCAAGGAAAUC	1505
1136025.1	uuL96		uuscsu		UG
AD-	asusgccuUfcCfAfAfggaaaucu	788	asCfsagaUfuuccuugGfaAfggcausus	1147	GAAUGCCUUCCAAGGAAAUCU	1506
1136026.1	guL96		c		GU
AD-	usgsccuuCfcAfAfGfgaaaucug	789	asAfscagAfuuuccuuGfgAfaggcasus	1148	AAUGCCUUCCAAGGAAAUCUG	1507
1136027.1	uuL96		u		UG
AD-	gscscuucCfaAfGfGfaaaucugu	790	asCfsacaGfauuuccuUfgGfaaggcsas	1149	AUGCCUUCCAAGGAAAUCUGU	1508
1136028.1	guL96		u		GC
AD-	cscsuuccAfaGfGfAfaaucugug	791	asGfscacAfgauuuccUfuGfgaaggscs	1150	UGCCUUCCAAGGAAAUCUGUG	1509
1136029.1	cuL96		a		CC
AD-	gsasgaugAfaGfUfUfcaagaaua	792	asAfsuadTu(C2p)uugaacUfuCfauc	1151	UUGAGAUGAAGUUCAAGAAU	1510
1136030.1	uuL96		ucsasa		AUG
AD-	gsasugaaGfuUfCfAfagaauaug	793	asGfscauAfuucuugaAfcUfucaucsus	1152	GAGAUGAAGUUCAAGAAUAU	1511
1136031.1	cuL96		c		GCU
AD-	asasguucAfaGfAfAfuaugcug	794	asAfsacdAg(C2p)auauucUfuGfaac	1153	UGAAGUUCAAGAAUAUGCUG	1512
1136032.1	uuuL96		uuscsa		UUU
AD-	asgsuucaAfgAfAfUfaugcugu	795	asAfsaadCa(G2p)cauauuCfuUfgaac	1154	GAAGUUCAAGAAUAUGCUGU	1513
1136033.1	uuuL96		ususc		UUC
AD-	gsusucaaGfaAfUfAfugcuguu	796	asGfsaadAc(Agn)gcauauUfcUfuga	1155	AAGUUCAAGAAUAUGCUGUU	1514
1136034.1	ucuL96		acsusu		UCC
AD-	ususcaagAfaUfAfUfgcuguuu	797	asGfsgaaAfcagcauaUfuCfuugaascs	1156	AGUUCAAGAAUAUGCUGUUU	1515
1136035.1	ccuL96		u		CCU
AD-	asasgaauAfuGfCfUfguuuccua	798	asAfsuadGg(Agn)aacagcAfuAfuuc	1157	UCAAGAAUAUGCUGUUUCCUA	1516
1136036.1	uuL96		uusgsa		UG
AD-	gsgsgaguAfuUfUfCfucagcau	799	asGfsaadTg(C2p)ugagaaAfuAfcucc	1158	GGGGGAGUAUUUCUCAGCAU	1517
1136037.1	ucuL96		cscsc		UCA
AD-	gsgsaguaUfuUfCfUfcagcauuc	800	asUfsgadAu(G2p)cugagaAfaUfacu	1159	GGGGAGUAUUUCUCAGCAUUC	1518
1136038.1	auL96		ccscsc		AA
AD-	gsasguauUfuCfUfCfagcauuca	801	asUfsugaAfugcugagAfaAfuacucscs	1160	GGGAGUAUUUCUCAGCAUUCA	1519
1136039.1	auL96		c		AG
AD-	asgsuauuUfcUfCfAfgcauucaa	802	asCfsuugAfaugcugaGfaAfauacuscs	1161	GGAGUAUUUCUCAGCAUUCAA	1520
1136040.1	guL96		c		GC
AD-	gsusauuuCfuCfAfGfcauucaag	803	asGfscudTg(Agn)augcugAfgAfaau	1162	GAGUAUUUCUCAGCAUUCAAG	1521
1136041.1	cuL96		acsusc		CA
AD-	gsusggcaUfgAfGfAfguuuuau	804	asGfsaauAfaaacucuCfaUfgccacsus	1163	CAGUGGCAUGAGAGUUUUAU	1522
1136042.1	ucuL96		g		UCA
AD-	gsgscaugAfgAfGfUfuuuauuc	805	asUfsugaAfuaaaacuCfuCfaugccsas	1164	GUGGCAUGAGAGUUUUAUUC	1523
1136043.1	aauL96		c		AAG
AD-	csasugagAfgUfUfUfuauucaag	806	asGfscudTg(Agn)auaaaaCfuCfucau	1165	GGCAUGAGAGUUUUAUUCAA	1524
1136044.1	cuL96		gscsc		GCC
AD-	cscsucacCfcUfCfAfgcuucuuc	807	asAfsgaaGfaagcugaGfgGfugaggsgs	1166	ACCCUCACCCUCAGCUUCUUC	1525
1136045.1	uuL96		u		UU
AD-	uscsacccUfcAfGfCfuucuucuu	808	asGfsaadGa(Agn)gaagcuGfaGfggu	1167	CCUCACCCUCAGCUUCUUCUU	1526
1136046.1	cuL96		gasgsg		CA
AD-	uscsuucaAfgUfUfCfuaccugac	809	asUfsgudCa(G2p)guagaaCfuUfgaa	1168	CUUCUUCAAGUUCUACCUGAC	1527
1136047.1	auL96		gasasg		AG
AD-	ususucgcCfaGfUfGfcaacuuua	810	asGfsuaaAfguugcacUfgGfcgaaasgs	1169	ACUUUCGCCAGUGCAACUUUA	1528
1136048.1	cuL96		u		CU
AD-	ususcgccAfgUfGfCfaacuuuac	811	asAfsguaAfaguugcaCfuGfgcgaasas	1170	CUUUCGCCAGUGCAACUUUAC	1529
1136049.1	uuL96		g		UG
AD-	ususccagGfgUfUfUfguuuguu	812	asGfsaaaCfaaacaaaCfcCfuggaascsc	1171	GGUUCCAGGGUUUGUUUGUU	1530
1136050.1	ucuL96				UCA
AD-1	csasggguUfuGfUfUfuguuuca	813	asAfsaugAfaacaaacAfaAfcccugsgs	1172	UCCAGGGUUUGUUUGUUUCA	1531
136051.1	uuuL96		a		UUU
AD-	gsgsguuuGfuUfUfGfuuucauu	814	asGfsaaaUfgaaacaaAfcAfaacccsusg	1173	CAGGGUUUGUUUGUUUCAUU	1532
1136052.1	ucuL96				UCC
AD-	gsgsuuugUfuUfGfUfuucauuu	815	asGfsgaaAfugaaacaAfaCfaaaccscsu	1174	AGGGUUUGUUUGUUUCAUUU	1533
1136053.1	ccuL96				CCG
AD-	ususguuuGfuUfUfCfauuuccg	816	asAfsgcgGfaaaugaaAfcAfaacaasas	1175	GUUUGUUUGUUUCAUUUCCGC	1534
1136054.1	cuuL96		c		UG
AD-	ususccugGfgAfGfUfaacauaac	817	asAfsguuAfuguuacuCfcCfaggaascs	1176	UGUUCCUGGGAGUAACAUAAC	1535
1136055.1	uuL96		a		UG
AD-	gsgsgaguAfaCfAfUfaacuggaa	818	asAfsuudCc(Agn)guuaugUfuAfcuc	1177	CUGGGAGUAACAUAACUGGA	1536
1136056.1	uuL96		ccsasg		AUU
AD-	usasacauAfaCfUfGfgaauuugu	819	asUfsacaAfauuccagUfuAfuguuascs	1178	AGUAACAUAACUGGAAUUUG	1537
1136057.1	auL96		u		UAA
AD-	asascauaAfcUfGfGfaauuugua	820	asUfsuacAfaauuccaGfuUfauguusas	1179	GUAACAUAACUGGAAUUUGU	1538
1136058.1	auL96		c		AAU
AD-	csgsaaggAfuAfAfGfguuacuu	821	asAfscaaGfuaaccuuAfuCfcuucgscs	1180	UGCGAAGGAUAAGGUUACUU	1539
1136059.1	guuL96		a		GUG
AD-	gsasaggaUfaAfGfGfuuacuug	822	asCfsacaAfguaaccuUfaUfccuucsgs	1181	GCGAAGGAUAAGGUUACUUG	1540
1136060.1	uguL96		c		UGU
AD-	gsgsgugaAfaAfUfCfaccuauga	823	asUfsucaUfaggugauUfuUfcacccscs	1182	AGGGGUGAAAAUCACCUAUG	1541
1136061.1	auL96		u		AAG
AD-	asasucacCfuAfUfGfaagaacua	824	asGfsuadGu(Tgn)cuucauAfgGfuga	1183	AAAAUCACCUAUGAAGAACUA	1542
1136062.1	cuL96		uususu		CC
AD-	asuscaccUfaUfGfAfagaacuac	825	asGfsgudAg(Tgn)ucuucaUfaGfgug	1184	AAAUCACCUAUGAAGAACUAC	1543
1136063.1	cuL96		aususu		CA
AD-	usasccagCfcAfUfUfaucacaau	826	asAfsaudTg(Tgn)gauaauGfgCfugg	1185	ACUACCAGCCAUUAUCACAAU	1544
1136064.1	uuL96		uasgsu		UG
