Low fiber pennycress meal and methods of making

[0001] This invention was made with government support under Grant Number 2014-67009-22305 and 2018-67009-27374 awarded by the National Institute of Food and Agriculture, USDA. The government has certain rights in the invention.

[0002] The sequence listing contained in the file named “63612_179003_ST25.txt”, which is 511,444 bytes in size (measured in operating system MS-Windows), contains 183 sequences, and which was created on Sep. 13, 2018, is contemporaneously filed with this specification by electronic submission (using United States Patent Office EFS-Web filing system) and is incorporated herein by reference in its entirety.

[0003] Different plants have seed contents that make them desirable for feed compositions. Examples are soybean, canola, rapeseed and sunflower. After crushing the seeds and recovering the oil, the resulting meal has a protein content making the meal useful as a feed ingredient for ruminants, monogastrics, poultry, and aquaculture. Nevertheless, there remains a desire for improved plant seeds that can provide additional sources of nutrition to animals.

[0004] Field Pennycress Thlaspi arvense L. (common names: fanweed, stinkweed, field pennycress), hereafter referred to as Pennycress or pennycress, is a winter cover crop that helps to protect soil from erosion, prevent the loss of farm-field nitrogen into water systems, and retain nutrients and residues to improve soil productivity. While it is well established that cover crops provide agronomic and ecological benefits to agriculture and environment, only 5% of farmers today are using them. One reason is economics—it requires on average ˜$30-40/acre to grow a cover crop on the land that is otherwise idle between two seasons of cash crops such as corn and soy. In the last 5 years, it has been recognized that pennycress could be used as a novel cover crop, because in addition to providing cover crop benefits, it is an oilseed with its oil being useful as a biofuel. Extensive testing indicates that it can be interseeded over standing corn in early fall and harvested in spring prior to soybean planting (in appropriate climates). As such, its growth and development requires minimal incremental inputs (e.g., no/minimum tillage, no/low nitrogen, insecticides or herbicides). Pennycress also does not directly compete with existing crops when intercropped for energy production, and the recovered oil and meal can provide an additional source of income for farmers.

[0005] Pennycress is a winter annual belonging to the Brassicaceae (mustard) family. It's related to cultivated crops, rapeseed and canola, which are also members of the Brassicaceae family. Pennycress seeds are smaller than canola, but they are also high in oil content. They typically contain 36% oil, which is roughly twice the level found in soybean, and the oil has a very low saturated fat content (˜4%). Pennycress represents a clear opportunity for sustainable optimization of agricultural systems. For example, in the US Midwest, ˜35M acres that remain idle could be planted with pennycress after a corn crop is harvested and before the next soybean crop is planted. Pennycress can serve as an important winter cover crop working within the no/low-till corn and soybean rotation to guard against soil erosion and improve overall field soil nitrogen and pest management.

[0006] Pennycress has an oil content that makes it highly desirable as a biofuel, and potentially as a food oil. Once the oil is obtained from pennycress, either from mechanical expeller pressing or hexane extraction, the resulting meal has a high protein level with a favorable amino acid profile that could provide nutritional benefits to animals. However, studies of pennycress processing have consistently demonstrated that the meal produced has a high level of non-digestible fiber, and as a result, not enough metabolizable energy to be competitive with high-value products like soybean and canola meals as an animal feed.

[0007] Compositions comprising non-defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 5% to 20% by dry weight are provided herein.

[0008] Compositions comprising defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 7% to 25% by dry weight are provided herein.

[0009] Pennycress seed meals comprising an acid detergent fiber (ADF) content of 5% to 20% by dry weight, wherein the seed meal is non-defatted, are provided herein.

[0010] Pennycress seed meals comprising an acid detergent fiber (ADF) content of 7% to 25% by dry weight, wherein the seed meal is defatted, are provided herein.

[0011] Pennycress seed cakes comprising an acid detergent fiber (ADF) content of 7% to 25% by dry weight are provided herein.

[0012] In one embodiment, this disclosure provides a low fiber pennycress meal composition.

[0013] Seed lots comprising a population of pennycress seeds that comprise an acid detergent fiber (ADF) content of 5% to 20% by dry weight are provided herein.

[0014] Methods of making non-defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 5% to 20% by dry weight, comprising the step of grinding, macerating, extruding, and/or crushing the aforementioned seed lots, thereby obtaining the non-defatted seed meal, are provided herein.

[0015] Methods of making defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 7% to 25% by dry weight, comprising the step of solvent extracting the, separating the extracted seed meal from the solvent, thereby obtaining the defatted seed meal, are provided herein.

[0016] Methods of making pennycress seed cake comprising an acid detergent fiber (ADF) content of 7% to 25% by dry weight, comprising the step of crushing or expelling the seed of any of the aforementioned seed lots, thereby obtaining a seed cake, are provided herein.

[0017] Methods of making a pennycress seed lot comprising the steps of: (a) introducing at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof; (b) selecting germplasm that is homozygous for said loss-of-function mutation; and, (c) harvesting seed from the homozygous germplasm, thereby obtaining a seed lot, wherein said seed lot comprises an acid detergent fiber (ADF) content of 5% to 20% by dry weight, are provided herein.

[0018] Method of making a pennycress seed lot comprising the steps of: (a) introducing at least one transgene that suppresses expression of at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof into a pennycress plant genome; (b) selecting a transgenic plant line that comprises said transgene and (c) harvesting seed from the transgenic plant line, thereby obtaining a seed lot, wherein said seed lot comprises an acid detergent fiber (ADF) content of 5% to 20% by dry weight, are provided herein.

[0019] In one embodiment, this disclosure provides a method for producing low fiber pennycress seeds and meal. The method comprises genetically modifying pennycress seed (e.g., using gene editing or transgenic approach) to modify expression of one or more genes involved in seed coat development. Genetically altered seed lots with improved composition, such as lower fiber content, increased oil content, and increased protein content, all in comparison to control seed lots that lack the genetic alteration can be obtained by these methods.

[0027] The term “and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term and/or” as used in a phrase such as “A and/or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0028] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

[0029] Where a term is provided in the singular, other embodiments described by the plural of that term are also provided.

[0030] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

[0031] Pennycress has value in both its oil and the resulting meal following the removal of oil. The meal is used for animal feed and is typically valued for its energy, protein and sometimes fiber. Fiber is usually delivered by forage elements (not protein supplements) and only a modest amount is desired. Fiber is measured by multiple measures including Crude Fiber (CF), Acid detergent Fiber (ADF) and Neutral detergent fiber (NDF). ADF is a useful determinant in estimating the energy available to animals. In certain embodiments, ADF can be measured gravimetrically using Association of Official Analytical Chemists (AOAC) Official Method 973.18 (1996): “Fiber (Acid Detergent) and Lignin in Animal Feed”. In certain embodiments, modifications of this method can include use of Sea Sand for filter aid as needed. NDF can be determined as disclosed in JAOAC 56, 1352-1356, 1973. In certain embodiments, fiber (ADF and/or NDF), protein, and/or oil content can be determined by Near-infrared (NIR) spectroscopy.

[0032] Defatted-pennycress seed meal having less fiber than defatted control pennycress seed meal obtained from wild type pennycress seed is provided herein. In certain embodiments, the ADF content of defatted pennycress seed meal and compositions comprising the same that are provided herein is reduced from about 1.25-, 1.5-, 2-, or 3-fold to about 4-, 5-, 6-, or 7-fold in comparison to control defatted pennycress seed meal and compositions comprising the same obtained from control wild-type pennycress seeds. Typically, the level of acid detergent fiber (ADF) in wild-type pennycress seed varies from about 25 to about 31% by dry weight. Defatted-pennycress meal is a product obtained from high-pressure crushing of seed, via mechanical pressing and/or expanding/extrusion, followed by a solvent extraction process, which removes oil from the whole seed. Solvents used in such extractions include, but are not limited to, hexane or mixed hexanes. The meal is the material that remains after most of the oil has been removed. During a typical oilseed processing procedure, extraction of the oil leads to concentration of fiber as a result of oil mass removal. The typical range of ADF in meal made from wild-type pennycress seed is 35-45%. To be useful as a high protein animal feed, and competitive with other protein feedstuffs, the level of ADF level in meal should be less than 20% by dry weight, less than 15% by dry weight, or less than 10% by dry weight of the meal. In certain embodiments, defatted pennycress seed meal having an ADF content of less than 25% by dry weight, less than 20% by dry weight, less than 15% by dry weight, less than 10% by dry weight, or less than 7% by dry weight of meal is provided herein. In certain embodiments, defatted pennycress seed meal having an ADF content of about 5%, 8%, or 10% to 15%, 18%, 20%, or 25% by dry weight is provided herein. Compositions comprising such defatted pennycress seed meal are also provided herein.

[0033] Non-defatted pennycress seed meal having less fiber than non-defatted control pennycress seed meal obtained from wild type pennycress seed is provided herein. In certain embodiments, the ADF content of non-defatted pennycress seed meal and compositions comprising the same that are provided herein is reduced from about 1.25-, 1.5-, 2-, or 3-fold to about 4-, 5-, 6-, or 7-fold in comparison to control non-defatted pennycress seed meal and compositions comprising the same obtained from control wild-type pennycress seeds. In certain embodiments, the non-defatted pennycress seed meal is obtained from pennycress seeds that have been crushed, ground, macerated, expelled, extruded, expanded, or any combination thereof. Typically, the level of acid detergent fiber (ADF) in wild-type pennycress seed and non-defatted seed meal obtained therefrom varies from about 20% to about 38% by dry weight. To be useful as a high protein animal feed, and competitive with other protein feedstuffs, the level of ADF level in non-defatted meal should be less than 20% by dry weight, less than 15% by dry weight, or less than 10% by dry weight of the meal. In certain embodiments, non-defatted pennycress seed meal having an ADF content of less than 20% by dry weight, less than 15% by dry weight, less than 10% by dry weight, or less than 7% by dry weight of the meal is provided herein. In certain embodiments, non-defatted pennycress seed meal having an ADF content of about 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight is provided herein. Compositions comprising such non-defatted pennycress seed meal are also provided herein.

[0034] In certain embodiments, pennycress seed lots comprising a population of seed having reduced fiber content, reduced fiber content and increased protein content, reduced fiber content and increased oil content, or reduced fiber content and increased protein and oil content, all in comparison to fiber, protein, and oil content of the control seed lots of wild-type pennycress seed, are provided. In certain embodiments, the seed lots will comprise loss-of-function (LOF) mutations in one or more genes, coding sequences, and/or proteins that result in reduced fiber content, reduced fiber content and increased protein content, reduced fiber content and increased oil content, or reduced fiber content, increased protein, and increased oil content. Such LOF mutations include, but are not limited to, INDELS (insertions, deletions, and/or substitutions or any combination thereof), translocations, inversions, duplications, or any combination thereof in a promoter, a 5′ untranslated region, coding region, an intron of a gene, and/or a 3′ UTR of a gene. Such Indels can introduce one or more mutations including, but not limited to, frameshift mutations, missense mutations, pre-mature translation termination codons, splice donor and/or acceptor mutations, regulatory mutations, and the like that result in an LOF mutation. In certain embodiments, the LOF mutation will result in: (a) a reduction in the enzymatic or other biochemical activity associated with the encoded polypeptide in the plant comprising the LOF mutation in comparison to a wild-type control plant; or (b) both a reduction in the enzymatic or other biochemical activity and a reduction in the amount of a transcript (e.g., mRNA) in the plant comprising the LOF mutation in comparison to a wild-type control plant. Such reductions in activity or activity and transcript levels can, in certain embodiments, comprise a reduction of at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of activity or activity and transcript levels in the LOF mutant in comparison to the activity or transcript levels in a wild-type control plant. In certain embodiments, reductions in activity, specific activity, and/or transcript levels are provided by at least one LOF mutation in an endogenous wild-type pennycress gene, promoter, terminator, or protein set forth in Table 1. In certain embodiments, such aforementioned reductions in activity, specific activity and/or transcript levels are provided by at least one LOF mutation in an endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, allelic variants thereof, or any combination thereof. In certain embodiments, such aforementioned reductions in activity, specific activity, and/or transcript levels are provided by at least one LOF mutation in an endogenous wild-type pennycress gene, promoter, or terminator comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 69, 71, 75, 77, 87, 88, allelic variants thereof, or any combination thereof. In certain embodiments, any of the aforementioned allelic variants of endogenous wild-type pennycress genes can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, or 173. In certain embodiments, such aforementioned reductions in activity, specific activity, and/or transcript levels are provided by at least one LOF mutation in an endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, allelic variants thereof, or any combination thereof. In certain embodiments, such aforementioned reductions in activity or activity and transcript levels are provided by at least one LOF mutation in an endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 70, 76, allelic variants thereof, or any combination thereof. In certain embodiments, an endogenous wild-type pennycress gene can encode a polypeptide allelic variant having at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, or 172. In certain embodiments, an endogenous wild-type pennycress gene can encode a polypeptide allelic variant having one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, or 172. In certain embodiments, the seed lots will comprise one or more transgenes that suppress expression of one or more genes, coding sequences, and/or proteins, thus resulting in reduced fiber content, reduced fiber content and increased protein content, reduced fiber content and increased oil content, or reduced fiber content, increased protein content, and increased oil content, all in comparison to control or wild-type pennycress seed lots. Transgenes that can provide for such suppression include, but are not limited to, transgenes that produce artificial miRNAs targeting a given gene or gene transcript for suppression. In certain embodiments, the transgenes that suppress expression will result in: (a) a reduction in the enzymatic or other biochemical activity associated with the encoded polypeptide in the plant comprising the transgene in comparison to a wild-type control plant; or (b) both a reduction in the enzymatic or other biochemical activity and a reduction in the amount of a transcript (e.g., mRNA) in the plant comprising the transgene in comparison to a wild-type control plant. Such reductions in activity and transcript levels can in certain embodiments comprise a reduction of at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of activity and/or transcript levels in the transgenic plant in comparison to the activity or transcript levels in a wild-type control plant. In certain embodiments, certain genes, coding sequences, and/or proteins that can be targeted for introduction of LOF mutations or that are targeted for transgene-mediated suppression are provided in the following Table 1 and accompanying Sequence Listing. In certain embodiments, allelic variants of the wild-type genes, coding sequences, and/or proteins provided in Table 1 and the sequence listing are targeted for introduction of LOF mutations or are targeted for transgene-mediated suppression. Allelic variants found in distinct pennycress isolates or varieties that exhibit wild-type seed fiber, protein, and or oil content can be targeted for introduction of LOF mutations or are targeted for transgene-mediated suppression to obtain seed lots having reduced fiber content, reduced fiber content and increased protein content, reduced fiber content and increased oil content, or reduced fiber content, increased protein, and increased oil content, all in comparison to fiber, protein, and oil content of the control seed lots of wild-type pennycress. Such allelic variants can comprise polynucleotide sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity across the entire length of the polynucleotide sequences of the wild-type coding regions or wild-type genes of Table 1 and the sequence listing. Such allelic variants can comprise polypeptide sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity across the entire length of the polypeptide sequences of the wild-type proteins of Table 1 and the sequence listing. Pennycress seed lots having reduced seed coat fiber, lighter-colored seed coat due to reduced proanthocyanidins content, increased protein content, and/or higher seed oil content as described herein can comprise one or more LOF mutations in one or more genes that encode polypeptides involved in seed coat and embryo formation or can comprise transgenes that suppress expression of those genes. Polypeptides affecting these traits include, without limitation, TRANSPARENT TESTA1 (TT1) through TRANSPARENT TESTA19 (TT19) (e.g., TT1, TT2, TT3, TT4, TT5, TT6, TT7, TT8, TT9, TT10, TT12, TT13, TT15, TT16, TT18, and TT19), TRANSPARENT TESTA GLABRA1 and 2 (TTG1 and TTG2), GLABROUS 2 (GL2), GLABROUS 3 (GL3), ANR-BAN, and AUTOINHIBITED H+-ATPASE 10 (AHA10) disclosed in Table 1. In certain embodiments, pennycress seed lots provided herein can comprise LOF mutations in any of the aforementioned wild-type pennycress genes disclosed in Table 1 or any combination of mutations disclosed in Table 1. Compositions comprising defatted or non-defatted seed meal obtained from any of the aforementioned seed lots, defatted or non-defatted seed meal obtained from any of the aforementioned seed lots, and seed cakes obtained from any of the aforementioned seed lots are also provided herein. Methods of making any of the aforementioned seed lots, compositions, seed meals, or seed cakes are also provided herein. As used herein, the phrase “seed cake” refers to the material obtained after the seeds are crushed, ground, heated, and expeller pressed or extruded/expanded prior to solvent extraction.