AD-	gsasacaaCfuCfCfUfuuuaugga	827	asGfsuccAfuaaaaggAfgUfuguucsus	1186	AAGAACAACUCCUUUUAUGGA	1545
1136065.1	cuL96		u		CC
AD-	gsgsccaaGfaGfCfAfcuucuacc	828	asAfsggdTa(G2p)aagugcUfcUfugg	1187	GUGGCCAAGAGCACUUCUACC	1546
1136066.1	uuL96		ccsasc		UG
AD-	gsasgcacUfuCfUfAfccuggaga	829	asGfsucdTc(C2p)agguagAfaGfugc	1188	AAGAGCACUUCUACCUGGAGA	1547
1136067.1	cuL96		ucsusu		CU
AD-	gscsacuuCfuAfCfCfuggagacu	830	asGfsagdTc(Tgn)ccagguAfgAfagu	1189	GAGCACUUCUACCUGGAGACU	1548
1136068.1	cuL96		gcsusc		CA
AD-	csascuucUfaCfCfUfggagacuc	831	asUfsgadGu(C2p)uccaggUfaGfaag	1190	AGCACUUCUACCUGGAGACUC	1549
1136069.1	auL96		ugscsu		AC
AD-	uscsacugCfaCfCfAfuugcuguu	832	asGfsaadCa(G2p)caauggUfgCfagu	1191	ACUCACUGCACCAUUGCUGUU	1550
1136070.1	cuL96		gasgsu		CC
AD-	csascugcAfcCfAfUfugcuguuc	833	asGfsgadAc(Agn)gcaaugGfuGfcag	1192	CUCACUGCACCAUUGCUGUUC	1551
1136071.1	cuL96		ugsasg		CA
AD-	cscsauugCfuGfUfUfccaaaagg	834	asGfsccuUfuuggaacAfgCfaauggsus	1193	CACCAUUGCUGUUCCAAAAGG	1552
1136072.1	cuL96		g		CG
AD-	asgscucuUfuGfUfGfucuacaca	835	asCfsugdTg(Tgn)agacacAfaAfgagc	1194	GGAGCUCUUUGUGUCUACACA	1553
1136073.1	guL96		uscsc		GA
AD-	gscsucuuUfgUfGfUfcuacacag	836	asUfscudGu(G2p)uagacaCfaAfaga	1195	GAGCUCUUUGUGUCUACACAG	1554
1136074.1	auL96		gcsusc		AA
AD-	csuscuuuGfuGfUfCfuacacaga	837	asUfsucdTg(Tgn)guagacAfcAfaaga	1196	AGCUCUUUGUGUCUACACAGA	1555
1136075.1	auL96		gscsu		AC
AD-	uscsuuugUfgUfCfUfacacagaa	838	asGfsuudCu(G2p)uguagaCfaCfaaa	1197	GCUCUUUGUGUCUACACAGAA	1556
1136076.1	cuL96		gasgsc		CA
AD-	csusuuguGfuCfUfAfcacagaac	839	asUfsgudTc(Tgn)guguagAfcAfcaaa	1198	CUCUUUGUGUCUACACAGAAC	1557
1136077.1	auL96		gsasg		AC
AD-	ususugugUfcUfAfCfacagaaca	840	asGfsugdTu(C2p)uguguaGfaCfaca	1199	UCUUUGUGUCUACACAGAACA	1558
1136078.1	cuL96		aasgsa		CC
AD-	ascsacagAfaCfAfCfcaugaaga	841	asGfsucdTu(C2p)auggugUfuCfugu	1200	CUACACAGAACACCAUGAAGA	1559
1136079.1	cuL96		gusasg		CC
AD-	gsasgcuuUfgUfUfGfcaaaaaug	842	asAfscauUfuuugcaaCfaAfagcucsus	1201	CAGAGCUUUGUUGCAAAAAU	1560
1136080.1	uuL96		g		GUU
AD-	asgscuuuGfuUfGfCfaaaaaugu	843	asAfsacaUfuuuugcaAfcAfaagcuscs	1202	AGAGCUUUGUUGCAAAAAUG	1561
1136081.1	uuL96		u		UUG
AD-	asgsgaucUfcUfCfUfcagaguau	844	asAfsaudAc(Tgn)cugagaGfaGfaucc	1203	CCAGGAUCUCUCUCAGAGUAU	1562
1136082.1	uuL96		usgsg		UA
AD-	gsgsaucuCfuCfUfCfagaguauu	845	asUfsaadTa(C2p)ucugagAfgAfgau	1204	CAGGAUCUCUCUCAGAGUAUU	1563
1136083.1	auL96		ccsusg		AU
AD-	gsasucucUfcUfCfAfgaguauua	846	asAfsuaaUfacucugaGfaGfagaucscs	1205	AGGAUCUCUCUCAGAGUAUUA	1564
1136084.1	uuL96		u		UG
AD-	asuscucuCfuCfAfGfaguauuau	847	asCfsauaAfuacucugAfgAfgagauscs	1206	GGAUCUCUCUCAGAGUAUUAU	1565
1136085.1	guL96		c		GG
AD-	uscsucucUfcAfGfAfguauuau	848	asCfscauAfauacucuGfaGfagagasus	1207	GAUCUCUCUCAGAGUAUUAUG	1566
1136086.1	gguL96		c		GA
AD-	csuscucuCfaGfAfGfuauuaugg	849	asUfsccaUfaauacucUfgAfgagagsas	1208	AUCUCUCUCAGAGUAUUAUGG	1567
1136087.1	auL96		u		AA
AD-	uscsucucAfgAfGfUfauuaugg	850	asUfsuccAfuaauacuCfuGfagagasgs	1209	UCUCUCUCAGAGUAUUAUGGA	1568
1136088.1	aauL96		a		AC
AD-	csuscucaGfaGfUfAfuuauggaa	851	asGfsuudCc(Agn)uaauacUfcUfgag	1210	CUCUCUCAGAGUAUUAUGGAA	1569
1136089.1	cuL96		agsasg		CG
AD-	uscsucagAfgUfAfUfuauggaac	852	asCfsguuCfcauaauaCfuCfugagasgs	1211	UCUCUCAGAGUAUUAUGGAAC	1570
1136090.1	guL96		a		GA
AD-	uscsagagUfaUfUfAfuggaacga	853	asCfsucgUfuccauaaUfaCfucugasgs	1212	UCUCAGAGUAUUAUGGAACG	1571
1136091.1	guL96		a		AGC
AD-	csasgaguAfuUfAfUfggaacgag	854	asGfscucGfuuccauaAfuAfcucugsas	1213	CUCAGAGUAUUAUGGAACGA	1572
1136092.1	cuL96		g		GCU
AD-	gscsugugCfaAfAfAfccaaccuu	855	asGfsaadGg(Tgn)ugguuuUfgCfaca	1214	CGGCUGUGCAAAACCAACCUU	1573
1136093.1	cuL96		gcscsg		CC
AD-	csusgugcAfaAfAfCfcaaccuuc	856	asGfsgadAg(G2p)uugguuUfuGfcac	1215	GGCUGUGCAAAACCAACCUUC	1574
1136094.1	cuL96		agscsc		CC
AD-	cscsugacAfcAfCfUfucaaccag	857	asUfscudGg(Tgn)ugaaguGfuGfuca	1216	GACCUGACACACUUCAACCAG	1575
1136095.1	auL96		ggsusc		AA
AD-	usgsacacAfcUfUfCfaaccagaa	858	asCfsuudCu(G2p)guugaaGfuGfugu	1217	CCUGACACACUUCAACCAGAA	1576
1136096.1	guL96		casgsg		GC
AD-	gsascacaCfuUfCfAfaccagaag	859	asGfscudTc(Tgn)gguugaAfgUfgug	1218	CUGACACACUUCAACCAGAAG	1577
1136097.1	cuL96		ucsasg		CU
AD-	ascsacuuCfaAfCfCfagaagcuu	860	asCfsaagCfuucugguUfgAfagugusgs	1219	ACACACUUCAACCAGAAGCUU	1578
1136098.1	guL96		u		GA
AD-	asusgccuAfgCfAfAfgcucucag	861	asAfscudGa(G2p)agcuugCfuAfggc	1220	GAAUGCCUAGCAAGCUCUCAG	1579
1136099.1	uuL96		aususc		UA
AD-	cscsuagcAfaGfCfUfcucaguau	862	asGfsaudAc(Tgn)gagagcUfuGfcua	1221	UGCCUAGCAAGCUCUCAGUAU	1580
1136100.1	cuL96		ggscsa		CA
AD-	csusagcaAfgCfUfCfucaguauc	863	asUfsgadTa(C2p)ugagagCfuUfgcu	1222	GCCUAGCAAGCUCUCAGUAUC	1581
1136101.1	auL96		agsgsc		AU
AD-	usasgcaaGfcUfCfUfcaguauca	864	asAfsugaUfacugagaGfcUfugcuasgs	1223	CCUAGCAAGCUCUCAGUAUCA	1582
1136102.1	uuL96		g		UG
AD-	asgscaagCfuCfUfCfaguaucau	865	asCfsaugAfuacugagAfgCfuugcusas	1224	CUAGCAAGCUCUCAGUAUCAU	1583
1136103.1	guL96		g		GC
AD-	csasagcuCfuCfAfGfuaucaugc	866	asAfsgcdAu(G2p)auacugAfgAfgcu	1225	AGCAAGCUCUCAGUAUCAUGC	1584
1136104.1	uuL96		ugscsu		UC
AD-	csuscggaAfgAfGfUfgagguug	867	asGfsucdAa(C2p)cucacuCfuUfccga	1226	UGCUCGGAAGAGUGAGGUUG	1585
1136105.1	acuL96		gscsa		ACA
AD-	asasggagAfaUfUfGfuuggaaaa	868	asUfsuudTu(C2p)caacaaUfuCfuccu	1227	ACAAGGAGAAUUGUUGGAAA	1586
1136106.1	auL96		usgsu		AAG
AD-	csasccaaGfuUfUfGfgaauaagc	869	asAfsgcuUfauuccaaAfcUfuggugsgs	1228	CCCACCAAGUUUGGAAUAAGC	1587
1136107.1	uuL96		g		UU
AD-	ascscaagUfuUfGfGfaauaagcu	870	asAfsagcUfuauuccaAfaCfuuggusgs	1229	CCACCAAGUUUGGAAUAAGCU	1588
1136108.1	uuL96		g		UU
AD-	asgsuuccUfuUfUfCfugaaucag	871	asCfscugAfuucagaaAfaGfgaacusgs	1230	ACAGUUCCUUUUCUGAAUCAG	1589
1136109.1	guL96		u		GC
AD-	gsusuccuUfuUfCfUfgaaucagg	872	asGfsccdTg(Agn)uucagaAfaAfgga	1231	CAGUUCCUUUUCUGAAUCAGG	1590
1136110.1	cuL96		acsusg		CA
AD-	ususccuuUfuCfUfGfaaucaggc	873	asUfsgcdCu(G2p)auucagAfaAfagg	1232	AGUUCCUUUUCUGAAUCAGGC	1591
1136111.1	auL96		aascsu		AG
AD-	usascuucAfuGfUfGfuacacaga	874	asAfsucdTg(Tgn)guacacAfuGfaagu	1233	CCUACUUCAUGUGUACACAGA	1592
1136112.1	uuL96		asgsg		UG
AD-	csasaggcCfuUfCfAfuaccaaaa	875	asAfsuudTu(G2p)guaugaAfgGfccu	1234	GCCAAGGCCUUCAUACCAAAA	1593
1136114.1	uuL96		ugsgsc		UG
AD-	asasggccUfuCfAfUfaccaaaau	876	asCfsauuUfugguaugAfaGfgccuusgs	1235	CCAAGGCCUUCAUACCAAAAU	1594
1136115.1	guL96		g		GG
AD-	gscscuucAfuAfCfCfaaaauggu	877	asGfsaccAfuuuugguAfuGfaaggcscs	1236	AGGCCUUCAUACCAAAAUGGU	1595
1136116.1	cuL96		u		CC
AD-	csasccucUfaAfGfAfuuuauauc	878	asUfsgauAfuaaaucuUfaGfaggugsgs	1237	CCCACCUCUAAGAUUUAUAUC	1596
1136117.1	auL96		g		AG
AD-	ascscucuAfaGfAfUfuuauauca	879	asCfsugaUfauaaaucUfuAfgaggusgs	1238	CCACCUCUAAGAUUUAUAUCA	1597
1136118.1	guL96		g		GC
AD-	gscsgagaCfaAfGfCfacuaacac	880	asAfsgudGu(Tgn)agugcuUfgUfcuc	1239	CAGCGAGACAAGCACUAACAC	1598
1136119.1	uuL96		gcsusg		UG
AD-	csgsagacAfaGfCfAfcuaacacu	881	asCfsagdTg(Tgn)uagugcUfuGfucu	1240	AGCGAGACAAGCACUAACACU	1599
1136120.1	guL96		cgscsu		GU
AD-	gsasgacaAfgCfAfCfuaacacug	882	asAfscadGu(G2p)uuagugCfuUfguc	1241	GCGAGACAAGCACUAACACUG	1600
1136121.1	uuL96		ucsgsc		UG
AD-	asgsacaaGfcAfCfUfaacacugu	883	asCfsacdAg(Tgn)guuaguGfcUfugu	1242	CGAGACAAGCACUAACACUGU	1601
1136122.1	guL96		cuscsg		GC
AD-	csgsgcuuGfuCfAfGfaccaucuu	884	asCfsaagAfuggucugAfcAfagccgscs	1243	UGCGGCUUGUCAGACCAUCUU	1602
1136123.1	guL96		a		GA
AD-	gsgscuugUfcAfGfAfccaucuu	885	asUfscaaGfauggucuGfaCfaagccsgs	1244	GCGGCUUGUCAGACCAUCUUG	1603
1136124.1	gauL96		c		AA
AD-	gscsuuguCfaGfAfCfcaucuuga	886	asUfsucdAa(G2p)auggucUfgAfcaa	1245	CGGCUUGUCAGACCAUCUUGA	1604
1136125.1	auL96		gcscsg		AA
AD-	csusugucAfgAfCfCfaucuugaa	887	asUfsuudCa(Agn)gaugguCfuGfaca	1246	GGCUUGUCAGACCAUCUUGAA	1605
1136126.1	auL96		agscsc		AA
AD-	ususgucaGfaCfCfAfucuugaaa	888	asUfsuudTc(Agn)agauggUfcUfgac	1247	GCUUGUCAGACCAUCUUGAAA	1606
1136127.1	auL96		aasgsc		AG
AD-	usgsucagAfcCfAfUfcuugaaaa	889	asCfsuuuUfcaagaugGfuCfugacasas	1248	CUUGUCAGACCAUCUUGAAAA	1607
1136128.1	guL96		g		GG
AD-	gsuscagaCfcAfUfCfuugaaaag	890	asCfscuuUfucaagauGfgUfcugacsas	1249	UUGUCAGACCAUCUUGAAAAG	1608
1136129.1	guL96		a		GC
AD-	uscsagacCfaUfCfUfugaaaagg	891	asGfsccuUfuucaagaUfgGfucugascs	1250	UGUCAGACCAUCUUGAAAAGG	1609
1136130.1	cuL96		a		CU
AD-	ascsccuaCfaAfGfAfagaagaau	892	asGfsaudTc(Tgn)ucuucuUfgUfagg	1251	GAACCCUACAAGAAGAAGAAU	1610
1136131.1	cuL96		gususc		CC
AD-	csusgccaCfuGfGfGfuuuuauag	893	asUfscuaUfaaaacccAfgUfggcagsas	1252	GUCUGCCACUGGGUUUUAUAG	1611
1136132.1	auL96		c		AA
AD-	usgsccacUfgGfGfUfuuuauaga	894	asUfsucuAfuaaaaccCfaGfuggcasgs	1253	UCUGCCACUGGGUUUUAUAGA	1612
1136133.1	auL96		a		AC
AD-	csascuggGfuUfUfUfauagaaca	895	asGfsugdTu(C2p)uauaaaAfcCfcagu	1254	GCCACUGGGUUUUAUAGAACA	1613
1136134.1	cuL96		gsgsc		CC
AD-	ascsugggUfuUfUfAfuagaacac	896	asGfsgudGu(Tgn)cuauaaAfaCfccag	1255	CCACUGGGUUUUAUAGAACAC	1614
1136135.1	cuL96		usgsg		CC
AD-	gsgsguuuUfaUfAfGfaacaccca	897	asUfsugdGg(Tgn)guucuaUfaAfaac	1256	CUGGGUUUUAUAGAACACCCA	1615
1136136.1	auL96		ccsasg		AU
AD-	gsgsuuuuAfuAfGfAfacacccaa	898	asAfsuudGg(G2p)uguucuAfuAfaaa	1257	UGGGUUUUAUAGAACACCCAA	1616
1136137.1	uuL96		ccscsa		UC
AD-	usgsggcuAfcAfGfCfuuugaga	899	asAfsgudCu(C2p)aaagcuGfuAfgcc	1258	UCUGGGCUACAGCUUUGAGAC	1617
1136138.1	cuuL96		casgsa		UA
AD-1	gsgsgcuaCfaGfCfUfuugagacu	900	asUfsagdTc(Tgn)caaagcUfgUfagcc	1259	CUGGGCUACAGCUUUGAGACU	1618
1136139.	auL96		csasg		AA
AD-	gscsuacaGfcUfUfUfgagacuaa	901	asGfsuudAg(Tgn)cucaaaGfcUfgua	1260	GGGCUACAGCUUUGAGACUAA	1619
1136140.1	cuL96		gcscsc		CU
AD-	csusacagCfuUfUfGfagacuaac	902	asAfsgudTa(G2p)ucucaaAfgCfugu	1261	GGCUACAGCUUUGAGACUAAC	1620
1136141.1	uuL96		agscsc		UC
AD-	usascagcUfuUfGfAfgacuaacu	903	asGfsagdTu(Agn)gucucaAfaGfcug	1262	GCUACAGCUUUGAGACUAACU	1621
1136142.1	cuL96		uasgsc		CA
AD-	ascsagcuUfuGfAfGfacuaacuc	904	asUfsgadGu(Tgn)agucucAfaAfgcu	1263	CUACAGCUUUGAGACUAACUC	1622
1136143.1	auL96		gusasg		AG