[0035] In certain embodiments, reductions or increases in various features of seed lots, seed meal compositions, seed meal, or seed cake are in comparison to a control or wild-type seed lots, seed meal compositions, seed meal, or seed cake. Such controls include, but are not limited to, seed lots, seed meal compositions, seed meal, or seed cake obtained from control plants that lack the LOF mutations or transgene-mediated gene suppression. In certain embodiments, control plants that lack the LOF mutations or transgene-mediated gene suppression will be otherwise isogenic to the plants that contain the LOF mutations or transgene-mediated gene suppression.

[0036] In certain embodiments, the controls will comprise seed lots, seed meal compositions, seed meal, or seed cake obtained from plants that lack the LOF mutations or transgene-mediated gene suppression and that were grown in parallel with the plants having the LOF mutations or transgene-mediated gene suppression. Such features that can be compared to wild-type or control plants include, but are not limited to, ADF content, NDF fiber content, protein content, oil content, protein activity and/or transcript levels, and the like.

[0037]

TABLE 1
Wild-type (WT) coding regions, encoded proteins, and genes that can be
targeted for introduction of LOF mutations or transgene-mediated suppression, their mutant
variants and representative genetic elements for achieving suppression of gene expression.
				Other Names
				Used and
				Representative
SEQ				Pennycress LOF
ID	Sequence			Mutants
NO:	Name	Type	Function / Nature of the mutation	Disclosed Herein
1	TT2 CDS	WT	R2R3 MYB domain transcription	MYB123,
		Coding	factor, a key determinant in	TRANSPARENT
		region	proanthocyanidin accumulation	TESTA 2 (TT2)
2	TT2 ORF	WT Protein
3	TT2 Ta	WT Gene
	locus
4	TT2 CDS-	Mutant	Modified TT2 gene isolated from an	tt2-1, tt2-2, BC38,
	Mut	Coding	EMS-mutagenized population,	E5-547
		region	GAACCATTGGAACTCAAAC (nt
			321-339 of SEQ ID NO: 1)→
			GAACCATTGAAACTCAAAC (nt
			321-339 of SEQ ID NO: 4)
5	TT2 Mut P1	Mutant	Truncated protein, due to Trp (W)
		Protein	codon → Stop mutation
6	ATS-KAN4	WT	Member of the KANADI family of	ABERRANT
	CDS	Coding	transcription factors, involved in	TESTA SHAPE,
		region	integument formation during ovule	ATS, KAN4,
7	ATS-KAN4	WT	development and expressed at the	KANADI 4
	ORF	Protein	boundary between the inner and outer
8	ATS-KAN4	WT Gene	integuments. Essential for directing
	Ta locus		laminar growth of the inner
			integument
9	BAN-ANR	WT	Negative regulator of flavonoid	BAN, BANYULS,
	CDS	Coding	biosynthesis, putative oxidoreductase.	NAD(P)-binding
		region	Mutants accumulate flavonoid	Rossmann-fold
10	BAN-ANR	WT Protein	pigments in seed coat. Putative	superfamily
	ORF		ternary complex composed of TT2,	protein
11	BAN-ANR	WT Gene	TT8 and TTG1 is believed to be
	Ta locus		required for correct expression of
			BAN in seed endothelium
12	DTX35 CDS	WT	Encodes a multidrug and toxin efflux	Detoxifying Efflux
		Coding	family transporter. Involved in	Carrier 35, FFT,
		region	flavonoid metabolism, affecting root	FLOWER
13	DTX35 ORF	WT Protein	growth, seed development and	FLAVONOID
14	DTX35 Ta	WT Gene	germination, pollen development,	TRANSPORTER
	locus		release and viability
15	GL2 CDS	WT	Glabra 2, a homeodomain protein	Glabra 2, HD-ZIP
		Coding	affects epidermal cell identity	IV homeobox-
		region	including trichomes, root hairs, and	leucine zipper
16	GL2 ORF	WT Protein	seed coat. Abundantly expressed	protein with lipid-
17	GL2 Ta	WT Gene	during early seed development and in	binding START
	locus		atrichoblasts. Directly regulated by	domain
			WER
18	MUM4_like	WT	Encodes a putative NDP-L-rhamnose	MUCILAGE-
	1 CDS	Coding	synthase, an enzyme required for the	MODIFIED 4,
		region	synthesis of the pectin	RHAMNOSE
19	MUM4_like	WT Protein	rhamnogalacturonan I, major	BIOSYNTHESIS
	1 ORF		component of plant mucilage.	2, RHM2,
20	MUM4_like	WT Gene	Involved in seed coat mucilage cell	ATRHM2
	1 Ta locus		development. Required for complete
21	MUM4_like	WT	mucilage synthesis, cytoplasmic
	2 CDS	Coding	rearrangement and seed coat
		region	development
22	MUM4_like	WT Protein
	2 ORF
23	MUM4_like	WT Gene
	2 Ta locus
24	MYB61	WT	Putative transcription factor. Mutants	MYB DOMAIN
	CDS	Coding	are deficient in mucilage extrusion	PROTEIN 61,
		region	from the seeds during imbibition,	ATMYB61
25	MYB61	WT Protein	resulting in reduced deposition of
	ORF		mucilage during development of the
26	MYB61 Ta	WT Gene	seed coat epidermis in myb61
	locus		mutants
27	TT1_like1	WT	Encodes a zinc finger protein;	WIP DOMAIN
	CDS	Coding	involved in photomorphogenesis,	PROTEIN 1,
		region	flavonoid biosynthesis, flower and	WIP1
28	TT1_like1	WT Protein	seed development
	ORF
29	TT1_like1	WT Gene
	Ta locus
30	TT1_like2	WT
	CDS	Coding
		region
31	TT1_like2	WT Protein
	ORF
32	TT1_like2	WT Gene
	Ta locus
33	TT10 CDS	WT	Protein similar to laccase-like	ATLAC15,
		Coding	polyphenol oxidases, with conserved	ATTT10, LAC15
		region	copper binding domains. Involved in	(LACCASE-LIKE
34	TT10 ORF	WT Protein	lignin and flavonoids biosynthesis.	15),
35	TT10 Ta	WT Gene	Expressed in developing testa,	TRANSPARENT
	locus		colocalizing with flavonoid end	TESTA 10 (TT10)
			products proanthocyanidins and
			flavonols. Mutants exhibit delay in
			developmentally determined
			browning of the testa, characterized
			by the pale brown color of seed coat
36	TT12 CDS	WT	Proton antiporter, involved in the	TRANSPARENT
		Coding	transportation of proanthocyanidin	TESTA 12
		region	precursors into the vacuole. Loss-of-	(TT12), ATTT12,
37	TT12 ORF	WT Protein	function mutation has strong	MATE efflux
38	TT12 Ta	WT Gene	reduction of proanthocyanidin	family protein
	locus		deposition in vacuoles and reduced
			dormancy. Expressed in the
			endothelium of ovules and in
			developing seeds
39	TT13 CDS	WT	Proton pump from the H+-ATPase	AHA10
		Coding	family, involved in proanthocyanidin	(AUTOINHIBITE
		region	biosynthesis. Mutations disturb	D H(+)-ATPASE
40	TT13 ORF	WT Protein	vacuolar biogenesis and acidification	ISOFORM 10),
41	TT13 Ta	WT Gene	process. The acidification of the	TRANSPARENT
	locus		vacuole provides energy for import of	TESTA 13 (TT13)
			proanthocyanidins into the vacuole
42	TT15 CDS	WT	Encodes a UDP-glucose: sterol-	TRANSPARENT
		Coding	glucosyltransferase. Mutants produce	TESTA 15
		region	pale greenish-brown seeds with	(TT15),
43	TT15 ORF	WT Protein	slightly reduced dormancy	TRANSPARENT
44	TT15 Ta	WT Gene		TESTA
	locus			GLABROUS 15
				(TTG15),
				UGT80B1, UDP-
				Glycosyltransferase
				superfamily
				protein
45	TT16 CDS	WT	MADS-box protein regulating	ABS,
		Coding	proanthocyanidin biosynthesis and	AGAMOUS-LIKE
		region	cell shape in the inner-most cell layer	32 (AGL32),
46	TT16 ORF	WT Protein	of the seed coat. Required for	ARABIDOPSIS
47	TT16 Ta	WT Gene	determining the identity of the	BSISTER,
	locus		endothelial layer within the ovule.	TRANSPARENT
			Paralogous to GOA. Plays a maternal	TESTA16 (TT16)
			role in fertilization and seed
			development
48	TT18 CDS	WT	Encodes leucoanthocyanidin	ANS,
		Coding	dioxygenase, which is involved in	ANTHOCYANIDIN
		region	proanthocyanin biosynthesis. Mutant	SYNTHASE,
49	TT18 ORF	WT Protein	analysis suggests that this gene is also	LDOX,
50	TT18 Ta	WT Gene	involved in vacuole formation	LEUCOANTHOC
	locus			YANIDIN
				DIOXYGENASE,
				TANNIN
				DEFICIENT
				SEED 4 (TDS4),
				TT18
51	TT19 CDS	WT	Encodes glutathione transferase	GLUTATHIONE
		Coding	belonging to the phi class of GSTs.	S-
		region	Mutants display no pigments in the	TRANSFERASE
52	TT19 ORF	WT Protein	leaves or stems. Likely to function as	PHI 12,
53	TT19 Ta	WT Gene	a carrier to transport anthocyanin	ATGSTF12,
	locus		from the cytosol to tonoplasts	GLUTATHIONE
				S-
				TRANSFERASE
				26 (GST26),
				GLUTATHIONE
				S-
				TRANSFERASE
				PHI 12, GSTF12,
				TRANSPARENT
				TESTA 19 (TT19)
54	TT3 CDS	WT	Dihydroflavonol reductase. Catalyzes	DFR,
		Coding	conversion of dihydroquercetin to	DIHYDROFLAVONOL
		region	leucocyanidin in the biosynthesis of	4-
55	TT3 ORF	WT Protein	anthocyanins	REDUCTASE,
56	TT3 Ta	WT Gene		M318,
	locus			TRANSPARENT
				TESTA 3, (TT3)
57	TT4 CDS	WT	Encodes chalcone synthase (CHS), a	ATCHS,
		Coding	key enzyme in biosynthesis of	CHALCONE
		region	flavonoids. Required for	SYNTHASE,
58	TT4 ORF	WT Protein	accumulation of purple anthocyanins	CHS,
59	TT4 Ta	WT Gene	in leaves, stems and seed coat. Also	TRANSPARENT
	locus		involved in regulation of auxin	TESTA 4 (TT4)
			transport and root gravitropism
60	TT5 CDS	WT	Another key enzyme in biosynthesis	A11, ATCHI, CFI,
		Coding	of flavonoids. Catalyzes the	CHALCONE
		region	conversion of chalcones into	FLAVANONE
61	TT5 ORF	WT Protein	flavanones. Required for the	ISOMERASE,
62	TT5 Ta	WT Gene	accumulation of purple anthocyanins	CHALCONE
	locus		leaves, stems and seed coat. Co-	ISOMERASE,
			expressed with CHS	CHI,
				TRANSPARENT
				TESTA 5 (TT5)
63	TT6 CDS	WT	Encodes flavanone 3-hydroxylase,	F3′H, F3H,
		Coding	regulating flavonoid biosynthesis.	FLAVANONE 3-
		region	Coordinately expressed with	HYDROXYLASE,
64	TT6 ORF	WT Protein	chalcone synthase and chalcone	TRANSPARENT
65	TT6 Ta	WT Gene	isomerases	TESTA 6 (TT6)
	locus
66	TT7 CDS	WT	Required for flavonoid 3′-	F3′H CYP75B1,
		Coding	hydroxylase activity. Enzyme	CYTOCHROME
		region	abundance relative to CHS	P450 75B1, D501,
67	TT7 ORF	WT Protei	n determines Quercetin/Kaempferol	TRANSPARENT
68	TT7 Ta	WT Gene	metabolite ratio	TESTA 7 (TT7)
	locus
69	TT8 CDS	WT	TT8 is a transcription factor acting in	ATTT8, BHLH42,
		Coding	concert with TT1, PAP1 and TTG1	TRANSPARENT
		region	on regulation of flavonoid pathways,	TESTA 8, (TT8)
70	TT8 ORF	WT Protein	namely proanthocyanidin and
71	TT8 Ta	WT Gene	anthocyanin biosynthesis. Affects
	locus		dihydroflavonol 4-reductase gene
			expression. It is believed that a
			ternary complex composed of TT2,
			TT8 and TTG1 is required for correct
			expression of BAN in seed
			endothelium. Interacts with JAZ
			proteins to regulate anthocyanin
			accumulation
72	TT9 CDS	WT	Encodes a peripheral membrane	GFS9, GREEN
		Coding	protein localized at the Golgi	FLUORESCENT
		region	apparatus. Involved in membrane	SEED 9,
73	TT9 ORF	WT Protein	trafficking, vacuole development and	TRANSPARENT
74	TT9 Ta	WT Gene	in flavonoid accumulation in the seed	TESTA 9, TT9
	locus		coat. Mutant seed color is pale brown	CLEC16A-like
				protein
75	TTG1 CDS	WT	Part of a ternary complex composed	TTG1, TTG,
		Coding	of TT2, TT8 and TTG1 necessary for	URM23,
		region	correct expression of BAN in seed	ATTTG1,
76	TTG1 ORF	WT Protein	endothelium. Required for the	Transducin/
77	TTG1 Ta	WT Gene	accumulation of purple anthocyanins	WD40-repeat-
	locus		in leaves, stems and seed coat.	containing protein
			Controls epidermal cell fate
			specification. Affects
			dihydroflavonol 4-reductase gene
			expression. TTG1 was shown to act
			non-cell autonomously and to move
			via plasmodesmata between cells
78	TTG2 CDS	WT	Belongs to a family of WRKY	TRANSPARENT
		Coding	transcription factors expressed in	TESTA GLABRA
		region	seed integument and endosperm.	2 (TTG2),
79	TTG2 ORF	WT Protein	Mutants are defective in	AtWRKY44,
80	TTG2 Ta	WT Gene	proanthocyanidin synthesis and seed	DSL1 (DR.
	locus		mucilage deposition. Seeds are	STRANGELOVE
			yellow colored. Seed size is also	1)
			affected; seeds are reduced in size but
			only when the mutant allele is
			transmitted through the female parent
81	TT1	Artificial	Artificial micro-RNA designed to
	aMIR319a	miRNA	reduce expression of TT1 in
	gene		corresponding cell layer of
			developing seed coat
82	TT10	Artificial	Artificial micro-RNA designed to
	aMIR319a	miRNA	reduce expression of TT10 in
	gene		corresponding cell layer of
			developing seed coat
83	TT2	Artificial	Artificial micro-RNA designed to
	aMIR319a	miRNA	reduce expression of TT2 in
	gene		corresponding cell layer of
			developing seed coat
84	TT8	Artificial	Artificial micro-RNA designed to
	aMIR319a	miRNA	reduce expression of TT8 in
	gene		corresponding cell layer of
			developing seed coat
85	TT1	Promoter	Genomic region of TT1 locus
	Promoter		upstream of TT1 start codon
			containing TT1 promoter regulatory
			elements
86	TT1	Transcrip-	Genomic region of TT1 locus
	Terminator	tional	downstream of TT1 stop codon
		terminator	containing regulatory elements
87	TT8		Genomic region of TT8 locus
	Promoter		upstream of TT8 start codon
			containing TT8 promoter regulatory
		Promoter	elements
88	TT8	Transcrip-	Genomic region of TT8 locus
	Terminator	tional	downstream of TT8 stop codon
		terminator	containing regulatory elements
89	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SpCAS9_F1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
90	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SpCAS9_R1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
91	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SaCAS9_F2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
92	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SaCAS9_R2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
93	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SaCAS9_F3	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
94	TT2_CRISPR-	Oligo-	TT2 CDS targeted for cleavage by
	SaCAS9_R3	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
95	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_F1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
96	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_R1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
97	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_F2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
98	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_R2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
99	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_F3	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
100	TT8_CRISPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_R3	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
101	TT10_CRISPR-	Oligo-	TT10 CDS targeted for cleavage by
	SaCAS9_F1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
102	TT10_CRISPR-	Oligo-	TT10 CDS targeted for cleavage by
	SaCAS9_R1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
103	TT10_CRISPR-	Oligo-	TT10 CDS targeted for cleavage by
	SaCAS9_F2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
104	TT10_CRISPR-	Oligo-	TT10 CDS targeted for cleavage by
	SaCAS9_R2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
105	TT16_CRISPR-	Oligo-	TT16 CDS targeted for cleavage by
	SpCAS9_F1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
106	TT16_CRISPR-	Oligo-	TT16 CDS targeted for cleavage by
	SpCAS9_R1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
107	TT16_CRISPR-	Oligo-	TT16 CDS targeted for cleavage by
	SpCAS9_F2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
108	TT16_CRISPR-	Oligo-	TT16 CDS targeted for cleavage by
	SpCAS9_R2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
109	TT8_CRISPPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_F4	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
110	TT8_CRISPPR-	Oligo-	TT8 CDS targeted for cleavage by
	SpCAS9_F5	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
111	TT8_CRISPPR-	Oligo-	TT8 CDS targeted for cleavage by
	SaCAS9_F1	nucleotide	SaCAS9 enzyme; part of gRNA
			cassette
112	TT8_CRISPPR-	Oligo-	TT8 CDS targeted for cleavage by
	SaCAS9_F2	nucleotide	SaCAS9 enzyme; part of gRNA
			cassette
113	TTG1_CRISPR-	Oligo-	TTG1 CDS targeted for cleavage by
	SpCAS9_F1	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
114	TTG1_CRISPR-	Oligo-	TTG1 CDS targeted for cleavage by
	SpCAS9_F2	nucleotide	SpCAS9 enzyme; part of gRNA
			cassette
115	TTG1_CRISPR-	Oligo-	TTG1 CDS targeted for cleavage by
	SaCAS9_F1	nucleotide	SaCAS9 enzyme; part of gRNA
			cassette
116	TTG1_CRISPR-	Oligo-	TTG1 CDS targeted for cleavage by
	SaCAS9_ F2	nucleotide	SaCAS9 enzyme; part of gRNA
			cassette
117	TT4-1 CDS-	Mutant	GTCTGCTCCGAGATCACAG (nt	tt4-1, A7-95
	Mut	Coding	580-598 of SEQ ID NO: 57) →
		region	GTCTGCTCCAAGATCACAG (nt
			580-598 of SEQ ID NO: 117)
118	TT4 Mut P1	Mutant	Presumed LOF due to E→K aa
		Protein	change
119	TT4-2 CDS-	Mutant	AAGTGACTGGAACTCTCTC (nt	tt4-2, E5-549
	Mut	Coding	894-912 of SEQ ID NO: 57) →
		region	AAGTGACTGAAACTCTCTC (nt
			894-912 of SEQ ID NO: 119)
120	TT4 Mut P2	Mutant	Truncated protein, W→Stop change
		Protein
121	TT6-1 CDS-	Mutant	GAGACTGTGCAAGATTGGA (nt	tt6-1, AX17
	Mut	Coding	364-382 of SEQ ID NO: 63) →
		region	GAGACTGTGTAAGATTGGA (nt
			364-382 of SEQ ID NO: 121)
122	TT6 Mut P1	Mutant	Truncated protein, Q→Stop change
		Protein
123	TT6-2 CDS-	Mutant	TTCAGAATCCGGCGCAGGA (nt	tt6-2, Q36
	Mut	Coding	872-890 of SEQ ID: 63) →
		region	TTCAGAATCTGGCGCAGGA (nt
			872-890 of SEQ ID: 123)
124	TT6 Mut P2	Mutant	Presumed LOF due to P→L aa
		Protein	change
125	TT7-1 CDS-	Mutant	CCAAATTCAGGAGCCAAAC (nt	tt7-1, A7-3, E5-
	Mut	Coding	304-322 of SEQ ID: 66) →	586, E5-484 P15,
		region	CCAAATTCAAGAGCCAAAC (nt	E5-484 P5
			304-322 of SEQ ID: 125)
126	TT7-1 Mut	Mutant	Presumed LOF due to G→R aa
	P1	Protein	change
127	TT8-1 CDS-	Mutant	TTTACGGCAGAGAAAGTGA (nt	tt8-1, D3-N10 P5
	Mut	Coding	19-37 of SEQ 1D:69) →
		region	TTTACGGCAAAGAAAGTGA (nt
			19-37 of SEQ ID: 127)
128	TT8 Mut P1	Mutant	Presumed LOF due to E→K aa
		Protein	change
129	TT8-2 CDS-	Mutant	TCTTACATCCAATCATCAT (nt	tt8-2, D5-191, D3-
	Mut	Coding	940-958 of SEQ ID: 69) →	N25P1, E5-590,
		region	TCTTACATCTAATCATCAT (nt	A7-191
			940-958 of SEQ ID: 129)
130	TT8 Mut P2	Mutant	Truncated protein, Q→Stop change
		Protein
131	TT8-3 CDS-	Mutant	TGCCACATGGAAGGCTGA (nt	tt8-3, I0193, E5-
	Mut	Coding	960-978 of SEQ ID: 69) →	542, E5-548
		region	TGCCACATGAAAGGCTGAT (nt
			960-978 of SEQ ID: 131)
132	TT8 Mut P3	Mutant	Truncated protein, W→Stop change
		Protein
133	TT8-11	Mutant	GCAATAAAGACGAGGAAGA (nt	tt8-11
	CDS-Mut	Coding	172-190 of SEQ ID: 69) →
		region	GCAATAAAGAACGAGGAAGA
			(nt 172-191 of SEQ ID: 133)
134	TT8 Mut P4	Mutant	Frameshift caused by 1 bp insertion
		Protein
135	TT8-12	Mutant	GCAATAAAGACGAGGAAGA (nt	tt8-12
	CDS-Mut	Coding	172-190 of SEQ ID: 69) →
		region	GCAATAAA--CGAGGAAGA (nt
			172-188 of SEQ ID: 135)
136	TT8 Mut P5	Mutant	Frameshift caused by 2 bp deletion
		Protein
137	TT8-13	Mutant	GCAATAAAGACGAGGAAGA (nt	tt8-13
	CDS-Mut	Coding	172-190 of SEQ ID: 69) →
		region	GCAATAAAGGACGAGGAAGA
			(nt 172-191 of SEQ ID: 137)
138	TT8 Mut P6	Mutant	Frameshift caused by 1 bp insertion
		Protein
139	TT10-1	Mutant	GACTGTTTGGTGGCATGCG (nt	tt10-1, E5-539,
	CDS-Mut	Coding	354-372 of SEQ ID: 33) →	E5-543
		region	GACTGTTTGATGGCATGCG (nt
			354-372 of SEQ ID: 139)
140	TT10 Mut	Mutant	Truncated protein, W→Stop change
	P1	Protein
141	TT10-2	Mutant	TACCGCATTCGGATGGTAA (nt	tt10-2, E5-545
	CDS-Mut	Coding	646-664 of SEQ ID: 33) →
		region	TACCGCATTTGGATGGTAA (nt
			646-664 of SEQ ID: 141)
142	TT10 Mut	Mutant	Presumed LOF due to R→W aa
	P2	Protein	change
143	TT10-11	Mutant	GGACCAGTGTTAAGGGCT (nt	tt10-11
	CDS-Mut	Coding	154-171 of SEQ ID: 33) →
		region	GGACCAGTGTTTAAGGGCT (nt
			154-172 of SEQ ID: 143)
144	TT10 Mut	Mutant	Frameshift caused by 1 bp insertion
	P3	Protein
145	TT10-12	Mutant	GGACCAGTGTTAAGGGCT (nt	tt10-12
	CDS-Mut	Coding	154-171 of SEQ ID: 33) →
		region	GGACCAGTGATTAAGGGCT (nt
			154-172 of SEQ ID: 145)
146	TT10 Mut	Mutant	Frameshift caused by 1 bp insertion
	P4	Protein
147	TT10-13	Mutant	TCCTGGACCAGTGTTAAGG (nt	tt10-13
	CDS-Mut	Coding	150-168 of SEQ ID: 33) →
		region	TCCTGG--------TTAAGG (nt 150-
			161 of SEQ ID: 147)
148	TT10 Mut	Mutant	Frameshift caused by 7 bp deletion
	P5	Protein
149	TT12-1	Mutant	AACCCTTTGGCTTACATGTC (nt	tt12-1, A7-261
	CDS-Mut	Coding	604-623 of SEQ ID: 36) →
		region	AACCCTTT----TACATGTC (nt
			604-619 of SEQ ID: 149)
150	TT12 Mut	Mutant	Frameshift caused by 4 bp deletion
	P1	Protein
151	TT12-2	Mutant	ATTCTCTCTGGTGTTGCCA (nt	tt12-2, J22
	CDS-Mut	Coding	1237-1255 of SEQ ID: 36) →
		region	ATTCTCTCTAGTGTTGCCA (nt
			1237-1255 of SEQ ID: 151)
152	TT12 Mut	Mutant	Presumed LOF due to G→S aa
	P2	Protein	change
153	TT13-1	Mutant	GCTCTTAACCTTGGAGTTT (nt	tt13-1, ahal0-1,
	CDS-Mut	Coding	895-913 of SEQ ID: 39) →	J22
		region	GCTCTTAACTTTGGAGTTT (nt
			895-913 of SEQ ID: 153)
154	TT13 Mut	Mutant	Truncated protein, L→F change
	P1	Protein
155	TT13-2	Mutant	ACAGGAAGGCGACTTGGGA (nt	tt13-2, P32
	CDS-Mut	Coding	958-976 of SEQ ID: 39) →
		region	ACAGGAAGGTGACTTGGGA (nt
			958-976 of SEQ ID: 155)
156	TT13 Mut	Mutant	Truncated protein, R→Stop change
	P2	Protein
157	TT13-3	Mutant	GGAATGACCGGAGATGGTG (nt	tt13-3, E5-540
	CDS-Mut	Coding	1144-1162 of SEQ ID: 39) →
		region	GGAATGACCAGAGATGGTG (nt
			1144-1162 of SEQ ID: 157)
158	TT13 Mut	Mutant	Truncated protein, G→R change
	P3	Protein
159	TT16-1	Mutant	TACTTGAAGACCAGTGGAAT (nt	tt16-1
	CDS-Mut	Coding	211-230 of SEQ ID: 45) →
		region	TACTTGAAGACCCAGTGGAAT
			(nt 211-231 of SEQ ID: 159)
160	TT16 Mut	Mutant	Frameshift caused by 1 bp insertion
	P1	Protein
161	TT16-2	Mutant	TACTTGAAGACCAGTGGAAT (nt	tt16-2
	CDS-Mut	Coding	211-230 of SEQ ID: 45) →
		region	TACTTGAAGACGCAGTGGAAT
			(nt 211-231 of SEQ ID: 161)
162	TT16 Mut	Mutant	Frameshift caused by 1 bp insertion
	P2	Protein
163	TT16-3	Mutant	TACTTGAAGACCAGTGGAAT (nt	tt16-3
	CDS-Mut	Coding	211-230 of SEQ ID: 45) →
		region	TACTTGAAGACTCAGTGGAAT
			(nt 211-231 of SEQ ID: 163)
164	TT16 Mut	Mutant	Frameshift caused by 1 bp insertion
	P3	Protein
165	TTG1 CDS-	Mutant	GATCTCCTCGCTTCCTCCGGCG	Y1067, Y1126
	Mut	Coding	ATTTCCT (nt 286-314 of SEQ
		region	ID: 75) → GATC---------------------
			TCCT (nt 286-293 of SEQ ID: 165)
166	TTG1 Mut	Mutant	LOF caused by 21 bp/7 aa deletion
	P1	Protein
167	TTG1-1	Mutant	TCGCTTCCTCCGGCGATTT (nt	ttg1-1, E5-544
	CDS-Mut	Coding	293-311 of SEQ ID: 75) →
		region	TCGCTTCCTTCGGCGATTT (nt
			293-311 of SEQ ID: 167)
168	TTG1 Mut	Mutant	Presumed LOF due to S→F aa
	P2	Protein	change
169	TTG1-2	Mutant	TCGCTTGGGGAGAAGCTAG (nt	ttg1-2, A7-187
	CDS-Mut	Coding	542-560 of SEQ ID: 75) →
		region	TCGCTTGGGAAGAAGCTAG (nt
			542-560 of SEQ ID: 169)
170	TTG1 Mut	Mutant	Presumed LOF due to G→E aa
	P3	Protein	change
171	GL3 CDS	WT	Transcription activator of bHLH	GL3, MYC6.2
		Coding	superfamily involved in cell fate	basic helix-loop-
		region	specification. In association with	helix protein
172	GL3 ORF	WT Protein	TTG1, promotes trichome formation.
173	GL3 Ta	WT Gene	Together with MYB75/PAP1, plays a
	locus		role in the activation of anthocyanin
			biosynthesis. Activates the
			transcription of GL2.
174	GL3-1 CDS-	Mutant	CAACTTAGGGAGCTTTACG (nt	gl3-1, E5-541, E5-
	Mut	Coding	241-259 of SEQ ID: 171) →	559
		region	CAACTTAGGAAGCTTTACG (nt
			241-259 of SEQ ID: 174)
175	GL3 Mut P1	Mutant	Presumed LOF due to E→K aa
		Protein	change
176	GL3-2 CDS-	Mutant	GCCGACACAGAGTGGTACT (nt	gl3-2, A7-92, E5-
	Mut	Coding	358-376 of SEQ ID: 171) →	444
		region	GCCGACACAAAGTGGTACT (nt
			358-376 of SEQ ID: 176)
177	GL3 Mut P2	Mutant	Presumed LOF due to E→K aa
		Protein	change
178	GL3-3 CDS-	Mutant	GGTTTAACTGATAATTTAA (nt	gl3-3, A7-229, E5-
	Mut	Coding	1663-1681 of SEQ ID: 171) →	582
		region	GGTTTAACTAATAATTTAA (nt
			1663-1681 of SEQ ID: 178)
179	GL3 Mut P3	Mutant	Presumed LOF due to D→N aa
		Protein	change
180	BAN-1	Mutant	ATCAAGCCAGGGATACAAG (nt	ban-1, BJ8, BJ8D
	CDS-Mut	Coding	319-337 of SEQ ID: 9) →
		region	ATCAAGCCAAGGATACAAG (nt
			319-337 of SEQ ID: 9 and SEQ
			ID: 180)
181	BAN Mut	Mutant	Presumed LOF due to G→R aa
	P1	Protein	change
182	TT4-3 CDS-	Mutant	CTCACCCTGGAGGTCCTGC (nt	tt4-3, A7-229, E5-
	Mut	Coding	923-941 of SEQ ID: 57) →	582
		region	CTCACCCTGAAGGTCCTGC (nt
			923-941 of SEQ ID: 182)
183	TT4-3 Mut	Mutant	Presumed LOF due to G→R aa
	P1	Protein	change