AD-	csasgcuuUfgAfGfAfcuaacuca	905	asCfsugaGfuuagucuCfaAfagcugsus	1264	UACAGCUUUGAGACUAACUCA	1623
1136144.1	guL96		a		GG
AD-	asgscuuuGfaGfAfCfuaacucag	906	asCfscudGa(G2p)uuagucUfcAfaag	1265	ACAGCUUUGAGACUAACUCAG	1624
1136145.1	guL96		cusgsu		GG
AD-	csusuccaCfuAfCfUfucagcuau	907	asCfsaudAg(C2p)ugaaguAfgUfgga	1266	CCCUUCCACUACUUCAGCUAU	1625
1136146.1	guL96		agsgsg		GG
AD-	ususccacUfaCfUfUfcagcuaug	908	asCfscauAfgcugaagUfaGfuggaasgs	1267	CCUUCCACUACUUCAGCUAUG	1626
1136147.1	guL96		g		GG
AD-	gsusggcuUfgCfUfCfugaagua	909	asUfscudAc(Tgn)ucagagCfaAfgcca	1268	GGGUGGCUUGCUCUGAAGUA	1627
1136148.1	gauL96		cscsc		GAA
AD-	usgsgcuuGfcUfCfUfgaaguaga	910	asUfsucdTa(C2p)uucagaGfcAfagcc	1269	GGUGGCUUGCUCUGAAGUAG	1628
1136149.1	auL96		ascsc		AAA
AD-	gsgscuugCfuCfUfGfaaguagaa	911	asUfsuudCu(Agn)cuucagAfgCfaag	1270	GUGGCUUGCUCUGAAGUAGA	1629
1136150.1	auL96		ccsasc		AAU
AD-	gscsuugcUfcUfGfAfaguagaaa	912	asAfsuudTc(Tgn)acuucaGfaGfcaag	1271	UGGCUUGCUCUGAAGUAGAA	1630
1136151.1	uuL96		cscsa		AUC
AD-	cscsuaacAfgGfAfGfaucauaag	913	asUfscuuAfugaucucCfuGfuuaggscs	1272	UGCCUAACAGGAGAUCAUAAG	1631
1136152.1	auL96		a		AA
AD-	csusaacaGfgAfGfAfucauaaga	914	asUfsucdTu(Agn)ugaucuCfcUfguu	1273	GCCUAACAGGAGAUCAUAAGA	1632
1136153.1	auL96		agsgsc		AC
AD-	usasacagGfaGfAfUfcauaagaa	915	asGfsuucUfuaugaucUfcCfuguuasgs	1274	CCUAACAGGAGAUCAUAAGAA	1633
1136154.1	cuL96		g		CC
AD-	asascaggAfgAfUfCfauaagaac	916	asGfsgudTc(Tgn)uaugauCfuCfcug	1275	CUAACAGGAGAUCAUAAGAAC	1634
1136155.1	cuL96		uusasg		CU
AD-	cscsuccgCfaCfAfGfauauuguc	917	asUfsgacAfauaucugUfgCfggaggsus	1276	AACCUCCGCACAGAUAUUGUC	1635
1136156.1	auL96		u		AU
AD-	csusccgcAfcAfGfAfuauuguca	918	asAfsugaCfaauaucuGfuGfcggagsgs	1277	ACCUCCGCACAGAUAUUGUCA	1636
1136157.1	uuL96		u		UG
AD-	ususggcuCfcAfGfUfcuaaaccc	919	asAfsggdGu(Tgn)uagacuGfgAfgcc	1278	UGUUGGCUCCAGUCUAAACCC	1637
1136158.1	uuL96		aascsa		UG
AD-	ususccugGfcUfGfCfuucuaucu	920	asAfsagaUfagaagcaGfcCfaggaasgs	1279	UCUUCCUGGCUGCUUCUAUCU	1638
1136159.1	uuL96		a		UC
AD-	uscscuggCfuGfCfUfucuaucuu	921	asGfsaagAfuagaagcAfgCfcaggasas	1280	CUUCCUGGCUGCUUCUAUCUU	1639
1136160.1	cuL96		g		CU
AD-	cscsuggcUfgCfUfUfcuaucuuc	922	asAfsgaaGfauagaagCfaGfccaggsas	1281	UUCCUGGCUGCUUCUAUCUUC	1640
1136161.1	uuL96		a		UU
AD-	csusggcuGfcUfUfCfuaucuucu	923	asAfsagaAfgauagaaGfcAfgccagsgs	1282	UCCUGGCUGCUUCUAUCUUCU	1641
1136162.1	uuL96		a		UU
AD-	usgsgcugCfuUfCfUfaucuucu	924	asAfsaagAfagauagaAfgCfagccasgs	1283	CCUGGCUGCUUCUAUCUUCUU	1642
1136163.1	uuuL96		g		UG
AD-	gscsugcuUfcUfAfUfcuucuuu	925	asGfscaaAfgaagauaGfaAfgcagcscs	1284	UGGCUGCUUCUAUCUUCUUUG	1643
1136164.1	gcuL96		a		CC
AD-	csusgcuuCfuAfUfCfuucuuug	926	asGfsgcaAfagaagauAfgAfagcagscs	1285	GGCUGCUUCUAUCUUCUUUGC	1644
1136165.1	ccuL96		c		CA
AD-	usgscuucUfaUfCfUfucuuugcc	927	asUfsggdCa(Agn)agaagaUfaGfaag	1286	GCUGCUUCUAUCUUCUUUGCC	1645
1136166.1	auL96		casgsc		AU
AD-	gscsuucuAfuCfUfUfcuuugcca	928	asAfsugdGc(Agn)aagaagAfuAfgaa	1287	CUGCUUCUAUCUUCUUUGCCA	1646
1136167.1	uuL96		gcsasg		UC
AD-	csusucuaUfcUfUfCfuuugccau	929	asGfsaudGg(C2p)aaagaaGfaUfagaa	1288	UGCUUCUAUCUUCUUUGCCAU	1647
1136168.1	cuL96		gscsa		CA
AD-	ususcuauCfuUfCfUfuugccauc	930	asUfsgadTg(G2p)caaagaAfgAfuag	1289	GCUUCUAUCUUCUUUGCCAUC	1648
1136169.1	auL96		aasgsc		AA
AD-	uscsuaucUfuCfUfUfugccauca	931	asUfsugdAu(G2p)gcaaagAfaGfaua	1290	CUUCUAUCUUCUUUGCCAUCA	1649
1136170.1	auL96		gasasg		AA
AD-	csusaucuUfcUfUfUfgccaucaa	932	asUfsuudGa(Tgn)ggcaaaGfaAfgau	1291	UUCUAUCUUCUUUGCCAUCAA	1650
1136171.1	auL96		agsasa		AG
AD-	usasucuuCfuUfUfGfccaucaaa	933	asCfsuuuGfauggcaaAfgAfagauasgs	1292	UCUAUCUUCUUUGCCAUCAAA	1651
1136172.1	guL96		a		GA
AD-	asuscuucUfuUfGfCfcaucaaag	934	asUfscudTu(G2p)auggcaAfaGfaag	1293	CUAUCUUCUUUGCCAUCAAAG	1652
1136173.1	auL96		ausasg		AU
AD-	csusucuuUfgCfCfAfucaaagau	935	asCfsaucUfuugauggCfaAfagaagsas	1294	AUCUUCUUUGCCAUCAAAGAU	1653
1136174.1	guL96		u		GC
AD-	gsasgcucAfgCfAfCfacagguaa	936	asAfsuudAc(C2p)ugugugCfuGfagc	1295	UCGAGCUCAGCACACAGGUAA	1654
1136175.1	uuL96		ucsgsa		UA
AD-	csuscagcAfcAfCfAfgguaauaa	937	asGfsuuaUfuaccuguGfuGfcugagscs	1296	AGCUCAGCACACAGGUAAUAA	1655
1136176.1	cuL96		u		CG
AD-	uscsagcaCfaCfAfGfguaauaac	938	asCfsguuAfuuaccugUfgUfgcugasgs	1297	GCUCAGCACACAGGUAAUAAC	1656
1136177.1	guL96		c		GU
AD-	csasgcacAfcAfGfGfuaauaacg	939	asAfscguUfauuaccuGfuGfugcugsas	1298	CUCAGCACACAGGUAAUAACG	1657
1136178.1	uuL96		g		UG
AD-	ascsagguAfaUfAfAfcgugaagg	940	asUfsccdTu(C2p)acguuaUfuAfccu	1299	ACACAGGUAAUAACGUGAAG	1658
1136179.1	auL96		gusgsu		GAA
AD-	csasgguaAfuAfAfCfgugaagga	941	asUfsucdCu(Tgn)cacguuAfuUfacc	1300	CACAGGUAAUAACGUGAAGG	1659
1136180.1	auL96		ugsusg		AAC
AD-	asgsguaaUfaAfCfGfugaaggaa	942	asGfsuudCc(Tgn)ucacguUfaUfuacc	1301	ACAGGUAAUAACGUGAAGGA	1660
1136181.1	cuL96		usgsu		ACU
AD-	asusaacgUfgAfAfGfgaacucuu	943	asGfsaadGa(G2p)uuccuuCfaCfguu	1302	UAAUAACGUGAAGGAACUCU	1661
1136182.1	cuL96		aususa		UCC
AD-	usasacguGfaAfGfGfaacucuuc	944	asGfsgadAg(Agn)guuccuUfcAfcgu	1303	AAUAACGUGAAGGAACUCUUC	1662
1136183.1	cuL96		uasusu		CG
AD-	cscscagaAfaAfCfUfgcaaaccc	945	asAfsggdGu(Tgn)ugcaguUfuUfcug	1304	GUCCCAGAAAACUGCAAACCC	1663
1136184.1	uuL96		ggsasc		UG
AD-	csascagaAfcAfUfGfgaucuauu	946	asUfsaadTa(G2p)auccauGfuUfcug	1305	ACCACAGAACAUGGAUCUAUU	1664
1136185.1	auL96		ugsgsu		AA
AD-	ascsagaaCfaUfGfGfaucuauua	947	asUfsuaaUfagauccaUfgUfucugusgs	1306	CCACAGAACAUGGAUCUAUUA	1665
1136186.1	auL96		g		AA
AD-	csasgaacAfuGfGfAfucuauuaa	948	asUfsuuaAfuagauccAfuGfuucugsus	1307	CACAGAACAUGGAUCUAUUAA	1666
1136187.1	auL96		g		AG
AD-	asgsaacaUfgGfAfUfcuauuaaa	949	asCfsuuuAfauagaucCfaUfguucusgs	1308	ACAGAACAUGGAUCUAUUAA	1667
1136188.1	guL96		u		AGU
AD-	gsasacauGfgAfUfCfuauuaaag	950	asAfscuuUfaauagauCfcAfuguucsus	1309	CAGAACAUGGAUCUAUUAAA	1668
1136189.1	uuL96		g		GUC
AD-	asascaugGfaUfCfUfauuaaagu	951	asGfsacuUfuaauagaUfcCfauguuscs	1310	AGAACAUGGAUCUAUUAAAG	1669
1136190.1	cuL96		u		UCA
AD-	ascsauggAfuCfUfAfuuaaaguc	952	asUfsgadCu(Tgn)uaauagAfuCfcau	1311	GAACAUGGAUCUAUUAAAGU	1670
1136191.1	auL96		gususc		CAC
AD-	csasuggaUfcUfAfUfuaaaguca	953	asGfsugdAc(Tgn)uuaauaGfaUfcca	1312	AACAUGGAUCUAUUAAAGUC	1671
1136192.1	cuL96		ugsusu		ACA
AD-	asusggauCfuAfUfUfaaagucac	954	asUfsgudGa(C2p)uuuaauAfgAfucc	1313	ACAUGGAUCUAUUAAAGUCAC	1672
1136193.1	auL96		ausgsu		AG
AD-	usgsgaucUfaUfUfAfaagucaca	955	asCfsugdTg(Agn)cuuuaaUfaGfauc	1314	CAUGGAUCUAUUAAAGUCACA	1673
1136194.1	guL96		casusg		GA
AD-	gsgsaucuAfuUfAfAfagucacag	956	asUfscudGu(G2p)acuuuaAfuAfgau	1315	AUGGAUCUAUUAAAGUCACA	1674
1136195.1	auL96		ccsasu		GAA
AD-	gsasucuaUfuAfAfAfgucacaga	957	asUfsucdTg(Tgn)gacuuuAfaUfaga	1316	UGGAUCUAUUAAAGUCACAG	1675
1136196.1	auL96		ucscsa		AAU
AD-	ascsaaugAfuAfAfGfcaaauuca	958	asUfsugaAfuuugcuuAfuCfauugusg	1317	ACACAAUGAUAAGCAAAUUCA	1676
1136197.1	auL96		su		AA
AD-	csasaugaUfaAfGfCfaaauucaa	959	asUfsuudGa(Agn)uuugcuUfaUfcau	1318	CACAAUGAUAAGCAAAUUCAA	1677
1136198.1	auL96		ugsusg		AA
AD-	asusgauaAfgCfAfAfauucaaaa	960	asGfsuudTu(G2p)aauuugCfuUfauc	1319	CAAUGAUAAGCAAAUUCAAA	1678
1136199.1	cuL96		aususg		ACU
AD-	asusgccuAfaAfUfGfgugaauau	961	asCfsauaUfucaccauUfuAfggcausas	1320	UUAUGCCUAAAUGGUGAAUA	1679
1136200.1	guL96		a		UGC
AD-	usgsccuaAfaUfGfGfugaauaug	962	asGfscauAfuucaccaUfuUfaggcasus	1321	UAUGCCUAAAUGGUGAAUAU	1680
1136201.1	cuL96		a		GCA
AD-	gscscuaaAfuGfGfUfgaauaugc	963	asUfsgcdAu(Agn)uucaccAfuUfuag	1322	AUGCCUAAAUGGUGAAUAUG	1681
1136202.1	auL96		gcsasu		CAA
AD-	cscsuaaaUfgGfUfGfaauaugca	964	asUfsugdCa(Tgn)auucacCfaUfuuag	1323	UGCCUAAAUGGUGAAUAUGC	1682
1136203.1	auL96		gscsa		AAU
AD-	csusaaauGfgUfGfAfauaugcaa	965	asAfsuudGc(Agn)uauucaCfcAfuuu	1324	GCCUAAAUGGUGAAUAUGCA	1683
1136204.1	uuL96		agsgsc		AUU
AD-	asasugguGfaAfUfAfugcaauua	966	asCfsuaaUfugcauauUfcAfccauusus	1325	UAAAUGGUGAAUAUGCAAUU	1684
1136205.1	guL96		a		AGG
AD-	csgsggaaGfgGfUfUfugugcua	967	asAfsaudAg(C2p)acaaacCfcUfuccc	1326	GUCGGGAAGGGUUUGUGCUA	1685
1136206.1	uuuL96		gsasc		UUC
AD-	gsgsgaagGfgUfUfUfgugcuau	968	asGfsaadTa(G2p)cacaaaCfcCfuucc	1327	UCGGGAAGGGUUUGUGCUAU	1686
1136207.1	ucuL96		csgsa		UCC
AD-	gsgsaaggGfuUfUfGfugcuauu	969	asGfsgaaUfagcacaaAfcCfcuuccscs	1328	CGGGAAGGGUUUGUGCUAUU	1687
1136208.1	ccuL96		g		CCC
AD-	gsusauaaCfcUfCfAfaguucuga	970	asAfsucaGfaacuugaGfgUfuauacsas	1329	CUGUAUAACCUCAAGUUCUGA	1688
1136209.1	uuL96		g		UG
AD-	usasuaacCfuCfAfAfguucugau	971	asCfsaudCa(G2p)aacuugAfgGfuua	1330	UGUAUAACCUCAAGUUCUGAU	1689
1136210.1	guL96		uascsa		GG
AD-	cscsucaaGfuUfCfUfgauggugu	972	asGfsacdAc(C2p)aucagaAfcUfuga	1331	AACCUCAAGUUCUGAUGGUGU	1690
1136211.1	cuL96		ggsusu		CU
AD-	csasaguuCfuGfAfUfggugucu	973	asAfscadGa(C2p)accaucAfgAfacuu	1332	CUCAAGUUCUGAUGGUGUCUG	1691
1136212.1	guuL96		gsasg		UC
AD-	cscsacaaAfcCfUfCfuagaagcu	974	asAfsagdCu(Tgn)cuagagGfuUfugu	1333	UCCCACAAACCUCUAGAAGCU	1692
1136213.1	uuL96		ggsgsa		UA
AD-	ascsaaacCfuCfUfAfgaagcuua	975	asUfsuadAg(C2p)uucuagAfgGfuuu	1334	CCACAAACCUCUAGAAGCUUA	1693
1136214.1	auL96		gusgsg		AA
AD-	asasaccuCfuAfGfAfagcuuaaa	976	asGfsuuuAfagcuucuAfgAfgguuusg	1335	ACAAACCUCUAGAAGCUUAAA	1694
1136215.1	cuL96		su		CC
AD-	asasccucUfaGfAfAfgcuuaaac	977	asGfsguuUfaagcuucUfaGfagguusus	1336	CAAACCUCUAGAAGCUUAAAC	1695
1136216.1	cuL96		g		CG
AD-	usgsgccuUfcAfAfAfccaaugaa	978	asGfsuucAfuugguuuGfaAfggccasg	1337	CCUGGCCUUCAAACCAAUGAA	1696
1136217.1	cuL96		sg		CA
AD-	gsgsccuuCfaAfAfCfcaaugaac	979	asUfsgudTc(Agn)uugguuUfgAfagg	1338	CUGGCCUUCAAACCAAUGAAC	1697
1136218.1	auL96		ccsasg		AG
AD-	gscscuucAfaAfCfCfaaugaaca	980	asCfsuguUfcauugguUfuGfaaggcscs	1339	UGGCCUUCAAACCAAUGAACA	1698
1136219.1	guL96		a		GC
AD-	uscsaaacCfaAfUfGfaacagcaa	981	asUfsuudGc(Tgn)guucauUfgGfuuu	1340	CUUCAAACCAAUGAACAGCAA	1699
1136220.1	auL96		gasasg		AG
AD-	gsasacagCfaAfAfGfcauaaccu	982	asAfsaggUfuaugcuuUfgCfuguucsas	1341	AUGAACAGCAAAGCAUAACCU	1700
1136221.1	uuL96		u		UG
AD-	asascagcAfaAfGfCfauaaccuu	983	asCfsaadGg(Tgn)uaugcuUfuGfcug	1342	UGAACAGCAAAGCAUAACCUU	1701