[0038] In certain embodiments, pennycress plants having reduced seed coat fiber, lighter-colored seed coat, and/or higher seed oil content as described herein can be from the Y1067, Y1126, BC38, BJ8, P32, J22, Q36, BD24, AX17, E5-444, E5-540, E5-541, E5-542, E5-543, E5-544, E5-545, E5-547, E5-549, E5-582, E5-586, D3-N10 P5, D5-191, A7-95, A7-187, or A7-261 variant lines provided herein, or can be progeny derived from those lines.

[0039] A representative wild-type (WT) pennycress TT2 coding sequence is as shown in sequence listing (SEQ ID NO:1). In certain embodiments, a WT pennycress TT2 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:1), and is referred to as an allelic variant sequence. In certain embodiments, a TT2 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:1. A representative wild-type pennycress TT2 polypeptide is shown in sequence listing (SEQ ID NO:2). In certain embodiments, a WT pennycress TT2 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:2) and is referred to as an allelic variant sequence.

[0040] In certain embodiments, a WT pennycress TT2 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:2), referred to herein as an allelic variant sequence, provided the polypeptide maintains its wild-type function. For example, a TT2 polypeptide can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99) percent sequence identity to SEQ ID NO:2. A TT2 polypeptide of an allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:2.

[0041] In certain embodiments, pennycress seed lots having reduced seed coat fiber, lighter-colored seed coat due to reduced proanthocyanidins content, and/or higher seed oil content as described herein can include at least one loss-of-function modification in a TT2 gene (e.g., in a TT2 coding sequence, in a TT2 regulatory sequence including the promoter, 5′ UTR, intron, 3′ UTR, or in any combination thereof) or a transgene that suppresses expression of the TT2 gene. As used herein, a loss-of-function mutation in a TT2 gene can be any modification that is effective to reduce TT2 polypeptide expression or TT2 polypeptide function. In certain embodiments, reduced TT2 polypeptide expression and/or TT2 polypeptide function can be eliminated or reduced in comparison to a wild-type plant. Examples of genetic modifications that can provide for a loss-of-function mutation include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, or any combination thereof.

[0042] In certain embodiments, pennycress seed lots having reduced seed coat fiber, lighter-colored seed coat, and/or higher seed oil and/or protein content as described herein can include a substitution (e.g., a single base-pair substitution) relative to the WT pennycress TT2 coding sequence. In certain embodiments, a modified TT2 coding sequence can include a single base-pair substitution of the cytosine (G) at nucleotide residue 330 in a WT pennycress TT2 coding sequence (e.g., SEQ ID NO:1 or an allelic variant thereof). The G at nucleotide residue 330 can be substituted with any appropriate nucleotide (e.g., thymine (T), adenine (A), or cytosine (C)). For example, a single base-pair substitution can be a G to A substitution at nucleotide residue 330 in a WT pennycress TT2 coding sequence thereby producing a premature stop codon. A representative modified pennycress TT2 coding sequence having a loss-of-function single base pair substitution is presented in SEQ ID NO:4.

[0043] A modified pennycress TT2 coding sequence having a loss-of-function single base pair substitution (e.g., SEQ ID NO:4) can encode a modified TT2 polypeptide (e.g., a modified TT2 polypeptide having reduced TT2 polypeptide expression and/or reduced TT2 polypeptide function). For example, a modified pennycress TT2 coding sequence having a single base-pair substitution (e.g., SEQ ID NO:4) can encode a modified TT2 polypeptide. In certain embodiments, a modified TT2 polypeptide can include a truncation resulting from the introduction of a stop codon at codon position 110 within the TT2 open reading frame (e.g., SEQ ID NO:4). A representative truncated pennycress TT2 polypeptide is presented in SEQ ID NO:5. Representative pennycress varieties having a mutation in the TT2 gene include the tt2-1, tt2-2, BC38, and E5-547 varieties.

[0044] A representative WT pennycress TRANSPARENT TESTA8 (TT8) coding region is presented in SEQ ID NO:69. Two protospacer locations and adjacent protospacer-adjacent motif (PAM) sites that can be targeted by, for example, CRISPR-SpCAS9 correspond to nucleotides 164-183 and 287-306 (protospacers) or 184-186 and 284-286 (PAM sites). In another embodiment, two separate examples of alternative protospacer locations and adjacent protospacer-adjacent motifs (PAM) sites are provided in FIGS. 3-5. In each case, two protospacer locations can be targeted by, for example, CRISPR-FnCpf1, CRISPR-SmCsm1 or a similar enzyme, correspond to nucleotides 175-153 and 261-283 (protospacers) or 179-176 and 257-260 (PAM sites); and nucleotides 145-167 and 274-296 (protospacers) or 141-144 and 270-273 (PAM sites), all of SEQ ID NO:69.

[0045] In certain embodiments, a WT pennycress TT8 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:69), and is referred to as an allelic variant sequence. In certain embodiments, a TT8 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:69. A representative WT pennycress TT8 polypeptide is presented in SEQ ID NO:70.

[0046] In certain embodiments, a WT pennycress TT8 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:70) and is referred to as an allelic variant sequence. For example, a TT8 polypeptide can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:70. A TT8 polypeptide can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:70.

[0047] In certain embodiments, pennycress seed lots having reduced fiber content as described herein can include a loss-of-function modification in a TT8 gene (e.g., in a TT8 coding sequence) or a transgene that suppresses expression of the TT8 gene. As used herein, a loss-of-function mutation in a TT8 gene can be any modification that is effective to reduce TT8 polypeptide expression or TT8 polypeptide function. In certain embodiments, reduced TT8 polypeptide expression and/or TT8 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT8 gene mutations include the mutations shown in SEQ ID NO:127, 129, 131, 133, 135, and 137 that result in the TT8 mutant polypeptides of SEQ ID NO:128, 130, 132, 134, 136, and 138, respectively. Representative pennycress varieties with TT8 gene mutations include the tt4-2 tt8-1, tt8-2, tt8-3, tt8-11, tt8-12, tt8-12, tt8-13, 10193, E5-542, E5-548, D5-191, D3-N25P1, E5-590, A7-191, and D3-N10 P5 varieties.

[0048] In certain embodiments, a WT pennycress TT1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:27 or 30), and is referred to as an allelic variant sequence. In certain embodiments, a TT1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:27 or 30. In certain embodiments, a WT pennycress TT1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:28 or 31), and is referred to as an allelic variant sequence. For example, a TT1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:28 or 31. A TT1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:28 or 31.

[0049] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT1 encoding gene or a transgene that suppresses expression of the TT1 gene. As used herein, a loss-of-function mutation in a TT1 gene can be any modification that is effective to reduce TT1 polypeptide expression or TT1 polypeptide function. In certain embodiments, reduced TT1 polypeptide expression and/or TT1 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0050] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT1 encoding gene, a promoter thereof, or a terminator, thereof, or a transgene that suppresses expression of the TT1 gene. As used herein, a loss-of-function mutation in a TT1 gene can be any modification that is effective to reduce TT1 polypeptide expression or TT1 polypeptide function. In certain embodiments, reduced TT1 polypeptide expression and/or TT1 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0051] In certain embodiments, a WT pennycress TT4 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:57), and is referred to as an allelic variant sequence. In certain embodiments, a TT4 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:57. In certain embodiments, a WT pennycress TT4 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:58), and is referred to as an allelic variant sequence. For example, a TT4 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:58. A TT4 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:58.

[0052] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT4 encoding gene or a transgene that suppresses expression of the TT4 gene. As used herein, a loss-of-function mutation in a TT4 gene can be any modification that is effective to reduce TT4 polypeptide expression or TT4 polypeptide function. In certain embodiments, reduced TT4 polypeptide expression and/or TT4 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT4 gene mutations include the mutation shown in SEQ ID NO:119 that results in the truncated TT4 mutant polypeptide of SEQ ID NO:120. Representative TT4 gene mutations also include the mutations shown in SEQ ID NO:117 and 182 that result in the TT4 mutant polypeptides of SEQ ID NO: 118 and 183, respectively. Representative pennycress varieties with TT4 gene mutations include the tt4-1, tt4-2, tt4-3, A7-229, E5-582 and E5-549 varieties.

[0053] In certain embodiments, a WT pennycress TT5, TT9, TT15, TT18, or TT19 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:60, 72, 42, 48, or 51, respectively), and is referred to as an allelic variant sequence. In certain embodiments, a TT5, TT9, TT15, TT18, or TT19 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:60, 72, 42, 48, or 51, respectively. In certain embodiments, a WT pennycress TT5, TT9, TT15, TT18, or TT19 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:61, 73, 43, 49, or 52, respectively), and is referred to as an allelic variant sequence. For example, a TT5, TT9, TT15, TT18, or TT19 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:61, 73, 43, 49, or 52, respectively. A TT5, TT9, TT15, TT18, or TT19 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:61, 73, 43, 49, or 52, respectively.

[0054] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT5, TT9, TT15, TT18, or TT19 encoding gene or a transgene that suppresses expression of the TT5, TT9, TT15, TT18, or TT19 gene. As used herein, a loss-of-function mutation in a TT5 gene can be any modification that is effective to reduce TT5, TT9, TT15, TT18, or TT19 polypeptide expression or TT5, TT9, TT15, TT18, or TT19 polypeptide function. In certain embodiments, TT5, TT9, TT15, TT18, or TT19 polypeptide expression and/or TT5, TT9, TT15, TT18, or TT19 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0055] In certain embodiments, a WT pennycress TT6 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:63), and is referred to as an allelic variant sequence. In certain embodiments, a TT6 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:63. In certain embodiments, a WT pennycress TT6 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:64), and is referred to as an allelic variant sequence. For example, a TT6 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:64. A TT6 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:64.

[0056] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT6 encoding gene or a transgene that suppresses expression of the TT6 gene. As used herein, a loss-of-function mutation in a TT6 gene can be any modification that is effective to reduce TT6 polypeptide expression or TT6 polypeptide function. In certain embodiments, reduced TT6 polypeptide expression and/or TT6 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT6 gene mutations include the mutation shown in SEQ ID NO:121 that results in the TT6 mutant polypeptide of SEQ ID NO:122. Representative pennycress varieties with TT6 gene mutations mutants include the tt6-1 and AX17 varieties. Representative TT6 gene mutations also include the mutation shown in SEQ ID NO:123 that results in the TT6 mutant polypeptide of SEQ ID NO:124. Representative pennycress varieties with TT6 gene mutations mutants also include the tt6-1, tt6-2 and Q36 varieties.

[0057] In certain embodiments, a WT pennycress TT7 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:66), and is referred to as an allelic variant sequence. In certain embodiments, a TT7 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:66. In certain embodiments, a WT pennycress TT7 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:67), and is referred to as an allelic variant sequence. For example, a TT7 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:67. A TT7 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:67.

[0058] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT7 encoding gene or a transgene that suppresses expression of the TT7 gene. As used herein, a loss-of-function mutation in a TT7 gene can be any modification that is effective to reduce TT7 polypeptide expression or TT7 polypeptide function. In certain embodiments, reduced TT7 polypeptide expression and/or TT7 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT7 gene mutations include the mutation shown in SEQ ID NO:125 that results in the TT7 mutant polypeptide of SEQ ID NO:126. Representative pennycress varieties with TT7 gene mutations include the tt7-1, A7-3, E5-586, E5-484 P15, and E5-484 P5 varieties.

[0059] In certain embodiments, a WT pennycress TTG1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:75), and is referred to as an allelic variant sequence. In certain embodiments, a TTG1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:75. In certain embodiments, a WT pennycress TTG1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:76), and is referred to as an allelic variant sequence. For example, a TTG1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:28 or 31. A TTG1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:76.

[0060] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function (LOF) modification in a TTG1 encoding gene or a transgene that suppresses expression of the TTG1 gene. As used herein, a loss-of-function mutation in a TTG1 gene can be any modification that is effective to reduce TTG1 polypeptide expression or TTG1 polypeptide function. In certain embodiments, reduced TTG1 polypeptide expression and/or TTG1 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. In certain embodiments, a LOF mutation in a TTG1 gene can comprise a 21 bp deletion in the TTG1 coding sequence as shown in SEQ ID NO:165. In other embodiments, a LOF mutation in a TTG1 gene can comprise ttg1-1 and ttg1-2 mutant alleles having single nucleotide substitutions that result in the substitution of a conserved amino acid residue in the TTG protein (SEQ ID NOs:167-170). Representative TTG1 gene mutations thus include the mutations shown in SEQ ID NO:165, 167, and 169 that result in the TTG1 mutant polypeptides of SEQ ID NO:166, 1268, and 170, respectively. Representative pennycress varieties with TTG1 gene mutations include the Y1067, Y1126, ttg1-1, E5-544, ttg1-2, and A7-187 varieties.

[0061] In certain embodiments, a WT pennycress TT10 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:33), and is referred to as an allelic variant sequence. In certain embodiments, a TT10 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:33. In certain embodiments, a WT pennycress TT10 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:34), and is referred to as an allelic variant sequence. For example, a TT10 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:34. A TT10 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:34.

[0062] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT10 encoding gene or a transgene that suppresses expression of the TT10 gene. As used herein, a loss-of-function mutation in a TT10 gene can be any modification that is effective to reduce TT10 polypeptide expression or TT10 polypeptide function. In certain embodiments, reduced TT10 polypeptide expression and/or TT10 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0063] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT10 encoding gene or a transgene that suppresses expression of the TT10 gene. As used herein, a loss-of-function mutation in a TT10 gene can be any modification that is effective to reduce TT10 polypeptide expression or TT10 polypeptide function. In certain embodiments, reduced TT10 polypeptide expression and/or TT10 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT10 gene mutations include the mutations shown in SEQ ID NO:139, 141, 143, 145, or 147 that result in the TT10 mutant polypeptides of SEQ ID NO: 140, 142, 144, 146, or 148, respectively. Representative pennycress varieties with TT10 gene mutations include the tt10-1, tt10-2, tt10-1, tt10-12, tt10-13, E5-539, E5-543, and E5-545 varieties.

[0064] In certain embodiments, a WT pennycress TT12 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:36), and is referred to as an allelic variant sequence. In certain embodiments, a TT12 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:36. In certain embodiments, a WT pennycress TT12 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:37), and is referred to as an allelic variant sequence. For example, a TT12 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:37. A TT12 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:37.

[0065] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT12 encoding gene or a transgene that suppresses expression of the TT12 gene. As used herein, a loss-of-function mutation in a TT12 gene can be any modification that is effective to reduce TT12 polypeptide expression or TT12 polypeptide function. In certain embodiments, reduced TT12 polypeptide expression and/or TT12 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0066] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT12 encoding gene or a transgene that suppresses expression of the TT12 gene. As used herein, a loss-of-function mutation in a TT12 gene can be any modification that is effective to reduce TT12 polypeptide expression or TT12 polypeptide function. In certain embodiments, reduced TT12 polypeptide expression and/or TT12 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT12 gene mutations include the mutations shown in SEQ ID NO:149 or 151 that result in the TT12 mutant polypeptides of SEQ ID NO:150 or 152, respectively. Representative pennycress varieties with TT12 gene mutations include the tt12-1, tt12-2, A7-261, and J22 varieties.

[0067] In certain embodiments, a WT pennycress TT13 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:39), and is referred to as an allelic variant sequence. In certain embodiments, a TT13 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:39. In certain embodiments, a WT pennycress TT13 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:40), and is referred to as an allelic variant sequence. For example, a TT13 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:40. A TT13 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:40.

[0068] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT13 encoding gene or a transgene that suppresses expression of the TT13 gene. As used herein, a loss-of-function mutation in a TT13 gene can be any modification that is effective to reduce TT13 polypeptide expression or TT13 polypeptide function. In certain embodiments, reduced TT13 polypeptide expression and/or TT13 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT13 gene mutations include the mutations shown in SEQ ID NO:153, 155, or 157 that result in the TT13 mutant polypeptides of SEQ ID NO:154, 156, or 158, respectively. Representative pennycress varieties with TT13 gene mutations include the tt13-1, tt13-2, tt13-3, aha10-1, J22, and P32 E5-540 varieties.

[0069] In certain embodiments, a WT pennycress TT16 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:45), and is referred to as an allelic variant sequence. In certain embodiments, a TT16 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:45. In certain embodiments, a WT pennycress TT16 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:46), and is referred to as an allelic variant sequence. In certain embodiments, a TT16 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:46. A TT16 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:46.

[0070] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT16 encoding gene or a transgene that suppresses expression of the TT16 gene. As used herein, a loss-of-function mutation in a TT16 gene can be any modification that is effective to reduce TT16 polypeptide expression or TT16 polypeptide function. In certain embodiments, reduced TT16 polypeptide expression and/or TT16 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

[0071] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a TT16 encoding gene or a transgene that suppresses expression of the TT16 gene. As used herein, a loss-of-function mutation in a TT16 gene can be any modification that is effective to reduce TT16 polypeptide expression or TT16 polypeptide function. In certain embodiments, reduced TT16 polypeptide expression and/or TT16 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. Representative TT16 gene mutations include the mutations shown in SEQ ID NO:159, 161, or 163 that result in the TT16 mutant polypeptides of SEQ ID NO:160, 162, or 164, respectively. Representative pennycress varieties with TT16 gene mutations include the tt16-1, tt16-2, and tt16-3 varieties.