1136222.1	guL96		uuscsa		GA
AD-	asgscaaaGfcAfUfAfaccuugaa	984	asAfsuucAfagguuauGfcUfuugcusg	1343	ACAGCAAAGCAUAACCUUGAA	1702
1136223.1	uuL96		su		UC
AD-	gscsaaagCfaUfAfAfccuugaau	985	asGfsaudTc(Agn)agguuaUfgCfuuu	1344	CAGCAAAGCAUAACCUUGAAU	1703
1136224.1	cuL96		gcsusg		CU
AD-	csasaagcAfuAfAfCfcuugaauc	986	asAfsgadTu(C2p)aagguuAfuGfcuu	1345	AGCAAAGCAUAACCUUGAAUC	1704
1136225.1	uuL96		ugscsu		UA
AD-	gscsauaaCfcUfUfGfaaucuaua	987	asGfsuauAfgauucaaGfgUfuaugcsus	1346	AAGCAUAACCUUGAAUCUAUA	1705
1136226.1	cuL96		u		CU
AD-	csasuaacCfuUfGfAfaucuauac	988	asAfsguaUfagauucaAfgGfuuaugscs	1347	AGCAUAACCUUGAAUCUAUAC	1706
1136227.1	uuL96		u		UC
AD-	asusaaccUfuGfAfAfucuauacu	989	asGfsaguAfuagauucAfaGfguuausgs	1348	GCAUAACCUUGAAUCUAUACU	1707
1136228.1	cuL96		c		CA
AD-	usasaccuUfgAfAfUfcuauacuc	990	asUfsgadGu(Agn)uagauuCfaAfggu	1349	CAUAACCUUGAAUCUAUACUC	1708
1136229.1	auL96		uasusg		AA
AD-	asasccuuGfaAfUfCfuauacuca	991	asUfsugdAg(Tgn)auagauUfcAfagg	1350	AUAACCUUGAAUCUAUACUCA	1709
1136230.1	auL96		uusasu		AA
AD-	ascscuugAfaUfCfUfauacucaa	992	asUfsuudGa(G2p)uauagaUfuCfaag	1351	UAACCUUGAAUCUAUACUCAA	1710
1136231.1	auL96		gususa		AU
AD-	cscsuugaAfuCfUfAfuacucaaa	993	asAfsuudTg(Agn)guauagAfuUfcaa	1352	AACCUUGAAUCUAUACUCAAA	1711
1136232.1	uuL96		ggsusu		UU
AD-	asasucuaUfaCfUfCfaaauuuug	994	asGfscaaAfauuugagUfaUfagauuscs	1353	UGAAUCUAUACUCAAAUUUU	1712
1136233.1	cuL96		a		GCA
AD-	asuscuauAfcUfCfAfaauuuugc	995	asUfsgcaAfaauuugaGfuAfuagausus	1354	GAAUCUAUACUCAAAUUUUGC	1713
1136234.1	auL96		c		AA
AD-	gsgsuuaaAfuCfCfUfcuaaccau	996	asGfsaudGg(Tgn)uagaggAfuUfuaa	1355	AAGGUUAAAUCCUCUAACCAU	1714
1136235.1	cuL96		ccsusu		CU
AD-	usasaaucCfuCfUfAfaccaucuu	997	asAfsaadGa(Tgn)gguuagAfgGfauu	1356	GUUAAAUCCUCUAACCAUCUU	1715
1136236.1	uuL96		uasasc		UG
AD-	asasauccUfcUfAfAfccaucuuu	998	asCfsaaaGfaugguuaGfaGfgauuusas	1357	UUAAAUCCUCUAACCAUCUUU	1716
1136237.1	guL96		a		GA
AD-	asasuccuCfuAfAfCfcaucuuug	999	asUfscaaAfgaugguuAfgAfggauusu	1358	UAAAUCCUCUAACCAUCUUUG	1717
1136238.1	auL96		sa		AA
AD-	asusccucUfaAfCfCfaucuuuga	1000	asUfsucaAfagaugguUfaGfaggausus	1359	AAAUCCUCUAACCAUCUUUGA	1718
1136239.1	auL96		u		AU
AD-	uscscucuAfaCfCfAfucuuugaa	1001	asAfsuucAfaagauggUfuAfgaggasus	1360	AAUCCUCUAACCAUCUUUGAA	1719
1136240.1	uuL96		u		UC
AD-	cscsucuaAfcCfAfUfcuuugaau	1002	asGfsaudTc(Agn)aagaugGfuUfaga	1361	AUCCUCUAACCAUCUUUGAAU	1720
1136241.1	cuL96		ggsasu		CA
AD-	csuscuaaCfcAfUfCfuuugaauc	1003	asUfsgadTu(C2p)aaagauGfgUfuag	1362	UCCUCUAACCAUCUUUGAAUC	1721
1136242.1	auL96		agsgsa		AU
AD-	uscsuaacCfaUfCfUfuugaauca	1004	asAfsugaUfucaaagaUfgGfuuagasgs	1363	CCUCUAACCAUCUUUGAAUCA	1722
1136243.1	uuL96		g		UU
AD-	csusaaccAfuCfUfUfugaaucau	1005	asAfsaudGa(Tgn)ucaaagAfuGfguu	1364	CUCUAACCAUCUUUGAAUCAU	1723
1136244.1	uuL96		agsasg		UG
AD-	usasaccaUfcUfUfUfgaaucauu	1006	asCfsaadTg(Agn)uucaaaGfaUfggu	1365	UCUAACCAUCUUUGAAUCAUU	1724
1136245.1	guL96		uasgsa		GG
AD-	asasccauCfuUfUfGfaaucauug	1007	asCfscaaUfgauucaaAfgAfugguusas	1366	CUAACCAUCUUUGAAUCAUUG	1725
1136246.1	guL96		g		GA
AD-	cscsaucuUfuGfAfAfucauugga	1008	asUfsuccAfaugauucAfaAfgauggsus	1367	AACCAUCUUUGAAUCAUUGGA	1726
1136247.1	auL96		u		AA
AD-	csasucuuUfgAfAfUfcauuggaa	1009	asUfsuudCc(Agn)augauuCfaAfaga	1368	ACCAUCUUUGAAUCAUUGGAA	1727
1136248.1	auL96		ugsgsu		AG
AD-	asuscuuuGfaAfUfCfauuggaaa	1010	asCfsuudTc(C2p)aaugauUfcAfaaga	1369	CCAUCUUUGAAUCAUUGGAAA	1728
1136249.1	guL96		usgsg		GA
AD-	csusuugaAfuCfAfUfuggaaaga	1011	asUfsucdTu(Tgn)ccaaugAfuUfcaaa	1370	AUCUUUGAAUCAUUGGAAAG	1729
1136250.1	auL96		gsasu		AAU
AD-	gsasaagaAfuAfAfAfgaaugaaa	1012	asGfsuudTc(Agn)uucuuuAfuUfcuu	1371	UGGAAAGAAUAAAGAAUGAA	1730
1136251.1	cuL96		ucscsa		ACA
AD-	asasagaaUfaAfAfGfaaugaaac	1013	asUfsgudTu(C2p)auucuuUfaUfucu	1372	GGAAAGAAUAAAGAAUGAAA	1731
1136252.1	auL96		uuscsc		CAA
AD-	gsasaugaAfaCfAfAfauucaagg	1014	asAfsccuUfgaauuugUfuUfcauucsus	1373	AAGAAUGAAACAAAUUCAAG	1732
1136253.1	uuL96		u		GUU
AD-	asusgaaaCfaAfAfUfucaagguu	1015	asUfsaadCc(Tgn)ugaauuUfgUfuuc	1374	GAAUGAAACAAAUUCAAGGU	1733
1136254.1	auL96		aususc		UAA
AD-	asascaaaUfuCfAfAfgguuaauu	1016	asCfsaauUfaaccuugAfaUfuuguusus	1375	GAAACAAAUUCAAGGUUAAU	1734
1136255.1	guL96		c		UGG
AD-	usgsaagcUfgCfAfUfaaagcaag	1017	asUfscudTg(C2p)uuuaugCfaGfcuu	1376	UGUGAAGCUGCAUAAAGCAA	1735
1136256.1	auL96		cascsa		GAU
AD-	asasgcugCfaUfAfAfagcaagau	1018	asAfsaudCu(Tgn)gcuuuaUfgCfagc	1377	UGAAGCUGCAUAAAGCAAGA	1736
1136257.1	uuL96		uuscsa		UUA
AD-	asgscugcAfuAfAfAfgcaagauu	1019	asUfsaadTc(Tgn)ugcuuuAfuGfcagc	1378	GAAGCUGCAUAAAGCAAGAU	1737
1136258.1	auL96		ususc		UAC
AD-	gscsugcaUfaAfAfGfcaagauua	1020	asGfsuadAu(C2p)uugcuuUfaUfgca	1379	AAGCUGCAUAAAGCAAGAUU	1738
1136259.1	cuL96		gcsusu		ACU
AD-	csusgcauAfaAfGfCfaagauuac	1021	asAfsguaAfucuugcuUfuAfugcagscs	1380	AGCUGCAUAAAGCAAGAUUAC	1739
1136260.1	uuL96		u		UC
AD-	usgscauaAfaGfCfAfagauuacu	1022	asGfsaguAfaucuugcUfuUfaugcasgs	1381	GCUGCAUAAAGCAAGAUUACU	1740
1136261.1	cuL96		c		CU
AD-	csasuaaaGfcAfAfGfauuacucu	1023	asUfsagdAg(Tgn)aaucuuGfcUfuua	1382	UGCAUAAAGCAAGAUUACUCU	1741
1136262.1	auL96		ugscsa		AU
AD-	usasaagcAfaGfAfUfuacucuau	1024	asUfsaudAg(Agn)guaaucUfuGfcuu	1383	CAUAAAGCAAGAUUACUCUAU	1742
1136263.1	auL96		uasusg		AA
AD-	asusacaaAfaAfUfCfcaaccaac	1025	asAfsgudTg(G2p)uuggauUfuUfugu	1384	UAAUACAAAAAUCCAACCAAC	1743
1136264.1	uuL96		aususa		UC
AD-	usascaaaAfaUfCfCfaaccaacuc	1026	asGfsagdTu(G2p)guuggaUfuUfuug	1385	AAUACAAAAAUCCAACCAACU	1744
1136265.1	uL96		uasusu		CA
AD-	ascsaaaaAfuCfCfAfaccaacuca	1027	asUfsgadGu(Tgn)gguuggAfuUfuuu	1386	AUACAAAAAUCCAACCAACUC	1745
1136266.1	uL96		gusasu		AA
AD-	csasaaaaUfcCfAfAfccaacucaa	1028	asUfsugdAg(Tgn)ugguugGfaUfuuu	1387	UACAAAAAUCCAACCAACUCA	1746
1136267.1	uL96		ugsusa		AU
AD-	asasaaauCfcAfAfCfcaacucaa	1029	asAfsuudGa(G2p)uugguuGfgAfuu	1388	ACAAAAAUCCAACCAACUCAA	1747
1136268.1	uuL96		uuusgsu		UU
AD-	asasaaucCfaAfCfCfaacucaau	1030	asAfsaudTg(Agn)guugguUfgGfauu	1389	CAAAAAUCCAACCAACUCAAU	1748
1136269.1	uuL96		uususg		UA
AD-	asasauccAfaCfCfAfacucaauu	1031	asUfsaadTu(G2p)aguuggUfuGfgau	1390	AAAAAUCCAACCAACUCAAUU	1749
1136270.1	auL96		uususu		AU
AD-	asasuccaAfcCfAfAfcucaauua	1032	asAfsuaaUfugaguugGfuUfggauusu	1391	AAAAUCCAACCAACUCAAUUA	1750
1136271.1	uuL96		su		UU
AD-	asusccaaCfcAfAfCfucaauuau	1033	asAfsauaAfuugaguuGfgUfuggausu	1392	AAAUCCAACCAACUCAAUUAU	1751
1136272.1	uuL96		su		UG
AD-	uscscaacCfaAfCfUfcaauuauu	1034	asCfsaauAfauugaguUfgGfuuggasus	1393	AAUCCAACCAACUCAAUUAUU	1752
1136273.1	guL96		u		GA
AD-	cscsaaccAfaCfUfCfaauuauug	1035	asUfscaaUfaauugagUfuGfguuggsas	1394	AUCCAACCAACUCAAUUAUUG	1753
1136274.1	auL96		u		AG
AD-	csasaccaAfcUfCfAfauuauuga	1036	asCfsucaAfuaauugaGfuUfgguugsgs	1395	UCCAACCAACUCAAUUAUUGA	1754
1136275.1	guL96		a		GC
AD-	asasccaaCfuCfAfAfuuauugag	1037	asGfscucAfauaauugAfgUfugguusg	1396	CCAACCAACUCAAUUAUUGAG	1755
1136276.1	cuL96		sg		CA
AD-	ascscaacUfcAfAfUfuauugagc	1038	asUfsgcdTc(Agn)auaauuGfaGfuug	1397	CAACCAACUCAAUUAUUGAGC	1756
1136277.1	auL96		gususg		AC
AD-	cscsaacuCfaAfUfUfauugagca	1039	asGfsugdCu(C2p)aauaauUfgAfguu	1398	AACCAACUCAAUUAUUGAGCA	1757
1136278.1	cuL96		ggsusu		CG
AD-	csgsuacaAfuGfUfUfcuagauuu	1040	asGfsaadAu(C2p)uagaacAfuUfgua	1399	CACGUACAAUGUUCUAGAUUU	1758
1136279.1	cuL96		cgsusg		CU
AD-	gsusacaaUfgUfUfCfuagauuuc	1041	asAfsgaaAfucuagaaCfaUfuguacsgs	1400	ACGUACAAUGUUCUAGAUUUC	1759
1136280.1	uuL96		u		UU
AD-	usascaauGfuUfCfUfagauuucu	1042	asAfsagaAfaucuagaAfcAfuuguascs	1401	CGUACAAUGUUCUAGAUUUCU	1760
1136281.1	uuL96		g		UU
AD-	ascsaaugUfuCfUfAfgauuucuu	1043	asAfsaagAfaaucuagAfaCfauugusas	1402	GUACAAUGUUCUAGAUUUCU	1761
1136282.1	uuL96		c		UUC
AD-	csasauguUfcUfAfGfauuucuu	1044	asGfsaaaGfaaaucuaGfaAfcauugsus	1403	UACAAUGUUCUAGAUUUCUU	1762
1136283.1	ucuL96		a		UCC
AD-	asasuguuCfuAfGfAfuuucuuu	1045	asGfsgaaAfgaaaucuAfgAfacauusgs	1404	ACAAUGUUCUAGAUUUCUUUC	1763
1136284.1	ccuL96		u		CC
AD-	gsusucuaGfaUfUfUfcuuucccu	1046	asAfsagdGg(Agn)aagaaaUfcUfaga	1405	AUGUUCUAGAUUUCUUUCCCU	1764
1136285.1	uuL96		acsasu		UC
AD-	ususcuagAfuUfUfCfuuucccu	1047	asGfsaadGg(G2p)aaagaaAfuCfuag	1406	UGUUCUAGAUUUCUUUCCCUU	1765
1136286.1	ucuL96		aascsa		CC
AD-	uscsuuuaCfaUfUfUfgaagccaa	1048	asUfsuudGg(C2p)uucaaaUfgUfaaa	1407	AAUCUUUACAUUUGAAGCCAA	1766
1136287.1	auL96		gasusu		AG
AD-	csusuuacAfuUfUfGfaagccaaa	1049	asCfsuudTg(G2p)cuucaaAfuGfuaa	1408	AUCUUUACAUUUGAAGCCAAA	1767
1136288.1	guL96		agsasu		GU
AD-	ususuacaUfuUfGfAfagccaaag	1050	asAfscudTu(G2p)gcuucaAfaUfgua	1409	UCUUUACAUUUGAAGCCAAAG	1768
1136289.1	uuL96		aasgsa		UA
AD-	ascsauuuGfaAfGfCfcaaaguaa	1051	asAfsuudAc(Tgn)uuggcuUfcAfaau	1410	UUACAUUUGAAGCCAAAGUA	1769
1136290.1	uuL96		gusasa		AUU
AD-	asusuugaAfgCfCfAfaaguaauu	1052	asAfsaauUfacuuuggCfuUfcaaausgs	1411	ACAUUUGAAGCCAAAGUAAU	1770
1136291.1	uuL96		u		UUC
AD-	gsasagccAfaAfGfUfaauuucca	1053	asGfsuggAfaauuacuUfuGfgcuucsas	1412	UUGAAGCCAAAGUAAUUUCCA	1771
1136292.1	cuL96		a		CC
AD-	asasgccaAfaGfUfAfauuuccac	1054	asGfsgudGg(Agn)aauuacUfuUfggc	1413	UGAAGCCAAAGUAAUUUCCAC	1772
1136293.1	cuL96		uuscsa		CU
AD-	cscsaaagUfaAfUfUfuccaccua	1055	asCfsuadGg(Tgn)ggaaauUfaCfuuu	1414	AGCCAAAGUAAUUUCCACCUA	1773
1136294.1	guL96		ggscsu		GA
AD-	csasaaguAfaUfUfUfccaccuag	1056	asUfscudAg(G2p)uggaaaUfuAfcuu	1415	GCCAAAGUAAUUUCCACCUAG	1774
1136295.1	auL96		ugsgsc		AA
AD-	asasaguaAfuUfUfCfcaccuaga	1057	asUfsucdTa(G2p)guggaaAfuUfacu	1416	CCAAAGUAAUUUCCACCUAGA	1775
1136296.1	auL96		uusgsg		AA
AD-	gscsaagaUfcUfUfGfucucugaa	1058	asCfsuucAfgagacaaGfaUfcuugcsus	1417	GAGCAAGAUCUUGUCUCUGAA	1776
1136297.1	guL96		c		GA
AD-	asgsguagAfaGfAfGfccaagaag	1059	asGfscudTc(Tgn)uggcucUfuCfuacc	1418	AGAGGUAGAAGAGCCAAGAA	1777
1136298.1	cuL96		uscsu		GCC
AD-	csusagcuCfuGfUfCfucuucugu	1060	asGfsacaGfaagagacAfgAfgcuagsgs	1419	UCCUAGCUCUGUCUCUUCUGU	1778
1136299.1	cuL96		a		CU