[0072] In certain embodiments, a genome editing system such as a CRISPR-Cas9 system can be used to introduce one or more loss-of-function mutations into genes such as the TRANSPARENT TESTA (TT) and related genes provided herewith in Table 1 and the sequence listing that are associated with agronomically-relevant seed traits including reduced seed coat fiber, lighter-colored seed coat due to reduced proanthocyanidins content, increased protein content, and/or higher seed oil content. For example, a CRISPR-Cas9 vector can include at least one guide sequence specific to a pennycress TT2 sequence (see, e.g., SEQ ID NO:1) and/or at least one guide sequence specific to a pennycress TT8 sequence (see, e.g., SEQ ID NO:5). A Cas9 enzyme will bind to and cleave within the gene when the target site is followed by a PAM sequence. For example, the canonical SpCAS9 PAM site is the sequence 5′-NGG-3′, where N is any nucleotide followed by two guanine (G) nucleotides. The Cas9 component of a CRISPR-Cas9 system designed to introduce one or more loss-of-function modifications described herein can be any appropriate Cas9. In certain embodiments, the Cas9 of a CRISPR-Cas9 system described herein can be a Streptococcus pyogenes Cas9 (SpCas9). One example of an SpCas9 is described in (Fauser et al., 2014).

[0073] In certain embodiments, a WT pennycress GL3 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:171), and is referred to as an allelic variant sequence. In certain embodiments, a GL3 coding sequence allelic variants can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:171. In certain embodiments, a WT pennycress GL3 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:172), and is referred to as an allelic variant sequence. For example, a GL3 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:160. A GL3 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:172.

[0074] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a GL3 encoding gene or a transgene that suppresses expression of the GL3 gene. As used herein, a loss-of-function mutation in a GL3 gene can be any modification that is effective to reduce GL3 polypeptide expression or GL3 polypeptide function. In certain embodiments, GL3 polypeptide expression and/or GL3 polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. In certain embodiments, the GL3 mutation can comprise the coding sequence mutations of SEQ ID NO:174, 176, 178 and/or the protein sequence mutation of SEQ ID NO:175, 177, 180. Representative pennycress varieties with GL3 gene mutations include the gl3-1, gl3-2, gl3-3, E5-541, E5-559, A7-92, E5-444, A7-229, and E5-582 varieties.

[0075] In certain embodiments, a WT pennycress BAN-ANR (or BAN) coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:9), and is referred to as an allelic variant sequence. In certain embodiments, a BAN coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:9. In certain embodiments, a WT pennycress BAN polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:10), and is referred to as an allelic variant sequence. For example, a BAN polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:10. A BAN polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:10.

[0076] In certain embodiments, pennycress seed lots having reduced fiber as described herein can include a loss-of-function modification in a BAN encoding gene or a transgene that suppresses expression of the BAN gene. As used herein, a loss-of-function mutation in a BAN gene can be any modification that is effective to reduce BAN polypeptide expression and/or BAN polypeptide function. In certain embodiments, BAN polypeptide expression and/or BAN polypeptide function can be eliminated or reduced. Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. In certain embodiments, the BAN mutation can comprise the coding sequence mutation of SEQ ID NO:180 and/or the protein sequence mutation of SEQ ID NO:181. Representative pennycress varieties with BAN gene mutations include the ban-1, BJ8, and BJ8D varieties.

[0077] In certain embodiments, pennycress seeds or seed lots having reduced fiber, as well as pennycress seed meal obtained therefrom (including both defatted and non-defatted seed meal), as described herein can include a loss-of-function mutation in more than one of the genes or coding sequences set forth in Table 1. In certain embodiments, pennycress seeds or seed lots having reduced fiber can have a LOF mutation in the gene(s) and/or coding sequences of any combination of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and/or any allelic variants thereof. In certain embodiments, pennycress seed meal, including de-fatted and non-defatted forms) and having reduced fiber can comprise a detectable amount of any combination of nucleic acids having a LOF mutation in the gene(s) and/or coding sequences of any combination of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and/or any allelic variants thereof.

[0078] The LOF mutations in any of the genes or coding sequences of Table 1 can be introduced by a variety of methods. Methods for introduction of the LOF mutations include, but are not limited to, traditional mutagenesis (e.g., with EMS or other mutagens), TILLING, meganucleases, zinc finger nucleases, transcription activator-like effector nucleases, clustered regularly interspaced short palindromic repeat (CRISPR)-associated nuclease (e.g., S. pyogenes Cas9 and its variants, S. aureus Cas9 and its variants, eSpCas9, Cpf1, Cms1 and their variants) targetrons, and the like. Various tools that can be used to introduce mutations into genes have been disclosed in Guha et al. Comput Struct Biotechnol J. 2017; 15: 146-160. Methods for modifying genomes by use of Cpf1 or Csm1 nucleases are disclosed in US Patent Application Publication 20180148735, which is incorporated herein by reference in its entirety, and can be adapted for introduction of the LOF mutations disclosed herein. Methods for modifying genomes by use of CRISPR/CAS systems are disclosed in US Patent Application Publication 20180179547, which is incorporated herein by reference in its entirety, and can be adapted for introduction of the LOF mutations disclosed herein. The genome editing reagents described herein can be introduced into a pennycress plant by any appropriate method. In certain embodiments, nucleic acids encoding the genome editing reagents can be introduced into a plant cell using Agrobacterium or Ensifer mediated transformation, particle bombardment, liposome delivery, nanoparticle delivery, electroporation, polyethylene glycol (PEG) transformation, or any other method suitable for introducing a nucleic acid into a plant cell. In certain embodiments, the Site-Specific Nuclease (SSN) or other expressed gene editing reagents can be delivered as RNAs or as proteins to a plant cell and the RT, if one is used, can be delivered as DNA.

[0079] The disclosure will be further described in the following examples, which do not limit the scope of the disclosure described in the claims.

[0080] Higher dietary fiber results in lower net energy for swine (Kil et al., 2013) and poultry (Meloche et al., 2013). It was also reported that hemicellulose displayed the strongest correlation with apparent metabolizable energy (AMEn), followed by neutral detergent fiber (NDF), total dietary fiber (TDF), and crude fiber (CF) in broilers fed corn co-products (Rochelle et al., 2011). Thus, a reduction in fiber will result in increased available energy to pigs and poultry.

[0081] When comparing mechanically expeller-pressed meals made from two USDA-developed pennycress varieties (Beecher and Ruby II) to mechanically expeller-pressed canola meal, the various fiber fractions when analyzed as crude fiber (CF), acid detergent fiber (ADF), neutral detergent fiber (NDF) and total dietary fiber (TDF) were 1.5-2 times the levels in canola meal (Table 2). Similar levels were observed when comparing different lots of pennycress meal with canola meal (Table 3). Analysis conducted by Arvegenix at University of Georgia showed similar results (Table 4).

[0082]

TABLE 2
Nutrient composition of mechanically expeller-pressed canola and
pennycress meals produced at Dairyland by Arvegenix in August 2015.
All numbers are in percent dry weight (% DW).
Meal	Expeller-Pressed	Pennycress Meal	Pennycress Meal
Constituent	Canola Meal	(Beecher)	(Ruby II)
Crude Protein	38.7	31.3	31.1
Either extract	11.2	10.1	10.6
Crude fiber	10.9	27.1	27.9
ADF	18.1	35.6	33.8
NDF	22.7	40.5	36.8
Total Dietary	29.5	43.3	37.8
Fiber

[0083]

TABLE 3
Lot variation in proximate values in mechanically expeller-pressed pennycress
meal, composite mechanically expeller-pressed pennycress meal blend (all produced
by Arvegenix), and commercially available mechanically expeller-pressed canola
(ME Canola). All numbers represent the average of duplicate analytical runs
for mean and standard error measured in percent dry weight (% DW).
	Meal Constituent Processing Date(s)
					Blend*	ME
	Lot 1	Lot 2	Lot 3	Lot 4	22-27	Canola
	22 Jul. 2015	23 Jul. 2015	23 Jul. 2015	23 Jul. 2015	Jul. 2015	N/A
Moisture (%	2.12 ± 0.08	6.10 ± 0.1	5.20 ± 0.01	4.06 ± 0.08	3.36 ± 0.05	4.41 ± 0.13
FW)
Ash Content	7.32 ± 0.06	7.24 ± 0.1	7.13 ± 0.01	7.17 ± 0.02	5.62 ± 2.38	6.88 ± 0.02
Carbohydrates	51.4 ± 0.07	50.9 ± 0.7	50.9 ± 0.14	49.7 ± 0.07	49.8 ± 2.26	40.7 ± 1.3
Crude Fat	8.99 ± 0.03	10.3 ± 0.01	10.6 ± 0.14	11.1 ± 0.01	11.6 ± 0.01	13.5 ± 1.5
Crude	32.2 ± 0.1	31.6 ± 0.7	31.4 ± 0.1	32.0 ± 0.01	33.1 ± 0.1	38.9 ± 0.2
Protein
Crude Fiber	28.7 ± 1.2	29.5 ± 2.1	30.3 ± 0.2	28.0 ± 0.1	26.4 ± 0.6	10.9 ± 0.5
Acid	37.9 ± 0.5	38.7 ± 0.1	36.7 ± 2.8	36.8 ± 0.5	32.1 ± 0.8	18.25 ± 0.1
Detergent
Fiber
Neutral	39.8 ± 0.6	39.9 ± 0.1	39.5 ± 0.8	38.5 ± 0.6	34.8 ± 2.0	23.3 ± 0.2
Detergent
Fiber
Total Dietary	41.6 ± 1.2	41.2 ± 1.2	41.0 ± 1.0	39.0 ± 0.1	42.2 ± 7.4	29.7 ± 1.3
Fiber
*The Blend sample, consisting of Lots 1-4 (~66% by weight) and Lot 5 (~33% by weight), was blended and analyzed for nutrition studies.

[0084]

TABLE 4
Proximate compositions (% as is) for canola meal (CM) and
pennycress meal samples.
	CM1	PM2
	Crude Protein	36.7	32.0
	Fat	11.4	8.61
	Crude Fiber	9.27	19.9
	ADF3	18.3	39.6
	NDF4	22.7	43.0
	Ash	6.51	7.57
	Dry Matter	94.1	94.4

[0085] Total Metabolizable Energy (TMEn) corrected for nitrogen was measured in mechanically expeller-pressed pennycress meal and canola meal. TMEn was found to be 18.2% or 18.9% less in the pennycress meal as compared to the canola meal when fed to chickens due to the higher fiber content (Table 5) and Metabolizable Energy (ME) was 16% less in pennycress meal as compared to the canola meal when fed to pigs due to the higher fiber content (Table 6).

[0086]

TABLE 5
Total metabolizable energy corrected for nitrogen (TMEn) for
mechanically expeller-pressed canola and pennycress meal when
fed to chickens.
	Mech
	Pennycress Meal	Mech Canola
	(Beecher)	Meal	Difference, %
Energy	Parsons 2015	Parsons 2006
TMEn (kcal/g DM)	2.455	3	−18.17

[0087]

TABLE 6
Concentration of digestible energy (DE) and metabolizable energy (ME) in
pennycress expeller and canola expellers when fed to pigs (data1 produced
at University of Illinois).
	Ingredients
		Canola
Item	Pennycress expellers	expellers	SEM	P-value
DE, kcal/kg	3,191	3,582	92.18	0.009
DE, kcal/kg of DM	3,536	3,833	99.43	0.053
ME, kcal/kg	2,652	3,269	143.98	0.009
ME, kcal/kg of DM	2,938	3,499	158.17	0.025
1Data are means of 8 observations per treatment. SEM abbreviation stands for standard error of the mean. DM abbreviation is for Dry Matter.

[0088] In summary, Beecher and Ruby II varieties of pennycress meal contain between 1.5× to 2× the fiber content as compared to similarly processed canola meal resulting in 18-19% less energy when fed to chickens and pigs. Reduction in the fiber content of pennycress to levels of those in canola should result in a significant increase in value and energy to poultry and pigs.

[0089] About 850 wildtype pennycress seed samples exhibited a dark-brown seed coat were collected. These wildtype samples were then cultivated as independent lines for over two seasons in over 10,000 unique and managed plots. Upon careful analysis of the harvests from these dark type plantings, a few individual seeds which were yellow in color were identified in only two of the 850 cultivated lines (Table 2) and selected for further propagation and breeding. Certain selected pennycress variant lines Y1067 and Y1126 were isolated from a cultivated field in Grantfork IL. Certain selected pennycress Y1126 lines were isolated from a cultivated field in Macomb IL in 2015. As no yellow pennycress seeds were reported to date, initially, the isolates were first assumed to be weed seeds from a species other than pennycress. However, upon careful evaluations of plants grown from these seeds in the greenhouse, they were positively identified as pennycress using visual (plant morphology) and molecular (PCR/sequencing) inspections. The selected Y1067 and Y1126 lines were then carefully grown as single seed isolates to produce progeny lines which consisted of 100% yellow seeds. The yellow seed coat trait in the selected Y1067 and Y1126 lines has now been confirmed to be stable for several generations in both greenhouse and field environments.

[0090] Seeds from the yellow-seeded lines (Y1067 and Y1126) were carefully bulked up and sent to an analytical lab (Dairyland Laboratories) for analysis. Upon removal of the oil using standard defatting procedure, a small amount of yellow pennycress meal was produced and determined to have an ADF level (adjusted for oil content) of 15.5% and 11.5% vs. 27.5% in wild type, demonstrating 43-58% reduction in ADF fiber. Other measurements of fiber content such as NDF and CF were also significantly (29-55%) lower in the yellow-seeded lines relative to wild type, while the protein level was significantly (˜50%) higher. The composition of yellow and dark brown seeds is listed in Table 7. The yellow Y1067 and Y1126 lines have since been crossed with “regular” dark brown-seeded pennycress and demonstrated a non-reciprocal pattern of inheritance indicating that yellow seed coat is a maternally inherited trait.

[0091]

TABLE 7
The composition of meal (adjusted for oil content)
made from yellow and dark brown seeds (Dairyland
Laboratories, Arcadia, Wisconsin).
Pennycress	Seed coat	% mois-	ADF	NDF	Crude	Pro-
line	color	ture	fiber	fiber	fiber	tein
Y1067	yellow	6.63	15.5	22.3	15.5	32.4
Y1126	yellow	6.38	11.5	15.2	9.9	31.9
1063	dark brown	7.39	27.2	30.6	22.6	21.3
1067	dark brown	7.29	26.6	29.8	19.9	19.8
1126	dark brown	6.43	28.4	33.7	24.7	24.6
1139	dark brown	6.50	26.4	29.8	19.9	22.4
1204	dark brown	6.58	26.3	28.9	18.7	20.9
1228	dark brown	6.30	28.8	33.8	25.4	22.1
1326	dark brown	6.47	29.2	32.6	23.4	21.7
2032	dark brown	6.16	24.7	28.8	17.6	22.1
2084	dark brown	6.89	26.0	29.0	19.4	22.2
2116	dark brown	7.16	30.4	36.2	24.4	20.1
2133	dark brown	6.64	29.6	34.4	25.0	21.5
2206	dark brown	6.69	25.5	29.4	18.1	20.7
2229	dark brown	6.61	27.1	32.5	23.0	21.9
2253	dark brown	6.42	24.0	28.3	17.8	22.5
2288	dark brown	6.28	26.6	33.0	25.5	N/A
2329	dark brown	6.57	26.6	31.9	18.8	20.8
2369	dark brown	6.05	23.1	26.7	17.9	23.2
2458	dark brown	6.39	25.4	29.8	18.8	22.2
2460	dark brown	6.49	30.6	36.3	26.7	21.2
2369	light brown	6.50	36.9	45.8	32.1	19.1
Average	yellow	6.51	13.5	18.7	12.7	32.2
Average	dark brown	6.59	27.5	32.1	22.0	21.6
% change	yellow	Y1067	−43%	−30%	−29%	50%
% change	yellow	Y1126	−58%	−53%	−55%	48%

[0092] In order to determine molecular nature of the mutations responsible for the low fiber, high oil/high protein phenotype in Y1067 and Y1126 lines, a combination of a genetic method called bulk segregant analysis (Michelmore et. al., 1991) and a next generation sequencing (NGS) method was used. In brief, for each of the yellow-seeded lines, a genetically close black-seeded relative line was identified and 200 individuals from each population were grown. They were harvested in bulk and used for DNA isolation that was subsequently used for preparation of NGS libraries and sequencing using standard Illumina technology. It was determined that Y1067 and Y1126 lines carry the same 21 bp deletion in TTG1 gene (Seq ID No. 165) by analyzing the sequencing data through comparative bioinformatics techniques. Comparative bioinformatics tools that were used in part to analyze the data are disclosed in Magwene et. al., 2011. This mutation results in a deletion of 7 amino acids in the conserved area of TTG1 protein, likely leading to a complete loss of function. The definitive nature of this 21 bp deletion was confirmed in heterologous (black ♀×yellow ♂) crosses, where only the progeny of F2 segregants carrying the described deletion displayed the yellow-seeded phenotype.

[0093] In addition to mutants carrying domestication enabling traits selected from natural isolates, light colored pennycress mutants were isolated from a mutant population created using chemical mutagen (EMS) using the protocol described in the Materials and Methods section below.

[0094] To identify useful domestication genes in pennycress plants, pennycress seeds were mutagenized with several different mutagens, including ethyl methanesulfonate (EMS), fast neutrons (FN) and gamma rays (y rays). Treatment of dry plant seeds with mutagens results in the generation of distinct sets of mutations in a variety of cells in the seed. The fate of many of these cells can be followed when a mutation in one of these cells results in a visible phenotype creating a marked plant sector.

[0095] Pennycress plants exhibiting domestication enabling traits such as reduced seed coat fiber, lighter-colored seed coat due to reduced proanthocyanidins content, and/or higher seed oil content were analyzed and loss of function mutations in domestication genes were identified.

Materials and Methods

[0096] Solutions:

[0097]

A) 0.2M sodium phosphate monobasic (NaH2PO4*H2O)	6.9 g/250 mL
B) 0.2M sodium phosphate dibasic (NaH2PO4 anhydrous)	7.1 g/250 mL
For 50 mL of 0.1M sodium phosphate buffer at pH 7:
9.75 mL	A
15.25 mL	B
25.0 mL	dH2O
0.2% EMS in buffer:
20 mL 0.1M Sodium Phosphate Buffer, pH 7
40 μL EMS liquid (Sigma #M0880-5G)
0.1M sodium thiosulfate at pH 7.3:
12.4 g sodium thiosulfate in 500 mL

Primary Seed Surface Sterilization

[0098] Wild-type pennycress (Thlaspi arvense) seeds (Spring 32 ecotype) were surface sterilized for 10 minutes in a 30% bleach, 0.05% SDS solution before being rinsed 3× with sterile water. Sterilized seeds were immediately subjected to EMS treatment.

Ethyl Methane Sulfonate (EMS) Treatment of Pennycress Seeds

[0099] Sterilized pennycress seeds (41 g) were agitated in distilled water overnight. Four 250 mL Erlenmeyer flasks with 10 g seed each, and 1 g in a separate small flask as a control, were agitated. The water was decanted.

[0100] 25 mLs of 0.2% EMS in 0.1M sodium phosphate buffer (pH 7) was added. The control received only phosphate buffer with no EMS. The flasks were shaken in fume hood for 18 hours. The EMS solution was decanted off into an EMS waste bottle.

[0101] To rinse the seeds, 25 ml of dH₂O was added to each flask, and the flasks were shaken for 20 minutes. The rinse water was decanted into the EMS waste bottle.

[0102] To deactivate the EMS, seeds were washed for 20 minutes in 0.1M sodium thiosulfate (pH 7.3), rinsed 4 with dH₂O for 15 minutes, suspended in 0.1% agarose, and germinated directly in autoclaved Reddiearth soil at a density of approximately 10 seeds per 4-inch pot.

Plant Growth Conditions

[0103] EMS-treated pennycress seeds were germinated and grown in an environmental growth chamber at 21° C., 16:8 6400K fluorescent light/dark, 50% humidity. Approximately 14 days after planting, plants were thinned and transplanted to a density of 4 plants per 4-inch pot. These M₁-generation plants showed telltale chlorotic leaf sectors that are indicative of a successful mutagenesis.

[0104] After dry down, these M₁-generation plants were catalogued and harvested. The M₂- and M₃-generation seeds were surface sterilized, planted and grown according to the protocols previously described.

Identification and Characterization of Light-Colored Seed Coat Mutant Lines

[0105] Light-colored seed coat mutants in the M₃-generation were identified as those having mature seed coats of a lighter color relative to that of wild type. Seeds (M₃-generation) from putative M₂-generation mutants were planted and grown in potting soil-containing 4-inch pots in a growth chamber and the seed coat color phenotype re-assessed upon plant senescence.

[0106] Near infrared (NIR) spectroscopic analysis was used to determine the fiber content of selected seed lines to compare the obtained values to the range of fiber in control dark brown seeds. The results are presented in Table 8 of Example 5 (five light-colored lines mentioned above vs. almost one hundred control dark brown seed lines). These results indicate that ADF and NDF fiber levels in certain selected light-colored seed lines are significantly lower and are outside of the corresponding ranges found in control dark-colored seeds, while oil and protein levels are often higher and are also outside of their corresponding ranges found in dark-colored control seeds.

[0107] EMS mutagenesis typically introduces single-nucleotide transition mutations (e.g. G to A, or C to T) into plant genomes. To identify the causative mutations in selected light seed colored plants, DNA was extracted from mutant and wild-type leaf tissue and used for NGS and comparative bioinformatics analysis as described in Example 3. Underlying gene and protein mutations were identified (Table 1, SEQ ID NO: 117-132, 139-142, 149-158, 167-170 and 174-181) and confirmed using standard Sanger sequencing and genetic segregation analyses.

[0108] Materials and Methods Construction of the Thlaspi arvense (pennycress) TT1, TT2, TT8, TT10, and TT16 gene-specific CRISPR genome-editing vectors.

[0109] The constructs and cloning procedures for generation of the Thlaspi arvense (pennycress) TT2-, TT8-, TT10-, and TT16-specific CRISPR-SpCas9, CRISPR-SaCas9, CRISPR-Cpf1 and CRISPR-Cms1 constructs are described in Fauser et. al., 2014, Steinert et. al., 2015 and Begemann et. al., 2017.

[0110] The plant selectable markers (formerly NPT) in the original pDe-SpCas9 and pDe-SaCas9 binary vectors were swapped for hygromycin resistance (Hygromycin phosphotransferase (HPT) gene.

[0111] Complementary oligo pairs described in Table 1 (Seq ID NO: 89-116) were synthesized, annealed to create the 20-mer protospacers specific to the designated pennycress genes and used for construction of gene-editing binary vectors as described (Fauser et. al., 2014, Steinert et. al., 2015 and Begemann et. al., 2017).

Vector Transformation into Agrobacterium

[0112] The pDe-SpCas9_Hyg and pDe-SaCas9_Hyg and related vectors containing the CRISPR nuclease and guide RNA cassettes with the corresponding sequence-specific protospacers were transformed into Agrobacterium tumefaciens strain GV3101 using the freeze/thaw method (Holsters et al, 1978).

[0113] The transformation product was plated on 1% agar Luria Broth (LB) plates with gentamycin (50 μg/ml) rifampicin (50 μg/ml) and spectinomycin (75 μgimp. Single colonies were selected after two days of growth at 28° C.

Plant Transformation—Pennycress Floral Dip

[0114] DAY ONE: 5 mL of LB+5 uL with appropriate antibiotics (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with Agrobacterium. The cultures were allowed to grow, with shaking, overnight at 28° C.

[0115] DAY TWO (early morning): 25 mL of Luria Broth+25 uL appropriate antibiotics (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with the initial culture from day one. The cultures were allowed to grow, with shaking, overnight at 28° C.

[0116] DAY TWO (late afternoon): 250 mL of Luria Broth+250 uL appropriate antibiotic (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with 25 mL culture. The cultures were allowed to grow, with shaking, overnight at 28° C.

[0117] DAY THREE: When the culture had grown to an OD₆₀₀ of ˜1.0, the culture was decanted into large centrifuge tubes and spun at 3,500 RPM at room temperature for 10 minutes to pellet cells. The supernatant was decanted off. The pelleted cells were resuspended in a solution of 5% sucrose and 0.02% Silwet L-77. The suspension was poured into clean beakers and placed in a vacuum chamber.

[0118] Newly flowering inflorescences of pennycress were fully submerged into the beakers and subjected to a negative vacuum pressure of 25-30 PSI for 10 minutes.

[0119] After pennycress plants were dipped, they were covered loosely with Saran wrap to maintain humidity and kept in the dark overnight before being uncovered and placed back in the environmental growth chamber.

Screening Transgenic Plants and Growth Condition

[0120] Pennycress seeds were surface sterilized by first rinsing in 70% ethanol then incubating 10 minutes in a 30% bleach, 0.05% SDS solution before being rinsed two times with sterile water and plated on selective plates (0.8% agar/one half-strength Murashige and Skoog salts with hygromycin B selection (40 U/ml) or glufosinate (18 μg/ml). Plates were wrapped in parafilm and kept in an environmental growth chamber at 21° C., 16:8 day/night for 8 days until antibiotic or herbicide selection was apparent.

[0121] Surviving hygromycin or glufosinate-resistant T₁-generation seedlings were transplanted into autoclaved Reddiearth soil mix and grown in an environmental growth chamber set to 16-hour days/8-hour nights at 21° C. and 50% humidity. T₂-generation seeds were planted, and ˜1.5 mg of leaf tissue from each T₂-generation plant was harvested with a 3-mm hole punch, then processed using the Thermo Scientific™ Phire™ Plant Direct PCR Kit as per manufacturer's instructions. Subsequently, PCR reactions for genotyping (20 μl volume) were performed.

[0122] Gene editing using Cas9, Cpf1 and Cms1 nucleases typically introduces a double-stranded break into a targeted genome area in close proximity to the nuclease's PAM site. During non-homologous end-joining process (NHEJ), these double-stranded breaks are repaired, often resulting in introduction of indel-type mutations into targeted genomes. To identify plants with small indels in genes of interest, standard Sanger sequencing or T7 endonuclease assay (Guschin et. al., 2010) were employed. Sequence analysis revealed that multiple guide RNAs/CRISPR nuclease combinations were effective in generating loss-of-function (LOF) mutations in targeted genes, as described in Table 1 (Seq ID Nos. 133-138, 143-148, 159-164). Plants carrying LOF mutations were grown to homozygosity, and the phenotypes were confirmed using visual and analytical assessments.

[0123] Homozygous light seed coat-colored mutants obtained from screening EMS populations or from gene editing were bulked up in the greenhouse or in the fields and their fiber composition was assessed using standard methods below at Dairyland Laboratories (Arcadia, Wis.).

ADF (Acid Detergent Fiber)

[0124] Fiber (Acid Detergent) and Lignin in Animal Feed: AOAC Official Method 973.18 (1996) (Modification includes use of Sea Sand for filter aid as needed).

Crude Fiber

[0125] Fiber (Crude) in Animal Feed and Pet Food (Fritted Glass Crucible Method): AOAC Official Method 978.10 ch4 p28 (1979) (Modification includes use of Sea Sand for filter aid as needed).

Lignin

[0126] Fiber (Acid Detergent) and Lignin in Animal Feed: AOAC Official Method 973.18 (1996) (Modification includes use of Sea Sand for filter aid as needed, use of Whatman GF/C filter paper to collect residue, and holding crucibles in beakers to cover fiber with 72% sulfuric acid for full time required).

NDF (Neutral Detergent Fiber)

[0127] Amylase-Treated Neutral Detergent Fiber in Feeds AOAC Official Method 2002.04 2005 (Modification includes use of Sea Sand for filter aid and Whatman GF/C filter paper for residue collection).

[0128] The results presented in Table 8 indicate that majority of the light-colored mutants have 35-60% less fiber and its components relative to WT plants (MN106 and Beecher).

[0129]

TABLE 8
Composition of sixteen selected light-colored pennycress mutants vs. two wild type
pennycress accessions measured using wet chemistry methods at Dairyland Laboratories
(Arcadia, Wisconsin). The numbers represent percent of dry matter (% DM).
		Mutated	Seed		Crude			Crude
No.	Name/ID	Gene/Allele	Coat	Moisture	Protein	ADF	aNDF	fiber
1	Y1126	ttg1	light	7.6	28.1	13.9	16.6	9.6
2	E5-543	tt10-1	light	7.4	26.5	15.3	19.7	14.4
3	E5-542	tt8	light	7.5	30.6	9.1	17.5	13.8
4	E5-547	tt2-1	light	6.7	28.1	12.8	17.2	12.1
5	A7-63	N/A	light	6.9	28.7	14.6	20.5	11.8
6	A7-187	ttg1-2	light	7.5	29.2	12.9	17.8	13.1
7	E5-559	gl3-1	light	7.0	26.3	21.8	32.5	22.5
8	E5-539	tt10-1	light	7.5	27.3	13.9	17.6	12.0
9	A7-261	tt12-1	light	6.6	27.2	14.9	19.5	13.6
10	E5-549	tt4-2	light	7.4	26.5	16.2	22.3	12.7
11	E5-444	gl3-2	light	7.8	27.7	14.6	17.5	10.8
12	D5-191	tt8-2	light	6.5	26.6	13.3	17.9	13.0
13	E5-586	tt7-1	light	7.4	27.9	12.6	17.2	11.3
14	E5-542	tt8-3	light	6.9	26.0	13.5	19.9	16.2
15	E5-541	gl3-1	light	6.8	27.2	15.1	19.2	13.2
16	E5-545	tt10-2	light	6.7	24.5	14.8	18.5	12.9
17	MN106	WT	dark	6.7	25.2	22.7	25.8	16.1
18	Beecher	WT	dark	6.5	25.6	21.1	23.9	15.4
19	MIN of	light-colored	% of DM	6.5	24.5	9.1	16.6	9.6
20	MAX of	light-colored	% of DM	7.8	30.6	21.8	32.5	22.5
21	MIN of	light-colored	% of WT	97%	97%	40%	64%	60%

[0130]