AD-	usasgcucUfgUfCfUfcuucuguc	1061	asAfsgadCa(G2p)aagagaCfaGfagcu	1420	CCUAGCUCUGUCUCUUCUGUC	1779
1136300.1	uuL96		asgsg		UC
AD-	asgscucuGfuCfUfCfuucugucu	1062	asGfsagdAc(Agn)gaagagAfcAfgag	1421	CUAGCUCUGUCUCUUCUGUCU	1780
1136301.1	cuL96		cusasg		CU
AD-	asuscuuuGfuGfAfUfcuuggac	1063	asCfsaguCfcaagaucAfcAfaagausas	1422	CUAUCUUUGUGAUCUUGGACU	1781
1136302.1	uguL96		g		GU
AD-	csusuccuGfuGfAfUfccauuuua	1064	asGfsuaaAfauggaucAfcAfggaagsgs	1423	CCCUUCCUGUGAUCCAUUUUA	1782
1136303.1	cuL96		g		CU
AD-	ususccugUfgAfUfCfcauuuuac	1065	asAfsguaAfaauggauCfaCfaggaasgs	1424	CCUUCCUGUGAUCCAUUUUAC	1783
1136304.1	uuL96		g		UG
AD-	uscscuguGfaUfCfCfauuuuacu	1066	asCfsaguAfaaauggaUfcAfcaggasas	1425	CUUCCUGUGAUCCAUUUUACU	1784
1136305.1	guL96		g		GC
AD-	cscsugugAfuCfCfAfuuuuacu	1067	asGfscagUfaaaauggAfuCfacaggsas	1426	UUCCUGUGAUCCAUUUUACUG	1785
1136306.1	gcuL96		a		CA
AD-	csusgugaUfcCfAfUfuuuacugc	1068	asUfsgcdAg(Tgn)aaaaugGfaUfcaca	1427	UCCUGUGAUCCAUUUUACUGC	1786
1136307.1	auL96		gsgsa		AA
AD-	csusauaaAfuAfUfAfugaccuga	1069	asUfsucdAg(G2p)ucauauAfuUfuau	1428	GCCUAUAAAUAUAUGACCUGA	1787
1136308.1	auL96		agsgsc		AA
AD-	usgsaccuGfaAfAfAfcuccaguu	1070	asUfsaadCu(G2p)gaguuuUfcAfggu	1429	UAUGACCUGAAAACUCCAGUU	1788
1136309.1	auL96		casusa		AC
AD-	gsasccugAfaAfAfCfuccaguua	1071	asGfsuadAc(Tgn)ggaguuUfuCfagg	1430	AUGACCUGAAAACUCCAGUUA	1789
1136310.1	cuL96		ucsasu		CA
AD-	asasggauCfuGfCfAfgcuaucua	1072	asUfsuadGa(Tgn)agcugcAfgAfucc	1431	UAAAGGAUCUGCAGCUAUCUA	1790
1136311.1	auL96		uususa		AG
AD-	asgsgaucUfgCfAfGfcuaucuaa	1073	asCfsuuaGfauagcugCfaGfauccusus	1432	AAAGGAUCUGCAGCUAUCUAA	1791
1136312.1	guL96		u		GG
AD-	gscsuaucUfaAfGfGfcuugguu	1074	asAfsaaaCfcaagccuUfaGfauagcsus	1433	CAGCUAUCUAAGGCUUGGUUU	1792
1136313.1	uuuL96		g		UC
AD-	csusaucuAfaGfGfCfuugguuu	1075	asGfsaaaAfccaagccUfuAfgauagscs	1434	AGCUAUCUAAGGCUUGGUUU	1793
1136314.1	ucuL96		u		UCU
AD-	asuscuaaGfgCfUfUfgguuuuc	1076	asAfsagaAfaaccaagCfcUfuagausas	1435	CUAUCUAAGGCUUGGUUUUCU	1794
1136315.1	uuuL96		g		UA
AD-	uscsuaagGfcUfUfGfguuuucu	1077	asUfsaadGa(Agn)aaccaaGfcCfuuag	1436	UAUCUAAGGCUUGGUUUUCU	1795
1136316.1	uauL96		asusa		UAC
AD-	csusaaggCfuUfGfGfuuuucuu	1078	asGfsuaaGfaaaaccaAfgCfcuuagsas	1437	AUCUAAGGCUUGGUUUUCUU	1796
1136317.1	acuL96		u		ACU
AD-	usasaggcUfuGfGfUfuuucuua	1079	asAfsguaAfgaaaaccAfaGfccuuasgs	1438	UCUAAGGCUUGGUUUUCUUAC	1797
1136318.1	cuuL96		a		UG
AD-	gsgscuugGfuUfUfUfcuuacug	1080	asGfsacdAg(Tgn)aagaaaAfcCfaagc	1439	AAGGCUUGGUUUUCUUACUG	1798
1136319.1	ucuL96		csusu		UCA
AD-	gscsuuggUfuUfUfCfuuacugu	1081	asUfsgadCa(G2p)uaagaaAfaCfcaag	1440	AGGCUUGGUUUUCUUACUGUC	1799
1136320.1	cauL96		cscsu		AU
AD-	csusugguUfuUfCfUfuacuguc	1082	asAfsugdAc(Agn)guaagaAfaAfcca	1441	GGCUUGGUUUUCUUACUGUCA	1800
1136321.1	auuL96		agscsc		UA
AD-	ususgguuUfuCfUfUfacuguca	1083	asUfsaudGa(C2p)aguaagAfaAfacca	1442	GCUUGGUUUUCUUACUGUCAU	1801
1136322.1	uauL96		asgsc		AU
AD-	usgsguuuUfcUfUfAfcugucau	1084	asAfsuadTg(Agn)caguaaGfaAfaacc	1443	CUUGGUUUUCUUACUGUCAUA	1802
1136323.1	auuL96		asasg		UG
AD-	gsgsuuuuCfuUfAfCfugucaua	1085	asCfsauaUfgacaguaAfgAfaaaccsas	1444	UUGGUUUUCUUACUGUCAUA	1803
1136324.1	uguL96		a		UGA
AD-	ususuucuUfaCfUfGfucauauga	1086	asAfsucaUfaugacagUfaAfgaaaascs	1445	GGUUUUCUUACUGUCAUAUG	1804
1136325.1	uuL96		c		AUA
AD-	ususucuuAfcUfGfUfcauauga	1087	asUfsaucAfuaugacaGfuAfagaaasas	1446	GUUUUCUUACUGUCAUAUGA	1805
1136326.1	uauL96		c		UAC
AD-	uscsuuacUfgUfCfAfuaugauac	1088	asGfsgudAu(C2p)auaugaCfaGfuaa	1447	UUUCUUACUGUCAUAUGAUAC	1806
1136327.1	cuL96		gasasa		CU
AD-	csusuacuGfuCfAfUfaugauacc	1089	asAfsgguAfucauaugAfcAfguaagsas	1448	UUCUUACUGUCAUAUGAUACC	1807
1136328.1	uuL96		a		UG
AD-	uscsugcgGfuUfGfGfuaaagaga	1090	asUfsucdTc(Tgn)uuaccaAfcCfgcag	1449	UUUCUGCGGUUGGUAAAGAG	1808
1136329.1	auL96		asasa		AAC
AD-	usgsgugaUfuUfAfAfucccuaca	1091	asAfsugdTa(G2p)ggauuaAfaUfcac	1450	AAUGGUGAUUUAAUCCCUACA	1809
1136330.1	uuL96		casusu		UG
AD-	gsgsugauUfuAfAfUfcccuacau	1092	asCfsaugUfagggauuAfaAfucaccsas	1451	AUGGUGAUUUAAUCCCUACAU	1810
1136331.1	guL96		u		GG
AD-	usgsuauaAfaUfCfCfaaccuucu	1093	asCfsagaAfgguuggaUfuUfauacasgs	1452	ACUGUAUAAAUCCAACCUUCU	1811
1136332.1	guL96		u		GC
AD-	gsusgcuuGfaUfGfUfcacuaaua	1094	asUfsuadTu(Agn)gugacaUfcAfagc	1453	UGGUGCUUGAUGUCACUAAU	1812
1136333.1	auL96		acscsa		AAA
AD-	usgscuugAfuGfUfCfacuaauaa	1095	asUfsuuaUfuagugacAfuCfaagcascs	1454	GGUGCUUGAUGUCACUAAUA	1813
1136334.1	auL96		c		AAU
AD-	gscsuugaUfgUfCfAfcuaauaaa	1096	asAfsuuuAfuuagugaCfaUfcaagcsas	1455	GUGCUUGAUGUCACUAAUAA	1814
1136335.1	uuL96		c		AUG
AD-	asusgucaCfuAfAfUfaaaugaaa	1097	asGfsuudTc(Agn)uuuauuAfgUfgac	1456	UGAUGUCACUAAUAAAUGAA	1815
1136336.1	cuL96		auscsa		ACU
AD-	usgsucacUfaAfUfAfaaugaaac	1098	asAfsgudTu(C2p)auuuauUfaGfuga	1457	GAUGUCACUAAUAAAUGAAA	1816
1136337.1	uuL96		casusc		CUG
AD-	usasauaaAfuGfAfAfacugucag	1099	asGfscudGa(C2p)aguuucAfuUfuau	1458	ACUAAUAAAUGAAACUGUCA	1817
1136338.1	cuL96		uasgsu		GCU