TABLE 9
Composition of five selected light-colored pennycress mutants vs.
95 wild type pennycress accessions harvested at various locations
across USA and measured using NIR spectroscopy analysis.
			%	% Erucic	% Total	Sinigrin	% ADF	% NDF	%
No.	Accession	Color	Moisture	Acid	Oil	μmol/g	Fiber	Fiber	Protein
1	Y1067	Yellow	7.2	25.1	37.6	149.1	15.5	16.2	32.5
2	Y1126	Yellow	8.3	31.1	43.3	49.9	11.5	14.9	31.8
3	P32	Light	6.0	39.5	36.4	180.2	13.5	18.0	29.1
		brown
4	Q36.C	Brown	6.1	22.8	33.0	196.2	19.7	24.1	25.0
5	BJ.8	Tan	7.0	39.0	49.0	107.4	10.0	13.1	33.6
6	1126	Dark	10.2	33.7	30.8	59.2	27.6	31.2	22.2
		brown
7	Spring32	Dark	8.6	34.8	30.6	116.0	27.6	32.2	22.0
	(WT)	brown
8	1069	Dark	8.8	32.9	29.4	103.4	37.8	35.1	22.6
		brown
9	1096	Dark	8.4	31.3	26.0	128.7	32.9	34.2	20.1
		brown
10	2139	Dark	8.7	29.6	23.1	147.0	29.0	33.9	20.4
		brown
11	2057	Dark	8.2	31.0	23.7	157.6	31.5	33.8	18.7
		brown
12	1126	Dark	7.8	29.2	30.6	117.4	34.7	31.1	20.8
		brown
13	2066	Dark	8.7	36.8	35.2	83.0	26.2	29.1	22.4
		brown
14	2142	Dark	8.9	32.6	32.5	85.5	29.8	32.7	20.4
		brown
15	2170	Dark	8.8	31.8	29.4	118.4	30.6	31.3	22.3
		brown
16	2055	Dark	8.7	30.8	27.6	87.1	36.1	34.0	21.1
		brown
17	2065	Dark	9.0	27.8	29.7	127.6	30.0	33.9	19.7
		brown
18	2110	Dark	9.0	27.3	31.4	85.3	35.4	33.1	20.5
		brown
19	2154	Dark	8.7	32.0	34.6	58.1	33.2	32.2	20.1
		brown
20	2195	Dark	8.6	32.3	34.3	61.6	29.2	32.5	19.1
		brown
21	1311	Dark	8.3	34.8	30.1	126.6	26.7	28.4	25.0
		brown
22	2003	Dark	8.3	33.4	25.4	79.5	29.6	29.6	20.7
		brown
23	1065	Dark	8.7	34.2	29.6	112.5	29.2	31.7	23.5
		brown
24	2045	Dark	8.8	33.9	25.3	122.0	33.0	31.9	22.4
		brown
25	2128	Dark	8.5	34.6	29.5	129.3	23.4	27.2	25.2
		brown
26	2182	Dark	8.4	32.7	33.7	81.6	28.2	29.6	22.2
		brown
27	2030	Dark	7.7	31.3	33.2	105.8	24.0	27.7	20.3
		brown
28	2034	Dark	8.1	32.4	29.6	116.9	26.6	30.0	22.9
		brown
29	2072	Dark	8.2	30.2	27.8	97.3	30.8	31.0	21.3
		brown
30	2145	Dark	8.2	33.1	29.7	119.0	23.3	28.6	24.1
		brown
31	1027	Dark	8.0	29.4	30.6	110.6	30.5	29.1	23.4
		brown
32	1323	Dark	8.5	31.2	28.2	115.3	33.0	32.2	23.3
		brown
33	1340	Dark	8.0	32.3	29.2	129.8	28.5	29.4	22.9
		brown
34	2129	Dark	8.0	33.1	29.6	109.4	21.5	27.4	24.1
		brown
35	2167	Dark	8.5	28.6	34.8	71.8	34.4	31.7	21.5
		brown
36	2171	Dark	8.0	33.4	28.6	108.1	24.5	28.5	20.7
		brown
37	1054	Dark	8.3	34.0	29.0	128.4	29.4	31.3	22.2
		brown
38	1092	Dark	8.3	36.6	29.8	131.6	27.2	30.1	22.6
		brown
39	2196	Dark	9.2	32.4	32.5	113.1	22.7	30.7	21.2
		brown
40	2183	Dark	8.1	33.4	28.0	111.7	27.0	30.0	21.2
		brown
41	2020	Dark	8.5	32.5	31.9	128.1	22.5	29.0	21.4
		brown
42	2123	Dark	8.5	34.9	30.9	122.3	22.7	27.1	25.3
		brown
43	1296	Dark	8.0	36.2	30.6	113.3	25.9	28.3	23.7
		brown
44	2062	Dark	8.8	31.6	26.7	117.5	29.5	31.7	22.2
		brown
45	1167	Dark	8.0	34.0	28.3	121.0	31.7	30.4	22.3
		brown
46	1359	Dark	7.7	33.4	29.4	125.9	25.2	27.2	22.9
		brown
47	1265	Dark	8.4	34.6	32.2	78.0	29.6	30.7	22.8
		brown
48	1331	Dark	8.0	37.6	29.0	112.3	27.0	28.3	23.1
		brown
49	2002	Dark	7.9	33.1	27.4	59.8	28.6	30.0	20.6
		brown
50	2009	Dark	7.4	35.9	32.3	67.1	26.7	26.9	22.7
		brown
51	2079	Dark	8.0	37.5	29.3	126.2	21.0	28.3	22.5
		brown
52	2092	Dark	9.1	32.3	33.4	89.7	27.6	33.4	21.0
		brown
53	2107	Dark	8.8	35.8	29.7	103.4	21.3	28.8	21.5
		brown
54	2113	Dark	8.8	31.9	33.7	83.4	28.5	30.3	23.0
		brown
55	2117	Dark	8.2	30.8	26.6	99.0	23.7	29.5	20.9
		brown
56	2132	Dark	8.0	36.1	29.2	121.4	25.1	27.9	23.4
		brown
57	2137	Dark	7.9	32.9	28.8	115.6	27.7	28.8	22.2
		brown
58	2140	Dark	8.7	32.0	27.5	103.9	24.7	31.2	20.7
		brown
59	2008	Dark	7.7	35.0	29.7	75.5	23.8	26.3	22.1
		brown
60	2102	Dark	7.9	18.3	24.0	193.8	35.2	32.3	16.4
		brown
61	2021	Dark	9.0	30.5	28.1	127.7	26.4	33.3	19.7
		brown
62	2114	Dark	9.4	30.6	30.1	114.7	27.1	32.2	20.3
		brown
63	1022	Dark	8.7	33.8	28.4	137.0	26.6	30.8	22.3
		brown
64	2051	Dark	9.4	34.8	31.7	73.9	30.1	32.7	21.3
		brown
65	2073	Dark	9.8	33.5	27.6	132.3	27.3	34.0	20.2
		brown
66	2078	Dark	7.6	37.1	29.2	74.5	22.3	27.4	22.0
		brown
67	2209	Dark	8.1	31.0	28.4	104.2	27.3	29.2	22.1
		brown
68	2210	Dark	8.6	32.5	33.4	86.3	24.9	29.4	20.5
		brown
69	1332	Dark	7.9	36.5	30.1	113.4	24.1	26.9	23.8
		brown
70	2095	Dark	8.6	31.0	27.4	114.6	30.7	31.2	22.8
		brown
71	2143	Dark	9.0	29.1	33.1	97.8	23.7	32.3	21.5
		brown
72	2156	Dark	8.1	35.5	28.5	144.4	22.1	28.7	23.7
		brown
73	1235	Dark	8.1	32.7	27.8	148.3	27.4	28.4	23.0
		brown
74	2058	Dark	8.2	31.1	26.1	142.6	26.3	28.8	23.4
		brown
75	2151	Dark	8.7	29.5	33.2	68.4	37.3	34.1	20.4
		brown
76	1002	Dark	8.1	29.2	26.8	141.7	28.7	31.1	22.1
		brown
77	1218	Dark	8.0	23.9	26.6	120.2	37.9	34.9	18.3
		brown
78	1345	Dark	8.0	36.1	32.5	99.1	27.4	27.9	24.5
		brown
79	1366	Dark	8.0	36.5	31.3	115.1	26.9	28.2	22.4
		brown
80	2185	Dark	9.1	32.9	31.7	97.0	28.1	32.4	21.5
		brown
81	2221	Dark	7.7	35.8	29.9	123.2	23.3	26.9	23.2
		brown
82	2332	Dark	8.2	30.6	28.7	70.4	34.0	31.9	20.9
		brown
83	1149	Dark	8.2	31.7	29.8	114.2	30.5	31.0	23.1
		brown
84	1001	Dark	7.7	30.4	30.7	124.6	29.6	28.2	23.7
		brown
85	1082	Dark	8.1	30.8	30.7	85.6	33.3	30.2	22.4
		brown
86	2286	Dark	8.5	34.2	34.3	74.7	27.2	30.7	22.8
		brown
87	2298	Dark	8.0	33.6	27.5	106.8	25.2	30.6	20.8
		brown
88	2304	Dark	7.6	33.5	29.7	108.0	23.8	26.9	23.0
		brown
89	2308	Dark	8.7	36.0	29.0	113.9	27.0	30.0	22.8
		brown
90	2318	Dark	9.2	31.4	32.5	90.6	28.8	32.3	21.5
		brown
91	2319	Dark	9.0	27.4	32.2	71.6	31.1	35.1	20.2
		brown
92	2332	Dark	8.8	25.0	22.9	169.3	26.7	31.5	17.0
		brown
93	2338	Dark	8.0	24.5	24.1	145.7	20.8	30.9	15.3
		brown
94	2346	Dark	8.3	31.7	27.6	140.9	27.6	30.4	22.8
		brown
95	2347	Dark	8.8	31.0	34.4	78.9	27.8	30.5	22.9
		brown
96	2349	Dark	9.6	31.2	32.3	88.0	26.6	32.2	21.7
		brown
97	2354	Dark	8.3	28.9	27.2	84.5	30.4	30.1	21.7
		brown
98	2359	Dark	7.6	29.3	27.7	101.4	28.2	30.2	20.3
		brown
99	2362	Dark	8.7	30.5	28.6	86.7	30.1	31.3	22.7
		brown
100	2364	Dark	9.2	31.4	32.2	89.6	28.9	34.4	21.6
		brown
		%	% Erucic	% Total	Sinigrin	% ADF	% NDF	%
	Color	Moisture	Acid	Oil	μmol/g	Fiber	Fiber	Protein
Minimum	Light	6.0	22.8	33.0	49.9	10.0	13.1	25.0
Minimum	Dark	7.4	18.3	22.9	58.1	20.8	26.3	15.3
Maximum	Light	8.3	39.5	49	196.2	19.7	24.1	33.6
Maximum	Dark	10.2	37.6	35.2	193.8	37.9	35.1	25.3

[0131] Approximately 13 lbs each of cleaned Y1126 yellow-seeded mutant and regular black-seeded pennycress seed were processed into oil and hexane-extracted meal at the Texas A&M Engineering Experiment Station's Process Engineering Research & Development Center (College Station, Tex.). The material was conditioned using a single deck of the French cooker for approximately 5 minutes at 100° F.±10° F. Conditioned seed was processed using a Ferrel Ross flaking rolls to yield flakes with a thickness of approximately 0.012 inches or thinner.

[0132] The flakes were loaded into a cooker with the objective of inactivating lipases, myrosinases, and other hydrolytic enzymes to facilitate pre-pressing. Maximum steam was used to get the flakes to 190° F. without lingering to avoid activation of such enzymes. This was achieved in 10-15 minutes. The press (Rosedowns Mini 200) was fed from a Wenger metered feeder with flake at a rate of 3.5-4 pounds per minute. The press operated best at 50-55 Hz, which corresponds to 38-40 RPM.

[0133] The presscake was extracted in stainless batch cans using commercial hexane at a temperature of 110-140° F.±10° F. Solvent was added and drained sequentially in 6 rounds of incubation, each of which was approximately 12 minutes. To remove residual hexane and yield desolventized meal, a batch-type desolventizer/toaster (DT) was heated, which showed a product temperature of 150-175° F. under vacuum. Crude oil was made by desolventizing using a Precision Scientific Evaporator. The hexane extracted meal was air dried overnight.

[0134] Samples of the hexane extracted meal were sent to Dairyland and DairyOne Laboratories for analysis. A sample of commercial canola meal was acquired from a feed plant in Wisconsin, which was also sent to DairyOne for comparison.

[0135]

TABLE 10
The meal produced from Y1126 yellow-seeded pennycress mutant is significantly more valuable
(lower in fiber, higher in protein and available energy and nutrients) than regular pennycress
meal and is closer in composition and predicted performance to canola meal.
					Yellow
			Desired		seed
Meal Component	Type	Unit	Change	Pennycress	(Y1126)	Canola
CP	Crude Protein	Protein	% Dry	Increased	31.9	40.5	41.4
			Matter
RUP	Rumen Undegraded	Protein	% CP	No change	41.45	42	55
	Protein
Fat	Oil	Oil	% Dry	No change	1.17	1.69	3.6
			Matter
ADF	Acid Detergent Fiber	Fiber	% Dry	Reduce	41.7	20.6	22.9
			Matter
NDF	Neutral Detergent Fiber	Fiber	% Dry	Reduce	45.5	27.2	34.3
			Matter
Lignin	indigestible cell wall	Fiber	% Dry	Reduce	24.3	7.7	10
	material		Matter
Starch	Starch	Starch	% Dry	No change	0.5	0.5	0.3
			Matter
Sugar	Sugar	Sugar	% Dry	No change	6.5	9.5	8
			Matter
IVTD 24	24 hour In Vitro Total	Energy	% Dry	Increase	65	89	82
	Digestibility		Matter
TDN	Total Digestible Nutrients	Energy	% Dry	Increase	53	68.5	67
			Matter
ME, 1X	Calculated Metabolizable	Energy	Mcal/lb	Increase	0.93	1.33	1.33
	Energy, 1 X maintenance
NEL, 1X	Calculated Net Energy	Energy	Mcal/lb	Increase	1.08	1.52	1.55
	Lactation, 1X
	maintenance
NEG, 1X	Calculated Net Energy	Energy	Mcal/lb	Increase	0.32	0.91	0.93
	Gain, 1X maintenance
NEM, 1X	Calculated Net Energy	Energy	Mcal/lb	Increase	0.86	1.5	1.52
	Maintenance, 1X
	maintenance

[0136] Samples of the meal made from Y1126 yellow-seeded mutant, regular black-seeded pennycress and commercial canola meal were sent to the University of Illinois (Urbana-Champaign, Ill.) for Total Metabolizable Energy corrected for nitrogen (TMEn) and digestible amino acid analysis. The University of Illinois utilized the cecectomized rooster assay to measure TMEn and the digestibility of amino acids.

[0137]

TABLE 11
Y1126 yellow-seed mutant had increased TMEn as compared to the black-
seeded pennycress and was comparable to canola.
		Dry Matter (DM)	TMEn
	Feed	%	Kcal/g DM
	Pennycress	97.0	1.68
	Yellow Seed (Y1126)	97.6	2.02
	Canola	89.1	2.14

[0138]

TABLE 12
Y1126 yellow-seeded mutant has increased true amino acid digestibility as
compared to the black-seeded pennycress and was as digestible or more
so than canola.
	Amino
No.	Acid	Unit	Canola	Yellow Seed Y1126	Pennycress
1	ASP	%	77.6	84.8	79.6
2	THR	%	77.0	79.2	73.6
3	SER	%	76.7	81.8	81.8
4	GLU	%	87.5	90.0	82.6
5	PRO	%	76.0	82.2	66.0
6	ALA	%	76.9	82.4	76.1
7	CYS	%	76.6	71.0	63.7
8	VAL	%	75.5	81.3	72.9
9	MET	%	85.9	84.9	75.8
10	ILE	%	77.2	82.2	75.7
11	LEU	%	81.5	86.1	79.1
12	TYR	%	77.1	83.8	78.2
13	PHE	%	81.6	87.1	80.4
14	LYS	%	73.5	76.7	68.9
15	HIS	%	83.4	86.6	70.1
16	ARG	%	87.0	93.0	83.6
17	TRP	%	95.4	93.2	89.2

• [0139] Kil, D. J., B. G. Kim, and H. H. Stein. (2013). Feed energy evaluation for growing pigs. Asian-Austrs. J. Animal. Sci. 26(9):1205-1217.
• [0140] Meloche, K. J., B. J. Kerr, G. C. Shurson, and W. A. Dozier, III. (2013). Apparent metabolizable energy and prediction equations for reduced-oil corn distillers fried grains with solubles in broiler chicks. Poultry Science 92(12):3176-3183.
• [0141] Rochelle, S. J., B. J. Kerr, and W. A. Dozier III. (2011). Energy determination of corn co-products fed to broiler chicks from 15 to 24 days of age and use of composition analysis to predict nitrogen-corrected apparent metabolizable energy. Poultry Science 90:1999-2007.
• [0142] Slominski B A, Simbaya J, Campbell L D, Rakow G, Guenter W (1999) Nutritive value for broilers of meals derived from newly developed varieties of yellow-seeded canola. Anim Feed Sci Technol 78:249-262.
• [0143] Chauhan, Y. S. and Kumar, K. (1987). Genetics of seed colour in mustard (Brassica juncea L. Czern and Coss), Cruciferae Newsletter 12, 22-23.
• [0144] Appelhagen I, Lu G H, Huep G, Schmelzer E, Weisshaar B, Sagasser M. (2011) TRANSPARENT TESTA1 interacts with R2R3-MYB factors and affects early and late steps of flavonoid biosynthesis in the endothelium of Arabidopsis thaliana seeds. Plant J. 67:406-419.
• [0145] Appelhagen I, Thiedig K, Nordholt N, Schmidt N, Huep G, Sagasser M, Weisshaar B. (2014) Update on transparent testa mutants from Arabidopsis thaliana: characterisation of new alleles from an isogenic collection. Planta 240:955-970.
• [0146] Baudry A, Heim M A, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L. (2004) TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39:366-380.
• [0147] Begemann M B, Gray B N, January E, Gordon G C, He Y, Liu H, Wu X, Brutnell T P, Mockler T C, Oufattole M. (2017) Precise insertion and guided editing of higher plant genomes using Cpf1 CRISPR nucleases. Scientific reports 7:11606.
• [0148] Begemann M B, Gray B N, January E, Singer A, Kesler D C, He Y, Liu H, Guo H, Jordan A, Brutnell T P, Mockler T C. (2017) Characterization and Validation of a Novel Group of Type V, Class 2 Nucleases for in vivo Genome Editing. bioRxiv. 2017:192799.
• [0149] Chen M, Wang Z, Zhu Y, Li Z, Hussain N, Xuan L, Guo W, Zhang G, Jiang L. (2012) The effect of TRANSPARENT TESTA2 on seed fatty acid biosynthesis and tolerance to environmental stresses during young seedling establishment in Arabidopsis. Plant Physiol. 160:1023-1036.
• [0150] Chen M, Xuan L, Wang Z, Zhou L, Li Z, Du X, Ali E, Zhang G, Jiang L. (2014) TRANSPARENT TESTA8 inhibits seed fatty acid accumulation by targeting several seed development regulators in Arabidopsis. Plant Physiol 165:905-916.
• [0151] Debeaujon I, Peeters A J, Léon-Kloosterziel K M, Koornneef M. (2001) The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13:853-871.
• [0152] Fauser F, Schiml S, Puchta H (2014) Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J79: 348-359.
• [0153] Guschin D Y, Waite A J, Katibah G E, Miller J C, Holmes M C, Rebar E J. (2010) A rapid and general assay for monitoring endogenous gene modification. In: Engineered zinc finger proteins:247-256. Humana Press, Totowa, N.J.
• [0154] Holsters, M., De Waele, D., Depicker, A., Messens, E., Van Montagu, M., & Schell, J. (1978). Transfection and transformation of Agrobacterium tumefaciens. Molecular and General Genetics (MGG), 163(2), 181-187.
• [0155] Li X, Chen L, Hong M, Zhang Y, Zu F, Wen J, Yi B, Ma C, Shen J, Tu J, Fu T. (2012) A large insertion in bHLH transcription factor BrTT8 resulting in yellow seed coat in Brassica rapa. PLoS One 7:e44145.
• [0156] Lian J, Lu X, Yin N, Ma L, Lu J, Liu X, Li J, Lu J, Lei B, Wang R, Chai Y. (2017) Silencing of BnTT1 family genes affects seed flavonoid biosynthesis and alters seed fatty acid composition in Brassica napus. Plant Sci. 254:32-47.
• [0157] Liang M, Davis E, Gardner D, Cai X, Wu Y. (2006) Involvement of AtLAC15 in lignin synthesis in seeds and in root elongation of Arabidopsis. Planta 224:1185-1196.
• [0158] Michelmore R W, Paran I, Kesseli R V. (1991) Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proceedings of the National Academy of Sciences 88: 9828-9832.
• [0159] Magwene P M, Willis J H, Kelly J K. (2011) The statistics of bulk segregant analysis using next generation sequencing. PLoS computational biology 7:11.
• [0160] Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L. (2000) The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12:1863-1878.
• [0161] Nesi N, Debeaujon I, Jond C, Stewart A J, Jenkins GI, Caboche M, Lepiniec L. (2002) The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADS domain protein and is required for proper development and pigmentation of the seed coat. Plant Cell 14:2463-2479.
• [0162] Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L. (2001) The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13:2099-2114.
• [0163] Pourcel L, Routaboul J M, Kerhoas L, Caboche M, Lepiniec L, Debeaujon I. (2005) TRANSPARENT TESTA10 encodes a laccase-like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat. Plant Cell 17:2966-2980.
• [0164] Sagasser M, Lu G H, Hahlbrock K, Weisshaar B. (2002) A. thaliana TRANSPARENT TESTA 1 is involved in seed coat development and defines the WIP subfamily of plant zinc finger proteins. Genes Dev 16:138-149.
• [0165] Steinert J, Schiml S, Fauser F, Puchta H (2015) Highly efficient heritable plant genome engineering using Cas9 orthologues from Streptococcus thermophilus and Staphylococcus aureus. Plant J 84:1295-305.
• [0166] Zhang J, Lu Y, Yuan Y, Zhang X, Geng J, Chen Y, Cloutier S, McVetty P B, Li G. (2008) Map-based cloning and characterization of a gene controlling hairiness and seed coat color traits in Brassica rapa. Plant Mol Biol. 69:553-563.

[0167] It is to be understood that while certain embodiments have been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure. Other aspects, advantages, and modifications are within the scope of the following embodiments and claims.

[0168] A composition comprising non-defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight.

[0169] The composition of embodiment 1, wherein said composition has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight.

[0170] The composition of embodiment 1, wherein said composition has an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0171] The composition of embodiment 1, wherein said composition has a neutral detergent fiber (NDF) content of 10%, 12%, 14%, or 16% to 20%, 22%, 24%, or 25% by dry weight.

[0172] The composition of embodiment 1, wherein said composition has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight and an oil content of 30% to 50% by dry weight.

[0173] A composition comprising defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 7%, 8%, 10%, or 12% to 20%, 22%, 24%, or 25% by dry weight.

[0174] The composition of embodiment 6, wherein said composition has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight.

[0175] The composition of embodiment 6, wherein said composition has an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0176] The composition of embodiment 6, wherein said composition has a neutral detergent fiber (NDF) content of 10%, 12%, or 15% to 20%, 25%, 28%, or 30% by dry weight.

[0177] The composition of embodiment 6, wherein said composition has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight and an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0178] The composition of embodiment 6, wherein said composition has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight and a neutral detergent fiber (NDF) content of 10%, 12%, or 15% to 20%, 25%, 28%, or 30% by dry weight.

[0179] The composition of any one of embodiments 1-11, wherein said composition further comprises a preservative, a dust preventing agent, a bulking agent, a flowing agent, or any combination thereof.

[0180] The composition of any one of embodiments 1-12, wherein said pennycress seed meal is obtained from pennycress seeds that have been crushed, ground, macerated, expelled, extruded, expanded, or any combination thereof.

[0181] The composition of any one of embodiments 1-13, wherein said pennycress seed meal is obtained from a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0182] The composition of any one of embodiments 1-14, wherein said pennycress seed meal is obtained from a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof.

[0183] The composition of any one of embodiments 1-15, wherein said composition comprises a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0184] The composition of any one of embodiments 1-16, wherein said pennycress seed meal comprises: (i) pennycress variety Y1067, Y1126, BC38, BJ8, P32, J22, Q36, BD24, AX17, E5-444, E5-540, E5-541, E5-542, E5-543, E5-544, E5-545, E5-547, E5-549, E5-582, E5-586, D3-N10 P5, D5-191, A7-95, A7-187 or A7-261 seed meal; (ii) seed meal of hybrids of the varieties; (iii) seed meal from progeny of the varieties; (iv) seed meal from seed comprising germplasm from the varieties that provides seed comprising an acid detergent fiber (ADF) content of 5% to 20% by dry weight; or (v) seed meal of any combination of said varieties, hybrid varieties, progeny of said varieties, or seed comprising the germplasm.

[0185] The composition of any one of embodiments 1-17, wherein said pennycress seed meal comprises seed meal obtained from the seed lot of anyone of embodiments 43 to 62, or any combination thereof.

[0186] The composition of any one of embodiments 1 to 18, wherein the composition exhibits a lighter-color in comparison to a control composition comprising wild-type pennycress seed meal.

[0187] Pennycress seed meal comprising an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight, wherein the seed meal is non-defatted.

[0188] The seed meal of embodiment 20, wherein said seed meal has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight.

[0189] The seed meal of embodiment 21, wherein said seed meal has an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0190] The seed meal of embodiment 21, wherein said seed meal has a neutral detergent fiber (NDF) content of 10%, 12%, 14%, or 16% to 20%, 22%, 24%, or 25% by dry weight.

[0191] The seed meal of embodiment 21, wherein said seed meal has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight and an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0192] Pennycress seed meal comprising an acid detergent fiber (ADF) content of 7%, 8%, 10%, or 12% to 20%, 22%, 24%, or 25% by dry weight, wherein the seed meal is defatted.

[0193] The seed meal of embodiment 25, wherein said seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight.

[0194] The seed meal of embodiment 25, wherein said seed meal has an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0195] The seed meal of embodiment 25, wherein said seed meal has a neutral detergent fiber (NDF) content of 10%, 12%, or 15% to 20%, 25%, 28%, or 30% by dry weight.

[0196] The seed meal of embodiment 25, wherein said seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight and an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0197] The pennycress seed meal of any one of embodiments 20-28, wherein the meal comprises ground and/or macerated seed of the seed lot of any one of embodiments 43 to 62.

[0198] The pennycress seed meal of any one of embodiments 20-29, wherein said meal comprises a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO:1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0199] The pennycress seed meal of any one of embodiments 20-30, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0200] The pennycress seed meal of any one of embodiments 20-31, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172 and allelic variants thereof.

[0201] The pennycress seed meal of any one of embodiments 20-32, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one transgene that suppresses expression of at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof.

[0202] The pennycress seed meal of any one of embodiments 20-33, wherein the meal exhibits a lighter-color in comparison to a control pennycress seed meal prepared from wild-type pennycress seed.

[0203] Pennycress seed cake comprising an acid detergent fiber (ADF) content of 7%, 8%, 10%, or 12% to 20%, 22%, 24%, or 25% by dry weight.

[0204] The seed cake of embodiment 35, wherein said seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight.

[0205] The seed cake of embodiment 35, wherein said seed meal has an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0206] The seed cake of embodiment 35, wherein said seed meal has a neutral detergent fiber (NDF) content of 10%, 12%, or 15% to 20%, 25%, 28%, or 30% by dry weight.

[0207] The seed cake of embodiment 35, wherein said seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight and an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0208] The pennycress seed cake of any one of embodiments 35 to 39, wherein the cake comprises crushed or expelled seed of the seed lot of any one of embodiments 43 to 62.

[0209] The pennycress seed cake of any one of embodiments 35 to 40, wherein the cake comprises a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0210] The pennycress seed meal or pennycress seed meal cake of any one of embodiments 36 to 41, wherein the cake exhibits a lighter-color in comparison to a control pennycress seed meal cake prepared from wild-type pennycress seed.

[0211] A seed lot comprising a population of pennycress seeds that comprise an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight.

[0212] The seed lot of embodiment 43, wherein said seed has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight.

[0213] The seed lot of embodiment 43, wherein said seed has an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0214] The seed lot embodiment 43, wherein said seed has a neutral detergent fiber (NDF) content of 10%, 12%, 14%, or 16% to 20%, 22%, 24%, or 25% by dry weight.

[0215] The seed lot of embodiment 43, wherein said seed has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight and an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0216] The seed lot of any one of embodiments 43 to 47, wherein the population comprises at least 10, 20, 50, 100, 500, or 1,000 seeds comprising said ADF content.

[0217] The seed lot of any one of embodiments 43 to 48, wherein at least 95% of the pennycress seeds in the seed lot are seeds comprising said ADF content and said protein content.

[0218] The seed lot of any one of embodiments 43 to 49, wherein less than 5% of the seeds in said seed lot have an ADF content of greater than 20% by dry weight.

[0219] The seed lot of any one of embodiments 43 to 50, wherein said seeds further comprise an agriculturally acceptable excipient or adjuvant.

[0220] The seed lot of any one of embodiments 43 to 51, wherein said seeds further comprise a fungicide, a safener, or any combination thereof.

[0221] The seed lot of any one of embodiments 43 to 52, wherein said population of pennycress seeds comprise seeds having at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof or comprise seeds having at least one transgene that suppresses expression of at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof.

[0222] The seed lot of any one of embodiments 43 to 53, wherein said population of pennycress seeds comprise seeds having at least one loss-of-function mutation in an endogenous wild-type pennycress gene that encodes SEQ ID NO:2, 70, 76, or an allelic variant thereof.

[0223] The seed lot of embodiment 54, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2, 70, 76, or the allelic variant thereof comprises an insertion, deletion, or substitution of one or more nucleotides.

[0224] The seed lot of embodiment 54, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises a mutation that introduces a pre-mature stop codon or frameshift mutation at codon positions 1-108 of SEQ ID NO:1 or an allelic variant thereof, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:70 or the allelic variant thereof comprises a mutation set forth in SEQ ID NO:127, 129, 131, 133, 135, or 137, or wherein the loss-of-function mutation in the gene encoding SEQ ID NO:76 or the allelic variant thereof comprises a mutation set forth in SEQ ID NO:165, 167, or 170.

[0225] The seed lot of any one of embodiments 54-56, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises a substitution of a guanine residue at nucleotide 491 of SEQ ID NO:1 with an adenine residue or a substitution of a guanine residue a nucleotide equivalent to nucleotide 491 of SEQ ID NO:1 in the allelic variant thereof with an adenine residue.

[0226] The seed lot of any one of embodiments 43 to 57, wherein said population of pennycress seeds comprise seeds having at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO:1, 3, 6, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, 42, 44, 45, 47, 48, 50, 51, 53, 54, 56, 57, 59, 60, 62, 63, 65, 66, 68, 69, 71, 72, 74, 75, 77, 78, 80, 171, 173, and allelic variants thereof.

[0227] The seed lot of any one of embodiments 43 to 58, wherein said population of pennycress seeds comprising seeds having at least one transgene that suppresses expression of at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof.

[0228] The seed lot of any one of embodiments 43 to 59, wherein said population of pennycress seeds comprise: (i) pennycress variety Y1067, Y1126, BC38, BJ8, P32, J22, Q36, BD24, AX17, AX17, E5-444, E5-540, E5-541, E5-542, E5-543, E5-544, E5-545, E5-547, E5-549, E5-582, E5-586, D3-N10 P5, D5-191, A7-95, A7-187 or A7-261 seed; (ii) hybrid seed of said varieties; (iii) seed from progeny of said varieties; (iv) seed comprising germplasm from said varieties that provides seed having an acid detergent fiber (ADF) content of 10% to 20% by dry weight; or (v) any combination of said seed, hybrid seed, seed from progeny of said varieties, or seed comprising said germplasm.

[0229] The seed lot of any one of embodiments 43 to 60, wherein the seeds in the population exhibit a lighter-colored seed coat in comparison to a wild-type pennycress seed.

[0230] A method of making non-defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight, comprising the step of grinding, macerating, extruding, and/or crushing the seed lot of any one of embodiments 43 to 62, thereby obtaining the non-defatted seed meal.

[0231] The method of embodiment 62, wherein the seed meal has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight, or the combination thereof.

[0232] The method of embodiment 62, wherein said seed meal has an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0233] The method of embodiment 62, wherein said seed meal has a neutral detergent fiber (NDF) content of 10%, 12%, 14%, or 16% to 20%, 22%, 24%, or 25% by dry weight.

[0234] The method of embodiment 62, wherein said seed meal has a protein content of 28%, 30%, 32%, or 34% to 38% or 40% by dry weight and an oil content of 30%, 32%, or 34% to 40%, 42%, 46%, 48%, or 50% by dry weight.

[0235] A method of making defatted pennycress seed meal comprising an acid detergent fiber (ADF) content of 7%, 8%, 10%, or 12% to 20%, 22%, 24%, or 25% by dry weight, comprising the step of solvent extracting the seed lot of any one of embodiments 43 to 62, separating the extracted seed meal from the solvent, thereby obtaining the defatted seed meal.

[0236] The method of embodiment 67, wherein the seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight.

[0237] The method of embodiment 67, wherein said seed meal has an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0238] The method of embodiment 67, wherein said seed meal has a neutral detergent fiber (NDF) content of 10% to 30% by dry weight.

[0239] The method of embodiment 67 wherein said seed meal has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight and an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0240] The method of any one of embodiments 67 to 71, wherein the solvent is hexane or mixed hexanes.

[0241] A method of making pennycress seed cake comprising an acid detergent fiber (ADF) content of 7%, 8%, 10%, or 12% to 20%, 22%, 24%, or 25% by dry weight, comprising the step of crushing or expelling the seed of the seed lot any one of embodiments 43 to 62, thereby obtaining a seed cake.

[0242] The method of embodiment 73, wherein the seed cake has a protein content of 30%, 35%, 40%, or 45% to 55%, 60%, 65%, or 70% by dry weight.

[0243] The method of embodiment 74, wherein the seed cake has an oil content of 0%, 2%, or 4% to 8%, 10%, or 12% by dry weight.

[0244] A method of making a pennycress seed lot comprising the steps of:

• • [0245] (a) introducing at least one loss-of-function mutation in at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof;
  • [0246] (b) selecting germplasm that is homozygous for said loss-of-function mutation; and,
  • [0247] (c) harvesting seed from the homozygous germplasm, thereby obtaining a seed lot, wherein said seed lot comprises an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight.

[0248] The method of embodiment 76, wherein said seed lot comprise the seed lot of any one of embodiments 43 to 61.

[0249] A method of making a pennycress seed lot comprising the steps of:

• • [0250] (a) introducing at least one transgene that suppresses expression of at least one endogenous wild-type pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 172, and allelic variants thereof into a pennycress plant genome;
  • [0251] (b) selecting a transgenic plant line that comprises said transgene; and,
  • [0252] (c) harvesting seed from the transgenic plant line, thereby obtaining a seed lot, wherein said seed lot comprises an acid detergent fiber (ADF) content of 5%, 8%, or 10% to 15%, 18%, or 20% by dry weight.

[0253] The method of embodiment 78, wherein said harvested seed comprise a seed lot of any one of embodiments 43 to 61.